EP4114987A1 - Gram-positive bakterien der spezies lactococcus lactis oder streptococcus thermophilus mit sehr geringer oberflächenproteolyse, verfahren zu ihrer herstellung und ihre verwendung - Google Patents

Gram-positive bakterien der spezies lactococcus lactis oder streptococcus thermophilus mit sehr geringer oberflächenproteolyse, verfahren zu ihrer herstellung und ihre verwendung

Info

Publication number
EP4114987A1
EP4114987A1 EP21708692.5A EP21708692A EP4114987A1 EP 4114987 A1 EP4114987 A1 EP 4114987A1 EP 21708692 A EP21708692 A EP 21708692A EP 4114987 A1 EP4114987 A1 EP 4114987A1
Authority
EP
European Patent Office
Prior art keywords
protease
strain
sequence seq
bacterium
identity
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP21708692.5A
Other languages
English (en)
French (fr)
Inventor
Vincent JUILLARD
Rozenn Gardan
Mylène BOULAY
Véronique MONNET
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institut National de Recherche pour lAgriculture lAlimentation et lEnvironnement
Institut des Sciences et Industries du Vivant et de lEnvironnement AgroParisTech
Original Assignee
Institut National de Recherche pour lAgriculture lAlimentation et lEnvironnement
Institut des Sciences et Industries du Vivant et de lEnvironnement AgroParisTech
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institut National de Recherche pour lAgriculture lAlimentation et lEnvironnement, Institut des Sciences et Industries du Vivant et de lEnvironnement AgroParisTech filed Critical Institut National de Recherche pour lAgriculture lAlimentation et lEnvironnement
Publication of EP4114987A1 publication Critical patent/EP4114987A1/de
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • C12P21/02—Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/54—Interleukins [IL]
    • C07K14/5428—IL-10
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/135—Bacteria or derivatives thereof, e.g. probiotics
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/81—Protease inhibitors
    • C07K14/8107—Endopeptidase (E.C. 3.4.21-99) inhibitors
    • C07K14/811—Serine protease (E.C. 3.4.21) inhibitors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C12N1/205—Bacterial isolates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/746—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for lactic acid bacteria (Streptococcus; Lactococcus; Lactobacillus; Pediococcus; Enterococcus; Leuconostoc; Propionibacterium; Bifidobacterium; Sporolactobacillus)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/52—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/74—Bacteria
    • A61K35/741—Probiotics
    • A61K35/744—Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/46—Streptococcus ; Enterococcus; Lactococcus

Definitions

  • the present invention relates to Gram-positive bacteria of the species Lactococcus lactis or Streptococcus thermophilus exhibiting very low surface proteolysis; it also relates to the use of these bacteria, in particular for the production of proteins of interest.
  • lactis (Poquet et al., 2000); a homologue in S. thermophilus is also present. This protease hydrolyses abnormal and / or misfolded proteins and is involved in the maturation of exported proteins (Poquet et al., 2000).
  • the inventors constructed single and double mutants for PrtS and HtrA in the LMD9 strain of S. thermophilus (see Example 1) and arrived at the conclusion that the deletion of the two proteases PrtS and HtrA does not abolish surface proteolysis in S. thermophilus LMD9 since a residual proteolysis is observed (see example 2).
  • the same results were obtained for the strains MG1363 and IL1403 of L. lactis (Guillot et al., 2016) and therefore confirm that the surface proteases HtrA and PrtS / PrtP are not alone responsible for the whole of the surface proteolytic activity of these strains. Hafeez et al.
  • proteases responsible for this residual activity are present in each of the three strains. This is how they identified the protease Ster-1612 (or STER_RS07910 in the new NCBI annotation) in the wild strain LMD9 of S. thermophilus; this protease is called YwdF (or EFV54_RS 11495 in the new NCBI annotation) for the strain IL1403 of L. lactis subsp. lactis and llmg-2442 (or LLMG_RS 12255 in the new NCBI annotation) for the strain MG1363 of L. lactis subsp. cremoris (see example 3).
  • This protease belongs to the S 16 family of LonA proteases (Gottesman et al., 1978 and Charrette et al., 1981) which are serine proteases, characterized by the presence of a catalytic Serine - Lysine dyad conserved in the C- region. terminal of the protein (Botos et al., 2004).
  • the inventors then constructed strains derived from S. thermophilus LMD9 in which all or part of the three endogenous proteases PrtS, HtrA and Ster-1612 have been inactivated (see example 1); the inactivation of the three proteases leads to almost abolished surface proteolysis in this bacterium (see example 4). In addition, they constructed the strain of S.
  • thermophilus LMD9 in which the three proteases PrtS, HtrA and Ster-1612 were inactivated and produced the heterologous proteins IL-10 or elafin (see example 6) and confirmed that the inhibition of these three proteases no longer entailed degradation of heterologous proteins, thus making it possible to improve the production yield of heterologous proteins, compared with the wild parent bacterium (see example 7). These results were also observed in Lactococcus lactis (see example 11).
  • a subject of the present invention is therefore a Gram-positive bacterium of the species Lactococcus lactis or Streptococcus thermophilus, such as the endogenous surface protease homologous to the protein designated Ster-1612 in Streptococcus thermophilus LMD9 and Ywdf or llmq 2442 respectively in Lactococcus lactis.
  • IL1403 and MG1363 has decreased or abolished expression and / or activity; more particularly, it relates to a Gram-positive bacterium of the species Lactococcus lactis or Streptococcus thermophilus, such as the endogenous surface protease comprising an amino acid motif having at least 80% identity with the sequence SEQ ID N ° l, has decreased or abolished expression and / or activity, where SEQ ID N ° 1 is defined as follows:
  • XI is histidine (H) or lysine (K);
  • X2 is serine (S), alanine (A) or threonine (T);
  • X3 is isoleucine (I), leucine (L) or valine (V);
  • X4 is aspartic acid (D) or glutamine (Q);
  • X5 is alanine (A) or valine (V);
  • X6 is aspartic acid (D) or tyrosine (Y); and X7 is lysine (K) or leucine (L).
  • the endogenous surface protease is a serine protease whose enzymatic activity can be characterized by the evaluation of the degradation of a chromogenic substrate by colorimetric assay, or of a protein substrate by SDS-PAGE electrophoresis or by analysis in HPLC liquid chromatography.
  • the amino acid motif included in said protease has at least 80% identity, and in increasing order preferably at least 82%, 86%, 91%, 95% or 100% identity with the sequence of amino acids SEQ ID No. 1 when the sequences are aligned over their entire length.
  • the Gram-positive bacterium is of the species Streptococcus thermophilus and the endogenous surface protease has at least 70% identity, and in increasing order preferably at least 75%, 80%, 85%. , 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, and particularly preferably at least 90% identity with the sequence SEQ ID No. 2 when the sequences are aligned along their entire length.
  • the endogenous surface protease is Ster-1612 of sequence SEQ ID No. 2.
  • the Gram-positive bacterium is of the species Lactococcus lactis and the endogenous surface protease has at least 70% identity, and in increasing order preferably at least 75%, 80%, 85 %, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, and particularly preferably at least 80% identity with the sequence SEQ ID No. 3 or with the sequence SEQ ID No. 4 when the sequences are aligned over their entire length.
  • the Gram-positive bacterium can be Lactococcus lactis subsp. lactis and the endogenous surface protease is YwdF of sequence SEQ ID No. 3 or the Gram-positive bacteria may also be Lactococcus lactis subsp. cremoris and the endogenous surface protease is 11 mg 2442 of sequence SEQ ID No. 4.
  • identity percentages are calculated from an overall alignment of amino acid sequences performed using the “needle” algorithm (Needleman and Wunsch, 1970) using the default parameters: “Matrix”: EBLOSUM62, “Gap penalty”: 10.0 and “Extend penalty”: 0.5.
  • the nucleotide sequence of the gene encoding Ster-1612 is represented by the sequence SEQ ID No. 5.
  • the nucleotide sequence of the gene encoding YwdF is represented by the sequence SEQ ID No. 6.
  • the nucleotide sequence of the gene encoding llmg_2442 is represented by the sequence SEQ ID No. 7.
  • the Gram-positive bacterium according to the invention can be obtained from a strain of S. thermophilus LMD9, of S. thermophilus CNRZ1066, of Lactococcus lactis subsp. lactis IL1403, from Lactococcus lactis subsp. cremoris MG1363.
  • the bacterium according to the invention exhibits a significantly reduced surface proteolysis compared to the parent bacterium from which it is derived (see the protocol for quantifying proteolysis in Example 2).
  • the expression of an endogenous surface protease in a bacterium is reduced is meant the reduction in the amount of the protease produced by the bacterium of the invention in comparison with the parent bacterium from which it is derived and in which the expression of said protease is not reduced, whatever the cause (reduction in the level of expression of the gene encoding the protease, reduction in the number of messenger RNAs, degradation of the protease).
  • the methods used to measure the decrease in the expression of a protease in a bacterium include, for example, quantitative RT PCR to assess the level of expression of the gene encoding the protease or the assay of the protein by Elisa to quantify the protein synthesized. .
  • the activity of an endogenous surface protease in a bacterium is reduced is meant the reduction in the activity of the protease produced by the bacterium according to the invention in comparison with a parent bacterium from which it is derived and in which the activity of said protease is not reduced.
  • the methods used to measure the decrease in the activity of a protease in a bacterium include, for example, the counting of the surface peptides identified by mass spectrometry following a double chromatographic separation (Guillot et al., 2016), the evaluation of the degradation of a chromogenic substrate making it possible to easily quantify the activity by colorimetric assay, or of a protein substrate by SDS-PAGE electrophoresis or HPLC liquid chromatography analysis, etc.
  • the expression and / or an activity of an endogenous surface protease in a bacterium is abolished is meant the absence of expression and / or activity of the protease or also in the absence of expression. and / or activity of at least one of the other known proteases (HtrA and / or PrtS in Streptococcus lhennophilus, Hiv A and / or PrtP in Lactococcus lactis, as described below); this is the case when the proteolysis of the bacterium in question represents, in order of preference, less than 60%, 50%, 40%, 30% still preferably less than 10% and most preferably less than 5% of the proteolysis of the parent bacterium from which it is derived, according to the protocol for quantifying the proteolysis of Example 2.
  • Such an abolition of the expression and / or of the activity of the endogenous surface protease can be obtained by total reduction of the expression and / or activity of the protease (as defined below) or even occur when the structural gene of the protease is not naturally present in the genome of the bacterium, or present in a truncated form ( pseudogene).
  • the bacterium according to the invention having a decreased activity and / or expression of its endogenous surface protease also exhibits a decreased activity and / or a decreased expression of at least one other endogenous surface protease.
  • which can be HtrA and / or PrtS in Streptococcus thermophilus, HtrA and / or PrtP in Lactococcus lactis.
  • the bacterium of the species S. thermophilus according to the invention is also such as the endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 8 (HtrA) or the surface protease endogenous having at least 70% identity with the sequence SEQ ID No. 9 (PrtS) has decreased or abolished expression and / or activity.
  • HtrA the endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 8
  • PrtS surface protease endogenous having at least 70% identity with the sequence SEQ ID No. 9
  • the bacterium of the species L. lactis according to the invention is also such as the endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 10 (HtrA) or the surface protease endogenous having at least 70% identity with the sequence SEQ ID No. 11 (PrtP) has decreased or abolished expression and / or activity.
  • HtrA the endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 10
  • PrtP surface protease endogenous having at least 70% identity with the sequence SEQ ID No. 11
  • the surface protease in Streptococcus thermophilus, has at least 70% identity, and in increasing order of preference at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94 %, 95%, 96%, 97%, 98%, 99% or 100% identity with the amino acid sequence SEQ ID No. 8, when the sequences are aligned over their entire length.
  • the surface protease, called HtrA in Lactococcus lactis has at least 70% identity, and in increasing order of preference at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94 %, 95%, 96%, 97%, 98%, 99% or 100% identity with the amino acid sequence SEQ ID No. 10, when the sequences are aligned over their entire length.
  • the nucleotide sequence of the gene encoding HtrA is represented by the sequence SEQ ID No. 12 in the case of a strain of S. thermophilus, and by the sequence SEQ ID No. 13 in the case of a strain of Lactococcus lactis.
  • the surface protease called PrtS in Streptococcus thermophilus, has at least 70% identity, and in increasing order of preference at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94 %, 95%, 96%, 97%, 98%, 99% or 100% identity with the amino acid sequence SEQ ID No. 9, when the sequences are aligned over their entire length.
  • the surface protease, called PrtP in Lactococcus lactis has at least 70% identity, and in increasing order of preference at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94 %, 95%, 96%, 97%, 98%, 99% or 100% identity with the amino acid sequence SEQ ID No.
  • the nucleotide sequence of the gene encoding PrtS is represented by the sequence SEQ ID No. 14 in the case of a strain of S. thermophilus, by the sequence SEQ ID No. 15 in the case of a strain of Lactococcus lactis.
  • the bacterium of the species S. thermophilus according to the invention is such that the endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 8 (HtrA ) and the endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 9 (PrtS) have expression and / or activity reduced or abolished.
  • the bacterium of the species L. lactis according to the invention is such that the endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 10 (HtrA ) and the endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 11 (PrtP) have expression and / or activity reduced or abolished.
  • the decrease in the expression of each of the three endogenous surface proteases in a bacterium according to the invention is measured for example by quantitative RT PCR to evaluate the level of expression of each of the genes encoding the proteases, or by ELISA assay to quantify each of the proteins synthesized, and is compared to the expression of surface proteases of a parent bacterium from which it is derived.
  • the decrease in the overall activity of the three endogenous surface proteases in a bacterium according to the invention can be measured by counting the surface peptides identified by mass spectrometry following a double separation in liquid chromatography (HPLC) and is compared to all the activity of surface proteases of a parent bacterium from which it is derived.
  • HPLC liquid chromatography
  • the decrease in the expression and / or the activity of proteases can be total or partial.
  • the decrease in expression and / or activity is considered to be total within the meaning of the invention when it represents less than 5% of the proteolysis of the parent bacterium from which it is derived, according to the protocol for quantification of proteolysis of Example 2 and as observed with bacteria expressing none of the three endogenous surface proteases (see Example 4). It is considered partial when it is significantly less than that of the parent bacteria from which it is derived.
  • the significance of the difference is estimated by a statistical test suitable for small sample sizes (Kruskal-Wallis nonparametric test) with a probability P less than 0.05.
  • the significant decrease in this surface proteolysis observed for a bacterium according to the invention leads to a proteolysis, in order of preference, of less than 60%, 50%, 40%, 30% more preferably less than 10%, relative to the surface proteolysis of the parent bacterium from which it is derived.
  • a partial decrease in the expression and / or activity of the proteases is observed with bacteria not expressing one or two of the above three endogenous surface proteases (see Examples 2 and 4).
  • This decrease in the expression and / or activity of endogenous surface proteases can be obtained by mutagenesis of the genes encoding these proteases.
  • This mutagenesis can then take place at the level of the coding sequence or sequences for regulating the expression of these genes, in particular at the level of the promoter, leading to inhibition of transcription or translation of proteases.
  • the introduction of one or more point mutations inside the coding sequence of a gene or of its expression regulation sequences can induce, depending on the nature of the mutation, a displacement of the frame.
  • lactis the introduction of one or more point mutations within the coding sequence of a gene of G operon other than that encoding the protease can induce, depending on the nature of the mutation, a displacement of the reading frame and / or the introduction of a stop codon in the sequence and thus abolish the expression of the protease (polar mutation). The same is true for the sequence regulating the expression of the entire G operon.
  • the bacterium according to the invention can be obtained by deletion, insertion and / or substitution of one or more nucleotides, for example by deletion of all or part of the coding sequence of the gene encoding the protease or of its promoter, by the insertion of an exogenous sequence within the coding sequence of the gene encoding the protease or of its promoter, by the substitution of one or more nucleotides of the coding sequence of the gene encoding one of the amino acids of the active site of the protease or its promoter, or by introducing a polar mutation in the case of a gene organized as an operon.
  • Methods making it possible to delete, insert and / or substitute a given genetic sequence in the bacterium, in particular in S.
  • thermophilus and Lactococcus lactis are well known to those skilled in the art (Gardan et al., 2009 and Biswas et al. , 1993).
  • the insertion of an exogenous sequence within the coding sequence of the gene encoding the protease can be carried out using transposons of natural or artificial origin.
  • Mutagenesis can be carried out by inducing random mutations, for example using physical agents, such as radiation or chemicals such as EMS (Ethyl Methane Sulfonate) or in a targeted manner by transfection, transduction, natural transformation or by electroporation (Bron et al., 2019).
  • mutagenesis can be carried out by methods using nucleases (TALEN, CRISPR / Cas9, Wei et al., 2013).
  • the decrease in protease activity can be obtained by the use of specific inhibitors of serine proteases (PMSF [PhenylMethaneSulfonyl Fluoride], DFP [DiisopropylFluoroPhosphate], triterpenoid, coumarin, serpines, peptidomimetics ..., Shamsi et al. , 2016; Soualmia and El Amri, 2018).
  • PMSF PhhenylMethaneSulfonyl Fluoride
  • DFP DiisopropylFluoroPhosphate
  • triterpenoid triterpenoid
  • coumarin coumarin
  • serpines peptidomimetics ..., Shamsi et al. , 2016; Soualmia and El Amri, 2018
  • the decrease in the expression of proteases can be obtained by modifying the promoter sequence of the gene according to, for example, one of the methods used to substitute a nucleo
  • the mutated genes encoding the proteases as defined above can be identified for example by PCR using primers specific for said genes, PCR optionally followed by sequencing of the PCR fragment in the case of mutations not affecting the size of said. gene (substitutions, for example).
  • the two proteases HtrA and STER_1612 are present in all strains, and their protein sequences are very well conserved (except for one strain, N4L, whose gene encoding HtrA is a pseudogene).
  • the inventors evaluated the role of the two surface proteases HtrA and STER_1612 on the surface proteolysis of the strains of S. thermophilus of group B and showed that the residual surface proteolysis of the double mutant is comparable to that obtained with the triple mutant of the LMD9 strain (see example 5).
  • the activation of the genes encoding these two or three surface proteases respectively is sufficient to reduce the surface proteolysis of the bacteria by more than 90%.
  • An advantageous bacterium within the meaning of the present invention is a bacterium, preferably Streptococcus thermophilus, in which the expression or activity of 3 endogenous surface proteases, Ster-1612 of sequence SEQ ID No. 2, HtrA of sequence SEQ ID No. 8, and PrtS of sequence SEQ ID No. 9, of said bacterium is inhibited.
  • Another advantageous bacterium within the meaning of the present invention is a bacterium, preferably Streptococcus thermophilus, in particular a strain of Streptococcus thermophilus which does not possess PrtS, in which the expression or activity of the endogenous surface protease, Ster- 1612 of sequence SEQ ID No. 2 or in which the expression or activity of the 2 endogenous surface proteases, Ster-1612 of sequence SEQ ID No. 2 and HtrA of sequence SEQ ID No. 8 of said bacterium is inhibited.
  • Streptococcus thermophilus in particular a strain of Streptococcus thermophilus which does not possess PrtS, in which the expression or activity of the endogenous surface protease, Ster- 1612 of sequence SEQ ID No. 2 or in which the expression or activity of the 2 endogenous surface proteases, Ster-1612 of sequence SEQ ID No. 2 and HtrA of sequence SEQ ID No. 8 of said bacterium is inhibited.
  • An advantageous bacterium within the meaning of the present invention is a bacterium, preferably Lactococcus lactis, in which the expression or activity of the 3 endogenous surface proteases, YwdF or llmg2442 (or their homologues) of respective sequence SEQ ID N ° 3 or 4, HtrA of sequence SEQ ID No. 10, and PrtP of sequence SEQ ID No. 11, of said bacterium is inhibited.
  • Another advantageous bacterium within the meaning of the present invention is a bacterium, preferably Lactococcus lactis, in particular a strain of Lactococcus lactis which does not possess PrtP, in which the expression or activity of the endogenous surface protease, YwdF or llmg2442 (or their homologues) of respective sequence SEQ ID N ° 3 or 4 or in which the expression or activity of the 2 endogenous surface proteases, and YwdF or llmg2442 of respective sequence SEQ ID No. 3 or 4 and HtrA of sequence SEQ ID No. 10 of said bacterium is inhibited.
  • a bacterium preferably Lactococcus lactis, in particular a strain of Lactococcus lactis which does not possess PrtP, in which the expression or activity of the endogenous surface protease, YwdF or llmg2442 (or their homologues) of respective sequence SEQ ID N ° 3 or 4 or
  • Ster-1612 or its homologue
  • HtrA in Streptococcus thermophilus
  • Ster-1612 or its homologue
  • PrtS in Streptococcus thermophilus
  • Ywdf or llmq 2442 or its homologue
  • HtrA in Lactococcus lactis
  • Ywdf or llmq 2442 or its homologue
  • PrtP in Lactococcus lactis
  • Ster-1612 or its homologue
  • HtrA and PrtS in Streptococcus thermophilus
  • Ywdf or llmq 2442 or its homologue
  • HtrA and PrtP in Lactococcus lactis.
  • a subject of the present invention is also a bacterium as defined above, modified to express a protein of interest, for example a heterologous or recombinant protein of interest, said bacterium being transformed with an expression vector containing a DNA fragment. encoding the protein of interest, or by integration of the DNA fragment of interest into the chromosome of said bacterium.
  • heterologous protein is meant a protein which is neither produced naturally by the bacterial strain, nor necessary for its growth.
  • the present invention therefore has the advantage of the expression by the bacterium according to the present invention of proteins of industrial interest, which will be secreted into the culture medium of said bacterium and in which the proteins of interest can be easily recovered, or associated. on the bacterial surface and exerting their enzymatic activity on the external face of the bacteria.
  • protein associated with the bacterial surface is meant a protein anchored covalently to the bacterial wall via an anchoring motif specific for sortase, a protein inserted into the plasma membrane via a membrane anchor located at the N- or C end -terminal of its amino sequence, a protein covalently linked to the membrane via a lipid anchoring motif located at the N-terminus of its amino sequence or a protein having association motifs non-covalent to the wall of LysM type, for example (Cossart and Joncquiieri, 2000; Desvaux et al., 2018).
  • the present invention also relates to a process for preparing a Gram-positive bacterium of the species Lactococcus lactis or Streptococcus thermophilus weakly proteolytic, comprising the reduction or the abolition in said bacterium, of the expression and / or of the 'activity of an endogenous surface protease of said bacterium, said protease comprising an amino acid motif exhibiting at least 80%, and in increasing order preferably at least 82%, 86%, 91%, 95% or 100% identity with the sequence SEQ ID No. 1, where SEQ ID No. 1 is defined as follows:
  • XI is histidine (H) or lysine (K);
  • X2 is serine (S), alanine (A) or threonine (T);
  • X3 is isoleucine (I), leucine (L) or valine (V);
  • X4 is aspartic acid (D) or glutamine (Q);
  • X5 is alanine (A) or valine (V);
  • X6 is aspartic acid (D) or tyrosine (Y); and X7 is lysine (K) or leucine (L).
  • the endogenous surface protease in Streptococcus thermophilus has at least 70% and more preferably 90% identity with the sequence SEQ ID No. 2 and the endogenous surface protease in Lactococcus lactis has at least 70% and more preferably 80 % identity with the sequence SEQ ID No. 3 or with the sequence SEQ ID No. 4.
  • the process for preparing a weakly proteolytic Streptococcus thermophilus bacterium according to the invention further comprises the reduction or abolition in said bacterium of the expression and / or activity of the endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 8 (HtrA) and / or endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 9 (PrtS).
  • the process for preparing a weakly proteolytic Lactococcus lactis bacterium according to the invention further comprises the reduction or abolition in said bacterium of the expression and / or activity of the endogenous surface protease. having at least 70% identity with the sequence SEQ ID No. 10 (HtrA) and / or endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 11 (PrtP).
  • weakly proteolytic bacterium is understood to mean bacterium exhibiting very low surface proteolysis compared with the parent bacterium from which it is derived, that is to say estimated at less than 10% and preferably less than 5% of the proteolysis of the parent bacteria from which it is derived.
  • a subject of the present invention is also a method for reducing or abolishing the proteolytic activity of proteases in a Gram-positive bacterium of the species Lactococcus lactis or Streptococcus thermophilus, comprising the reduction or abolition in said bacterium, of the expression and / or the activity of an endogenous surface protease of said bacterium, said protease comprising an amino acid motif exhibiting at least 80%, and in increasing order preferably at least 82%, 86%, 91%, 95% or 100% identity with the sequence SEQ ID No. 1, where SEQ ID No. 1 is defined as follows:
  • XI is histidine (H) or lysine (K);
  • X2 is serine (S), alanine (A) or threonine (T);
  • X3 is isoleucine (I), leucine (L) or valine (V);
  • X4 is aspartic acid (D) or glutamine (Q);
  • X5 is alanine (A) or valine (V);
  • X6 is aspartic acid (D) or tyrosine (Y); and X7 is lysine (K) or leucine (L).
  • the endogenous surface protease in Streptococcus thermophilus has at least 70% and more preferably 90% identity with the sequence SEQ ID No. 2 and the endogenous surface protease in Lactococcus lactis has at least 70% and more preferably 80 % identity with the sequence SEQ ID No. 3 or with the sequence SEQ ID No. 4.
  • the method for decreasing or abolishing the proteolytic activity of proteases in a Streptococcus thermophilus bacteria further comprises, decreasing or abolishing in said bacteria, the expression and / or activity of the surface protease. endogenous having at least 70% identity with the sequence SEQ ID No. 8 (HtrA) and / or endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 9 (PrtS).
  • the method for decreasing or abolishing the proteolytic activity of proteases in a Lactococcus lactis bacteria further comprises, decreasing or abolishing in said bacteria, the expression and / or activity of the surface protease. endogenous having at least 70% identity with the sequence SEQ ID No. 10 (HtrA) and / or endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 11 (PrtP).
  • a subject of the present invention is also the use of a bacterium according to the present invention for the production of heterologous protein of interest, said bacterium being transformed with an expression vector containing a DNA fragment encoding the heterologous protein d. 'interest or by integration of the DNA fragment of interest into the chromosome of said bacterium.
  • heterologous proteins of interest mention may be made of elafine, which is an inhibitor of proteolytic activity. This activity is particularly sought after, in particular for the treatment of chronic inflammatory bowel diseases, in which the activity of human proteases must be inhibited (Bermudez-Humaran et al., 2015).
  • anti-inflammatory proteins targeting the mucosal immune system cytokines, human trefoil factor TFF-1, etc.
  • vaccine proteins fragment C of tetanus toxin, E7 antigen of the human papillomavirus,
  • antibacterial peptides targeting imbalances in the intestinal flora defensins, cathelidicins, PAP protein associated with pancreatitis
  • enzymes that compensate for deficiencies or deficiencies superoxide dismutase, phenylalanine hydroxylase, glutamate decarboxylase
  • strains of bacteria used for the production of heterologous proteins of interest there may be mentioned the strains L. lactis and S. thermophilus.
  • Lactococcus lactis is considered to be the benchmark bacterium for the production of molecules of therapeutic interest. Its use has several advantages: it is a food bacterium whose harmlessness is recognized (bacterium labeled GRAS and QPS), it can be manipulated genetically and a deletion mutant of the gene encoding the protease. HtrA is available. It was then shown that the production of elafin by this mutant was greater than that of the wild strain, and that the treatment of mice with colitis by oral administration of the mutated strain was more effective than with the wild strain (Bermudez -Humaran et al., 2015).
  • Streptococcus thermophilus according to the invention also has many advantages: it is thermophilic, its temperature optimum corresponds to the human body temperature of 37 ° C, it is easily transformable and completely devoid of surface proteolytic activity, this which prevents the degradation of the heterologous protein of interest as it is produced.
  • a particularly advantageous bacterium for the production of heterologous proteins of interest is a bacterium of S. thermophilus as defined in the present invention.
  • a subject of the present invention is also a method for producing a heterologous protein, using a bacterium of the invention, as defined above.
  • a subject of the present invention is also the use of a bacterium according to the present invention as a pre-maturation ferment for milk.
  • a bacterium according to the present invention as a pre-maturation ferment for milk makes it possible to abolish these variations.
  • the sources of non-protein nitrogen which can be used would be consumed, without surface proteases being able to hydrolyze the milk proteins and generate new sources of non-protein. protein.
  • the growth of the leaven used to ferment the milk would only be based on its ability to hydrolyze caseins, carried by the proteases PrtP and PrtS, depending on the bacterium considered. Such an operation therefore has the effect of standardizing the growth of the leaven, by abolishing the variations in growth due to variations in the composition of the milk in non-protein nitrogen.
  • a bacterium which is particularly advantageous as a pre-maturation ferment for milk is a strain of S. thermophilus as defined in the present invention.
  • Figure 1 Effect of the inactivation of the two surface proteases PrtS and HtrA on the presence in the culture medium of peptides derived from the degradation of surface proteins of S. thermophilus LMD9, present in the culture medium. Average of 3 experiments (in black), with standard deviation of the mean (in gray).
  • Figure 2 Alignment of the sequences of the three proteins STER_1612, YwdF and llmg_2442.
  • the multiple alignment was performed with MUSCLE (v3.8) available on the EMBL-EBI server (http://www.ebi.ac.uk/Tools/msa/muscle/).
  • White characters on a black background indicate amino acids located inside the cell, italics correspond to the transmembrane fragment and black characters are located outside the cell (HMMTOP predictions). The amino acids potentially constituting the catalytic diad are highlighted in gray.
  • Figure 3 Growth of S. thermophilus LMD9 wild-type strain and strain mutated for the three surface proteases PrtS, HtrA and STER_1612 (triple mutant) in a chemically defined medium (CDM) containing only free amino acids as a source of amino nitrogen .
  • CDM chemically defined medium
  • Figure 4 Effect of the inactivation of the 3 surface proteases PrtS, HtrA and STER_1612 on the number of peptides resulting from the degradation of surface proteins of S. thermophilus LMD9. Average of 3 experiments (in black), with standard deviation of the mean (in gray).
  • FIG. 5 Coverage of the IL-10 and elafin proteins by the degradation fragments (peptides) identified in the corresponding culture media of S. thermophilus LMD9 (wild-type strain producing IL-10 or elafin, respectively).
  • S. thermophilus LMD9 wild-type strain producing IL-10 or elafin, respectively.
  • Cysteines (C) are shown in bold type.
  • Figure 6 Immunodetection of elafine in the culture supernatant of S. thermophilus CNRZ1066 (wild-type and double mutant strain AhtrAASTER_1612).
  • Figure 7 Effect of inactivation of surface proteolysis on elafin activity produced by S. thermophilus CNRZ1066 (wild strain in black and double mutant AhtrAASTER_1612 in gray /.
  • Figure 8 Immunodetection of elafine produced by S. thermophilus CNRZ1066 (wild-type and double-mutant AhtrAASTER_1612) and L. lactis IL1403 (wild-type and mutant AhtrA strain).
  • Figure 9 Comparison of the elafin activities produced by L. lactis IL1403Ah / rA (denoted IL1403D) and S. thermophilus CNRZl066AhtrAASTER_1612 (denoted CNRZ1066DD).
  • FIG. 10 Immunodetection of elafin produced by L. lactis IL 1403 (wild-type and double mutant strain AhtrAAywdF).
  • Figure 11 Immunodetection of elafin produced by L. lactis MG1363 (wild-type and double mutant strain AhtrAAllmg-2442).
  • EXAMPLE 1 CONSTRUCTIONS OF MUTANTS OF THE STREPTOCOCCUS THERMOPHILUS LMD9 BACTERIAL STRAIN AND OF THE STREPTOCOCCUS THERMOPHILUS CNRZ1066 BACTERIAL STRAIN
  • the single mutants AhtrA, AprtS and D STER_1612 are constructed from the wild strain S. thermophilus LMD9 by gene replacement.
  • the technique used consists in producing a PCR fragment combining three amplicons:
  • the three amplicons are produced separately and then combined via a final additional PCR. This association is made possible by the addition of extensions to the oligonucleotides used to amplify the upstream and downstream regions which allow binding to the cassette of antibiotic resistance (PCR overlap). This final PCR fragment is then introduced into the strain by natural competence (WO2010 / 125091). The homology between the upstream and downstream fragments of the gene and of the PCR fragment allows recombination at the site of the gene to be replaced. Colonies in which the targeted gene has been replaced by the resistance gene can easily be isolated on a medium containing the corresponding antibiotic.
  • a kanamycin resistance cassette is used.
  • the upstream and downstream regions of the htrA gene are amplified separately by PCR from the chromosomal DNA of S. thermophilus LMD9; the kanamycin resistance cassette is amplified from the plasmid pKa (Trieu-Cuot et al., 1983) using the pairs of oligonucleotides htrA-upstream- F / htrA-upstream-R, htrA-downstream-F / htrA-downstream-R and aphA3-F / aphA3-R, the nucleotide sequences of which are presented in Table 1.
  • a first pre-culture is carried out during the day in M17 medium with 1% lactose (M171ac) (Terzagui et al., 1975) from a frozen stock of the strain; from which a second pre-culture in chemically defined medium (MCD) (Letort et al., 2001) is carried out overnight.
  • MCD chemically defined medium
  • This second pre-culture is used to inoculate a culture in MCD at an optical density of 600 nm (OD6 00 ) of 0.05.
  • the PCR product combining the three fragments is added to an aliquot of the culture.
  • the culture aliquot is spread on plates of M171ac agar containing 1 mg / ml of kanamycin.
  • the dishes are incubated for 48 hours at 42 ° C. in an anaerobic jar.
  • Several resistant clones are verified by PCR on a colony and a clone is then verified by sequencing.
  • An erythromycin resistance cassette is used.
  • the upstream and downstream regions of the ptrS gene were amplified separately by PCR from the chromosomal DNA of S. thermophilus LMD9; the erythromycin resistance cassette is amplified from the plasmid pG + host9 (Biswas et al., 1993) using the pairs of oligonucleotides prtS-upstream- F / prtS-upstream-R, prtS-downstream- F / prtS-aval-R and erm-F / erm-R, the nucleotide sequences of which are presented in Table 2.
  • Mutant D STER_1612. A spectinomycin resistance cassette is used. The upstream and downstream regions of the STER_1612 gene are amplified separately by PCR from the chromosomal DNA of S. thermophilus LMD9; the spectinomycin resistance cassette is amplified from the plasmid pAT28 (Trieu-Cuot et al., 1990) using the pairs of oligonucleotides STER_1612-upstream-F / STER_1612-upstream-R, STER_1612-downstream-F / STER_1612-aval-R and spec-F / spec-R, the nucleotide sequences of which are presented in Table 3.
  • Fe double mutant AhtrAAprtS is constructed from the single mutant AprtS by natural transformation using chromosomal DNA from the mutant AhtrA. After breaking the cells with glass beads, the chromosomal DNA of the AhtrA mutant is extracted with phenol-chloroform and then precipitated with ethanol. Fe mutant AprtS is transformed with the chromosomal DNA purified from the mutant AhtrA, following the same transformation protocol natural as described above. The transformants are selected by plating on agar medium containing kanamycin (1 mg / ml). A few resistant clones are verified by colony PCR.
  • the double mutants AhtrA ASTER_1612, AprtS ASTER_1612 and the triple mutant AhtrAAprtSASTER_l 612 are obtained by natural transformation of the strains LMD9 AhtrA, EMD9 AprtS and LMD9 AhtrAAprtS with the PCR fragment containing the upstream and downstream regions of the STER_1612 gene fused to the resistance cassette to spectinomycin used to construct the single mutant ASTER_1612 according to the protocol described above.
  • the protocol for selecting and controlling mutants is that described for obtaining the single mutant ⁇ MD9ASTER_1612.
  • chromosomal DNA from strain CNRZ1066 is used as a template to amplify the upstream and downstream regions of the gene to be mutated.
  • strain competence is enhanced by adding ComS competence peptide (LPYFAGCL) at a concentration of ImM for 10 minutes before adding the PCR fragment to the culture.
  • LYFAGCL ComS competence peptide
  • the double mutant CNRZ1066 AhtrAASTER_l 612 is obtained by natural transformation of strain C NRZ 1066ASTER_ 1612 with chromosomal DNA of strain CNRZ1066 AhtrA. A few mutants were checked by PCR on a colony.
  • the LMD9 strain naturally produces the two surface proteases PrtS and HtrA.
  • two single mutants AprtS and AhtrA and a double-mutant AhtrAAprtS were constructed by natural transformation (WO2010 / 125091), following the protocol described in Example 1 . 1) Material and methods: Determination of the exopeptidome of the strains
  • the exopeptidome of the strains thus obtained is determined under the same experimental conditions as that of the wild strain LMD9, as described below.
  • the filtered culture supernatant is acidified with trifluoroacetic acid (TFA) to a final concentration of 0.1% (470 m ⁇ of a 10% TFA solution in 47 ml of culture supernatant), and stored overnight at 4 ° C.
  • TFA trifluoroacetic acid
  • the peptides present in the acidified supernatant are extracted by solid phase extraction (SPE) on a StrataX cartridge (Phenomenex) containing 200 mg of phase, at a flow rate of approximately 0.3 ml / min, according to the manufacturer's recommendations.
  • SPE solid phase extraction
  • the cartridge is first activated with 3 ml of methanol, then equilibrated with 6 ml of an aqueous solution containing 5% acetonitrile and 0.1% TFA. 1.75 ml of acetonitrile are added to 35 ml of acidified supernatant, so as to have a final acetonitrile concentration of 5% in the supernatant.
  • 35 ml of the supernatant thus prepared are loaded onto the activated and equilibrated cartridge, at a flow rate of 0.3 ml / min.
  • the cartridge is then washed with 5 ml of the aqueous solution containing 5% acetonitrile and 0.1% TFA, then the peptides are eluted with 1.5 ml of an aqueous solution containing 50% acetonitrile and 0, 1% TFA.
  • the eluate is dried for 16 to 18 h by evaporation under vacuum (speed vac system) then stored at -20 ° C.
  • the dried eluate containing the peptides is taken up in 350 m ⁇ of an aqueous solution containing 0.1% TFA (final concentration), which corresponds to a concentration factor of 100.
  • the solubilization of the peptides is obtained by vortexing. and passage for 5 minutes in an ultrasonic tank.
  • the concentrated solution of peptides is ultrafiltered through a membrane with a porosity of 3 kDa, by centrifugation for 1 hour at 13,000 rpm.
  • the peptides are then separated by HPLC on a reversed phase column (Kinetex 08 column (Phenomenex), porosity 100 A, particle size 2.6 ⁇ m, dimension 150 x 4.6 mm) with a linear gradient (slope 1.6%).
  • acetonitrile in ammonium formate (20 mM, pH 6.2) at a flow rate of 0.7 ml / min and at a temperature of 40 ° C.
  • the equivalent of 20 ml of culture ie 200 m ⁇ of concentrated suspension
  • the fractions eluted between 3.2% and 53.3% acetonitrile are collected and dried in a speed vac.
  • the identification of the peptides is made by mass spectrometry.
  • the dried fractions are taken up in 30m1 of an aqueous solution containing 0.1% TFA and 2% acetonitrile, and a 4m1 fraction is loaded onto a Pepmap 08 column (150 x 0.075 mm, particle size 2 mhi, porosity 100 TO).
  • the peptides are eluted with a gradient of acetonitrile in formic acid (0.1%), and analyzed online by mass spectrometry (LTQ-Orbitrap Discovery, Thermo Fisher).
  • the ionization of the peptides is done by electrospray (l, 3kV), and the analysis parameters of the ionized peptides are as follows: measurement of mass / charge ratios (m / z) from 300 to 1600 with a resolution of 15000 by l Orbitrap mass analyzer, and fragmentation of the 6 most abundant parent ions on the linear LTQ trap.
  • the doubly charged peptides are subjected to fragmentation, with an exclusion window of 40 seconds and the standard fragmentation parameters (collision energy: 35%).
  • the identification of the peptides and proteins from which they are derived is made with the X! Tandem search engine (version 2017.2.1.4) and the X! Tandem pipeline software suite (version 3.4.3, www.pappso.fr) using the protein sequence of the S. thermophilus LMD9 strain associated with a contaminant protein base suitable for the analysis activity of the analysis platform (tryptic peptides from a sample of eukaryotic proteins containing in particular human keratins, bovine proteins and murine).
  • X! Tandem pipeline's research parameters include the absence of tryptic cleavage for peptide identification, one minimum peptide per protein, identified with an E-value less than or equal to 0.01 and a mass tolerance of 10 ppm .
  • the surface proteases HtrA and PrtS alone are not responsible for all of the surface proteolytic activity of these strains.
  • 11 are predicted to be localized on the cell surface according to the LocateP database (http://www.cmbi.ru.nl/locatep-db/cgi-bin/locatepdb.py) or SecretomeP (http://www.cbs.dtu.dk/services/SecretomeP/). It includes PrtS (STER_0846) (STER_RS04165) and HtrA (STER_2002) (STER_RS09790). The hypothesis pursued is that at least one of the 9 remaining proteases is involved in the surface proteolysis of S. thermophilus.
  • STER_0260 Peptides derived from the degradation of three of these 6 proteases (STER_0260, STER_1612 and STER_1741) were identified in the exopeptidome of S. thermophilus LMD9, indicating that these putative proteases were synthesized under these growth conditions.
  • STER_0260 is annotated as a D-Ala-D-Ala carboxypeptidase and STER_1741, as a signal peptide peptidase.
  • the STER_1612 protease (STER_RS07910) (annotated respectively YwdF in IL 1403 and llmg_2442 in MG 1363) therefore appears as the candidate protein to participate in the surface proteolysis of L. lactis and S. thermophilus.
  • the presence of a transmembrane fragment in the N-terminal region (www.enzim.hu/hmmtop/) is predicted for the protein of the 3 strains (FIG. 2).
  • the growth of the strain mutated for the synthesis genes of the three surface proteases is not significantly affected in the culture medium used, a chemically defined medium containing only amino acids as the source of amino nitrogen (see figure 3). , so that any differences observed between the wild-type strain and the mutants cannot be attributed to a difference in growth between the strains.
  • the double mutant CNRZ 1 Q66AhlrAAprlS is constructed by natural transformation following the experimental protocol described in Example 1.
  • the exopeptidome of the wild strain CNRZ1066 and of the mutant thus obtained are determined in the same experimental conditions than those described for the LMD9 strain and its mutants (example
  • the exopeptidome of the wild strain CNRZ1066 contains 240 spectra (peptide counts) from surface proteins. That of the double mutant only contains 15 spectra from surface proteins. On the basis of the number of spectra identified, it is possible to estimate the residual surface proteolysis of the double mutant of CNRZ1066 at 6% of that of the wild-type strain, ie a reduction comparable to that obtained with the LMD9 strain.
  • the L. lactis LL-pLB350 and LBH832 strains respectively contain the plasmids pLB350 (Hossain et al., 2012) and pLB386, which carry the genes encoding IL-10 and elafin, respectively, placed under the control of a promoter. inducible to bile salts (pGroEL).
  • the plasmids are extracted from these strains and purified using a commercial kit (Midikit, Quiagen).
  • the two plasmids pLB350 and pLB386 are then introduced into the wild strain S. thermophilus LMD9 and its triple mutant by natural competence, following the experimental protocol described in Example 1.
  • the plasmid pLB386 is introduced into the wild strain CNRZ1066 and its surface protease mutant by natural competence.
  • the transformants are selected by plating on M17 agar medium containing 5 ⁇ g / ml of chloramphenicol.
  • the presence of the plasmid pLB350 is then verified by PCR on colonies using the two pairs of oligonucleotides pGroEL-L (ATAATGCCGACTGTACTTT of sequence SEQ ID No. 34) / IL-10-R (GGCCTTGTAGACACCTTGGTCTT of sequence SEQ ID No. 35) generating a band of 690 base pairs.
  • That of the plasmid pLB386 is with the two pairs of oligonucleotides pGroEL-L and Elafin-R (TCACTGGGGAACGAAACAGGC of sequence SEQ ID N ° 36) giving a band of 572 bp and that of the empty plasmid using the two oligonucleotides Cm-F (GTTCAACAAACGAAAATTGG of sequence SEQ ID N ° 37) and Cm-R (TT AT AAA AGCC AGT C ATT AG of sequence SEQ ID No. 38) giving a band of 807 bp.
  • EXAMPLE 7 A NON-PROTEOLYTIC BACTERIAL STRAIN IMPROVES THE PRODUCTION YIELD OF HETEROLOGICAL PROTEINS
  • IL-10 interleukin 10
  • elafine Two heterologous protein models were chosen, interleukin 10 (IL-10) and elafine. These two proteins are candidate proteins in the treatment of chronic inflammatory bowel disease (Benbouziane et al., 2013 and Bermudez-Humaran et al., 2015).
  • the plasmid carrying the gene encoding 1TL-10 is extracted from the strain of lactococcus which contained it and introduced into the strain S. thermophilus LMD9 and its triple mutant lacking surface proteolytic activity by natural transformation, according to the protocol described in the Example 6. The same operation was carried out for the plasmid encoding elafin. 4 strains are thus obtained, two wild ones producing one IL-10, the other elafin and two protease mutants producing the same two heterologous proteins.
  • the two pairs of wild-type and mutant strains carrying the plasmid pLB350 and the plasmid pLB386 respectively are cultured for 4 h in MCD at 42 ° C.
  • An equal weight mixture of cholic acid and deoxycholic acid is then added to the culture medium, at a final concentration of 150 pg / ml.
  • the purpose of this addition is to induce the expression of genes controlled by the pGroESL promoter.
  • the cells are removed by centrifugation and the peptides present in the culture supernatant are identified as indicated in Example 2.
  • the only difference consists in the modification of the interrogation bank, to which the sequence of IL-10 or elafin have been added, depending on the pair of strains considered.
  • Table 5 Number of peptides derived from the degradation of IL-10 or elafin, present in the culture medium of S. thermophilus LMD9 and its mutant of the three surface proteases PrtS, HtrA and STER_1612.
  • the plasmid encoding elafine is extracted from the lactococcal strain containing it, and introduced into the wild and mutant strains of CNRZ1066 by natural competence. To assess the stability of elafine, their degradation fragments are looked for in the culture medium after 4 h of growth, following the same approach as that developed for the LMD9 strain.
  • the culture and induction of the production of elafin by the strains carrying the plasmid pLB386 are carried out as described in Example 6. After 15 min of induction, the cells are removed by centrifugation, and the supernatant containing the. elafine is filtered through a filter with a porosity of 0.22 ⁇ m (PVDF membrane with low protein adsorption). Ten ml of supernatant are concentrated by a factor of 20 by ultrafiltration through a membrane with a cut-off threshold of 3 kDa (Amicon ultracell 3k, MerckMillipore). Five ⁇ l of retentate are deposited on polyacrylamide gel (pre-cast NuPAGE 4-12% Bis-Tris Gel gel, Invitrogen).
  • the proteins After migration for 1 h at 110 mA and 200 V, the proteins are transferred to a PVDF transfer membrane (Trans-Bot Turbo Mini transfer pack, Bio-Rad). Elafin, after being labeled with a mouse monoclonal anti-elafin antibody (SantaCruz Biotechnology), is detected by chemiluminescence (ECL Plus Western kit, Pierce).
  • the wild strain CNRZ166 producing elafin (well 5, denoted WT pis elafin). There are two bands, the upper one migrating to a size very slightly smaller than that of the mature form of commercial elafin. The second migrates to a significantly smaller size, and would be a truncated form of elafin in the process of degradation, The strain CNRZ1066 mutated for its surface proteases producing elafin (well 6, noted mutant pis elafin). The lower band corresponding to the truncated form of elafin is no longer detected, only the band corresponding to mature elafin is revealed.
  • the activity of elafine accumulated in the supernatants of the wild-type and mutant CNRZ1666 strains is evaluated by determining the power to inhibit the activity of a control human protease (elastase), according to the protocol described below.
  • the S. thermophilus strains carrying the plasmid pLB386 are cultured in MCD at 37 ° C. to an OD ⁇ OO of 1.0.
  • the strains of L. lactis carrying this same plasmid are cultured at 30 ° C. in a MCD specific for lactococci (Otto et al., 1983) up to an OD ⁇ OO of 1.0.
  • the cultures are centrifuged and the cells resuspended in fresh MCD at OD O OO 2.0.
  • Elafin production is obtained by induction with bile salts (15 ng / ml) and overnight incubation at 37 ° C. The cells are then centrifuged, and the elafin contained in the supernatant is concentrated by ultrafiltration by a factor of approximately 300.
  • Elafine is a protease inhibitor. It is therefore dosed according to the following principle.
  • the activity of a human protease (elastase) is measured by fluorescence using a labeled substrate (EnzCheck® Elastae assay kit, Molecular Probes), in the presence and absence of a supernatant containing elafine.
  • the intensity of inhibition is measured by the difference in fluorescence between the measurement without and with elafin over time, following the protocol supplied with the assay kit (Molecular Probes).
  • EXAMPLE 8 THE PRODUCTION OF ELAFIN BY NON-PROTEOLYTIC BACTERIAL STRAINS OF THE INVENTION
  • the two strains are cultivated to an identical population level, and the induction of elafin production is carried out under optimal conditions for each of the strains (see example 7 point 3)).
  • the strains L. lactis IL1403 and L. lactis MG1363 being devoid of plasmid, they do not produce the wall protease PrtP (the gene of which is carried by a plasmid, Gasson, 1983).
  • PrtP the gene of which is carried by a plasmid, Gasson, 1983.
  • the other two surface proteases produced are therefore HtrA (Poquet et al., 2000) and YwdF in IL 1403 (or its homolog IImg-2442 in MG 1363).
  • the double mutant IL1403AhtrAAywdF devoid of the three surface protease activities PrtP, HtrA and YwdF, was constructed from the strain IL1403A / z / (Guillot et al., 2016) by double homologous recombination using the heat-sensitive plasmid pGhost9 according to the established protocol (Biswas et al., 1993).
  • the first step consisted in inactivating the htrA gene by double homologous recombination, the second in inactivating the llgm-2442 gene in the single mutant obtained beforehand MG1363AhtrA, following a strategy identical to that described above for L. lactis IL1403.
  • EXAMPLE 10 OBTAINING LACTOCOCCUS LACTIS STRAINS PRODUCING ELAFIN
  • the plasmid pLB386 was purified from the strain L. lactis LBH832, as described in Example 6. It was introduced into the strain L. lactis IL 1403, into its double mutant L. lactis IL1403 AhtrAAywdf and into the double mutant L. lactis MG1363 AhtrAAllmg-2442 by electroporation.
  • the L. lactis LBH832 strain is none other than the wild-type L. lactis MG1363 strain carrying the plasmid pLB386.
  • the plasmid pLB44 was purified from the strain L. lactis LBH68, as described in Example 6. It was introduced into the strain L. lactis IL 1403, its double mutant L. lactis IL1403 AhtrAAywdf and into the double mutant L. lactis MG1363 AhtrAAllmg-2442 by electroporation.
  • the L. lactis LBH68 strain is none other than the wild-type L. lactis MG1363 strain carrying the plasmid pLB44.
  • EXAMPLE 11 INACTIVATION OF SURFACE PROTEASES INCREASES THE AMOUNT OF HETEROLOGICAL PROTEIN PRODUCED BY LACTOCOCCUS LACTIS
  • the wild strain of L. lactis IL1403 producing elafin (FIG. 10, well 3, denoted WT pis elafin).
  • WT pis elafin The wild strain of L. lactis IL1403 producing elafin.
  • the mutated strain of L. lactis IL1403 producing elafin (FIG. 10, well 5, denoted Mutant pis elafin).
  • the lower band corresponding to the truncated form of elafin is practically no longer detectable, the band corresponding to mature elafin is revealed in the majority, with a much greater intensity than in the wild strain, which reflects a very low proteolysis of elafin in the double mutant,
  • the mutated strain of L. lactis MG1363 producing elafin (FIG. 11, well 5, denoted Mutant pis elafin).
  • Three bands are observed, one of very low intensity (6 kDa) corresponding to the truncated form of elafin also perceptible in the mutant of L. lactis IL1403.
  • the upper band (in the form of a doublet) is the same as that found in the wild strain, but with a much greater intensity, reflecting a markedly higher concentration of undegraded elaffin in the supernatant of the mutated strain.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Food Science & Technology (AREA)
  • Nutrition Science (AREA)
  • Toxicology (AREA)
  • Mycology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Polymers & Plastics (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
EP21708692.5A 2020-03-06 2021-03-05 Gram-positive bakterien der spezies lactococcus lactis oder streptococcus thermophilus mit sehr geringer oberflächenproteolyse, verfahren zu ihrer herstellung und ihre verwendung Pending EP4114987A1 (de)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FR2002268A FR3107902A1 (fr) 2020-03-06 2020-03-06 Bacteries gram-positives de l’espece lactococcus lactis ou streptococcus thermophilus ayant une tres faible proteolyse de surface, leurs methodes d’obtention et leurs utilisations
PCT/EP2021/055561 WO2021176039A1 (fr) 2020-03-06 2021-03-05 Bacteries gram-positives de l'espece lactococcus lactis ou streptococcus thermophilus ayant une tres faible proteolyse de surface, leurs methodes d'obtention et leurs utilisations

Publications (1)

Publication Number Publication Date
EP4114987A1 true EP4114987A1 (de) 2023-01-11

Family

ID=71452387

Family Applications (1)

Application Number Title Priority Date Filing Date
EP21708692.5A Pending EP4114987A1 (de) 2020-03-06 2021-03-05 Gram-positive bakterien der spezies lactococcus lactis oder streptococcus thermophilus mit sehr geringer oberflächenproteolyse, verfahren zu ihrer herstellung und ihre verwendung

Country Status (5)

Country Link
US (1) US20230101904A1 (de)
EP (1) EP4114987A1 (de)
CA (1) CA3169644A1 (de)
FR (1) FR3107902A1 (de)
WO (1) WO2021176039A1 (de)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116218711B (zh) * 2022-12-21 2024-02-06 陕西省微生物研究所 一株乳酸乳球菌pz1及其在制备富硒低聚肽中的应用

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2248823A1 (de) 2009-04-28 2010-11-10 Institut National de la Recherche Agronomique Neues die Funktionsfähigkeit stimulierendes Peptid

Also Published As

Publication number Publication date
CA3169644A1 (fr) 2021-09-10
WO2021176039A1 (fr) 2021-09-10
US20230101904A1 (en) 2023-03-30
FR3107902A1 (fr) 2021-09-10

Similar Documents

Publication Publication Date Title
Frenken et al. Role of the lipB gene product in the folding of the secreted lipase of Pseudomonas glumae
Hou et al. Evidence that a major determinant for the identity of a transfer RNA is conserved in evolution
CN111278852B (zh) 重组欧氏杆菌天冬酰胺酶的生产方法
CN111278979B (zh) 重组大肠杆菌天冬酰胺酶的生产方法
CN111601894A (zh) M23a家族蛋白酶的制造方法
EP4114987A1 (de) Gram-positive bakterien der spezies lactococcus lactis oder streptococcus thermophilus mit sehr geringer oberflächenproteolyse, verfahren zu ihrer herstellung und ihre verwendung
EP1285069B1 (de) Bakteriocin gegen listeria
Röhl et al. In vitro reconstitution of insertion and processing of cytochrome f in a homologous chloroplast translation system
EP0752475A1 (de) Modifizierte alkalische Phosphatase aus Bakterien und ihre Verwendungen
FR3016888A1 (fr) Synthetases de la colistine et cluster de genes correspondants
JP4346368B2 (ja) 組換え枯草菌
Kenjale et al. Structural determinants of autoproteolysis of the Haemophilus influenzae Hap autotransporter
Dou et al. The roles of RgpB and Kgp in late onset gingipain activity in the vimA‐defective mutant of P orphyromonas gingivalis W83
JP7233203B2 (ja) Ｍ２３ａファミリープロテアーゼの製造方法
EP1222250B1 (de) Mutanten von milchsäurebakterien die mindestens eine peptidase überexprimeren
EP1141337B1 (de) Htra-proteaseaktivitätfreien gram-positiven bakterien und ihre verwendungen
WO2024180195A1 (fr) Bactéries génétiquement modifiées comprenant un systeme d'expression orthogonal invasif
Seung-Ha et al. Isolation of N-acetylmuramoyl-L-alanine amidase gene (amiB) from Vibrio anguillarum and the effect of amiB gene deletion on stress responses
Ritt et al. Peptidases specific for proline‐containing peptides and their unusual peptide‐dependent regulation in Oenococcus oeni
JP5520498B2 (ja) タンパク質又はポリペプチドの製造方法
Linde et al. Characterisation of preYvaY export reveals differences in the substrate specificities of Bacillus subtilis and Escherichia coli leader peptidases
KR20230109648A (ko) 디펩티딜펩티다제 및 류신 아미노펩티다제 폴리펩티드 변이체(dipeptidylpeptidase and leucine aminopeptidase polypeptide variants)
FR2694766A1 (fr) Clônage du gène de structure d'une aminopeptiddase de lactococcus lactis, production et utilisations de ladite aminopeptidase.
FR3082208A1 (fr) Methode de modification d'une sequence cible d'acide nucleique d'une cellule hote
Weiß Functional analysis of the ubiquitously conserved protein GCP1 from Escherichia coli

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20220907

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)