EP3898970A1 - Bacteries clostridium genetiquement modifiees, preparation et utilisations de celles-ci - Google Patents

Bacteries clostridium genetiquement modifiees, preparation et utilisations de celles-ci

Info

Publication number
EP3898970A1
EP3898970A1 EP19848893.4A EP19848893A EP3898970A1 EP 3898970 A1 EP3898970 A1 EP 3898970A1 EP 19848893 A EP19848893 A EP 19848893A EP 3898970 A1 EP3898970 A1 EP 3898970A1
Authority
EP
European Patent Office
Prior art keywords
bacterium
nucleic acid
sequence
bacteria
beijerinckii
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP19848893.4A
Other languages
German (de)
English (en)
Inventor
Rémi HOCQ
Gwladys Chartier
François WASELS
Nicolas Lopes Ferreira
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
IFP Energies Nouvelles IFPEN
Original Assignee
IFP Energies Nouvelles IFPEN
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by IFP Energies Nouvelles IFPEN filed Critical IFP Energies Nouvelles IFPEN
Publication of EP3898970A1 publication Critical patent/EP3898970A1/fr
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102Mutagenizing nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/33Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Clostridium (G)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1025Acyltransferases (2.3)
    • C12N9/1029Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C12N9/1033Chloramphenicol O-acetyltransferase (2.3.1.28)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/02Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/02Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/06Ethanol, i.e. non-beverage
    • C12P7/065Ethanol, i.e. non-beverage with microorganisms other than yeasts
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/02Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/16Butanols
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y203/00Acyltransferases (2.3)
    • C12Y203/01Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C12Y203/01028Chloramphenicol O-acetyltransferase (2.3.1.28)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/80Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12RINDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00Microorganisms ; Processes using microorganisms
    • C12R2001/01Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/145Clostridium
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02EREDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00Technologies for the production of fuel of non-fossil origin
    • Y02E50/10Biofuels, e.g. bio-diesel

Definitions

  • the present invention relates to the genetic modification of bacteria of the genus Clostridium, typically of solventogenic bacteria of the genus Clostridium, in particular of bacteria possessing in the wild state a gene coding for an amphenicol-O-acetyltransferase. It thus relates to methods, tools and kits allowing such a genetic modification, in particular the elimination or modification of a coding sequence, or controlling the transcription of a coding sequence, an amphenicol-O-acetyltransferase, genetically modified bacteria. obtained and their uses, in particular for producing a solvent, preferably on an industrial scale.
  • Clostridium contains Gram-positive, strict anaerobic and sporulating bacteria, belonging to the phylum Firmicutes. Clostridia are a group of importance to the scientific community for several reasons. The first is that a certain number of serious diseases (eg tetanus, botulism) are due to infections of pathogenic members of this family (Gonzales et al., 2014) The second is the possibility of using so-called acidogenic or solventogenic strains in biotechnology (John & Wood, 1986, and Moon et al., 2016).
  • Clostridia naturally have the capacity to transform a large variety of sugars to produce chemical species of interest, and more particularly acetone, butanol, and ethanol (John & Wood, 1986). during a fermentation process called ABE.
  • IBE fermentation is possible in certain particular species, during which acetone is reduced in variable proportion to isopropanol (Chen et al., 1986, George et al., 1983) thanks to the presence in the genome of these strains of genes encoding secondary alcohol dehydrogenases (s-ADH; Ismael et al., 1993, Hiu et al., 1987).
  • C. acetobutylicum and C. beijerinckii with respective references C. acetobutylicum ATCC 824 (also designated DSM 792 or LMG 5710) and C. beijerinckii NCIMB 8052 which are the model strains for the study of ABE type fermentation.
  • Clostridium strains naturally capable of carrying out IBE fermentation are few in number and predominantly belong to the Clostridium beijerinckii species (cf. Zhang et al., 2018, Table 1). These strains are typically selected from C. butylicum LMD 27.6, C. aurantibutylicum NCIB 10659, C. beijerinckii LMD 27.6, C. beijerinckii VPI2968, C. beijerinckii NRRL B-593, C. beijerinckii ATCC 6014, C. beijerinckii McClung 3081 , C. isopropylicum IAM 19239, C. beijerinckii DSM 6423, C. sp. A1424, C. beijerinckii optinoii, and C. beijerinckii BGS1.
  • Clostridium bacteria naturally capable of producing isopropanol, in particular naturally capable of carrying out an IBE fermentation, which has been genetically modified, in particular a strain genetically modified so as to make sensitive to an antibiotic belonging to the class of amphenicols such as chloramphenicol or thiamphenicol, preferably to allow the optimized production of isopropanol.
  • the inventors describe, in the context of the present invention and for the first time, a genetically modified C. beijerinckii bacterium, as well as the tools allowing a genetic modification of bacteria of the genus Clostridium, typically of solventogenic bacteria of the genus Clostridium naturally (ie to in the wild) capable of producing isopropanol, in particular naturally capable of carrying out an IBE fermentation, in particular of bacteria comprising in the wild a gene conferring on the bacteria resistance to one or more antibiotics, in particular a gene encoding an amphenicol-O-acetyltransferase, for example a chloramphenicol-O-acetyltransferase or a thiamphenicol-O-acetyltransferase.
  • a preferred genetically modified bacterium according to the invention is a bacterium which does not express an enzyme which gives it resistance to one or more antibiotics, in particular a bacterium which does not express an amphenicol-O-acetyltransferase, for example a bacterium lacking the gene. catB or unable to express said gene.
  • a preferred genetically modified bacterium according to the invention is the bacterium identified in the present description as C. beijerinckii DSM 6423 A catB as registered under the deposit number LMG P-31151 (also identified as Clostridium beijerinckii IFP962 delta catB) at the Belgian Co-ordinated Collections of Micro-organisms (“BCCM”, KL Ledeganckstraat 35, B-9000 Gent - Belgium) on December 6, 2018.
  • BCCM Belgian Co-ordinated Collections of Micro-organisms
  • KL Ledeganckstraat 35, B-9000 Gent - Belgium Belgian Co-ordinated Collections of Micro-organisms
  • a particular object described by the inventors is a nucleic acid recognizing (binding at least in part), and preferably targeting, ie recognizing and allowing the cutting, in the genome of a bacterium of interest, of at least one strand i ) a coding sequence, ii) a sequence controlling the transcription of a coding sequence, or iii) a sequence flanking the coding sequence, an enzyme allowing said bacteria of interest to grow in a culture medium containing an antibiotic, typically an antibiotic belonging to the class of amphenicols, preferably selected from chloramphenicol, thiamphenicol, azidamfenicol and florfenicol, typically an amphenicol-O-acetyltransferase such as a chloramphenicol-O-acetyltransferase or a thiamphenicol -O- acetyltransferase
  • the inventors also describe the use of such a nucleic acid to transform and / or genetically modify a bacterium of the genus Clostridium, preferably a bacterium of the genus Clostridium naturally capable of producing isopropanol, in particular a bacterium of the genus Clostridium capable to carry out an IBE fermentation.
  • the inventors describe in particular the use of a nucleic acid recognizing the catB gene of sequence SEQ ID NO: 18 or a sequence identical to at least 70% thereof within the genome of C. beijerinckii DSM 6423 for transforming and / or genetically modify a C. beijerinckii DSM 6423 bacteria.
  • the bacterium capable of producing isopropanol in the wild can be, for example, a bacterium selected from a C. beijerinckii bacterium, a C. diolis bacterium, a C. puniceum bacteria, a C. butyricum bacteria, a C. bacteria. saccharoperbutylacetonicum, C. botulinum bacteria, C. drakei bacteria, C. scatologenes bacteria, C. perfringens bacteria, and C. tunisiense bacteria, preferably a bacteria selected from C. beijerinckii bacteria, C. diolis bacteria , a bacterium C. puniceum and a bacteria C. saccharoperbutylacetonicum.
  • a bacterium naturally capable of producing isopropanol which is particularly preferred is a bacterium C. beijerinckii.
  • the nucleic acid recognizing, and preferably targeting, i) a sequence coding for an amphenicol-O-acetyltransferase, ii) a sequence controlling the transcription of such a sequence, or iii) a sequence flanking such a sequence is used to transform a subclade of C. beijerinckii selected from DSM 6423, LMG 7814, LMG 7815, NRRL B-593, NCCB 27006 and a subclade having at least 97% identity with the strain DSM 6423.
  • the inventors also describe a process for transforming, and preferably genetically modifying, a bacterium of the genus Clostridium.
  • This method comprises a step of transforming said bacterium by introduction into this bacterium of a nucleic acid recognizing, and preferably targeting, i) a coding sequence, ii) a sequence controlling the transcription of a coding sequence, or iii) a sequence flanking a sequence encoding an enzyme of interest, preferably an amphenicol-O-acetyltransferase.
  • This process is typically carried out using a modification tool genetics, for example using a genetic modification tool selected from a CRISPR tool, a tool based on the use of type II introns and an allelic exchange tool.
  • genetically transformed and modified bacteria using such a method, of which the bacteria C. beijerinckii DSM 6423 AcatB is an example.
  • Another aspect described by the inventors relates to the use of a bacterium genetically modified according to the invention, preferably of the bacterium C. beijerinckii DSM 6423 AcatB as registered under the deposit number LMG P-31151, or a genetically modified version thereof, to produce a solvent, preferably isopropanol, or a mixture of solvents, preferably on an industrial scale.
  • a bacterium genetically modified according to the invention preferably of the bacterium C. beijerinckii DSM 6423 AcatB as registered under the deposit number LMG P-31151, or a genetically modified version thereof, to produce a solvent, preferably isopropanol, or a mixture of solvents, preferably on an industrial scale.
  • kits in particular a kit comprising a nucleic acid described in the present text and a genetic modification tool, in particular a genetic modification tool selected from among the elements of a genetic tool selected from a CRISPR tool, a tool based on the use of type II introns and an allelic exchange tool; a nucleic acid as guide RNA (gRNA); nucleic acid as a repair matrix; at least one pair of primers; and an inducer for the expression of a protein encoded by said tool.
  • gRNA guide RNA
  • CRISPR Clustered Regularly Interspaced Short Palindromie Repeats
  • Cas Cas (CRISPR-associated protein) technology.
  • This method is based on the use of an enzyme called nuclease (typically a Cas type nuclease in the case of the CRISPR / Cas genetic tool, such as the Cas9 protein from Streptococcus pyogenes), which will, guided by a molecule of RNA, make a double strand cut within a DNA molecule (target sequence of interest).
  • the sequence of guide RNA (gRNA) will determine the nuclease cleavage site, giving it very high specificity ( Figure 17).
  • a double strand cut in an essential DNA molecule being lethal for an organism will depend on its capacity to repair it (cf. for example Cui & Bikard, 2016).
  • the repair of a double strand cut depends on a homologous recombination mechanism requiring an intact copy of the cleaved sequence.
  • the inventors have developed and described a more efficient genetic tool for modifying bacteria, suitable for bacteria, typically for bacteria belonging to the phylum Firmicutes, in particular for bacteria of the genus Clostridium, based on the use of two distinct nucleic acids, typically of two plasmids (cf. WO2017064439, Wasels et al., 2017 and Figure 3) which notably solves this problem.
  • the first nucleic acid of this tool allows the expression of cas9 and a second nucleic acid, specific for the modification to be carried out, contains one or more cassettes of expression of gRNA as well as a matrix of repair allowing the replacement of a portion of the bacterial DNA targeted by Cas9 by a sequence of interest.
  • the toxicity of the system is limited by placing cas9 and / or the cassette (s) of expression of gRNA under the control of inducible promoters.
  • the inventors have recently improved this tool by making it possible to very significantly increase the efficiency of bansformation and therefore the obtaining, in number and useful quantity (in particular in the context of selection of robust strains for production on an industrial scale).
  • genetically modified bacteria of interest cf. FR 18/54835.
  • at least one nucleic acid comprises a sequence coding for an anti-CRISPR protein ("acr"), placed under the control of an inducible promoter. This anti-CRISPR protein represses the activity of the guide DNA / RNA endonuclease complex.
  • bacteria belonging to the phylum Firmicutes is meant, in the context of this description, bacteria belonging to the class of Clostridia, Mollicutes, Bacilli or Togobacteria, preferably to the class of Clostridia or Bacilli.
  • Particular bacteria belonging to the phylum Firmicutes include for example bacteria of the genus Clostridium, bacteria of the genus Bacillus or bacteria of the genus Lactobacillus.
  • bacteria of the genus Bacillus is meant in particular B. amyloliquefaciens, B. thurigiensis, B. coagulans, B. cereus, B. anthracis or even B. subtilis.
  • bacteria of the genus Clostridium is meant in particular the species of Clostridium said to be of industrial interest, typically the solventogenic or acetogenic bacteria of the genus Clostridium.
  • the expression “bacteria of the genus Clostridium” includes wild bacteria as well as the strains derived from these, genetically modified in order to improve their performance (for example overexpressing the genes ctfA, ctfB and adc) without having been exposed to CRISPR system.
  • kits of Clostridium of industrial interest are meant the species capable of producing, by fermentation, solvents and acids such as butyric acid or acetic acid, from sugars or from sugars, typically from sugars comprising 5 carbon atoms such as xylose, arabinose or fructose, sugars comprising 6 carbon atoms such as glucose or mannose, polysaccharides such as cellulose or hemicelluloses and / or any other source of carbon assimilable and usable by bacteria of the genus Clostridium (CO, CO2, and methanol for example).
  • solvents and acids such as butyric acid or acetic acid
  • solventogenic bacteria of interest are bacteria of the genus Clostridium producing acetone, butanol, ethanol and / or isopropanol, such as the strains identified in the literature as “ABE strain” [strains producing fermentations allowing the production of acetone, butanol and ethanol] and "IBE strain” [strains carrying out fermentations allowing the production of isopropanol (by reduction of acetone), butanol and ethanol].
  • Solventogenic bacteria of the genus Clostridium can be selected for example from C. acetobutylicum, C. cellulolyticum, C. phytofermentans, C. beijerinckii, C. saccharobutylicum, C.
  • saccharoperbutylacetonicum C. sporogenes, C. butyricum, C. aurantibutyricum and C. tyrobutyricum, preferably from C. acetobutylicum, C. beijerinckii, C. butyricum, C. tyrobutyricum and C. cellulolyticum, and even more preferably from C. acetobutylicum and C. beijerinckii.
  • Bacteria of the genus Clostridium naturally producing isopropanol typically having in their genome an adh gene encoding a primary / secondary alcohol dehydrogenase which allows the reduction of acetone to isopropanol, are distinguished both genetically and functionally from bacteria capable of the natural state of an ABE fermentation.
  • the inventors have advantageously succeeded, in the context of the present invention, in genetically modifying a bacterium of the genus Clostridium naturally producing isopropanol, the bacterium C. beijerinckii DSM 6423, as well as the reference strain C. acetobutylicum DSM 792.
  • the inventors thus describe, for the first time, a solventogenic bacterium of the genus Clostridium naturally (ie in the wild) capable of producing isopropanol, in particular naturally capable of carrying out an IBE fermentation, which has been genetically modified, as well as the tools, in particular the genetic tools, which made it possible to obtain it.
  • These tools have the advantage of considerably facilitating the transformation and genetic modification of bacteria capable, in the wild, of producing isopropanol, in particular of carrying out an IBE fermentation, in particular those carrying a gene encoding an enzyme responsible for resistance to an antibiotic.
  • the inventors have succeeded in removing from the C. beijerinckii DSM 6423 strain its natural plasmid pNF2.
  • the inventors have in particular managed to make sensitive to an amphenicol, a bacterium naturally carrying (carrying in the wild state) a gene encoding an enzyme responsible for the resistance to these antibiotics.
  • amphenicols of interest in the context of the invention are chloramphenicol, thiamphenicol, G azidamfenicol and florfenicol (Schwarz S. et al., 2004), in particular chloramphenicol and thiamphenicol.
  • a first aspect of the invention thus relates to a genetic tool which can be used to genetically transform and / or modify a bacterium of interest, typically a bacterium as described in the present text belonging to the phylum of Firmicutes, for example a bacterium of the genus Clostridium, of the genus Bacillus or of the genus Lactobacillus, preferably a solventogenic bacterium of the genus Clostridium naturally (ie in the wild) capable of producing isopropanol, in particular naturally capable of effecting an IBE fermentation, preferably a naturally resistant bacterium one or more antibiotics, such as C. beijerinckii bacteria.
  • a preferred bacterium has in the state wild both a bacterial chromosome and at least one DNA molecule distinct from chromosomal DNA.
  • this genetic tool consists of a nucleic acid (also identified in the present text as “nucleic acid of interest”) recognizing (binding at least in part), and preferably targeting, ie recognizing and allowing the cutting, in the genome of a bacterium of interest, of at least one strand i) of a sequence coding for an enzyme allowing the bacteria of interest to grow in a culture medium containing an antibiotic vis-à-vis of which it confers resistance to it, ii) of a sequence controlling the transcription of a sequence coding for an enzyme allowing the bacteria of interest to grow in a culture medium containing an antibiotic vis-à-vis which it confers on it a resistance, or iii) a sequence flanking a sequence encoding an enzyme allowing the bacteria of interest to grow in a culture medium containing an antibiotic against which it confers resistance to it.
  • This nucleic acid of interest is typically used in the context of the present invention to suppress the recognized sequence of the genome of the bacteria or to modify its expression, for example to modulate / regulate its expression, in particular to inhibit it, preferably for modify it so as to render said bacteria incapable of expressing a protein, in particular a functional protein, from said sequence.
  • the recognized sequence is also identified in the present text as “target sequence” or “targeted sequence”.
  • the nucleic acid of interest comprises at least one region complementary to the target sequence identical to 100% or identical to at least 80%, preferably 85%, 90%, 95%, 96% , 97%, 98% or 99% at least to the region / portion / DNA sequence targeted within the bacterial genome and is capable of hybridizing to all or part of the complementary sequence of said region / portion / sequence, typically with a sequence comprising at least 1 nucleotide, preferably at least 1, 2, 3, 4, 5, 10, 14, 15, 20, 25, 30, 35 or 40 nucleotides, typically between 1, 10 or 20 and 1000 nucleotides, for example between 1, 10 or 20 and 900, 800, 700, 600, 500, 400, 300 or 200 nucleotides, between 1, 10 or 20 and 100 nucleotides, between 1, 10 or 20 and 50 nucleotides, or between 1, 10 or 20 and 40 nucleotides, for example between 10 and 40 nucleotides, between 10 and 30 nucleotides, between 10 and 20 nucleotides, between
  • the nucleic acid of interest comprises at least two complementary regions each of a target sequence, identical to 100% or identical to at least 80%, preferably 85%, 90%, 95 %, 96%, 97%, 98% or 99% at least to said region / portion / DNA sequence targeted within the bacterial genome.
  • These regions are capable of hybridizing to all or part of the sequence complementary to said region / portion / sequence, typically to a sequence as described above comprising at least 1 nucleotide, preferably at least 100 nucleotides, typically between 100 and 1000 nucleotides.
  • the regions complementary to the target sequence present within the nucleic acid of interest can recognize, preferably target, the 5 'and 3' flanking regions of the targeted sequence in a genetic modification tool as described in the present text, for example the ClosTron® genetic tool, the Targetron® genetic tool or an ACE®-type allelic exchange tool.
  • the target sequence is a sequence encoding an amphenicol-O-acetyltransferase, for example a chloramphenicol-O-acetyltransferase or a thiamphenicol-O-acetyltransferase, controlling the transcription of such a sequence or flanking such a sequence, within the genome a bacterium of interest of the genus Clostridium capable of growing in a culture medium containing one or more antibiotics belonging to the class of amphenicols, for example chloramphenicol and / or thiamphenicol.
  • an amphenicol-O-acetyltransferase for example a chloramphenicol-O-acetyltransferase or a thiamphenicol-O-acetyltransferase
  • the recognized sequence is the sequence SEQ ID NO: 18 corresponding to the catB gene (CIBE_3859) encoding a chloramphenicol-O-acetyltransferase from C. beijerinckii DSM 6423 or an amino acid sequence identical to at least 70 %, 75%, 80%, 85%, 90% or 95% to said chloramphenicol-O-acetyltransferase, or a sequence comprising all or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% of the sequence SEQ ID NO: 18.
  • the recognized sequence can be a sequence comprising at least 1 nucleotide, preferably at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35 or 40 nucleotides, typically between 1 and 40 nucleotides, preferably a sequence comprising 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 , 26, 27, 28, 29 or 30 nucleotides of the sequence SEQ ID NO: 18.
  • amino acid sequences identical to at least 70% to chloramphenicol-O-acetyltransferase coded by the sequence SEQ ID NO: 18 correspond to the sequences identified in the NCBI database under the following references: WP_077843937.1, SEQ ID NO: 44 (WP_063843219.1), SEQ ID NO: 45 (WP_078116092.1), SEQ ID NO: 46 (WP_077840383.1), SEQ ID NO: 47 (WP_077307770.1), SEQ ID NO: 48 (WP_103699368 .1), SEQ ID NO: 49 (WP_087701812.1), SEQ ID NO: 50 (WP_017210112.1), SEQ ID NO: 51 (WP_077831818.1), SEQ ID NO: 52 (WP_012059398.1), SEQ ID NO: 53 (WP_077363893.1), SEQ ID NO: 54 (WP_015393553.1), SEQ ID NO: 55 (WP_02
  • amino acid sequences which are at least 75% identical to chloramphenicol-O-acetyltransferase coded by the sequence SEQ ID NO: 18 correspond to the sequences WP_077843937.1, WP 063843219.1, WP_078116092.1, WP_077840383.1, WP_077307770.1,
  • amino acid sequences identical to at least 90% to chloramphenicol-O-acetyltransferase coded by the sequence SEQ ID NO: 18, are the sequences WP_077843937.1, WP_063843219.1, WP_078116092.1, WP_077840383.1, WP_077307770.1, WP_103699368.1,
  • amino acid sequences which are at least 95% identical to chloramphenicol-O-acetyltransferase encoded by the sequence SEQ ID NO: 18 correspond to the sequences
  • WP_077363893.1 WP_015393553.1, WP_023973814.1, and WP_026887895.1.
  • Preferred amino acid sequences identical to at least 99% chloramphenicol-O-acetyltransferase coded by the sequence SEQ ID NO: 18, are the sequences WP_077843937.1, SEQ ID NO: 44 (WP_063843219.1) and SEQ ID NO: 45 (WP_078116092.1).
  • a particular sequence identical to the sequence SEQ ID NO: 18 is the sequence identified in the NCBI database under the reference WP_077843937.1.
  • the target sequence is the sequence SEQ ID NO: 68 corresponding to the catQ gene coding for a chloramphenicol-O-acetyltransferase from C. perfringens whose amino acid sequence corresponds to SEQ ID NO: 66 (WP_063843220. 1), or a sequence identical to at least 70%, 75%, 80%, 85%, 90% or 95% to said chloramphenicol-O-acetyltransferase, or a sequence comprising all or at least 70%, 75%, 80 %, 85%, 90%, 95%, 96%, 97%, 98% or 99% of the sequence SEQ ID NO: 68.
  • the recognized sequence can be a sequence comprising at least 1 nucleotide, preferably at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35 or 40 nucleotides, typically between 1 and 40 nucleotides, preferably a sequence comprising 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides of the sequence SEQ ID NO: 68.
  • the recognized sequence is selected from a nucleic acid sequence catB (SEQ ID NO: 18), catQ (SEQ ID NO 68), catD (SEQ ID NO: 69, Schwarz S. and al., 2004) or catP (SEQ ID NO: 70, Schwarz S. et al., 2004) known to those skilled in the art, naturally present in a bacterium of the genus Clostridium or introduced artificially into such a bacterium.
  • catB nucleic acid sequence catB
  • catQ SEQ ID NO: 68
  • catD SEQ ID NO: 69, Schwarz S. and al., 2004
  • catP SEQ ID NO: 70, Schwarz S. et al., 2004
  • the target sequence can also be a sequence controlling the transcription of a coding sequence as described above (coding an enzyme allowing the bacteria of interest to grow in a culture medium containing an antibiotic against which it confers resistance), typically a promoter sequence, for example the promoter sequence (SEQ ID NO: 73) of the catB gene or that (SEQ ID NO: 74) of the catQ gene.
  • a promoter sequence for example the promoter sequence (SEQ ID NO: 73) of the catB gene or that (SEQ ID NO: 74) of the catQ gene.
  • the nucleic acid of interest used as a genetic tool, then recognizes, and is therefore typically capable of binding to a sequence controlling the transcription of a coding sequence as described above.
  • the target sequence can be a sequence flanking a coding sequence as described above (coding an enzyme allowing the bacteria of interest to grow in a culture medium containing an antibiotic vis-à-vis which it confers resistance to it), for example a sequence flanking the catB gene of sequence SEQ ID NO: 18 or a sequence identical to at least 70% thereof.
  • flanking sequence typically comprises 1, 10 or 20 and 1000 nucleotides, for example between 1, 10 or 20 and 900, 800, 700, 600, 500, 400, 300 or 200 nucleotides, between 1, 10 or 20 and 100 nucleotides , between 1, 10 or 20 and 50 nucleotides, or between 1, 10 or 20 and 40 nucleotides, for example between 10 and 40 nucleotides, between 10 and 30 nucleotides, between 10 and 20 nucleotides, between 20 and 30 nucleotides, between 15 and 40 nucleotides, between 15 and 30 nucleotides or between 15 and 20 nucleotides.
  • the target sequence corresponds to the pair of sequences flanking such a coding sequence, each flanking sequence typically comprising at least 20 nucleotides, typically between 100 and 1000 nucleotides, preferably between 200 and 800 nucleotides.
  • nucleic acid is meant within the meaning of the invention, any natural, synthetic, semi-synthetic or recombinant DNA or RNA molecule, optionally chemically modified (ie comprising non-natural bases, modified nucleotides comprising by example a modified bond, modified bases and / or modified sugars), or optimized so that the codons of the transcripts synthesized from the coding sequences are the codons most frequently found in a bacterium of the genus Clostridium for its use at it.
  • the optimized codons are typically codons rich in adenine ("A") and thymine (“T”) bases.
  • C cysteine
  • D aspartic acid
  • E glutamic acid
  • F phenylalanine
  • G glycine
  • H histidine
  • I isoleucine
  • K lysine
  • L leucine
  • M methionine
  • N asparagine
  • P proline
  • Q glutamine
  • R arginine
  • S serine
  • T threonine
  • V valine
  • W tryptophan
  • Y tyrosine.
  • the nucleic acid of interest used as a genetic tool to transform and / or genetically modify a bacterium of interest, is a DNA fragment i) recognizing a coding sequence, ii) controlling the transcription of a coding sequence, or iii) flanking a coding sequence, an enzyme of interest, preferably an amphenicol-O-acetyltransferase, for example a chloramphenicol-O-acetyltransferase or a thiamphenicol -O- acetyltransferase, within the genome of a bacterium of the genus Clostridium, in particular of a solventogenic bacterium of the genus Clostridium naturally capable of producing isopropanol, in particular naturally capable of effecting an IBE fermentation.
  • an enzyme of interest preferably an amphenicol-O-acetyltransferase, for example a chloramphenicol-O-acetyltransferase or
  • the bacterium capable of naturally producing isopropanol can for example be a bacterium selected from a C. beijerinckii bacteria, a C. diolis bacteria, a C. puniceum bacteria, a C. butyricum bacterium, a C. saccharoperbutylacetonicum bacteria, a bacterium C. botulinum, a C. drakei bacteria, a C. scatologenes bacteria, a C. perfringens bacteria, and a C. tunisiense bacteria, preferably a bacteria selected from a C. beijerinckii bacteria, a C. diolis bacteria, a C bacteria puniceum and a bacterium C. saccharoperbutylacetonicum.
  • a particularly preferred bacterium capable of producing isopropanol in the wild is C. beijerinckii.
  • the bacterium of the genus Clostridium is a bacterium C. beijerinckii, the subclade of which is selected from DSM 6423, LMG 7814, LMG 7815, NCCB 27006 and a subclade having at least 90%, 95%, 96 %, 97%, 98% or 99% identity with the DSM 6423 strain.
  • the nucleic acid of interest according to the invention is capable of suppressing the recognized sequence (“target sequence”) from the genome of the bacteria or of modifying its expression, for example of modulating it, in particular of the inhibit, preferably modify it so as to render said bacterium incapable of expressing a protein, preferably an amphenicol-O-acetyltransferase, in particular a functional protein, from said sequence.
  • target sequence the recognized sequence
  • a protein preferably an amphenicol-O-acetyltransferase, in particular a functional protein
  • This nucleic acid of interest is typically in the form of an expression cassette (or “construction”) such as for example a nucleic acid comprising a transcriptional promoter linked in an operational manner (in the sense understood by man of the trade) to one or more (coding) sequences of interest, for example an operon comprising several coding sequences of interest, the expression products of which contribute to the achievement of a function of interest within the bacterium, or a nucleic acid further comprising an activator sequence and / or a transcription terminator; or in the form of a vector, circular or linear, single or double strand, for example a plasmid, a phage, a cosmid, an artificial or synthetic chromosome, comprising one or more expression cassettes as defined above.
  • the vector is a plasmid.
  • the nucleic acids of interest can be constructed by conventional techniques well known to those skilled in the art and can comprise one or more promoters, origins of bacterial replication (ORI sequences), termination, selection genes, for example antibiotic resistance genes, and sequence (s) (for example "region (s) flanked (s) ”) allowing targeted insertion of the cassette or vector.
  • cassettes and expression vectors can be integrated into the genome by techniques well known to those skilled in the art.
  • ORI sequences of interest can be chosen from pIP404, rAMbI, pCB 102, repH (origin of replication in C. acetobutylicum), ColEl or rep (origin of replication in E. coli), or any other origin of replication allowing maintenance of the vector, typically the plasmid, within a Clostridium cell.
  • Termination sequences of interest can be chosen from those of the adc, thl genes, of the bcs operon, or of any other terminator, well known to those skilled in the art, allowing the stopping of transcription within of Clostridium.
  • Selection genes (resistance genes) of interest can be chosen from ermB, catP, bla, tetA, tetM, and / or any other gene for resistance to ampicillin, erythromycin, chloramphenicol, thiamphenicol, tetracycline or any other antibiotic which can be used to select bacteria of the genus Clostridium well known to those skilled in the art.
  • the selection gene used is not a gene for resistance to chloramphenicol and / or thiamphenicol , and is preferably none of the catB, catQ, catD or catP genes.
  • the nucleic acid of interest comprises one or more guide RNAs (gRNA) targeting a sequence (“target sequence”, “targeted sequence” or “recognized sequence”) coding, controlling the transcription of a sequence encoding, or flanking a sequence encoding, an enzyme of interest, in particular an amphenicol-O-acetyltransferase, and / or a modification matrix (also identified in the present text as an “editing matrix”), by example a matrix making it possible to eliminate or modify all or part of the target sequence, preferably with the aim of inhibiting or suppressing the expression of the target sequence, typically a matrix comprising homologous sequences (corresponding) to the sequences located in upstream and downstream of the target sequence as described above, typically sequences (homologous to said sequences located upstream and downstream of the target sequence) each comprising between 10 or 20 base pairs and 1000, 15 00 or 2000 base pairs, for example between 100, 200, 300, 400 or 500 base pairs and 1000, 1200, 1300,
  • gRNA
  • a particular genetic tool according to the invention comprises several (at least two) nucleic acids of interest as described above, said nucleic acids of interest being different from each other.
  • the nucleic acid of interest used as a genetic tool to genetically transform and / or modify a bacterium of interest is a nucleic acid recognizing a coding sequence, a sequence controlling the transcription, or a flanking sequence, a sequence coding for an enzyme conferring on the bacteria resistance to one or more antibiotics, and capable of suppressing said sequence within the genome of this bacterium or of rendering it non-functional, in particular a nucleic acid showing no methylation at the levels of the patterns recognized by the Dam and Dcm methyltransferases (prepared from an Escherichia coli bacterium having the dam-dcm- genotype).
  • the nucleic acid of interest used as a genetic tool is a nucleic acid which does not exhibit methylation at the levels of the motifs recognized by methyltransferases of the Dam and Dcm type, typically a nucleic acid of which adenosine ("A") ) of the GATC motif and / or the second cytosine “C” of the CCWGG motif (W possibly corresponding to an adenosine (“A”) or to a thymine (“T”)) are demethylated.
  • A adenosine
  • C the second cytosine
  • a nucleic acid which does not exhibit methylation at the levels of the patterns recognized by the Dam and Dcm methyltransferases can typically be prepared from an Escherichia coli bacterium having the dam dcm genotype (for example Escherichia coli INV 110, Invitrogen).
  • This same nucleic acid can comprise other methylations carried out for example by EcoKI type methyltransferases, the latter targeting the adenines (“A”) of the AAC (N6) GTGC and GCAC (N6) GTT (N which may correspond to n ' whatever basis).
  • the targeted sequence corresponds to a gene coding for an amphenicol-O-acetyltransferase, for example a chloramphenicol-O-acetyltransferase such as the catB gene, to a sequence controlling the transcription of this gene, or to a flanking sequence this gene.
  • an amphenicol-O-acetyltransferase for example a chloramphenicol-O-acetyltransferase such as the catB gene
  • a nucleic acid of particular interest used as a genetic tool in the context of the invention is for example a vector, preferably a plasmid, for example the plasmid pCas9ind-Aca / B of sequence SEQ ID NO: 21 or the plasmid pCas9ind- gRNA_ca / B of sequence SEQ ID NO: 38 described in the experimental part of the present description, in particular a version of said sequence which does not have methylation at the level of the patterns recognized by methyltransferases of Dam and Dcm type.
  • the present description also relates to the use of a nucleic acid of interest as described in the present text for transforming and / or genetically modifying a bacterium of interest, in particular a solventogenic bacterium of the genus Clostridium capable in the wild. to produce isopropanol, in particular capable in the wild of carrying out IBE fermentation.
  • a bacterium capable of producing isopropanol in the wild, in particular capable of carrying out an IBE fermentation in the wild can be for example a bacterium selected from a bacterium C. beijerinckii, a bacterium C. diolis, C. puniceum bacteria, C. butyricum bacteria, C. saccharoperbutylacetonicum bacteria, C.
  • botulinum bacteria from preferably a bacterium selected from a C. beijerinckii bacterium, a C. diolis bacteria, a C. puniceum bacteria and a C. saccharoperbutylacetonicum bacteria.
  • a bacteria (naturally) capable of producing isopropanol in the wild, in particular capable of carrying out IBE fermentation in the wild, which is particularly preferred is a bacterium C. beijerinckii.
  • the acetogenic bacteria of interest are bacteria which produce acids and / or solvents from CO2 and 3 ⁇ 4.
  • Acetogenic bacteria of the genus Clostridium can be selected for example from C. aceticum, C. thermoaceticum, C. ljungdahlii, C. autoethanogenum, C. difficile, C. scatologenes and C. carboxydivorans.
  • the bacterium of the genus Clostridium concerned is an "ABE strain", preferably the DSM 792 strain (also designated ATCC 824 or LMG 5710 strain) from C. acetobutylicum, or the NCIMB 8052 strain from C. beijerinckii.
  • the bacterium of the genus Clostridium concerned is an "IBE strain", typically one of the C. beijerinckii bacteria identified in the present description, for example a C. beijerinckii bacterium whose subclade is selected among DSM 6423, LMG 7814, LMG 7815, NRRL B-593, NCCB 27006, or a bacterium C. aurantibutyricum DSZM 793 (Georges et al., 1983), and a subclade of such a bacterium C. beijerinckii or C aurantibutyricum having at least 90%, 95%, 96%, 97%, 98% or 99% identity with the strain DSM 6423.
  • a bacteria C. beijerinckii, or a subclade of bacteria C. beijerinckii, particularly preferred (e) lacks the plasmid pNF2.
  • the respective genomes of subclades LMG 7814, LMG 7815, NRRL B-593 and NCCB 27006 on the one hand, and DSZM 793 on the other hand, have percent sequence identity of at least 97% with the genome of the DSM 6423 subclade.
  • the bacteria C. beijerinckii is the subclade bacterium DSM 6423.
  • the bacteria C. beijerinckii is a strain C. beijerinckii IFP963 AcatB ApNF2 (registered on February 20, 2019 under the deposit number LMG P-31277 with the BCCM-LMG collection, and also identified in the present text as C. beijerinckii DSM 6423 AcatB ApNF2).
  • the bacterium intended to be transformed, and preferably genetically modified is according to a particular embodiment a bacterium which has been exposed to a first stage of transformation and to a first stage of genetic modification using a nucleic acid or genetic tool according to the invention which has made it possible to delete at least one extrachromosomal DNA molecule (typically at least one plasmid) naturally present within said bacterium in the wild.
  • Another aspect described by the inventors relates to a process for transforming, and preferably further genetically modifying, a bacterium of the genus Clostridium using a genetic tool according to the invention, typically using a nucleic acid of interest according to the invention as described above.
  • This method comprises a step of transforming the bacterium by introducing into said bacterium the nucleic acid of interest described in the present text.
  • the method may further comprise a step of obtaining, recovering, selecting or isolating the transformed bacterium, i.e. of the bacterium presenting the desired recombination / modifications / modifications / optimizations.
  • the method for transforming, and preferably genetically modifying, a bacterium of the genus Clostridium involves a genetic modification tool, for example a genetic modification tool selected from a CRISPR tool, a tool based on the use of type II introns (for example the Targetron® tool or the ClosTron® tool) and an allelic exchange tool (for example the ACE® tool), and comprises a step of transformation of the bacteria by introduction into said bacterium of a nucleic acid of interest according to the invention as described above.
  • a genetic modification tool for example a genetic modification tool selected from a CRISPR tool, a tool based on the use of type II introns (for example the Targetron® tool or the ClosTron® tool) and an allelic exchange tool (for example the ACE® tool)
  • a genetic modification tool for example a genetic modification tool selected from a CRISPR tool, a tool based on the use of type II introns (for example the Targetron® tool or the Clos
  • the present invention is typically advantageously implemented when the genetic modification tool selected to transform, and preferably genetically modify, a bacterium of the genus Clostridium, is intended to be used on a bacterium such as C. beijerinckii, carrier of the wild state of a gene encoding an enzyme responsible for resistance to one or more antibiotics, and that the implementation of said genetic tool comprises a step of transformation of said bacterium using a nucleic acid allowing the expression of a marker of resistance to an antibiotic to which this bacterium is resistant in the wild and / or a step of selection of bacteria transformed and / or genetically modified using said antibiotic (to which the bacterium is resistant to wild state).
  • a modification advantageously achievable thanks to the present invention for example using a genetic modification tool selected from a CRISPR tool, a tool based on the use of type II introns and an allelic exchange tool, consists in removing a sequence coding for an enzyme conferring on the bacteria resistance to one or more antibiotics, or in rendering this sequence non-functional.
  • Another modification advantageously achievable thanks to the present invention consists in genetically modifying a bacterium in order to improve its performance, for example its performance in the production of a solvent or of a mixture of solvents of interest, said bacterium having previously already was modified by the invention to make it sensitive to an antibiotic to which it was resistant in the wild.
  • the method according to the invention is based on the use of (implements) the CRISPR technology / genetic tool (Clustered Regularly Interspaced Short Palindromie Repeats), in particular the CRISPR genetic tool / Case (CRISPR-associated protein).
  • CRISPR technology / genetic tool Clustered Regularly Interspaced Short Palindromie Repeats
  • CRISPR genetic tool / Case CRISPR-associated protein
  • nuclease typically a Cas type nuclease in the case of the CRISPR / Cas genetic tool, such as the Cas9 protein (CRISPR-associated protein 9) of Streptococcus pyogenes
  • CRISPR-associated protein 9 the Cas9 protein (CRISPR-associated protein 9) of Streptococcus pyogenes
  • gRNA guide RNA
  • the present invention can be implemented on a bacterium of the genus Clostridium using a CRISPR / classic case genetic tool using a single plasmid comprising a nuclease, a gRNA and a repair matrix as described by Wang et al. (2015).
  • the CRISPR / Cas system contains two distinct essential elements, ie i) an endonuclease, in this case the nuclease associated with the CRISPR system, Cas, and ii) a guide RNA.
  • Guide RNA is in the form of a chimeric RNA which consists of the combination of a bacterial CRISPR RNA (crRNA) and a trans-activating CRISPR RNA.
  • the gRNA combines the targeting specificity of the cRNA corresponding to the "spacer sequences" which serve as guides for the Cas proteins, and the conformational properties of the trRNA in a single transcript.
  • the target genomic sequence can be changed permanently using a repair template provided.
  • Those skilled in the art can easily define the sequence and structure of the gRNAs according to the chromosomal region or the mobile genetic element to be targeted using well known techniques (see for example the article by DiCarlo et al., 2013).
  • the introduction into the bacterium of the elements (nucleic acids or gRNA) of the genetic tool is carried out by any method, direct or indirect, known to those skilled in the art, for example by transformation, conjugation, microinjection, transfection, electroporation, etc., preferably by electroporation (Mermelstein et al, 1993).
  • the inventors have recently developed and described a genetic tool for modifying bacteria, suitable for bacteria of the genus Clostridium and usable in the context of the present invention, based on the use of two plasmids (cf. WO2017 / 064439, Wasels et al ., 2017, and Figure 15 associated with this description).
  • the "first" plasmid of this tool allows the expression of the Cas nuclease and a "second" plasmid, specific to the modification to be carried out, contains one or more cassettes of expression of gRNA (targeting typically different regions of bacterial DNA) as well as a repair matrix allowing, by a homologous recombination mechanism, the replacement of a portion of the bacterial DNA targeted by Cas with a sequence of interest.
  • gRNA targeting typically different regions of bacterial DNA
  • the cas gene and / or the gRNA expression cassette (s) are placed under the control of constitutive or inducible, preferably inducible, expression promoters known to those skilled in the art (for example described in WO2017 / 064439 and incorporated by reference to the present description), and preferably different but inducible by the same inducing agent.
  • the gRNAs can be natural, synthetic or produced by recombinant techniques. These gRNAs can be prepared by any methods known to those skilled in the art, such as, for example, chemical synthesis, in vivo transcription or amplification techniques. When multiple gRNAs are used, the expression of each gRNA can be controlled by a different promoter. Preferably, the promoter used is the same for all the gRNAs. The same promoter can in a particular embodiment be used to allow the expression of several, for example of only a few, or in other words of all or part of the gRNAs intended to be expressed.
  • At least one of said "first" and “second” nucleic acids further codes for one or more RNAs guides (gRNA) or the genetic tool further comprises one or more guide RNAs, each guide RNA comprising an RNA binding structure with G Cas enzyme and a sequence complementary to the targeted portion of the bacterial DNA, and iii) at least one of said “first” and “second” nucleic acids further comprises a sequence coding for an anti-CRISPR protein placed under the control of an inducible promoter, or the genetic tool further comprises a “third” nucleic acid coding for a anti-CRISPR protein placed under the control of an inducible promoter, preferably different from the promoters controlling the expression of Cas and / or of the RNA (s) and inducible by an inducing agent vane.
  • gRNA RNAs guides
  • the anti-CRISPR protein is capable of inhibiting, preferably neutralizing, the action of nuclease, preferably during the phase of introduction of the nucleic acid sequences of the genetic tool into the bacterial strain of interest.
  • a particular process involving CRISPR technology capable of being implemented in the context of the present invention for transforming, and typically for genetically modifying by homologous recombination, a bacterium of the genus Clostridium, comprises the following steps:
  • step b) culturing the transformed bacterium obtained at the end of step a) on a medium which does not contain (or under conditions which do not involve) the agent inducing the expression of the anti-CRISPR protein, typically allowing expression of the Cas / gRNA ribonucleoprotein complex.
  • the method further comprises, during or after step b), a step of inducing the expression of the inducible promoter (s) controlling the expression of Cas and / or of the guide RNA (s) when such or such promoters are present within the genetic tool, in order to allow the genetic modification of interest of the bacterium once said genetic tool is introduced into said bacterium.
  • the induction is carried out using a substance which makes it possible to remove the inhibition of expression linked to the selected inducible promoter.
  • the method comprises an additional step c) of elimination of the nucleic acid containing the repair matrix (the bacterial cell then being considered as "cure” of said nucleic acid) and / or of elimination guide RNA (s) or sequences encoding the guide RNA (s) introduced with the genetic tool during step a).
  • the method comprises one or more additional steps, subsequent to step b) or to step c), of introducing an umpteenth, for example third, quabidiag, fifth, etc., nucleic acid containing a repair matrix distinct from that (s) already introduced and one or more guide RNA expression cassettes allowing the integration of the sequence of interest contained in said distinct repair matrix in a targeted area of the genome of the bacteria, in the presence of an agent inducing the expression of the anti-CRISPR protein, each additional step being followed by a step of culturing the bacteria thus transformed on a medium not containing the agent inducing the expression of the anti-CRISPR protein, typically allowing the expression of the ribonucleoprotein complex Cas / gRNA.
  • the bacteria is transformed using a CRISPR tool or a method, such as those described above, using (for example coding) an enzyme responsible for cutting at least one strand of the target sequence of interest, in which the enzyme is in a particular mode a nuclease, preferably a Cas type nuclease, preferably selected from a Cas9 enzyme and a MAD7 enzyme.
  • a nuclease preferably a Cas type nuclease, preferably selected from a Cas9 enzyme and a MAD7 enzyme.
  • the target sequence of interest is a sequence, for example the catB gene, coding for an enzyme which confers on the bacteria resistance to one or more antibiotics, preferably to one or more antibiotics belonging to the class of amphenicols, typically an amphenicol-O-acetyltransferase such as a chloramphenicol-O-acetyltransferase, a sequence controlling the transcription of the coding sequence or a sequence flanking said coding sequence.
  • Cas9 proteins usable in the present invention include, but are not limited to, the Cas9 proteins of S. pyogenes (cf. SEQ ID NO: 1 of application WO2017 / 064439 and NCBI entry number: WP_010922251.1), Streptococcus thermophilus, Streptococcus mutans, Campylobacter jejuni, Pasteurella multocida, Francisella novicida, Neisseria meningitidis, Neisseria lactamica and Lministeronella pneumophila (cf. Fonfara et al, 2013; Makarova et al, 2015).
  • S. pyogenes cf. SEQ ID NO: 1 of application WO2017 / 064439 and NCBI entry number: WP_010922251.1
  • Streptococcus thermophilus cf. SEQ ID NO: 1 of application WO2017 / 064439 and NCBI entry number: WP_010922251.1
  • the nuclease MAD7 (whose amino acid sequence corresponds to the sequence SEQ ID NO: 72), also identified as "Case 12" or “Cpfl", can otherwise be advantageously used in the context of the present invention by combining with one or more RNAs known to those skilled in the art capable of binding to such a nuclease (cf. Garcia-Doval et al., 2017 and Stella S. et al., 2017).
  • the sequence coding for the nuclease MAD7 is a sequence optimized for being easily expressed in strains of Clostridium, preferably the sequence SEQ ID NO: 71.
  • the anti-CRISPR protein is typically a protein " anti-Cas ”, ie a protein capable of inhibiting or preventing / neutralizing the action of Cas, and / or a protein capable of inhibiting or preventing / neutralizing the action of a CRISPR / Case, for example of a CRISPR / Cas type II system when the nuclease is a Cas9 nuclease.
  • the anti-CRISPR protein is advantageously an “anti-Cas9” protein, for example selected from AcrlIAl, AcrIIA2, AcrIIA3, AcrIIA4, AcrIIA5, AcrlICl, AcrIIC2 and AcrIIC3 (Pawluk et al, 2018).
  • the “anti-Cas9” protein is AcrIIA2 or AcrIIA4.
  • Such a protein is typically capable of very significantly limiting, ideally preventing, the action of Cas9, for example by binding to the enzyme Cas9.
  • an “anti-MAD7” protein for example the AcrVAl protein (Marino et al, 2018).
  • the editing / repair template may itself include one or more nucleic acid sequences or portions of nucleic acid sequence corresponding to natural sequences and / or synthetic, coding and / or non-coding.
  • the matrix can also comprise one or more “foreign” sequences, ie naturally absent from the genome of bacteria belonging to the genus Clostridium or from the genome of particular species of said genus.
  • the matrix can also include a combination of sequences.
  • the genetic tool used in the context of the present invention allows the repair matrix to guide the incorporation into the bacterial genome of a nucleic acid of interest, typically of a DNA sequence or portion of sequence comprising at least 1 base pair (bp), preferably at least 1, 2, 3, 4, 5, 10, 15, 20, 50, 100, 1,000, 10,000, 100,000 or 1,000,000 bp, typically between 1 bp and 20 kb, for example 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or 13 kb, or between 1 bp and 10 kb, preferably between 10 bp and 10 kb or between 1 kb and 10 kb, for example between lpb and 5 kb, between 2 kb and 5 kb, or between 2.5 or 3 kb and 5 kb.
  • bp base pair
  • the expression of the DNA sequence of interest allows the bacteria of the genus Clostridium to ferment (typically simultaneously) several different sugars, for example at least two different sugars, typically at least two different sugars among the sugars comprising 5 carbon atoms (such as glucose or mannose) and / or among the sugars comprising 6 carbon atoms (such as xylose, arabinose or fructose), preferably at least three different sugars, selected for example from glucose, xylose and mannose; glucose, arabinose and mannose; and glucose xylose and arabinose.
  • the DNA sequence of interest codes for at least one product of interest, preferably a product promoting the production of solvent by the bacterium of the genus Clostridium, typically at least one protein of interest, for example an enzyme; a membrane protein such as a transporter; a protein from the maturation of other proteins (chaperone protein); a transcription factor; or a combination of these.
  • the method according to the invention is based on the use of type II introns, and for example implements the ClosTron® genetic technology / tool or the Targetron® genetic tool.
  • Targetron® technology is based on the use of a reprogrammable group II intron (based on the Lactococcus lactis intron Ll.ltrB), capable of integrating the bacterial genome quickly at a desired locus (Chen et al., 2005 , Wang et al., 2013), typically for the purpose of inactivating a targeted gene.
  • the mechanisms of recognition of the edited area as well as of insertion into the genome by back-splicing are based on a homology between the intron and said area on the one hand, and on the activity of a protein (ltrA) d 'somewhere else.
  • ClosTron® technology is based on a similar approach, supplemented by the addition of a selection marker in the intron sequence (Heap et al., 2007).
  • This marker makes it possible to select the integration of the intron into the genome, and therefore facilitates the obtaining of the desired mutants.
  • This genetic system also exploits type I introns. Indeed, the selection marker (called RAM for retrotransposition-activated marker) is interrupted by such a genetic element, which prevents its expression from the plasmid (a more precise description of the system: Zhong et al.). Splicing of this genetic element occurs before integration into the genome, which makes it possible to obtain a chromosome having an active form of the resistance gene.
  • An optimized version of the system includes FLP / FRT sites upstream and downstream of this gene, which makes it possible to use the FRT recombinase to eliminate the resistance gene (Heap et al., 2010).
  • the method according to the invention is based on the use of an allelic exchange tool, and for example implements the ACE® technology / genetic tool.
  • the ACE® technology is based on the use of an auxotrophic mutant (for uracil in C. acetobutylicum ATCC 824 by deletion of the pyrE gene, which also causes resistance to 5-fluoroorotic acid (A-5-FO) ; Heap et al., 2012).
  • the system uses the allelic exchange mechanism, well known to those skilled in the art. Following a transformation with a pseudo-suicide vector (with very low copies), the integration of the latter into the bacterial chromosome by a first allelic exchange event is selected thanks to the resistance gene initially present on the plasmid.
  • the integration step can be carried out in two different ways, either within the pyrE locus or within another locus:
  • the pyrE gene is also placed on the plasmid, without however being expressed (no functional promoter).
  • the second recombination restores a functional pyrE gene and can then be selected by auxotrophy (minimum medium, containing no uracil).
  • auxotrophy minimum medium, containing no uracil
  • the non-functional pyrE gene also having a selectable character (sensitivity to A-5-FO), other integrations can then be envisaged on the same model, by successively alternating the state of pyrE between functional and non-functional.
  • a genomic zone allowing expression of the counter-selection marker after recombination is targeted (typically, as an operon after another gene, preferably a highly expressed gene). This second recombination is then selected by auxotrophy (minimum medium containing no uracil).
  • the targeted sequence is preferably a sequence flanking the sequence encoding an enzyme of interest, preferably, as explained above, an amphenicol-O-acetyltransferase.
  • Another subject of the invention relates to a transformed and / or genetically modified bacterium, typically a bacterium of the genus Clostridium belonging to a species or corresponding to one of the subclades described by the inventors, obtained using a process as described by the inventors in the present text, as well as any derived bacteria, clone, mutant or genetically modified version thereof.
  • a transformed and / or genetically modified bacterium typically a bacterium of the genus Clostridium belonging to a species or corresponding to one of the subclades described by the inventors, obtained using a process as described by the inventors in the present text, as well as any derived bacteria, clone, mutant or genetically modified version thereof.
  • a bacterium thus transformed and / or genetically modified typical of the invention is a bacterium no longer expressing an enzyme conferring resistance to one or more antibiotics, in particular a bacterium no longer expressing an amphenicol-O-acetyltransferase, for example a bacterium expressing in the wild the catB gene, and devoid of said catB gene or incapable of expressing said catB gene once transformed and / or genetically modified thanks to the invention.
  • the bacterium thus transformed and / or genetically modified thanks to the invention is made sensitive to an amphenicol, for example to an amphenicol as described in the present text, in particular to chloramphenicol or thiamphenicol.
  • a particular example of a genetically modified bacterium preferred according to the invention is the bacteria identified in the present description as C. beijerinckii DSM 6423 D catB as registered under the deposit number LMG P-31151 with the Belgian Co-ordinated Collections of Micro-organisms (“BCCM”, KL Ledeganckstraat 35, B-9000 Gent - Belgium) on December 6, 2018.
  • BCCM Belgian Co-ordinated Collections of Micro-organisms
  • KL Ledeganckstraat 35, B-9000 Gent - Belgium Belgian Co-ordinated Collections of Micro-organisms
  • the description also relates to any derived bacteria, clone, mutant or genetically modified version of said bacteria remaining sensitive to an amphenicol such than thiamphenicol and / or chloramphenicol.
  • the transformed and / or genetically modified bacterium according to the invention does not express an enzyme which gives it resistance to one or more antibiotics, in particular an amphenicol-O-acetyltransferase such as chloramphenicol-O- acetyltransferase, for example the bacteria C. beijerinckii DSM 6423 D catB, is still capable of being transformed, and preferably genetically modified.
  • an enzyme which gives it resistance to one or more antibiotics in particular an amphenicol-O-acetyltransferase such as chloramphenicol-O- acetyltransferase, for example the bacteria C. beijerinckii DSM 6423 D catB
  • a nucleic acid for example a plasmid as described in the present description, for example in the experimental part.
  • An example of a nucleic acid capable of being advantageously used is the plasmid pCas9 aCr of sequence SEQ ID NO: 23 (described in
  • a particular aspect of the invention relates in fact to the use of a bacterium genetically modified according to the invention, preferably the bacterium C. beijerinckii DSM 6423 AcatB deposited under the number LMG P-31151 or a genetically modified version of the latter, for example using one of the genetic tools or methods described in this text, to produce, through the expression of the nucleic acid (s) of interest introduced voluntarily into its genome, one or more several solvents, preferably at least isopropanol, preferably on an industrial scale.
  • a bacterium genetically modified according to the invention preferably the bacterium C. beijerinckii DSM 6423 AcatB deposited under the number LMG P-31151 or a genetically modified version of the latter, for example using one of the genetic tools or methods described in this text, to produce, through the expression of the nucleic acid (s) of interest introduced voluntarily into its genome, one or more several solvents, preferably at least isopropanol, preferably on an industrial scale
  • the invention also relates to a kit (kit) comprising (i) a nucleic acid of interest according to the invention, typically a DNA fragment recognizing a coding sequence, or controlling the transcription of a coding sequence, an enzyme of interest in a bacterium of the genus Clostridium, in particular in a bacterium capable of carrying out an IBE fermentation as described in the present text, and (ii) at least one tool, preferably several tools, selected from among the elements of a tool genetic modification making it possible to transform, and typically genetically modify a bacterium of the genus Clostridium, in order to produce an improved variant of said bacterium; nucleic acid as gRNA; nucleic acid as a repair matrix; at least one pair of primers, for example a pair of primers as described in the context of the present invention; and an inducer allowing the expression of a protein coded by said tool, for example a nuclease of the Cas9 or MAD7 type.
  • kit comprising (i)
  • the genetic modification tool for transforming, and typically genetically modifying a bacteria of the genus Clostridium may for example be selected from a CRISPR tool, a tool based on the use of type II introns and an allelic exchange tool , as explained above.
  • the kit may also comprise one or more inducers adapted to the selected inducible promoter (s) possibly used within the genetic tool to control the expression of the nuclease used and / or one or more guide RNAs.
  • inducers adapted to the selected inducible promoter (s) possibly used within the genetic tool to control the expression of the nuclease used and / or one or more guide RNAs.
  • a particular kit according to the invention allows the expression of a nuclease comprising a label (or "tag").
  • kits according to the invention may also comprise one or more consumables such as a culture medium, at least one competent bacterium of the genus Clostridium (ie conditioned for transformation), at least one gRNA, a nuclease, one or several selection molecules, or an explanatory note.
  • consumables such as a culture medium, at least one competent bacterium of the genus Clostridium (ie conditioned for transformation), at least one gRNA, a nuclease, one or several selection molecules, or an explanatory note.
  • the description also relates to the use of a kit according to the invention, or of one or more of the elements of this kit, for the implementation of a process of transformation and ideally of genetic modification of a bacterium of the genus Clostridium described in the present text, and / or for the production of solvent (s) or biofuel (s), or mixtures thereof, preferably on an industrial scale, using a bacterium of the genus Clostridium, preferably a bacterium of the genus Clostridium naturally producing isopropanol.
  • Solvents capable of being produced are typically acetone, butanol, ethanol, isopropanol or a mixture thereof, typically an ethanol / isopropanol, butanol / isopropanol, or ethanol / butanol mixture, preferably a isopropanol / butanol mixture.
  • bacteria transformed according to the invention typically allows the production per year on an industrial scale of at least 100 tonnes of acetone, at least 100 tonnes of ethanol, at least 1000 tonnes of isopropanol , at least 1,800 tonnes of butanol, or at least 40,000 tonnes of a mixture thereof.
  • the examples and figures below are intended to illustrate the invention more fully without limiting its scope.
  • Figure 1 represents the classification of 30 Clostridium solventogenic strains, according to Poehlein et al., 2017. Note that the subclade C. beijerinckii NRRL B-593 is also identified in the literature as C. beijerinckii DSM 6423.
  • Figure 2 represents the Map of the plasmid pCas9ind-Aca / B
  • Figure 3 represents the Map of the plasmid pCas9acr
  • Figure 4 represents the Map of the plasmid pEC750S- “ppHR
  • FIG 5 shows the Map of the plasmid pEX-A2-gRNA-wpp.
  • Figure 6 represents the Map of the plasmid pEC750S-A “pp.
  • FIG 7 shows the Map of plasmid pEC750C-A "pp
  • Figure 8 represents the Map of pGRNA-pNF2
  • Figure 9 represents the PCR Amplification of the catB gene in the clones resulting from the bacterial transformation of the C. beijerinckii DSM 6423 strain.
  • Figure 10 represents the Growth of C. beijerinckii DSM6423 WT and Aral B strains on 2YTG medium and 2YTG thiamphenicol selective medium.
  • Figure 11 represents the Induction of the CRISPR / Cas9acr system in transformants of the C. beijerinckii DSM 6423 strain containing pCas9, Cr and a gRNA expression plasmid targeting upp, with or without repair matrix .
  • Em erythromycin
  • Tm thiamphenicol
  • aTc anhydrotetracycline
  • ND undiluted.
  • FIG. 12A represents the Modification of the upp locus of C. beijerinckii DSM 6423 via the CRISPR / Cas9 system.
  • FIG. 12A represents the genetic organization of the upp locus: genes, target site of the gRNA and repair matrices, associated with the regions of corresponding homologies on F genomic DNA.
  • the priming hybridization sites for PCR verification (RH010 and RH011) are also indicated.
  • Figure 12 represents the Modification of the upp locus of C. beijerinckii DSM 6423 via the CRISPR / Cas9 system.
  • Figure 12B shows the amplification of the upp locus using primers RH010 and RH011. An amplification of 1680 bp is expected in the case of a wild-type gene, against 1090 bp for a modified upp gene.
  • M size marker 100 bp - 3 kb (Lonza); WT, wild strain.
  • Figure 13 represents the PCR Amplification verifying the presence of the plasmid pCas9i nd . in C. beijerinckii 6423 A catB.
  • Figure 14 represents the PCR Amplification (“900 bp) verifying the presence or not of the natural plasmid pNF2 before induction (positive control 1 and 2) then after induction on medium containing aTc from the CRISPR-Cas9 system .
  • Figure 15 represents the genetic tool for modification of bacteria, adapted to bacteria of the genus Clostridium, based on the use of two plasmids (cf. WO2017 / 064439, Wasels et al., 2017).
  • Figure 16 represents the Map of the plasmid pCas9ind-gRNA_ca / R.
  • Figure 17 represents the CRISPR / Cas9 system used for genome editing as a genetic tool allowing to create, using the nuclease Cas9, one or more double strand cleavages in F directed genomic DNA (s) by gRNA.
  • GRNA guide RNA
  • PAM Protospacer Adjacent Motif. Figure modified from Jinek et al, 2012.
  • Figure 18 represents the repair by homologous recombination of a double strand cut induced by Cas9.
  • PAM Protospacer Adjacent Motif.
  • Figure 19 shows the use of CRISPR / Cas9 at Clostridium.
  • ermB erythromycin resistance gene
  • catP SEQ ID NO: 70
  • tetR gene whose expression product represses transcription from Pcm-tet02 / l
  • Pcm-2tet01 and Pcm-tet02 / l anhydrotetracycycline-inducible promoters, "aTc” (Dong et al., 2012); miniPthl, constitutive promoter (Dong et al., 2012).
  • Figure 20 shows the map of plasmid pCas9, Cr ( SEQ ID NO: 23).
  • ermB erythromycin resistance gene
  • rep origin of replication in E. coli
  • repH origin of replication in C. acetobutylicum
  • Tthl thiolase terminator
  • miniPthl constitutive promoter
  • Pcm-tet02 / l promoter repressed by the product of tetR and inducible by G anhydrotetracycline, "aTc” (Dong et al., 2012)
  • Pbgal promoter repressed by the lacR product and inducible by lactose (Hartman et al., 2011); acrIIA4, gene encoding the anti-CRISPR protein AcrII14; bgaR, a gene whose expression product represses transcription from Pbgal.
  • Figure 21 represents the relative transformation rate of C. acetobutylicum DSM 792 containing pCas9i nd (SEQ ID NO: 22) or pCas9 aCr (SEQ ID N: 23).
  • the frequencies are expressed in number of transformants obtained per pg of DNA used during the transformation, related to the transformation frequencies of pEC750C (SEQ ID NO: 106), and represent the means of at least two independent experiments.
  • Figure 22 represents the induction of the CRISPR / Cas9 system in transformants of the strain DSM 792 containing pCas9, Cr and a gRNA expression plasmid targeting bdhB, with (SEQ ID NO: 79 and SEQ ID NO: 80) or without (SEQ ID NO: 105) repair matrix.
  • Em erythromycin; Tm, thiamphenicol; aTc, anhydrotetracycline; ND, undiluted.
  • FIG. 23 represents the modification of the bdh locus of C. acetobutylicum DSM792 via the CRISPR / Cas9 system.
  • Figure 23 A represents the genetic organization of the bdh locus. The homologies between the repair matrix and genomic DNA are highlighted using light gray parallelograms. The hybridization sites of primers VI and V2 are also shown.
  • Figure 23B represents the modification of the bdh locus of C. acetobutylicum DSM792 via the CRISPR / Cas9 system.
  • FIG. 23B represents the amplification of the bdh locus using primers VI and V2.
  • FIG. 24 represents the transformation efficiency (in colonies observed per ⁇ g of transformed DNA) for 20 ⁇ g of plasmid pCas9 md in the strain of C. beijerinckii DSM6423.
  • the error bars represent the standard error of the mean for a biological triplicate.
  • FIG. 25 represents the map of the plasmid pNF3.
  • Figure 26 shows the map of plasmid pEC751S.
  • Figure 27 shows the map of plasmid pNF3S.
  • Figure 28 shows the map of plasmid pNF3E.
  • Figure 29 shows the map of plasmid pNF3C.
  • FIG. 30 represents the transformation efficiency (in colonies observed per pg of transformed DNA) of the plasmid pCas9i nd in three strains of C. beijerinckii DSM 6423.
  • the error bars correspond to the standard deviation from the average for a biological duplicate.
  • FIG. 31 represents the transformation efficiency (in colonies observed per pg of transformed DNA) of the plasmid pEC750C in two strains derived from C. beijerinckii DSM 6423.
  • the error bars correspond to the standard deviation from the average for a biological duplicate.
  • Figure 32 represents the transformation efficiency (in colonies observed per pg of transformed DNA) of the plasmids pEC750C, pNF3C, pFWOl and pNF3E in the strain C. beijerinckii IFP963 A catB ApNF2.
  • the error bars correspond to the standard deviation from the mean for a biological triplicate.
  • FIG. 33 represents the efficiency of transformation (in colonies observed per pg of transformed DNA) of the plasmids pFWO1, pNF3E and pNF3S in the strain C. beijerinckii NCIMB 8052.
  • C. acetobutylicum DSM 792 was cultured in 2YTG medium (Tryptone 16 gl 1 , yeast extract 10 gl 1 , glucose 5 gl 1 , NaCl 4 gl 1 ).
  • E. coli NEB10B was cultured in LB medium (Tryptone 10 gl 1 , yeast extract 5 gl 1 , NaCl 5 gl 1 ).
  • Solid media were performed by adding 15 gl 1 agarose liquid environments. Erythromycin (at concentrations of 40 or 500 mg.l 1 respectively in 2YTG or LB medium), chloramphenicol (25 or 12.5 mg.l 1 respectively in solid or liquid LB) and thiamphenicol (15 mg. l 1 in medium 2YTG) were used when necessary.
  • Manipulation of nucleic acids were used when necessary.
  • the plasmid pCas9, Cr (SEQ ID NO: 23), presented in FIG. 20, was constructed by cloning the fragment (SEQ ID NO: 81) containing bgaR and acrIIA4 under the control of the Pbgal promoter synthesized by Eurofins Genomics at the site level Sacl of the vector pCas9 md (Wasels et al, 2017).
  • the plasmid pGRNA md (SEQ ID NO: 82) was constructed by cloning an expression cassette (SEQ ID NO: 83) of a gRNA under the control of the promoter Pcm-2tet01 (Dong et al, 2012) synthesized by Eurofins Genomics at the SacI site of the vector pEC750C (SEQ ID NO: 106) (Wasels et al, 2017).
  • the plasmids pGRNA-xylB (SEQ ID NO: 102), pGRNA-xylR (SEQ ID NO: 103), pGRNA-glcG (SEQ ID NO: 104) and pGRNA-bdhB (SEQ ID NO: 105) were constructed by cloning the respective primer pairs 5'-TCATGATTTCTCCATATTAGCTAG-3 'and 5'-
  • the plasmid pGRNA-D bdhB (SEQ ID NO: 79) was constructed by cloning the DNA fragment obtained by overlapping PCR assembly of the PCR products obtained with the primers 5’- ATGCATGGATCCAAACGAACCCAAAAAGAAAGTTTC-3 ’and 5’-
  • the plasmid pGRNA-AbdhAAbdhB (SEQ ID NO: 80) was constructed by cloning the DNA fragment obtained by overlapping PCR assembly of the PCR products obtained with the primers 5’- ATGCATGGATCCAAACGAACCCAAAAAGAAAGTTTC-3 ’and 5’-
  • C. acetobutylicum DSM 792 was transformed according to the protocol described by Mermelstein et al, 1993.
  • the selection of transformants of C. acetobutylicum DSM 792 already containing an expression plasmid Cas9 (pCas9 md or pCas9 acr ) transformed with a plasmid containing an expression cassette for an gRNA was carried out on solid 2YTG medium containing erythromycin (40 mg.l 1 ), thiamphenicol (15 mg.l 1 ) and lactose (40 nM).
  • the induction of the expression of cas9 was carried out via the growth of the transformants obtained on a solid 2YTG medium containing erythromycin (40 mg.l 1 ), thiamphenicol (15 mg.l 1 ) and the inducing agent cas9 expression and gRNA, aTc (1 mg.l 1 ).
  • Control of the editing of the genome of C. acetobutylicum DSM 792 at the locus of the bdhA and bdhB genes was carried out by PCR using the enzyme Q5® High-Fidelity DNA Polymerase (NEB) using primers VI (5 '- AC AC ATT GA AGGGAGCTTTT-3') and V2 (5'- GGCAACAACATCAGGCCTTT- 3 ').
  • NEB High-Fidelity DNA Polymerase
  • the targeting plasmid containing the bdhB-targeting gRNA expression cassette (pGRNA-bdhB - SEQ ID NO: 105) as well as two derived plasmids containing repair matrices allowing the deletion of the bdhB gene alone (pG RN A-AN /// # - SEQ ID NO: 79) or bdhA and bdhB genes (pGRNA- AbdhAAbdhB - SEQ ID NO: 80) were transformed into strain DSM 792 containing pCas9 md (SEQ ID NO: 22) or pCas9 acr ( SEQ ID NO: 23).
  • Table 2 [Table 2]
  • Transformation frequencies of the DSM 792 strain containing pCas9 md or pCas9 aCr with plasmids targeting bdhB are expressed in number of transformants obtained per pg of DNA used during the transformation, and represent the means of at least two independent experiments.
  • the first plasmid, pCas9i nd contains cas9 under the control of an aTc-inducible promoter
  • the second plasmid derived from pEC750C, contains the cassette for expression of a gRNA (placed under the control of a second promoter inducible to aTc) as well as an editing matrix making it possible to repair the double strand break system-induced.
  • gRNAs still seemed to be too toxic, despite the control of their expression as well as that of Cas9 using promoters inducible to aTc, consequently limiting the efficiency of transformation of bacteria by the genetic tool and therefore the modification of the chromosome.
  • the cas9 expression plasmid was modified, via the insertion of an anti-CRISPR gene, acrIIA4, under the control of a lactose-inducible promoter.
  • the transformation efficiencies of different gRNA expression plasmids have thus been improved very significantly, making it possible to obtain transformants for all the plasmids tested.
  • C. beijerinckii DSM 6423 was cultured in 2YTG medium (Tryptone 16 g L 1 , yeast extract 10 g L 1 , glucose 5 g L 1 , NaCl 4 g L 1 ).
  • E. coli NEB 10-beta and INV 110 were cultured in LB medium (Tryptone 10 g L 1 , yeast extract 5 g L 1 , NaCl 5 g L 1 ).
  • the solid media were produced by adding 15 g L 1 of agarose to the liquid media.
  • Erythromycin at concentrations of 20 or 500 mg L 1 respectively in 2YTG or LB medium
  • chloramphenicol 25 or 12.5 mg L 1 respectively in solid or liquid LB
  • thiamphenicol 15 mg L 1 in 2YTG medium
  • spectinomycin at concentrations of 100 or 650 mg L 1 respectively in LB or 2YTG medium
  • AcatB_fwd T GTT AT GG ATT AT A AGCGGCTCGAGGACGTC A A ACC AT GTT A ATC ATT GC AcatB_rev: AATCTATCACTGATAGGGACTCGAGCAATTTCACCAAAGAATTCGCTAGC AcatB_gRNA_rev
  • RH002 TCTATCTCCAGCTCTAGACCATTATTATTCCTCCAAGTTTGCT
  • RH003 AT A AT GGTCT AGAGCT GGAGAT AGATT ATTT GGT ACT A AG
  • RH004 TATGACCATGATTACGAATTCGAGCTCGAAGCGCTTATTATTGCATTAGC pEX-fwd: C AGATT GT ACT GAGAGT GC ACC
  • RH025 T AGT AT GCCGCC ATT ATT AC GAC A
  • RH 134 GTCGACGTGGAATTGTGAGC
  • pNF2_fwd GGGCGC ACTT AT AC ACC ACC
  • This fragment A catB contains the synthesized DNA fragment A catB cloned into the plasmid pEX-A258.
  • This fragment A catB comprises i) a cassette for expression of a guide RNA targeting the catB gene (chloramphenicol resistance gene coding for a chloramphenicol-O-acetyltransferase - SEQ ID NO: 18) from C. beijerinckii DSM6423 under the control of a promoter inducible to anhydrotetracycline (expression cassette: SEQ ID NO: 19), and ii) an editing matrix (SEQ ID NO: 20) comprising 400 bp homologs located upstream and downstream of the catB gene.
  • a guide RNA targeting the catB gene chloramphenicol resistance gene coding for a chloramphenicol-O-acetyltransferase - SEQ ID NO: 18
  • SEQ ID NO: 19 promoter inducible to anhydrotetracycline
  • Plasmid N ° 3 pCas9acr (cf. Figure 3 and SEQ ID NO: 23)
  • Plasmid N ° 4 pEC750S-wppHR (cf. Figure 4 and SEQ ID NO: 24)
  • SEQ ID NO: 25 a repair matrix used for the deletion of the upp gene and consisting of two homologous DNA fragments upstream and downstream of the upp gene (respective sizes: 500 (SEQ ID NO: 26) and 377 (SEQ ID NO: 27) base pairs).
  • the assembly was obtained using the Gibson cloning system (New England Biolabs, Gibson assembly Master Mix 2X). To do this, the upstream and downstream parts were amplified by PCR from the genomic DNA of the strain DSM 6423 (cf.
  • This plasmid comprises the gRNA-upp DNA fragment corresponding to an expression cassette (SEQ ID NO: 29) of a guide RNA targeting the upp gene (protospacer targeting upp (SEQ ID NO: 31)) under the control of a constitutive promoter (non-coding RNA with sequence SEQ ID NO: 30), inserted into a replication plasmid named pEX-A2.
  • Its base is the plasmid pEC750S- "ppHR (SEQ ID NO: 24) and additionally contains the DNA fragment comprising a cassette for the expression of a guide RNA targeting the upp gene under the control of a constitutive promoter.
  • This fragment was inserted into a pEX-A2, called pEX-A2-gRNA-upp.
  • the insert was then amplified by PCR with the primers pEX-fwd and pEX-rev, then digested with the restriction enzymes Xhol and Ncol. Finally, this fragment was cloned by ligation into pEC750S- "ppHR previously digested with the same restriction enzymes to obtain pEC750S-A" pp.
  • the cassette containing the guide RNA as well as the repair matrix were then amplified with the primers pEC750C-fwd and M13-rev.
  • the amplicon was digested by enzymatic restriction with the enzymes Xhol and Sacl, then cloned by enzymatic ligation in pEC750C to obtain pEC750C-Aupp.
  • This plasmid has pEC750C as its base and contains a cassette for the expression of a guide RNA targeting the plasmid pNF2 (SEQ ID NO: 118).
  • RNA targeting the catB locus amplified by PCR (primers AcatB_fwd and AcatB_gRNA_rev) and cloned in pCas9ind (described in patent application WO2017 / 064439) after digestion of the various DNAs with the restriction enzyme Xhol and ligation.
  • Plasmid N ° 10 pNF3 (cf. Figure 25 and SEQ ID NO: 119) It contains part of pNF2, comprising in particular the origin of replication and a gene coding for a plasmid replication protein (CIBE_p20001), amplified with the primers RH021 and RH022. This PCR product was then cloned at the SalI and BamHI restriction sites in the plasmid pUC19 (SEQ ID NO: 117).
  • pEC750C contains all the elements of pEC750C (SEQ ID NO: 106), except the chloramphenicol catP resistance gene (SEQ ID NO: 70).
  • SEQ ID NO: 70 The latter has been replaced by the aad9 gene from Enterococcus faecalis (SEQ ID NO: 130), which confers resistance to spectinomycin.
  • This element was amplified with the primers aad9-fwd2 and aad9-rev from the plasmid pMTL007S-El (SEQ ID NO: 120) and cloned in the Avall and Hpal sites of pEC750C, in place of the catP gene (SEQ ID NO : 70).
  • the plasmids were introduced and replicated in a strain of E. coli dam dcm (INV 110, Invitrogen). This makes it possible to eliminate the Dam and Dcm type methylations on the plasmid pCas9ind-Aca / B before introducing it by transformation into the strain DSM 6423 according to the protocol described by Mermelstein et al. (1993), with the following modifications: the strain is transformed with a larger quantity of plasmid (20 pg), at an ODeoo of 0.8, and using the following electroporation parameters: 100 W, 25 pF , 1400 V.
  • a clone of the C. beijerinckii DSM 6423 AcatB strain was previously transformed with the vector pCas9 acr which did not show methylation at the levels of the patterns recognized by dam and dcm type methyltransferases (prepared from an Escherichia coli bacterium having the dam dcmj genotype.
  • the verification of the presence of the plasmid pCas9 aCr maintained in the strain C. beijerinckii DSM 6423 was verified by PCR on colony with the primers RH025 and RH 134.
  • a clone resistant to erythromycin was then transformed with pEC750C-Awpp previously demethylated.
  • the colonies thus obtained were selected on medium containing erythromycin (20 pg / mL), thiamphenicol (15 pg / mL) and lactose (40 mM).
  • a clone of the C. beijerinckii DSM 6423 AcatB strain was previously transformed with the vector pCas9 md which does not exhibit methylation at the levels of the patterns recognized by the Dam and Dcm methyltransferases (prepared from an Escherichia coli bacterium having the dam dcm genotype).
  • the presence of the plasmid pCas9 md within the strain C. beijerinckii DSM6423 was verified by PCR with the primers pCas9 md _fwd (SEQ ID NO: 42) and pCas9; nd _rev (SEQ ID NO: 43) (see Figure 13).
  • An erythromycin-resistant clone was then used to transform pGRNA-pNF2, prepared from an Escherichia coli bacterium having the dam dcm genotype.
  • the inventors managed to introduce and maintain different plasmids within the Clostridium beijerinckii DSM 6423 strain. They managed to delete the catB gene using a CRISPR-Cas9 type tool based on the use of a single plasmid. The sensitivity to thiamphenicol of the recombinant strains obtained was confirmed by tests in agar medium.
  • Plasmids prepared in the strain of E. coli NEB 10-beta are also used to transform the strain C. beijerinckii NCIMB 8052.
  • the plasmids are previously introduced and replicated in a strain of E. coli dam dcm (INV110, Invitrogen). This makes it possible to eliminate the Dam and Dcm methylations on the plasmids of interest before introducing them by transformation into the strain DSM 6423.
  • the transformation is otherwise carried out similarly for each strain, that is to say according to the protocol described by Mermelstein et al. 1992, with the following modifications: the strain is transformed with a larger quantity of plasmid (5-20 pg), at a DCLoo of 0.6-0.8, and the electroporation parameters are 100 W, 25 pF, 1400 V. After 3 hours of regeneration in 2YTG, the bacteria are spread on a Petri dish (2YTG agar) containing the desired antibiotic (erythromycin: 20-40 pg / mL; thiamphenicol: 15 pg / mL; spectinomycin: 650 pg / mL). Comparison of transformation efficiencies of C. beijerinckii DSM 6423 strains
  • Transformations were carried out in biological duplicate in the following C. beijerinckii strains: wild DSM 6423, DSM 6423 AcatB and DSM 6423 AcalB ApNF2 ( Figure 30).
  • the vector pCas9 md notably difficult to use for modifying a bacterium because it does not allow good transformation efficiencies, was used. It also contains a gene which confers resistance to erythromycin, an antibiotic to which the three strains are sensitive.
  • the plasmids pNF3E and pNF3C were introduced into the strain C. beijerinckii DSM 6423 AcatB ApNF2.
  • the use of vectors containing genes for resistance to erythromycin or to chloamphenicol makes it possible to compare the transformation efficiency of the vector according to the nature of the resistance gene.
  • the plasmids pFWOl and pEC750C were also transformed. These two plasmids contain genes for resistance to different antibiotics (erythromycin and thiamphenicol respectively) and are commonly used to transform C. beijerinckii and C. acetobutylicum.
  • the vectors based on pNF3 exhibit excellent transformation efficiency, and are in particular usable in C. beijerinckii DSM 6423 AcatB ApNF2.
  • pNF3E which contains a gene for resistance to erythromycin shows a transformation efficiency clearly higher than that of pFWOl, which comprises the same resistance gene.
  • This same plasmid could not be introduced into the wild C. beijerinckii DSM 6423 strain (0 colonies obtained with 5 ⁇ g of plasmids transformed into biological duplicate), which demonstrates the impact of the presence of the natural plasmid pNF2.
  • the inventors carried out a comparative analysis of the transformation efficiencies of the plasmids pFWOl, pNF3E and pNF3S in the strain ABE C. beijerinckii NCIMB 8052 ( Figure 33) .
  • the NCIMB 8052 strain being naturally resistant to thiamphenicol, pNF3S, conferring resistance to spectinomycin, was used in place of pNF3C.
  • the results demonstrate that the strain NCIMB 8052 is transformable with the plasmids based on pNF3, which proves that these vectors are applicable to the species C. beijerinckii in the broad sense.
  • Patent application FR 18/73492 describes the strain D catB as well as the use of a CRISPR / Cas9 system with two plasmids requiring the use of a gene for resistance to erythromycin and a gene for resistance to thiamphenicol.
  • the vector pNF3C was transformed into strain D catB already containing the plasmid pCas9 aCr .
  • the transformation carried out in duplicate, showed a transformation efficiency of 0.625 ⁇ 0.125 colonies / ⁇ g of DNA (mean ⁇ standard error), which proves that a vector based on pNF3C can be used in combination with pCas9, Cr in the strain Aral B.
  • part of the plasmid pNF2 comprising its origin of replication (SEQ ID NO: 118) could be successfully reused to create a new series of shuttle vectors (SEQ ID NO: 119, 123, 124 and 125), customizable, allowing in particular their replication in a strain of E. coli as well as their reintroduction in C. beijerinckii DSM 6423.
  • shuttle vectors SEQ ID NO: 119, 123, 124 and 125
  • These new vectors have advantageous transformation efficiencies for carrying out genetic editing, for example in C. beijerinckii DSM 6423 and its derivatives, in particular using the tool CRISPR / Cas9 comprising two different nucleic acids.
  • PNA Peptide nucleic acids
  • ClosTron mutagenesis in Clostridium refined and streamlined. Journal of microbiological methods, 80 (1), 49-55.
  • ClosTron a universal gene knock-out System for the genus Clostridium. Journal of microbiological methods, 70 (3), 452-464.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Virology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

La présente invention concerne la modification génétique de bactéries du genre Clostridium, typiquement de bactéries solvantogènes du genre Clostridium, en particulier de bactéries possédant à l'état sauvage un gène codant une amphénicol-O-acetyltransférase. Elle concerne ainsi des méthodes, outils et kits permettant une telle modification génétique, en particulier l'élimination ou la modification d'une séquence codant ou contrôlant la transcription d'une amphénicol-O-acetyltransférase, les bactéries génétiquement modifiées obtenues et leurs utilisations, en particulier pour produire un solvant, de préférence à l'échelle industrielle.

Description

DESCRIPTION
Titre : BACTERIES CLOSTRIDIUM GENETIQUEMENT MODIFIEES, PREPARATION ET UTILISATIONS DE CELLES-CI
La présente invention concerne la modification génétique de bactéries du genre Clostridium, typiquement de bactéries solvantogènes du genre Clostridium, en particulier de bactéries possédant à l’état sauvage un gène codant une amphénicol-O-acetyltransférase. Elle concerne ainsi des méthodes, outils et kits permettant une telle modification génétique, en particulier l’élimination ou la modification d’une séquence codant, ou contrôlant la transcription d’une séquence codant, une amphénicol-O- acetyltransférase, les bactéries génétiquement modifiées obtenues et leurs utilisations, en particulier pour produire un solvant, de préférence à l’échelle industrielle.
ARRIERE-PLAN TECHNOLOGIQUE
Le genre Clostridium contient des bactéries à Gram positif, anaérobies strictes et sporulantes, appartenant au phylum des Firmicutes. Les Clostridia sont un groupe d’importance pour la communauté scientifique pour plusieurs raisons. La première est qu’un certain nombre de maladies graves (e.g. tétanos, botulisme) sont dues à des infections de membres pathogènes de cette famille (Gonzales et al., 2014) La deuxième est la possibilité d’utiliser des souches dites acidogènes ou solvantogènes en biotechnologie (John & Wood, 1986, et Moon et al., 2016). Ces Clostridia, non pathogènes, ont naturellement la capacité de transformer une variété importante de sucres pour produire des espèces chimiques d’intérêt, et plus particulièrement de l’acétone, du butanol, et de l’éthanol (John & Wood, 1986) au cours d’un processus fermentaire dit ABE. De manière similaire, la fermentation IBE est possible chez certaines espèces particulières, lors de laquelle l’acétone est réduit en proportion variable en isopropanol (Chen et al., 1986, George et al., 1983) grâce à la présence dans le génome de ces souches de gènes codant des alcool déshydrogénases secondaires (s-ADH ; Ismael et al., 1993, Hiu et al., 1987). Les espèces de Clostridia solvantogènes présentent des similarités phénotypiques importantes, ce qui rendait difficile leur classification avant l’émergence des techniques de séquençage modernes (Rogers et al., 2006). Avec la possibilité de séquencer les génomes complets de ces bactéries, il est aujourd’hui possible de classer ce genre bactérien en 4 espèces majeures : C. acetobutylicum, C. saccharoperbutylacetonicum, C. saccharobutylicum et C. beijerinckii. Une publication récente a permis de classer ces Clostridia solvantogènes en 4 clades principaux après analyse comparative des génomes complets de 30 souches (Figure 1).
Ces groupes séparent notamment les espèces que sont C. acetobutylicum et C. beijerinckii avec comme références respectives C. acetobutylicum ATCC 824 (également désignée DSM 792 ou encore LMG 5710) et C. beijerinckii NCIMB 8052 qui sont les souches modèles pour l’étude de la fermentation de type ABE.
Les souches de Clostridium naturellement capables d’effectuer une fermentation IBE sont peu nombreuses et appartiennent majoritairement à l’espèce Clostridium beijerinckii (cf. Zhang et al. , 2018, Tableau 1). Ces souches sont typiquement sélectionnées parmi les souches C. butylicum LMD 27.6, C. aurantibutylicum NCIB 10659, C. beijerinckii LMD 27.6, C. beijerinckii VPI2968, C. beijerinckii NRRL B-593, C. beijerinckii ATCC 6014, C. beijerinckii McClung 3081, C. isopropylicum IAM 19239, C. beijerinckii DSM 6423, C. sp. A1424, C. beijerinckii optinoii, et C. beijerinckii BGS1.
Il n’existe toutefois à ce jour pas de souche de bactérie Clostridium naturellement capable de produire de l’isopropanol, en particulier naturellement capable d’effectuer une fermentation IBE, qui ait été modifiée génétiquement, en particulier une souche modifiée génétiquement de manière à la rendre sensible à un antibiotique appartenant à la classe des amphénicols tel que le chloramphénicol ou le thiamphénicol, de préférence pour permettre la production optimisée d’isopropanol.
RESUME DE L’INVENTION
Les inventeurs décrivent, dans le contexte de la présente invention et pour la première fois, une bactérie C. beijerinckii génétiquement modifiée, ainsi que les outils permettant une modification génétique de bactéries du genre Clostridium, typiquement de bactéries solvantogènes du genre Clostridium naturellement (i.e. à l’état sauvage) capable de produire de l’isopropanol, en particulier naturellement capables d’effectuer une fermentation IBE, en particulier de bactéries comprenant à l’état sauvage un gène conférant à la bactérie la résistance à un ou plusieurs antibiotiques, en particulier un gène codant une amphénicol-O-acetyltransférase, par exemple une chloramphénicol-O-acetyltransférase ou une thiamphénicol-O-acetyltransferase.
Une bactérie génétiquement modifiée préférée selon l’invention est une bactérie n’exprimant pas une enzyme lui conférant la résistance à un ou plusieurs antibiotiques, en particulier une bactérie n’exprimant pas une amphénicol-O-acetyltransférase, par exemple une bactérie dépourvue du gène catB ou incapable d’exprimer ledit gène.
Une bactérie génétiquement modifiée préférée selon l’invention est la bactérie identifiée dans la présente description en tant que C. beijerinckii DSM 6423 A catB telle qu’enregistrée sous le numéro de dépôt LMG P-31151 (également identifié en tant que Clostridium beijerinckii IFP962 delta catB) auprès de la Belgian Co-ordinated Collections of Micro-organisms (« BCCM », K.L. Ledeganckstraat 35, B-9000 Gent - Belgique) le 6 décembre 2018. La description concerne également toute bactérie dérivée, clone, mutant ou version génétiquement modifiée de celle-ci. Un objet particulier décrit par les inventeurs est un acide nucléique reconnaissant (liant au moins en partie), et de préférence ciblant, i.e. reconnaissant et permettant la coupure, dans le génome d’une bactérie d’intérêt, d’au moins un brin i) d’une séquence codant, ii) d’une séquence contrôlant la transcription d’une séquence codant, ou iii) d’une séquence flanquant la séquence codant, une enzyme permettant à ladite bactérie d’intérêt de croître dans un milieu de culture contenant un antibiotique, typiquement un antibiotique appartenant à la classe des amphénicols, de préférence sélectionné parmi le chloramphénicol, le thiamphénicol, l’azidamfénicol et le florfénicol, typiquement une amphénicol-O- acetyltransférase telle qu’une chloramphénicol-O-acetyltransférase ou une thiamphénicol-O- acetyltransferase
Les inventeurs décrivent aussi l’utilisation d’un tel acide nucléique pour transformer et/ou modifier génétiquement une bactérie du genre Clostridium, de préférence une bactérie du genre Clostridium naturellement capable de produire de l’isopropanol, en particulier une bactérie du genre Clostridium capable d’effectuer une fermentation IBE.
Les inventeurs décrivent en particulier l’utilisation d’un acide nucléique reconnaissant le gène catB de séquence SEQ ID NO : 18 ou une séquence identique à au moins 70% à celle-ci au sein du génome de C. beijerinckii DSM 6423 pour transformer et/ou modifier génétiquement une bactérie C. beijerinckii DSM 6423.
La bactérie capable de produire de l’isopropanol à l’état sauvage peut être par exemple une bactérie sélectionnée parmi une bactérie C. beijerinckii, une bactérie C. diolis, une bactérie C. puniceum, une bactérie C. butyricum, une bactérie C. saccharoperbutylacetonicum, une bactérie C. botulinum, une bactérie C. drakei, une bactérie C. scatologenes , une bactérie C. perfringens, et une bactérie C. tunisiense, de préférence une bactérie sélectionnée parmi une bactérie C. beijerinckii, une bactérie C. diolis, une bactérie C. puniceum et une bactérie C. saccharoperbutylacetonicum. Une bactérie naturellement capable de produire de l’isopropanol particulièrement préférée est une bactérie C. beijerinckii.
Selon un aspect particulier, l’acide nucléique reconnaissant, et de préférence ciblant, i) une séquence codant une amphénicol-O-acetyltransférase, ii) une séquence contrôlant la transcription d’une telle séquence, ou iii) une séquence flanquant une telle séquence, est utilisé pour transformer un sous-clade de C. beijerinckii sélectionné parmi DSM 6423, LMG 7814, LMG 7815, NRRL B-593, NCCB 27006 et un sous-clade présentant au moins 97% d’identité avec la souche DSM 6423.
Les inventeurs décrivent par ailleurs un procédé pour transformer, et de préférence modifier génétiquement, une bactérie du genre Clostridium. Ce procédé comprend une étape de transformation de ladite bactérie par introduction dans cette bactérie d’un acide nucléique reconnaissant, et de préférence ciblant, i) une séquence codant, ii) une séquence contrôlant la transcription d’une séquence codant, ou iii) une séquence flanquant une séquence codant, une enzyme d’intérêt, de préférence une amphénicol-O-acetyltransférase. Ce procédé est typiquement réalisé à l’aide d’un outil de modification génétique, par exemple à l’aide d’un outil de modification génétique sélectionné parmi un outil CRISPR, un outil basé sur l’utilisation d’introns de type II et un outil d’échange allélique. Sont également décrites les bactéries transformées et modifiées génétiquement à l’aide d’un tel procédé, dont la bactérie C. beijerinckii DSM 6423 AcatB est un exemple.
Un autre aspect décrit par les inventeurs concerne l’utilisation d’une bactérie modifiée génétiquement selon l’invention, de préférence de la bactérie C. beijerinckii DSM 6423 AcatB telle qu’enregistrée sous le numéro de dépôt LMG P-31151 , ou d’une version génétiquement modifiée de celle-ci, pour produire un solvant, de préférence l’isopropanol, ou un mélange de solvants, de préférence à l’échelle industrielle.
La description concerne enfin des kits, en particulier un kit comprenant un acide nucléique décrit dans le présent texte et un outil de modification génétique, en particulier un outil de modification génétique sélectionné parmi les éléments d’un outil génétique sélectionné parmi un outil CRISPR, un outil basé sur l’utilisation d’introns de type II et un outil d’échange allélique ; un acide nucléique en tant qu’ARN guide (ARNg) ; un acide nucléique en tant que matrice de réparation ; au moins une paire d’amorces ; et un inducteur permettant l’expression d’une protéine codée par ledit outil.
DESCRIPTION DETAILLEE DE L’INVENTION
Bien qu’utilisées en industrie depuis plus d’un siècle, les connaissances sur les bactéries appartenant au genre Clostridium sont limitées par les difficultés rencontrées pour les modifier génétiquement.
Différents outils génétiques ont été conçus au cours des dernières années pour optimiser les souches de ce genre, la dernière génération étant basée sur l’utilisation de la technologie CRISPR (Clustered Regularly Interspaced Short Palindromie Repeats)/Cas (CRISPR-associated protein). Cette méthode est basée sur l’emploi d’une enzyme appelée nucléase (typiquement une nucléase de type Cas dans le cas de l’outil génétique CRISPR/Cas, telle que la protéine Cas9 de Streptococcus pyogenes), qui va, guidée par une molécule d’ARN, réaliser une coupure double brin au sein d’une molécule d’ADN (séquence cible d’intérêt). La séquence de l’ARN guide (ARNg) déterminera le site de coupure de la nucléase, lui conférant ainsi une très forte spécificité (Figure 17).
Une coupure double brin au sein d’une molécule d’ADN indispensable étant létale pour un organisme, la survie de ce dernier dépendra de sa capacité à la réparer (cf. par exemple Cui & Bikard, 2016). Chez les bactéries du genre Clostridium, la réparation d’une coupure double brin dépend d’un mécanisme de recombinaison homologue nécessitant une copie intacte de la séquence clivée. En fournissant à la bactérie un fragment d’ADN permettant d’effectuer cette réparation tout en modifiant la séquence originelle, il est possible de forcer le micro-organisme à intégrer les changements désirés au sein de son génome. La modification réalisée ne doit plus permettre le ciblage de l’ ADN génomique par le complexe ribonucléoprotéique Cas9-ARNg, via la modification de la séquence cible ou du site PAM (Figure 18). Différentes approches ont été décrites pour tenter de rendre fonctionnel cet outil génétique au sein de bactéries du genre Clostridium. Ces microorganismes sont en effet connus pour être difficiles à modifier génétiquement en raison de leurs faibles fréquences de transformation et de recombinaison homologue. Quelques approches sont basées sur l’emploi de Cas9, exprimée de manière constitutive chez C. beijerinckii et C. ljungdahlii (Wang et al, 2015 ; Huang et al, 2016) ou sous contrôle d’un promoteur inductible chez C. beijerinckii, C. saccharoperbutylacetonicum et C. authoethanogenum (Wang et al, 2016 ; Nagaraju et al, 2016 ; Wang et al, 2017). D’aubes auteurs ont décrit l’utilisation d’une version modifiée de la nucléase, Cas9n, qui réalise des coupures simple brin, au lieu de coupures double brin, au sein du génome (Xu et al, 2015 ; Li et al, 2016). Ce choix est dû aux observations selon lesquelles la toxicité de Cas9 est trop importante pour son utilisation chez des bactéries du genre Clostridium dans les conditions expérimentales testées. La plupart des outils décrits précédemment reposent sur l'utilisation d'un plasmide unique. Enfin, il est également possible d’utiliser des systèmes CRISPR/Cas endogènes lorsqu’ils ont été identifiés au sein du génome du micro-organisme, comme par exemple chez C. pasteurianum (Pyne et al, 2016).
A moins qu'ils n'utilisent (comme dans le dernier cas décrit ci-dessus) la machinerie endogène de la souche à modifier, les outils basés sur la technologie CRISPR présentent l'inconvénient majeur de limiter significativement la taille de l'acide nucléique d'intérêt (et donc le nombre de séquences codantes ou gènes) susceptible d'être inséré dans le génome bactérien (1,8 kb environ au mieux d'après Xu et al. , 2015).
Les inventeurs ont mis au point et décrit un outil génétique plus performant de modification de bactéries, adapté aux bactéries, typiquement aux bactéries appartenant au phylum des Firmicutes, en particulier aux bactéries du genre Clostridium, basé sur l’utilisation de deux acides nucléiques distincts, typiquement de deux plasmides (cf. WO2017064439, Wasels et al., 2017 et Figure 3) qui résout notamment ce problème. Dans un mode de réalisation particulier, le premier acide nucléique de cet outil permet l’expression de cas9 et un deuxième acide nucléique, spécifique de la modification à effectuer, contient une ou plusieurs cassettes d’expression d’ ARNg ainsi qu’une matrice de réparation permettant le remplacement d’une portion de l’ADN bactérien ciblée par Cas9 par une séquence d’intérêt. La toxicité du système est limitée en plaçant cas9 et/ou la (les) cassette(s) d’expression d’ARNg sous conbôle de promoteurs inductibles. Les inventeurs ont récemment amélioré cet outil en permettant d’augmenter très significativement l’efficacité de bansformation et donc l’obtention, en nombre et quantité utile (en particulier dans un contexte de sélection de souches robustes pour une production à l’échelle indusbielle), de bactéries génétiquement modifiées d’intérêt (cf. FR 18/54835). Dans cet outil amélioré au moins un acide nucléique comprend une séquence codant une protéine anti-CRISPR (« acr »), placée sous le contrôle d’un promoteur inductible. Cette protéine anti-CRISPR permet de réprimer l’activité du complexe endonucléase d’ADN/ARN guide. L’expression de la protéine est régulée pour permettre son expression uniquement pendant l’étape de bansformation de la bactérie. Par bactérie appartenant au phylum des Firmicutes on entend, dans le contexte de la présente description, les bactéries appartenant à la classe des Clostridia, Mollicutes, Bacilli ou des Togobacteria, de préférence à la classe des Clostridia ou des Bacilli.
Des bactéries particulières appartenant au phylum des Firmicutes comprennent par exemple les bactéries du genre Clostridium, les bactéries du genre Bacillus ou les bactéries du genre Lactobacillus.
Par « bactérie du genre Bacillus », on entend en particulier B. amyloliquefaciens, B. thurigiensis, B. coagulans, B. cereus, B. anthracis ou encore B. subtilis.
Par « bactérie du genre Clostridium », on entend en particulier les espèces de Clostridium dites d’intérêt industriel, typiquement les bactéries solvantogènes ou acétogènes du genre Clostridium. L’expression « bactérie du genre Clostridium » englobe les bactéries sauvages ainsi que les souches dérivées de celles- ci, modifiées génétiquement dans le but d’améliorer leur performance (par exemple surexprimant les gènes ctfA, ctfB et adc) sans avoir été exposées au système CRISPR.
Par « espèce de Clostridium d’intérêt industriel » on entend les espèces capables de produire, par fermentation, des solvants et des acides tels que l’acide butyrique ou l’acide acétique, à partir de sucres ou d’oses, typiquement à partir de sucres comprenant 5 atomes de carbone tels que le xylose, l’arabinose ou le fructose, de sucres comprenant 6 atomes de carbones tels que le glucose ou le mannose, de polyosides tels que la cellulose ou les hémicelluloses et/ou de toute autre source de carbone assimilable et utilisable par les bactéries du genre Clostridium (CO, CO2, et méthanol par exemple). Des exemples de bactéries solvantogènes d’intérêt sont les bactéries du genre Clostridium productrices d’acétone, de butanol, d’éthanol et/ou d’isopropanol, telles que les souches identifiées dans la littérature en tant que « souche ABE » [souches réalisant des fermentations permettant la production d’acétone, de butanol et d’éthanol] et « souche IBE » [souches réalisant des fermentations permettant la production d’isopropanol (par réduction de l’acétone), de butanol et d’éthanol]. Des bactéries solvantogènes du genre Clostridium peuvent être sélectionnées par exemple parmi C. acetobutylicum, C. cellulolyticum, C. phytofermentans, C. beijerinckii, C. saccharobutylicum, C. saccharoperbutylacetonicum, C. sporogenes, C. butyricum, C. aurantibutyricum et C. tyrobutyricum, de manière préférée parmi C. acetobutylicum, C. beijerinckii, C. butyricum, C. tyrobutyricum et C. cellulolyticum, et de manière encore plus préférée parmi C. acetobutylicum et C. beijerinckii.
Les bactéries du genre Clostridium naturellement productrice d’isopropanol, typiquement possédant dans leur génome un gène adh codant une alcool-déshydrogénase primaire/secondaire qui permet la réduction de l’acétone en isopropanol, se distinguent à la fois génétiquement et fonctionnellement des bactéries capables à l’état naturel d’une fermentation ABE.
Les inventeurs sont avantageusement parvenus, dans le contexte de la présente invention, à modifier génétiquement une bactérie du genre Clostridium naturellement productrice d’isopropanol, la bactérie C. beijerinckii DSM 6423, ainsi que la souche de référence C. acetobutylicum DSM 792. Les inventeurs décrivent ainsi, pour la première fois, une bactérie solvantogène du genre Clostridium naturellement (i.e. à l’état sauvage) capable de produire de l’isopropanol, en particulier naturellement capable d’effectuer une fermentation IBE, qui a été modifiée génétiquement, ainsi que les outils, en particulier les outils génétiques, ayant permis son obtention. Ces outils présentent l’avantage de faciliter considérablement la transformation et la modification génétique des bactéries capables, à l’état sauvage, de produire de l’isopropanol, en particulier d’effectuer une fermentation IBE, en particulier celles porteuses d’un gène codant une enzyme responsable de la résistance à un antibiotique.
Une partie des travaux décrits dans la partie expérimentale ont été réalisés au sein d’une souche capable de fermentation IBE, i.e. la souche C. beijerinckii DSM 6423 dont le génome et une analyse transcriptomique ont été décrits récemment par les inventeurs (Maté de Gerando et al. , 2018).
Lors de G assemblage du génome de cette souche, les inventeurs ont en particulier découvert, en plus du chromosome, la présence d’éléments génétiques mobiles (numéro d’accession PRJEB 11626 - https://www.ebi.ac.uk/ena/data/view/PRJEB11626): deux plasmides naturels (pNFl et pNF2) et un bactériophage linéaire (F6423).
Dans un mode de réalisation particulier de l’invention, les inventeurs sont parvenus à supprimer de la souche C. beijerinckii DSM 6423 son plasmide naturel pNF2.
Dans un autre mode de réalisation particulier, ils sont parvenus à supprimer le gène upp à l’origine présent sur le chromosome de la souche C. beijerinckii DSM 6423. Ces expériences démontrent ainsi rutilisation possible des outils et plus généralement de la technologie décrite dans le présent texte par les inventeurs pour modifier génétiquement une bactérie capable, à l’état sauvage, de produire de l’isopropanol, en particulier d’effectuer une fermentation IBE.
Dans un mode de réalisation particulièrement avantageux, les inventeurs sont en particulier parvenus à rendre sensible à un amphénicol, une bactérie naturellement porteuse (porteuse à l’état sauvage) d’un gène codant une enzyme responsable de la résistance à ces antibiotiques.
Des exemples d’amphénicols d’intérêt dans le contexte de l’invention sont le chloramphénicol, le thiamphénicol, G azidamfénicol et le florfénicol (Schwarz S. et al. , 2004), en particulier le chloramphénicol et le thiamphénicol.
Un premier aspect de l’invention concerne ainsi un outil génétique utilisable pour transformer et/ou modifier génétiquement une bactérie d’intérêt, typiquement une bactérie telle que décrite dans le présent texte appartenant au phylum des Firmicutes, par exemple une bactérie du genre Clostridium, du genre Bacillus ou du genre Lactobacillus, de préférence une bactérie solvantogène du genre Clostridium naturellement (i.e. à l’état sauvage) capable de produire de l’isopropanol, en particulier naturellement capable d’effectuer une fermentation IBE, de préférence une bactérie résistante naturellement à un ou plusieurs antibiotiques, telle qu’une bactérie C. beijerinckii. Une bactérie préférée possède à l’état sauvage à la fois un chromosome bactérien et au moins une molécule d’ADN distincte de l’ADN chromosomique .
Selon un aspect particulier, cet outil génétique consiste en un acide nucléique (également identifié dans le présent texte en tant que « acide nucléique d’intérêt ») reconnaissant (liant au moins en partie), et de préférence ciblant, i.e. reconnaissant et permettant la coupure, dans le génome d’une bactérie d’intérêt, d’au moins un brin i) d’une séquence codant une enzyme permettant à la bactérie d’intérêt de croître dans un milieu de culture contenant un antibiotique vis-à-vis duquel elle lui confère une résistance, ii) d’une séquence contrôlant la transcription d’une séquence codant une enzyme permettant à la bactérie d’intérêt de croître dans un milieu de culture contenant un antibiotique vis-à-vis duquel elle lui confère une résistance, ou iii) d’une séquence flanquant une séquence codant une enzyme permettant à la bactérie d’intérêt de croître dans un milieu de culture contenant un antibiotique vis-à-vis duquel elle lui confère une résistance. Cet acide nucléique d’intérêt est utilisé typiquement dans le contexte de la présente invention pour supprimer la séquence reconnue du génome de la bactérie ou pour modifier son expression, par exemple pour moduler/réguler son expression, en particulier l’inhiber, de préférence pour la modifier de manière à rendre ladite bactérie incapable d’exprimer une protéine, en particulier une protéine fonctionnelle, à partir de ladite séquence. La séquence reconnue est également identifiée dans le présent texte en tant que « séquence cible » ou « séquence ciblée ».
Dans un mode de réalisation particulier, l’acide nucléique d’intérêt comprend au moins une région complémentaire de la séquence cible identique à 100% ou identique à 80% au moins, de préférence à 85%, 90%, 95%, 96%, 97%, 98% ou 99% au moins à la région/portion/séquence d’ADN ciblée au sein du génome bactérien et est capable de s’hybrider à tout ou partie de la séquence complémentaire de ladite région/portion/séquence, typiquement à une séquence comprenant au moins 1 nucléotide, de préférence au moins 1, 2, 3, 4, 5, 10, 14, 15, 20, 25, 30, 35 ou 40 nucléotides, typiquement entre 1, 10 ou 20 et 1000 nucléotides, par exemple entre 1, 10 ou 20 et 900, 800, 700, 600, 500, 400, 300 ou 200 nucléotides, entre 1, 10 ou 20 et 100 nucléotides, entre 1, 10 ou 20 et 50 nucléotides, ou entre 1, 10 ou 20 et 40 nucléotides, par exemple entre 10 et 40 nucléotides, entre 10 et 30 nucléotides, entre 10 et 20 nucléotides, entre 20 et 30 nucléotides, entre 15 et 40 nucléotides, entre 15 et 30 nucléotides ou entre 15 et 20 nucléotides, de préférence à une séquence comprenant 14, 15, 16, 17, 18 ,19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 ou 30 nucléotides. La région complémentaire de la séquence cible présente au sein de l’acide nucléique d’intérêt peut correspondre à la région « SDS » d’un ARN guide (ARNg) utilisé dans un outil CRISPR tel que décrit dans le présent texte.
Dans un aube mode de réalisation particulier, l’acide nucléique d’intérêt comprend au moins deux régions complémentaires chacune d’une séquence cible, identiques à 100% ou identiques à 80% au moins, de préférence à 85%, 90%, 95%, 96%, 97%, 98% ou 99% au moins à ladite région/portion/séquence d’ADN ciblée au sein du génome bactérien. Ces régions sont capables de s’hybrider à tout ou partie de la séquence complémentaire de ladite région/portion/séquence, typiquement à une séquence telle que décrite ci-dessus comprenant au moins 1 nucléotide, de préférence au moins 100 nucléotides, typiquement entre 100 et 1000 nucléotides. Les régions complémentaires de la séquence cible présentes au sein de l’acide nucléique d’intérêt peuvent reconnaître, de préférence cibler, les régions flanquantes en 5’ et en 3’ de la séquence ciblée dans un outil de modification génétique tel que décrit dans le présent texte, par exemple l’outil génétique ClosTron®, l’outil génétique Targetron® ou un outil d’échange allélique type ACE®.
Typiquement, la séquence cible est une séquence codant une amphénicol-O-acetyltransférase, par exemple une chloramphénicol-O-acetyltransférase ou une thiamphénicol-O-acetyltransférase, contrôlant la transcription d’une telle séquence ou flanquant une telle séquence, au sein du génome d’une bactérie d’intérêt du genre Clostridium capable de croître dans un milieu de culture contenant un ou plusieurs antibiotiques appartenant à la classe des amphénicols, par exemple du chloramphénicol et/ou du thiamphénicol.
Dans un mode de réalisation particulier, la séquence reconnue est la séquence SEQ ID NO : 18 correspondant au gène catB (CIBE_3859) codant une chloramphénicol-O-acetyltransférase de C. beijerinckii DSM 6423 ou une séquence d’acides aminés identique à au moins 70%, 75%, 80%, 85%, 90% ou 95% à ladite chloramphénicol-O-acetyltransférase, ou une séquence comprenant tout ou au moins 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% ou 99% de la séquence SEQ ID NO : 18. Autrement formulé, la séquence reconnue peut être une séquence comprenant au moins 1 nucléotide, de préférence au moins 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35 ou 40 nucléotides, typiquement entre 1 et 40 nucléotides, de préférence une séquence comprenant 14, 15, 16, 17, 18 ,19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 ou 30 nucléotides de la séquence SEQ ID NO : 18.
Des exemples de séquences d’acides aminés identique à au moins 70% à la chloramphénicol-O- acetyltransférase codée par la séquence SEQ ID NO : 18 correspondent aux séquences identifiées dans la base de données NCBI sous les références suivantes : WP_077843937.1, SEQ ID NO : 44 (WP_063843219.1), SEQ ID NO : 45 (WP_078116092.1), SEQ ID NO : 46 (WP_077840383.1), SEQ ID NO : 47 (WP_077307770.1), SEQ ID NO : 48 (WP_103699368.1), SEQ ID NO : 49 (WP_087701812.1), SEQ ID NO : 50 (WP_017210112.1), SEQ ID NO : 51 (WP_077831818.1), SEQ ID NO : 52 (WP_012059398.1), SEQ ID NO : 53 (WP_077363893.1), SEQ ID NO : 54 (WP_015393553.1), SEQ ID NO : 55 (WP_023973814.1), SEQ ID NO : 56 (WP_026887895.1), SEQ ID NO 57 (AWK51568.1), SEQ ID NO : 58 (WP_003359882.1), SEQ ID NO : 59 (WP_091687918.1), SEQ ID NO : 60 (WP_055668544.1), SEQ ID NO : 61 (KGK90159.1), SEQ ID NO : 62 (WP_032079033.1), SEQ ID NO : 63 (WP_029163167.1), SEQ ID NO : 64 (WP_017414356.1), SEQ ID NO : 65 (WP_073285202.1), SEQ ID NO : 66 (WP_063843220.1), et SEQ ID NO : 67 ( WP_021281995.1).
Des exemples de séquences d’acides aminés identiques à au moins 75% à la chloramphénicol-O- acetyltransférase codée par la séquence SEQ ID NO : 18 correspondent aux séquences WP_077843937.1, WP 063843219.1, WP_078116092.1, WP_077840383.1, WP_077307770.1 ,
WP_103699368.1, WP_087701812.1, WP_017210112.1, WP_077831818.1, WP_012059398.1,
WP_077363893.1, WP_015393553.1, WP_023973814.1, WP_026887895.1 AWK51568.1,
WP_003359882.1 , WP_091687918.1, WP_055668544.1 et KGK90159.1.
Des exemples de séquences d’acides aminés identiques à au moins 90% à la chloramphénicol-O- acetyltransférase codée par la séquence SEQ ID NO : 18, sont les séquences WP_077843937.1, WP_063843219.1, WP_078116092.1, WP_077840383.1, WP_077307770.1 , WP_103699368.1,
WP_087701812.1, WP_017210112.1, WP_077831818.1, WP_012059398.1, WP_077363893.1,
WP_015393553.1, WP_023973814.1, WP_026887895.1 et AWK51568.1.
Des exemples de séquences d’acides aminés identiques à au moins 95% à la chloramphénicol-O- acetyltransférase codée par la séquence SEQ ID NO : 18 correspondent aux séquences
WP_077843937.1, WP_063843219.1, WP_078116092.1, WP_077840383.1, WP_077307770.1 ,
WP_103699368.1, WP_087701812.1, WP_017210112.1, WP_077831818.1, WP_012059398.1,
WP_077363893.1, WP_015393553.1, WP_023973814.1, et WP_026887895.1.
Des séquences d’acides aminés préférées, identiques à au moins 99% à la chloramphénicol-O- acetyltransférase codée par la séquence SEQ ID NO : 18, sont les séquences WP_077843937.1, SEQ ID NO : 44 (WP_063843219.1) et SEQ ID NO : 45 (WP_078116092.1).
Une séquence particulière identique à la séquence SEQ ID NO : 18 est la séquence identifiée dans la base de données NCBI sous la référence WP_077843937.1.
Dans un mode de réalisation particulier, la séquence cible est la séquence SEQ ID NO : 68 correspondant au gène catQ codant une chloramphénicol-O-acetyltransférase de C. perfringens dont la séquence d’acides aminés correspond à SEQ ID NO : 66 (WP_063843220.1), ou une séquence identique à au moins 70%, 75%, 80%, 85%, 90% ou 95% à ladite chloramphénicol-O-acetyltransférase, ou une séquence comprenant tout ou au moins 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% ou 99% de la séquence SEQ ID NO : 68.
Autrement formulé, la séquence reconnue peut être une séquence comprenant au moins 1 nucléotide, de préférence au moins 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35 ou 40 nucléotides, typiquement entre 1 et 40 nucléotides, de préférence une séquence comprenant 14, 15, 16, 17, 18 ,19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 ou 30 nucléotides de la séquence SEQ ID NO : 68.
Dans encore un autre mode de réalisation particulier, la séquence reconnue est sélectionnée parmi une séquence d’acide nucléique catB (SEQ ID NO : 18), catQ (SEQ ID NO 68), catD (SEQ ID NO : 69, Schwarz S. et al. , 2004) ou catP (SEQ ID NO : 70, Schwarz S. et al. , 2004) connue de l’homme du métier, présente naturellement au sein d’une bactérie du genre Clostridium ou introduite artificiellement dans une telle bactérie. Comme indiqué précédemment, selon un autre mode de réalisation, la séquence cible peut aussi être une séquence contrôlant la transcription d’une séquence codante telle que décrite précédemment (codant une enzyme permettant à la bactérie d’intérêt de croître dans un milieu de culture contenant un antibiotique vis-à-vis duquel elle lui confère une résistance), typiquement une séquence promotrice, par exemple la séquence promotrice (SEQ ID NO : 73) du gène catB ou celle (SEQ ID NO : 74) du gène catQ.
L’acide nucléique d’intérêt, utilisé comme outil génétique, reconnaît alors, et est donc typiquement capable de se lier à une séquence contrôlant la transcription d’une séquence codante telle que décrite précédemment.
Selon un autre mode de réalisation, la séquence cible peut être une séquence flanquant une séquence codante telle que décrite précédemment (codant une enzyme permettant à la bactérie d’intérêt de croître dans un milieu de culture contenant un antibiotique vis-à-vis duquel elle lui confère une résistance), par exemple une séquence flanquant le gène catB de séquence SEQ ID NO : 18 ou une séquence identique à au moins 70% à celle-ci. Une telle séquence flanquante comprend typiquement 1, 10 ou 20 et 1000 nucléotides, par exemple entre 1, 10 ou 20 et 900, 800, 700, 600, 500, 400, 300 ou 200 nucléotides, entre 1, 10 ou 20 et 100 nucléotides, entre 1, 10 ou 20 et 50 nucléotides, ou entre 1, 10 ou 20 et 40 nucléotides, par exemple entre 10 et 40 nucléotides, entre 10 et 30 nucléotides, entre 10 et 20 nucléotides, entre 20 et 30 nucléotides, entre 15 et 40 nucléotides, entre 15 et 30 nucléotides ou entre 15 et 20 nucléotides. Selon un aspect particulier, la séquence cible correspond à la paire de séquences flanquant une telle séquence codante, chaque séquence flanquante comprenant typiquement au moins 20 nucléotides, typiquement entre 100 et 1000 nucléotides, de préférence entre 200 et 800 nucléotides.
Par « acide nucléique », on entend au sens de l’invention, toute molécule d’ADN ou d’ARN naturelle, synthétique, semi-synthétique ou recombinante, éventuellement modifiée chimiquement (i.e. comprenant des bases non naturelles, des nucléotides modifiés comprenant par exemple une liaison modifiée, des bases modifiées et/ou des sucres modifiés), ou optimisée de manière à ce que les codons des transcrits synthétisés à partir des séquences codantes soient les codons les plus fréquemment trouvés chez une bactérie du genre Clostridium en vue de son utilisation chez celle-ci. Dans le cas du genre Clostridium, les codons optimisés sont typiquement des codons riches en bases adénines (« A ») et thymines (« T »).
Dans les séquences peptidiques décrites dans ce document, les acides aminés sont représentés par leur code à une lettre selon la nomenclature suivante : C : cystéine; D : acide aspartique; E : acide glutamique; F : phénylalanine; G : glycine; H : histidine; I : isoleucine; K : lysine; L : leucine ; M : méthionine ; N : asparagine ; P : proline ; Q : glutamine ; R : arginine ; S : sérine ; T : thréonine ; V : valine ; W : tryptophane et Y : tyrosine.
Dans le contexte de la présente invention, l’acide nucléique d’intérêt, utilisé comme outil génétique pour transformer et/ou modifier génétiquement une bactérie d’intérêt, est un fragment d’ADN i) reconnaissant une séquence codant, ii) contrôlant la transcription d’une séquence codant, ou iii) flanquant une séquence codant, une enzyme d’intérêt, de préférence une amphénicol-O- acetyltransférase, par exemple une chloramphénicol-O-acetyltransférase ou une thiamphénicol-O- acetyltransférase, au sein du génome d’une bactérie du genre Clostridium, en particulier d’une bactérie solvantogène du genre Clostridium naturellement capable de produire de l’isopropanol, en particulier naturellement capable d’effectuer une fermentation IBE.
La bactérie capable de produire naturellement de l’isopropanol peut être par exemple une bactérie sélectionnée parmi une bactérie C. beijerinckii, une bactérie C. diolis, une bactérie C. puniceum, une bactérie C. butyricum, une bactérie C. saccharoperbutylacetonicum, une bactérie C. botulinum, une bactérie C. drakei, une bactérie C. scatologenes , une bactérie C. perfringens, et une bactérie C. tunisiense, de préférence une bactérie sélectionnée parmi une bactérie C. beijerinckii, une bactérie C. diolis, une bactérie C. puniceum et une bactérie C. saccharoperbutylacetonicum. Une bactérie capable de produire de l’isopropanol à l’état sauvage particulièrement préférée est une bactérie C. beijerinckii.
Selon un aspect particulier, la bactérie du genre Clostridium est une bactérie C. beijerinckii dont le sous- clade est sélectionnée parmi DSM 6423, LMG 7814, LMG 7815, NCCB 27006 et un sous-clade présentant au moins 90%, 95%, 96%, 97%, 98% ou 99% d’identité avec la souche DSM 6423.
Comme indiqué précédemment, l’acide nucléique d’intérêt selon l’invention est capable de supprimer la séquence (« séquence cible ») reconnue du génome de la bactérie ou de modifier son expression, par exemple de la moduler, en particulier de l’inhiber, de préférence de la modifier de manière à rendre ladite bactérie incapable d’exprimer une protéine, de préférence une amphénicol-O-acetyltransférase, en particulier une protéine fonctionnelle, à partir de ladite séquence.
Cet acide nucléique d’intérêt se présente typiquement sous la forme d’une cassette d’expression (ou «construction») telle que par exemple un acide nucléique comprenant un promoteur transcriptionnel lié de manière opérationnelle (au sens où l’entend l’homme du métier) à une ou plusieurs séquences (codantes) d’intérêt, par exemple un opéron comprenant plusieurs séquences codantes d’intérêt dont les produits d’expression concourent à la réalisation d’une fonction d’intérêt au sein de la bactérie, ou un acide nucléique comprenant en outre une séquence activatrice et/ou un terminateur de transcription ; ou sous la forme d’un vecteur, circulaire ou linéaire, simple ou double brin, par exemple un plasmide, un phage, un cosmide, un chromosome artificiel ou synthétique, comprenant une ou plusieurs cassettes d’expression telles que définies ci-dessus. De manière préférée, le vecteur est un plasmide.
Les acides nucléiques d’intérêt, typiquement les cassettes ou vecteurs, peuvent être construits par des techniques classiques bien connues de l’homme du métier et peuvent comporter un(e) ou plusieurs promoteurs, origines de réplication bactérienne (séquences ORI), séquences de terminaison, gènes de sélection, par exemple gènes de résistance à un antibiotique, et séquence(s) (par exemple « région(s) flanquée(s) ») permettant l’insertion ciblée de la cassette ou du vecteur. Par ailleurs, ces cassettes et vecteurs d’expression peuvent être intégrés au sein du génome par des techniques bien connues de l’homme du métier.
Des séquences ORI d’intérêt peuvent être choisies parmi pIP404, rAMbI, pCB 102, repH (origine de réplication chez C. acetobutylicum), ColEl ou rep (origine de réplication chez E. colï), ou toute autre origine de réplication permettant le maintien du vecteur, typiquement du plasmide, au sein d’une cellule de Clostridium.
Des séquences de terminaison d’intérêt peuvent être choisies parmi celles des gènes adc, thl, de l’opéron bcs, ou de tout autre terminateur, bien connu de l’homme de l’art, permettant l’arrêt de la transcription au sein de Clostridium.
Des gènes de sélection (gènes de résistance) d’intérêt peuvent être choisis parmi ermB, catP, bla, tetA, tetM, et/ou tout autre gène de résistance à l’ampicilline, à l’érythromycine, au chloramphénicol, au thiamphénicol, à la tétracycline ou à tout autre antibiotique pouvant être utilisé pour sélectionner des bactéries du genre Clostridium bien connu de l’homme de l’art.
Dans un mode de réalisation particulier où la séquence reconnue codant une enzyme est une séquence conférant à la bactérie une résistance au chloramphénicol et/ou au thiamphénicol, le gène de sélection utilisé n’est pas un gène de résistance au chloramphénicol et/ou au thiamphénicol, et n’est de préférence aucun des gènes catB, catQ, catD ou catP.
Dans un mode de réalisation particulier, l’acide nucléique d’intérêt comprend un ou plusieurs ARN guides (ARNg) ciblant une séquence (« séquence cible », « séquence ciblée » ou «séquence reconnue») codant, contrôlant la transcription d’une séquence codant, ou flanquant une séquence codant, une enzyme d’intérêt, en particulier une amphénicol-O-acetyltransférase, et/ou une matrice de modification (également identifiée dans le présent texte en tant que « matrice d’édition »), par exemple une matrice permettant d’éliminer ou de modifier tout ou partie de la séquence cible, de préférence dans le but d’inhiber ou supprimer l’expression de la séquence cible, typiquement une matrice comprenant des séquences homologues (correspondant) aux séquences situées en amont et en aval de la séquence cible telles que décrites précédemment, typiquement des séquences (homologues auxdites séquences situées en amont et en aval de la séquence cible) comprenant chacune entre 10 ou 20 paires de base et 1000, 1500 ou 2000 paires de base, par exemple entre 100, 200, 300, 400 ou 500 paires de base et 1000, 1200, 1300, 1400 ou 1500 paires de base, de préférence entre 100 et 1500 ou entre 100 et 1000 paires de bases, et de manière encore plus préférée entre 500 et 1000 paires de base ou entre 200 et 800 paires de base. Un acide nucléique d’intérêt particulier se présente sous la forme d’un vecteur comprenant une ou plusieurs cassettes d’expression, chaque cassette codant au moins un ARN guide (ARNg).
Un outil génétique particulier selon l’invention comprend plusieurs (au moins deux) acides nucléiques d’intérêt tels que décrits précédemment, lesdits acides nucléiques d’intérêt étant différents les uns des autres. Dans un mode de réalisation particulier, l’acide nucléique d’intérêt utilisé comme outil génétique pour transformer et/ou modifier génétiquement une bactérie d’intérêt, typiquement une bactérie du genre Clostridium, est un acide nucléique reconnaissant une séquence codant, une séquence contrôlant la transcription, ou une séquence flanquant, une séquence codant une enzyme conférant à la bactérie la résistance à un ou plusieurs antibiotiques, et capable de supprimer ladite séquence au sein du génome de cette bactérie ou de la rendre non fonctionnelle, en particulier un acide nucléique ne présentant pas de méthylation aux niveaux des motifs reconnus par les méthyltransférases de type Dam et Dcm (préparé à partir d’une bactérie Escherichia coli présentant le génotype dam- dcm-).
Lorsque la bactérie d’intérêt à transformer et/ou modifier génétiquement est une bactérie C. beijerinckii, en particulier appartenant à l’un des sous-clades DSM 6423, LMG 7814, LMG 7815, NRRL B-593 et NCCB 27006, l’acide nucléique d’intérêt utilisé comme outil génétique, par exemple le plasmide, est un acide nucléique ne présentant pas de méthylation aux niveaux des motifs reconnus par les méthyltransférases de type Dam et Dcm, typiquement un acide nucléique dont l’adénosine (« A ») du motif GATC et/ou la deuxième cytosine « C » du motif CCWGG (W pouvant correspondre à une adénosine (« A ») ou à une thymine (« T »)) sont déméthylés.
Un acide nucléique ne présentant pas de méthylation aux niveaux des motifs reconnus par les méthyltransférases de type Dam et Dcm peut typiquement être préparé à partir d’une bactérie Escherichia coli présentant le génotype dam dcm (par exemple Escherichia coli INV 110, Invitrogen). Ce même acide nucléique peut comporter d’autres méthylations réalisées par exemple par des méthyltransférases de type EcoKI, cette dernière visant les adénines (« A ») des motifs AAC(N6)GTGC et GCAC(N6)GTT (N pouvant correspondre à n’importe quel base).
Dans un mode de réalisation préféré, la séquence ciblée correspond à un gène codant une amphénicol- O-acetyltransférase par exemple une chloramphénicol-O-acetyltransférase tel que le gène catB, à une séquence contrôlant la transcription de ce gène, ou à une séquence flanquant ce gène.
Un acide nucléique d’intérêt particulier utilisé comme outil génétique dans le cadre de l’invention est par exemple un vecteur, de préférence un plasmide, par exemple le plasmide pCas9ind-Aca/B de séquence SEQ ID NO : 21 ou le plasmide pCas9ind-gRNA_ca/B de séquence SEQ ID NO : 38 décrit dans la partie expérimentale de la présente description, en particulier une version de ladite séquence ne présentant pas de méthylation au niveau des motifs reconnus par les méthyltransférases de type Dam et Dcm.
La présente description concerne aussi l’utilisation d’un acide nucléique d’intérêt tel que décrit dans le présent texte pour transformer et/ou modifier génétiquement une bactérie d’intérêt, en particulier une bactérie solvantogène du genre Clostridium capable à l’état sauvage de produire de l’isopropanol, en particulier capable à l’état sauvage d’effectuer une fermentation IBE. Une bactérie capable de produire de l’isopropanol à l’état sauvage, en particulier capable d’effectuer une fermentation IBE à l’état sauvage, peut être par exemple une bactérie sélectionnée parmi une bactérie C. beijerinckii, une bactérie C. diolis, une bactérie C. puniceum, une bactérie C. butyricum, une bactérie C. saccharoperbutylacetonicum, une bactérie C. botulinum, une bactérie C. drakei, une bactérie C. scatologenes, une bactérie C. perfringens, et une bactérie C. tunisiense, de préférence une bactérie sélectionnée parmi une bactérie C. beijerinckii, une bactérie C. diolis, une bactérie C. puniceum et une bactérie C. saccharoperbutylacetonicum.
Une bactérie (naturellement) capable de produire de l’isopropanol à l’état sauvage, en particulier capable d’effectuer une fermentation IBE à l’état sauvage, particulièrement préférée est une bactérie C. beijerinckii.
Les bactéries acétogènes d’intérêt sont des bactéries productrices d’acides et/ou de solvants à partir de CO2 et ¾. Des bactéries acétogènes du genre Clostridium peuvent être sélectionnées par exemple parmi C. aceticum, C. thermoaceticum, C. ljungdahlii, C. autoethanogenum, C. difficile, C. scatologenes et C. carboxydivorans .
Dans un mode de réalisation particulier, la bactérie du genre Clostridium concernée est une « souche ABE », de préférence la souche DSM 792 (également désignée souche ATCC 824 ou encore LMG 5710) de C. acetobutylicum, ou la souche NCIMB 8052 de C. beijerinckii.
Dans un autre mode de réalisation particulier, la bactérie du genre Clostridium concernée est une « souche IBE », typiquement l’une des bactéries C. beijerinckii identifiées dans la présente description, par exemple une bactérie C. beijerinckii dont le sous-clade est sélectionnée parmi DSM 6423, LMG 7814, LMG 7815, NRRL B-593, NCCB 27006, ou une bactérie C. aurantibutyricum DSZM 793 (Georges et al. , 1983), et un sous-clade d’une telle bactérie C. beijerinckii ou C. aurantibutyricum présentant au moins 90%, 95%, 96%, 97%, 98% ou 99% d’identité avec la souche DSM 6423. Une bactérie C. beijerinckii, ou un sous-clade de bactérie C. beijerinckii, particulièrement préféré(e) est dépourvu(e) du plasmide pNF2.
Les génomes respectifs des sous-clades LMG 7814, LMG 7815, NRRL B-593 et NCCB 27006 d’une part, et DSZM 793 d’autre part, présentent des pourcentages d’identité de séquence d’au moins 97% avec le génome du sous-clade DSM 6423.
Les inventeurs ont réalisé des tests fermentaires confirmant que les bactéries C. beijerinckii de sous- clade DSM 6423, LMG 7815 et NCCB 27006 sont capables de produire de l’isopropanol à l’état sauvage (cf. tableau 1). [Tableau 1]
Bilan des essais de fermentation de glucose à l’aide des souches naturellement productrices d’isopropanol C. beijerinckii DSM 6423, LMG 7815 et NCCB 27006.
Dans un mode de réalisation particulièrement préféré de l’invention, la bactérie C. beijerinckii est la bactérie de sous-clade DSM 6423.
Dans encore un autre mode de réalisation préféré de l’invention, la bactérie C. beijerinckii est une souche C. beijerinckii IFP963 AcatB ApNF2 (enregistrée le 20 février 2019 sous le numéro de dépôt LMG P- 31277 auprès de la collection BCCM-LMG, et également identifiée dans le présent texte en tant que C. beijerinckii DSM 6423 AcatB ApNF2).
La bactérie destinée à être transformée, et de préférence modifiée génétiquement, est selon un mode de réalisation particulier une bactérie qui a été exposée à une première étape de transformation et à une première étape de modification génétique à l’aide d’un acide nucléique ou outil génétique selon l’invention ayant permis de supprimer au moins une molécule d’ADN extrachromosomique (typiquement au moins un plasmide) naturellement présente au sein de ladite bactérie à l’état sauvage.
Un autre aspect décrit par les inventeurs a trait à un procédé pour transformer, et de préférence en outre modifier génétiquement, une bactérie du genre Clostridium à l’aide d’un outil génétique selon l’invention, typiquement à l’aide d’un acide nucléique d’intérêt selon l’invention tel que décrit plus haut. Ce procédé comprend une étape de transformation de la bactérie par introduction dans ladite bactérie de l’acide nucléique d’intérêt décrit dans le présent texte. Le procédé peut comprendre en outre une étape d’obtention, de récupération, de sélection ou d’isolement de la bactérie transformée, i.e. de la bactérie présentant la ou les recombinaisons/modifications/optimisations recherchées.
Dans un mode de réalisation particulier, le procédé pour transformer, et de préférence modifier génétiquement, une bactérie du genre Clostridium fait intervenir un outil de modification génétique par exemple un outil de modification génétique sélectionné parmi un outil CRISPR, un outil basé sur l’utilisation d’introns de type II (par exemple l’outil Targetron® ou l’outil ClosTron®) et un outil d’échange allélique (par exemple l’outil ACE®), et comprend une étape de transformation de la bactérie par introduction dans ladite bactérie d’un acide nucléique d’intérêt selon l’invention tel que décrit plus haut. La présente invention est typiquement avantageusement mise en œuvre dès lors que l’outil de modification génétique sélectionné pour transformer, et de préférence modifier génétiquement, une bactérie du genre Clostridium, est destiné à être utilisé sur une bactérie telle que C. beijerinckii, porteuse à l’état sauvage d’un gène codant une enzyme responsable de la résistance à un ou plusieurs antibiotiques, et que la mise en œuvre dudit outil génétique comprend une étape de transformation de ladite bactérie à l’aide d’un acide nucléique permettant l’expression d’un marqueur de résistance à un antibiotique auquel cette bactérie est résistante à l’état sauvage et/ou une étape de sélection des bactéries transformées et/ou modifiées génétiquement à l’aide dudit antibiotique (auquel la bactérie est résistante à l’état sauvage).
Une modification avantageusement réalisable grâce à la présente invention, par exemple à l’aide d’un outil de modification génétique sélectionné parmi un outil CRISPR, un outil basé sur l’utilisation d’introns de type II et un outil d’échange allélique, consiste à supprimer une séquence codant une enzyme conférant à la bactérie la résistance à un ou plusieurs antibiotiques, ou à rendre cette séquence non fonctionnelle. Une autre modification avantageusement réalisable grâce à la présente invention consiste à modifier génétiquement une bactérie afin d’améliorer ses performances, par exemple ses performances dans la production d’un solvant ou d’un mélange de solvants d’intérêt, ladite bactérie ayant préalablement déjà été modifiée grâce à l’invention pour la rendre sensible à un antibiotique auquel elle était résistante à l’état sauvage.
Dans un mode de réalisation préféré, le procédé selon l’invention est basé sur l’utilisation de (met en œuvre) la technologie / l’outil génétique CRISPR (Clustered Regularly Interspaced Short Palindromie Repeats), en particulier l’outil génétique CRISPR/Cas (CRISPR-associated protein).
Cette méthode est basée sur l’emploi d’une enzyme appelée nucléase (typiquement une nucléase de type Cas dans le cas de l’outil génétique CRISPR/Cas, telle que la protéine Cas9 (CRISPR-associated protein 9) de Streptococcus pyogenes), qui va, guidée par une molécule d’ARN, réaliser une coupure double brin au sein d’une molécule d’ADN (séquence cible d’intérêt). La séquence de l’ARN guide (ARNg) déterminera le site de coupure de la nucléase, lui conférant ainsi une très forte spécificité. Une coupure double brin au sein d’une molécule d’ADN indispensable à la survie du microorganisme étant de fait létal pour un organisme, la survie de ce dernier dépendra de sa capacité à la réparer (cf. par exemple Cui & Bikard, 2016). Chez les bactéries du genre Clostridium, la réparation d’une coupure double brin dépend d’un mécanisme de recombinaison homologue nécessitant une copie intacte de la séquence clivée. En fournissant à la bactérie un fragment d’ADN permettant d’effectuer cette réparation tout en modifiant la séquence originelle, il est possible de forcer le micro-organisme à intégrer les changements désirés au sein de son génome.
La présente invention peut être mise en œuvre sur une bactérie du genre Clostridium à l’aide d’un outil génétique CRISPR/Cas classique utilisant un unique plasmide comprenant une nucléase, un ARNg et une matrice de réparation tel que décrit par Wang et al. (2015). Le système CRISPR/Cas contient deux éléments essentiels distincts, i.e. i) une endonucléase, dans le cas présent la nucléase associée au système CRISPR, Cas, et ii) un ARN guide. L’ARN guide se présente sous la forme d’un ARN chimérique qui consiste en la combinaison d’un ARN bactérien CRISPR (ARNcr) et d’un ARNtracr ( trans-activating ARN CRISPR). L’ARNg combine la spécificité de ciblage de l’ ARNcr correspondant aux "séquences espaçantes" qui servent de guides aux protéines Cas, et les propriétés conformationnelles de l’ ARNtracr en un transcrit unique. Lorsque l’ ARNg et la protéine Cas sont exprimés simultanément dans la cellule, la séquence génomique cible peut être modifiée de manière permanente grâce à une matrice de réparation fournie. L’homme du métier peut aisément définir la séquence et la structure des ARNg selon la région chromosomique ou l’élément génétique mobile à cibler en utilisant des techniques bien connues (voir par exemple l’article de DiCarlo et al. , 2013).
L’introduction dans la bactérie des éléments (acides nucléiques ou ARNg) de l’outil génétique est réalisée par toute méthode, directe ou indirecte, connue de l’homme du métier, par exemple par transformation, conjugaison, microinjection, transfection, électroporation, etc., de préférence par électroporation (Mermelstein et al, 1993).
Les inventeurs ont récemment mis au point et décrit un outil génétique de modification de bactéries, adapté aux bactéries du genre Clostridium et utilisable dans le contexte de la présente invention, basé sur G utilisation de deux plasmides (cf. WO2017/064439, Wasels et al., 2017, et Figure 15 associée à la présente description).
Dans un mode de réalisation particulier, le « premier » plasmide de cet outil permet l’expression de la nucléase Cas et un « deuxième » plasmide, spécifique de la modification à effectuer, contient une ou plusieurs cassettes d’expression d’ARNg (ciblant typiquement des régions différentes de l’ADN bactérien) ainsi qu’une matrice de réparation permettant, par un mécanisme de recombinaison homologue, le remplacement d’une portion de l’ADN bactérien ciblée par Cas par une séquence d’intérêt. Le gène cas et/ou la (les) cassette(s) d’expression d’ARNg sont placés sous le contrôle de promoteurs d’expression constitutifs ou inductibles, de préférence inductibles, connus de l’homme du métier (par exemple décrits dans la demande WO2017/064439 et incorporés par référence à la présente description), et de préférence différents mais inductibles par le même agent inducteur.
Les ARNg peuvent être des ARN naturels, synthétiques ou produits par des techniques de recombinaison. Ces ARNg peuvent être préparés par toutes méthodes connues de l’homme du métier telles que, par exemple, la synthèse chimique, la transcription in vivo ou des techniques d’ amplification. Lorsque plusieurs ARNg sont utilisés, l’expression de chaque ARNg peut être contrôlée par un promoteur différent. De préférence, le promoteur utilisé est le même pour tous les ARNg. Un même promoteur peut dans un mode de réalisation particulier être utilisé pour permettre l’expression de plusieurs, par exemple de quelques-uns seulement, ou en d’autres termes de tout ou partie, des ARNg destinés à être exprimés.
Dans un autre mode de réalisation particulier, utilisable dans le contexte de la présente invention, ii) au moins l’un desdits « premier » et « deuxième » acides nucléiques code en outre un ou plusieurs ARN guides (ARNg) ou l’outil génétique comprend en outre un ou plusieurs ARN guides, chaque ARN guide comprenant une structure ARN de fixation à G enzyme Cas et une séquence complémentaire de la portion ciblée de l’ADN bactérien, et iii) au moins l’un desdits « premier » et « deuxième » acides nucléiques comprend en outre une séquence codant une protéine anti-CRISPR placée sous le contrôle d’un promoteur inductible, ou l’outil génétique comprend en outre un « troisième » acide nucléique codant une protéine anti-CRISPR placée sous le contrôle d’un promoteur inductible, de préférence différent des promoteurs contrôlant l’expression de Cas et/ou du ou des ARNg et inductible par un aube agent inducteur.
Dans un mode de réalisation préféré, la protéine anti-CRISPR est capable d’inhiber, de préférence neutraliser, l’action de la nucléase, de préférence durant la phase d’introduction des séquences d’acide nucléique de l’outil génétique dans la souche bactérienne d’intérêt.
Un procédé particulier faisant intervenir la technologie CRISPR, susceptible d’être mis en œuvre dans le cadre de la présente invention pour transformer, et typiquement pour modifier génétiquement par recombinaison homologue, une bactérie du genre Clostridium, comprend les étapes suivantes :
a) d’introduction dans la bactérie d’un outil génétique CRISPR décrit par les inventeurs en présence d’un agent inducteur de l’expression d’une protéine anti-CRISPR, et
b) de culture de la bactérie transformée obtenue à l’issue de l’étape a) sur un milieu ne contenant pas (ou dans des conditions n’impliquant pas) l’agent inducteur de l’expression de la protéine anti-CRISPR, permettant typiquement l’expression du complexe ribonucléoprotéique Cas/ ARNg.
Dans un mode de réalisation particulier, le procédé comprend en outre, pendant ou après l’étape b), une étape d’induction de l’expression du ou des promoteurs inductibles contrôlant l’expression de Cas et/ou du ou des ARN guides lorsqu’un tel ou de tels promoteurs sont présents au sein de l’outil génétique, afin de permetbe la modification génétique d’intérêt de la bactérie une fois ledit outil génétique inboduit dans ladite bactérie. L’induction est réalisée à l’aide d’une substance permettant de lever l’inhibition d’expression liée au promoteur inductible sélectionné.
Dans un autre mode de réalisation particulier, le procédé comprend une étape c) additionnelle d’élimination de l’acide nucléique contenant la matrice de réparation (la cellule bactérienne étant alors considérée comme « curée » dudit acide nucléique) et/ou d’élimination du/des ARNs guides ou séquences codant le/les ARNs guides introduits avec l’outil génétique lors de l’étape a).
Dans encore un autre mode de réalisation particulier, le procédé comprend une ou plusieurs étapes additionnelles, postérieure(s) à l’étape b) ou à l’étape c), d’introduction d’un énième, par exemple troisième, quabième, cinquième, etc., acide nucléique contenant une matrice de réparation distincte de celle(s) déjà introduite(s) et d’une ou plusieurs cassettes d’expression d’ARN guides permettant l’intégration de la séquence d’intérêt contenue dans ladite matrice de réparation distincte dans une zone ciblée du génome de la bactérie, en présence d’un agent inducteur de l’expression de la protéine anti- CRISPR, chaque étape additionnelle étant suivie d’une étape de culture de la bactérie ainsi transformée sur un milieu ne contenant pas l’agent inducteur de l’expression de la protéine anti-CRISPR, permettant typiquement l’expression du complexe ribonucléoprotéique Cas/ARNg.
Dans un mode de réalisation particulier du procédé selon l’invention, la bactérie est transformée à l’aide d’un outil CRISPR ou d’un procédé, tels ceux décrits plus haut, utilisant (par exemple codant) une enzyme responsable de la coupure d’au moins un brin de la séquence cible d’intérêt, dans lequel l’enzyme est dans un mode particulier une nucléase, de préférence une nucléase de type Cas, préférentiellement sélectionnée parmi une enzyme Cas9 et une enzyme MAD7. De manière préférée, la séquence cible d’intérêt est une séquence, par exemple le gène catB, codant une enzyme conférant à la bactérie la résistance à un ou plusieurs antibiotiques, de préférence à un ou plusieurs antibiotiques appartenant à la classe des amphénicols, typiquement une amphénicol-O-acetyltransférase telle qu’une chloramphénicol-O-acetyltransférase, une séquence contrôlant la transcription de la séquence codante ou une séquence flanquant ladite séquence codante.
Des exemples de protéines Cas9 utilisables dans la présente invention incluent, sans y être limités, les protéines Cas9 de S. pyogenes (cf. SEQ ID NO : 1 de la demande WO2017/064439 et numéro d’entrée NCBI : WP_010922251.1), Streptococcus thermophilus, Streptococcus mutans, Campylobacter jejuni, Pasteurella multocida, Francisella novicida, Neisseria meningitidis, Neisseria lactamica et Légionella pneumophila (cf. Fonfara et al, 2013 ; Makarova et al, 2015).
La nucléase MAD7 (dont la séquence d’acides aminés correspond à la séquence SEQ ID NO : 72), également identifiée en tant que « Cas 12 » ou « Cpfl », peut autrement être avantageusement utilisée dans le cadre de la présente invention en la combinant avec un ou des ARNg connu(s) de l’homme de métier capable(s) de se lier à une telle nucléase (cf. Garcia-Doval et al. , 2017 et Stella S. et al. , 2017). Selon un aspect particulier, la séquence codant la nucléase MAD7 est une séquence optimisée pour être facilement exprimée dans des souches de Clostridium, de préférence la séquence SEQ ID NO : 71. Lorsqu’elle est utilisée la protéine anti-CRISPR est typiquement une protéine « anti-Cas », i.e. une protéine capable d’inhiber ou d’empêcher/de neutraliser l’action de Cas, et/ou une protéine capable d’inhiber ou d’empêcher/de neutraliser l’action d’un système CRISPR/Cas, par exemple d’un système CRISPR/Cas de type II lorsque la nucléase est une nucléase de type Cas9.
La protéine anti-CRISPR est avantageusement une protéine « anti-Cas9 », par exemple sélectionnée parmi AcrlIAl, AcrIIA2, AcrIIA3, AcrIIA4, AcrIIA5, AcrlICl, AcrIIC2 et AcrIIC3 (Pawluk et al, 2018). De manière préférée la protéine « anti-Cas9 » est AcrIIA2 ou AcrIIA4. Une telle protéine est typiquement capable de limiter très significativement, idéalement d’empêcher, l’action de Cas9, par exemple en se fixant sur l’enzyme Cas9.
Une autre protéine anti-CRISPR avantageusement utilisable est une protéine « anti-MAD7 », par exemple la protéine AcrVAl (Marino et al, 2018). Tout comme la portion d’ADN ciblée (« séquence reconnue »), la matrice d’édition/de réparation peut elle-même comprendre une ou plusieurs séquences d’ acide nucléique ou portions de séquence d’ acide nucléique correspondant à des séquences naturelles et/ou synthétiques, codantes et/ou non codantes. La matrice peut également comprendre une ou plusieurs séquences « étrangères », i.e. naturellement absentes du génome des bactéries appartenant au genre Clostridium ou du génome d’espèces particulières dudit genre. La matrice peut aussi comprendre une combinaison de séquences.
L’outil génétique utilisé dans le cadre de la présente invention permet à la matrice de réparation de guider l’incorporation au sein du génome bactérien d’un acide nucléique d’intérêt, typiquement d’une séquence ou portion de séquence d’ADN comprenant au moins 1 paire de base (pb), de préférence au moins 1, 2, 3, 4, 5, 10, 15, 20, 50, 100, 1 000, 10 000, 100 000 ou 1 000 000 pb, typiquement entre 1 pb et 20 kb, par exemple 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 ou 13 kb, ou entre 1 pb et 10 kb, de préférence entre 10 pb et 10 kb ou entre 1 kb et 10 kb, par exemple entre lpb et 5 kb, entre 2 kb et 5 kb, ou encore entre 2,5 ou 3 kb et 5 kb.
Dans un mode de réalisation particulier, l’expression de la séquence d’ADN d’intérêt permet à la bactérie du genre Clostridium de fermenter (typiquement simultanément) plusieurs sucres différents, par exemple au moins deux sucres différents, typiquement au moins deux sucres différents parmi les sucres comprenant 5 atomes de carbone (tels que le glucose ou le mannose) et/ou parmi les sucres comprenant 6 atomes de carbone (tels que le xylose, l’arabinose ou le fructose), de préférence au moins trois sucres différents, sélectionnés par exemple parmi glucose, xylose et mannose ; glucose, arabinose et mannose ; et glucose xylose et arabinose.
Dans un autre mode de réalisation particulier, la séquence d’ADN d’intérêt code au moins un produit d’intérêt, de préférence un produit favorisant la production de solvant par la bactérie du genre Clostridium, typiquement au moins une protéine d’intérêt, par exemple une enzyme ; une protéine membranaire tel qu’un transporteur ; une protéine de maturation d’autres protéines (protéine chaperonne) ; un facteur de transcription ; ou une combinaison de ceux-ci.
Dans un autre mode de réalisation, le procédé selon l’invention est basé sur l’utilisation d’introns de type II, et met par exemple en œuvre la technologie / l’outil génétique ClosTron® ou l’outil génétique Targetron®.
La technologie Targetron® repose sur l’utilisation d’un intron de groupe II (basé sur l’intron Ll.ltrB de Lactococcus lactis) reprogrammable, capable d’intégrer le génome bactérien rapidement à un locus désiré (Chen et al., 2005, Wang et al., 2013), typiquement dans le but d’inactiver un gène ciblé. Les mécanismes de reconnaissance de la zone éditée ainsi que d’insertion dans le génome par rétro-épissage sont basés sur une homologie entre l’intron et ladite zone d’une part, et sur l’activité d’une protéine (ltrA) d’autre part. La technologie ClosTron® repose sur une approche similaire, complétée par l’ajout d’un marqueur de sélection dans la séquence de l’intron (Heap et al. , 2007). Ce marqueur permet de sélectionner l’intégration de l’intron dans le génome, et facilite donc l’obtention des mutants désirés. Ce système génétique exploite également les introns de type I. En effet, le marqueur de sélection (appelé RAM pour retrotransposition-activated marker) est interrompu par un tel élément génétique, qui empêche son expression depuis le plasmide (une description plus précise du système : Zhong et al.). L’épissage de cet élément génétique se produit avant intégration dans le génome, ce qui permet l’obtention d’un chromosome présentant une forme active du gène de résistance. Une version optimisée du système comprend des sites FLP/FRT en amont et en aval de ce gène, ce qui permet d’utiliser la recombinase FRT pour éliminer le gène de résistance (Heap et al. , 2010).
Dans un autre mode de réalisation, le procédé selon l’invention est basé sur l’utilisation d’un outil d’échange allélique, et met par exemple en œuvre la technologie / l’outil génétique ACE®.
La technologie ACE® repose sur l’utilisation d’un mutant auxotrophe (pour l’uracile chez C. acetobutylicum ATCC 824 par délétion du gène pyrE, qui provoque également une résistance à l’acide 5- fluoroorotique (A-5-FO) ; Heap et al. , 2012). Le système utilise le mécanisme d’échange allélique, bien connu de l’homme de métier. Suite à une transformation avec un vecteur pseudo-suicide (à très faible copies), l’intégration de ce dernier dans le chromosome bactérien par un premier évènement d’échange allélique est sélectionné grâce au gène de résistance présent initialement sur le plasmide. L’étape d’intégration peut être réalisée de deux manières différentes, soit au sein du locus pyrE soit au sein d’un autre locus :
Dans le cas de l’intégration au locus pyrE, le gène pyrE est également placé sur le plasmide, sans toutefois être exprimé (pas de promoteur fonctionnel). La deuxième recombinaison restaure un gène pyrE fonctionnel et peut alors être sélectionnée par auxotrophie (milieu minimum, ne contenant pas d’uracile). Le gène pyrE non-fonctionnel présentant également un caractère sélectionnable (sensibilité au A-5-FO), d’autres intégrations sont ensuite envisageables sur le même modèle, en alternant successivement l’état de pyrE entre fonctionnel et non-fonctionnel.
Dans le cas de l’intégration à un autre locus, une zone génomique permettant une expression du marqueur de contre-sélection après recombinaison est ciblée (typiquement, en opéron après un autre gène, de préférence un gène fortement exprimé). Cette deuxième recombinaison est alors sélectionnée par auxotrophie (milieu minimum ne contenant pas d’uracile).
Dans les modes de réalisation décrits basés sur l’utilisation d’introns de type II, et mettant par exemple en œuvre la technologie / l’outil génétique ClosTron® ou l’outil génétique Targetron®, ou basés sur l’utilisation d’un outil d’échange allélique, et mettant par exemple en œuvre la technologie / l’outil génétique ACE®, la séquence ciblée est de préférence une séquence flanquant la séquence codant une enzyme d’intérêt, de préférence, comme expliqué ci-dessus, une amphénicol-O-acetyltransférase.
Un autre objet de l’invention concerne une bactérie transformée et/ou génétiquement modifiée, typiquement une bactérie du genre Clostridium appartenant à une espèce ou correspondant à l’un des sous-clades décrits par les inventeurs, obtenue à l’aide d’un procédé tel que décrit par les inventeurs dans le présent texte, ainsi que toute bactérie dérivée, clone, mutant ou version génétiquement modifiée de celle-ci.
Une bactérie ainsi transformée et/ou génétiquement modifiée typique de l’invention est une bactérie n’exprimant plus une enzyme lui conférant la résistance à un ou plusieurs antibiotiques, en particulier une bactérie n’exprimant plus une amphénicol-O-acetyltransférase, par exemple une bactérie exprimant à l’état sauvage le gène catB, et dépourvue dudit gène catB ou incapable d’exprimer ledit gène catB une fois transformée et/ou génétiquement modifiée grâce à l’invention. La bactérie ainsi transformée et/ou génétiquement modifiée grâce à l’invention est rendue sensible à un amphénicol, par exemple à un amphénicol tel que décrit dans le présent texte, en particulier au chloramphénicol ou au thiamphénicol. Un exemple particulier de bactérie génétiquement modifiée préférée selon l’invention est la bactérie identifiée dans la présente description en tant que C. beijerinckii DSM 6423 D catB telle qu’enregistrée sous le numéro de dépôt LMG P-31151 auprès de la Belgian Co-ordinated Collections of Micro- organisms (« BCCM », K.L. Ledeganckstraat 35, B-9000 Gent - Belgique) le 6 décembre 2018. La description concerne également toute bactérie dérivée, clone, mutant ou version génétiquement modifiée de ladite bactérie restant sensible à un amphénicol tel que le thiamphénicol et/ou le chloramphénicol. Selon un mode de réalisation particulier, la bactérie transformée et/ou génétiquement modifiée selon l’invention n’exprimant pas une enzyme lui conférant la résistance à un ou plusieurs antibiotiques, en particulier une amphénicol-O-acetyltransférase telle que la chloramphénicol-O-acetyltransférase, par exemple la bactérie C. beijerinckii DSM 6423 D catB, est encore susceptible d’être transformée, et de préférence modifiée génétiquement. Elle peut l’être à l’aide d’un acide nucléique, par exemple d’un plasmide tel que décrit dans la présente description, par exemple dans la partie expérimentale. Un exemple d’acide nucléique susceptible d’être avantageusement utilisé est le plasmide pCas9aCr de séquence SEQ ID NO : 23 (décrit dans la partie expérimentale de la présente description).
Un aspect particulier de l’invention concerne en effet l’utilisation d’une bactérie modifiée génétiquement selon l’invention, de préférence de la bactérie C. beijerinckii DSM 6423 AcatB déposée sous le numéro LMG P-31151 ou d’une version génétiquement modifiée de celle-ci, par exemple à l’aide de l’un des outils génétiques ou procédés décrits dans le présent texte, pour produire, grâce à l’expression du ou des acides nucléiques d’intérêt introduits volontairement dans son génome, un ou plusieurs solvants, de préférence au moins l’isopropanol, de préférence à l’échelle industrielle. L’invention concerne aussi un kit (trousse) comprenant (i) un acide nucléique d’intérêt selon l’invention, typiquement un fragment d’ADN reconnaissant une séquence codant, ou contrôlant la transcription d’une séquence codant, une enzyme d’intérêt dans une bactérie du genre Clostridium, en particulier dans une bactérie capable d’effectuer une fermentation IBE telle que décrite dans le présent texte, et (ii) au moins un outil, de préférence plusieurs outils, sélectionnés parmi les éléments d’un outil de modification génétique permettant de transformer, et typiquement modifier génétiquement une bactérie du genre Clostridium, en vue de produire un variant amélioré de ladite bactérie; un acide nucléique en tant qu’ARNg ; un acide nucléique en tant que matrice de réparation ; au moins une paire d’amorces, par exemple une paire d’ amorces telle que décrite dans le contexte de la présente invention ; et un inducteur permettant l’expression d’une protéine codée par ledit outil, par exemple d’une nucléase de type Cas9 ou MAD7.
L’outil de modification génétique pour transformer, et typiquement modifier génétiquement une bactérie du genre Clostridium, peut-être par exemple sélectionné parmi un outil CRISPR, un outil basé sur l’utilisation d’introns de type II et un outil d’échange allélique, comme expliqué plus haut.
Le kit peut en outre comprendre un ou plusieurs inducteurs adaptés au(x) promoteur(s) inductible(s) sélectionné(s) éventuellement utilisé(s) au sein de l’outil génétique pour contrôler l’expression de la nucléase utilisée et/ou d’un ou de plusieurs ARN guides.
Un kit particulier selon l’invention permet l’expression d’une nucléase comprenant une étiquette (ou «tag»).
Les kits selon l’invention peuvent en outre comprendre un ou plusieurs consommables tels qu’un milieu de culture, au moins une bactérie compétente du genre Clostridium (i.e. conditionnée en vue de la transformation), au moins un ARNg, une nucléase, une ou plusieurs molécules de sélection, ou encore une notice explicative.
La description concerne également l’utilisation d’un kit selon l’invention, ou de l’un ou de plusieurs des éléments de ce kit, pour la mise en œuvre d’un procédé de transformation et idéalement de modification génétique d’une bactérie du genre Clostridium décrit dans le présent texte, et/ou pour la production de solvant(s) ou de biocarburant(s), ou de mélanges de ceux-ci, de préférence à l’échelle industrielle, à l’aide d’une bactérie du genre Clostridium, de préférence d’une bactérie du genre Clostridium naturellement productrice d’isopropanol.
Des solvants susceptibles d’être produits sont typiquement l’acétone, le butanol, l’éthanol, l’isopropanol ou un mélange de ceux-ci, typiquement un mélange éthanol/isopropanol, butanol/isopropanol, ou éthanol/butanol, de préférence un mélange isopropanol/butanol.
L’utilisation de bactéries transformées selon l’invention permet typiquement la production par an à l’échelle industrielle d’au moins 100 tonnes d’acétone, d’au moins 100 tonnes d’éthanol, d’au moins 1000 tonnes d’isopropanol, d’au moins 1800 tonnes de butanol, ou d’au moins 40 000 tonnes d’un mélange de ceux-ci. Les exemples et figures ci-après ont pour but d’illustrer plus pleinement l’invention sans pour autant en limiter la portée.
FIGURES
[Fig 1] La Figure 1 représente le Classement de 30 souches de Clostridium solvantogènes, d’après Poehlein et al., 2017. A noter que le sous-clade C. beijerinckii NRRL B-593 est également identifié dans la littérature en tant que C. beijerinckii DSM 6423.
[Fig 2] La Figure 2 représente la Carte du plasmide pCas9ind-Aca/B
[Fig 3] La Figure 3 représente la Carte du plasmide pCas9acr
[Fig 4] La Figure 4 représente la Carte du plasmide pEC750S-«ppHR
[Fig 5] La Figure 5 représente la Carte du plasmide pEX-A2-gRNA-wpp.
[Fig 6] La Figure 6 représente la Carte du plasmide pEC750S-A«pp.
[Fig 7] La Figure 7 représente la Carte du plasmide pEC750C-A«pp
[Fig 8] La Figure 8 représente la Carte du pGRNA-pNF2
[Fig 9] La Figure 9 représente l’Amplification PCR du gène catB dans les clones issus de la transformation bactérienne de la souche C. beijerinckii DSM 6423.
Amplification d’environ 1,5 kb si la souche possède encore le gène catB, ou d’environ 900 pb si ce gène est délété.
[Fig 10] La Figure 10 représente la Croissance des souches C. beijerinckii DSM6423 WT et Aral B sur milieu 2YTG et milieu sélectif 2YTG thiamphénicol.
[Fig 11] La Figure 11 représente l’Induction du système CRISPR/Cas9acr chez des transformants de la souche C. beijerinckii DSM 6423 contenant pCas9, Cr et un plasmide d’expression de l’ARNg ciblant upp, avec ou sans matrice de réparation. Légende : Em, érythromycine ; Tm, thiamphénicol ; aTc, anhydrotétracycline ; ND, non dilué.
[Fig 12A] La Figure 12 représente la Modification du locus upp de C. beijerinckii DSM 6423 via le système CRISPR/Cas9. La Figure 12A représente l’organisation génétique du locus upp : gènes, site cible de l’ARNg et matrices de réparation, associées aux régions d’homologies correspondantes sur F ADN génomique. Les sites d’hybridation des amorces pour la vérification par PCR (RH010 et RH011) sont également indiqués.
[Fig 12B] La Figure 12 représente la Modification du locus upp de C. beijerinckii DSM 6423 via le système CRISPR/Cas9. La Figure 12B représente l’amplification du locus upp à l’aide des amorces RH010 et RH011. Une amplification de 1680 pb est attendue dans le cas d’un gène sauvage, contre 1090 pb pour un gène upp modifié. M, marqueur de taille 100 bp - 3 kb (Lonza) ; WT, souche sauvage.
[Fig 13] La Figure 13 représente l’Amplification PCR vérifiant la présence du plasmide pCas9ind. dans la souche C. beijerinckii 6423 A catB. [Fig 14] La Figure 14 représente l’Amplification PCR («900 pb) vérifiant la présence ou non du plasmide naturel pNF2 avant induction (contrôle positif 1 et 2) puis après induction sur milieu contenant de l’aTc du système CRISPR-Cas9.
[Fig 15] La Figure 15 représente l’Outil génétique de modification de bactéries, adapté aux bactéries du genre Clostridium, basé sur l’utilisation de deux plasmides (cf. WO2017/064439, Wasels et al. , 2017). [Fig 16] La Figure 16 représente la Carte du plasmide pCas9ind-gRNA_ca/R.
[Fig 17] La Figure 17 représente le système CRISPR/Cas9 utilisé pour l’édition du génome en tant qu’outil génétique permettant de créer, à l’aide de la nucléase Cas9, une ou des coupures double brin dans F ADN génomique dirigée(s) par l’ARNg.
ARNg, ARN guide ; PAM, Protospacer Adjacent Motif. Figure modifiée depuis Jinek et al, 2012.
[Fig 18] La Figure 18 représente la réparation par recombinaison homologue d’une coupure double brin induite par Cas9. PAM, Protospacer Adjacent Motif.
[Fig 19] La Figure 19 représente l’utilisation de CRISPR/Cas9 chez Clostridium.
ermB, gène de résistance à l’érythromycine ; catP (SEQ ID NO : 70), gène de résistance au thiamphénicol/chloramphenicol ; tetR, gène dont le produit d’expression réprime la transcription à partir de Pcm-tet02/l ; Pcm-2tet01 et Pcm-tet02/l , promoteurs inductibles à l’anhydrotétracycycline, « aTc » (Dong et al., 2012) ; miniPthl, promoteur constitutif (Dong et al. , 2012).
[Fig 20] La Figure 20 représente la carte du plasmide pCas9, Cr (SEQ ID NO : 23).
ermB, gène de résistance à l’érythromycine ; rep, origine de réplication chez E. coli ; repH, origine de réplication chez C. acetobutylicum ; Tthl, terminateur thiolase ; miniPthl, promoteur constitutif (Dong et al., 2012) ; Pcm-tet02/l, promoteur réprimé par le produit de tetR et inductible par G anhydrotétracycline, « aTc » (Dong et al. , 2012) ; Pbgal, promoteur réprimé par le produit de lacR et inductible par le lactose (Hartman et al. , 2011) ; acrIIA4, gène codant la protéine anti-CRISPR AcrII14 ; bgaR, gène dont le produit d’expression réprime la transcription à partir de Pbgal.
[Fig 21] La Figure 21 représente le taux de transformation relatifs de C. acetobutylicum DSM 792 contenant pCas9ind (SEQ ID NO : 22) ou pCas9aCr (SEQ ID N : 23). Les fréquences sont exprimées en nombre de transformants obtenus par pg d’ADN utilisé lors de la transformation, rapportées aux fréquences de transformation de pEC750C (SEQ ID NO : 106), et représentent les moyennes d’au moins deux expériences indépendantes.
[Fig 22] La Figure 22 représente l’induction du système CRISPR/Cas9 chez des transformants de la souche DSM 792 contenant pCas9, Cr et un plasmide d’expression de l’ARNg ciblant bdhB, avec (SEQ ID NO : 79 et SEQ ID NO : 80) ou sans (SEQ ID NO : 105) matrice de réparation. Em, érythromycine ; Tm, thiamphénicol ; aTc, anhydrotétracycline ; ND, non dilué.
[Fig 23A] La Figure 23 représente la modification du locus bdh de C. acetobutylicum DSM792 via le système CRISPR/Cas9. La figure 23 A représente l’organisation génétique du locus bdh. Les homologies entre matrice de réparation et ADN génomique sont mises en évidence à l’aide de parallélogrammes gris clair. Les sites d’hybridation des amorces VI et V2 sont également représentés. [Fig 23B] La Figure 23 représente la modification du locus bdh de C. acetobutylicum DSM792 via le système CRISPR/Cas9. La figure 23B représente l’amplification du locus bdh à l’aide des amorces VI et V2. M, marqueur de taille 2-log (NEB) ; P, plasmide pGRNA - bdhA bdhB ; WT, souche sauvage. [Fig. 24] La figure 24 représente l’efficacité de transformation (en colonies observées par pg d’ADN transformé) pour 20 pg de plasmide pCas9md dans la souche de C. beijerinckii DSM6423. Les barres d’erreur représentent l’erreur standard de la moyenne pour un triplicat biologique.
[Fig. 25] La figure 25 représente la carte du plasmide pNF3.
[Fig. 26] La figure 26 représente la carte du plasmide pEC751S.
[Fig. 27] La figure 27 représente la carte du plasmide pNF3S.
[Fig. 28] La figure 28 représente la carte du plasmide pNF3E.
[Fig. 29] La figure 29 représente la carte du plasmide pNF3C.
[Fig. 30] La figure 30 représente l’efficacité de transformation (en colonies observées par pg d’ADN transformé) du plasmide pCas9ind dans trois souches de C. beijerinckii DSM 6423. Les barres d’erreur correspondent à l’écart standard de la moyenne pour un duplicat biologique.
[Fig. 31] La figure 31 représente l’efficacité de transformation (en colonies observées par pg d’ADN transformé) du plasmide pEC750C dans deux souches dérivées de C. beijerinckii DSM 6423. Les barres d’erreur correspondent à l’écart standard de la moyenne pour un duplicat biologique.
[Fig. 32] La figure 32 représente l’efficacité de transformation (en colonies observées par pg d’ADN transformé) des plasmides pEC750C, pNF3C, pFWOl et pNF3E dans la souche C. beijerinckii IFP963 A catB ApNF2. Les barres d’erreur correspondent à l’écart standard de la moyenne pour un triplicat biologique.
[Fig. 33] La figure 33 représente l’efficacité de transformation (en colonies observées par pg d’ADN transformé) des plasmides pFWOl, pNF3E et pNF3S dans la souche C. beijerinckii NCIMB 8052.
EXEMPLES
EXEMPLE n°l
Matériels et méthodes
Conditions de culture
C. acetobutylicum DSM 792 a été cultivée en milieu 2YTG (Tryptone 16 g.l 1, extrait de levure 10 g.l 1, glucose 5 g.l 1, NaCl 4 g.l 1). E. coli NEB10B a été cultivée en milieu LB (Tryptone 10 g.l 1, extrait de levure 5 g.l 1, NaCl 5 g.l 1). Les milieux solides ont été réalisés en ajoutant 15 g.l 1 d’agarose aux milieux liquides. De l’érythromycine (à des concentrations de 40 ou 500 mg.l 1 respectivement en milieu 2YTG ou LB), du chloramphénicol (25 ou 12,5 mg.l 1 respectivement en LB solide ou liquide) et du thiamphénicol (15 mg.l 1 en milieu 2YTG) ont été utilisés lorsque nécessaire. Manipulation des acides nucléiques
Toutes les enzymes et kits utilisés l’ont été en suivant les recommandations des fournisseurs.
Construction des plasmides
Le plasmide pCas9, Cr (SEQ ID NO : 23), présenté en Figure 20, a été construit en clonant le fragment (SEQ ID NO : 81) contenant bgaR et acrIIA4 sous le contrôle du promoteur Pbgal synthétisé par Eurofins Genomics au niveau du site Sacl du vecteur pCas9md (Wasels et al, 2017).
Le plasmide pGRNAmd (SEQ ID NO : 82) a été construit en clonant une cassette d’expression (SEQ ID NO : 83) d’un ARNg sous contrôle du promoteur Pcm-2tet01 (Dong et al, 2012) synthétisée par Eurofins Genomics au niveau du site Sacl du vecteur pEC750C (SEQ ID NO : 106) (Wasels et al, 2017). Les plasmides pGRNA-xylB (SEQ ID NO : 102), pGRNA-xylR (SEQ ID NO : 103), pGRNA-glcG (SEQ ID NO : 104) et pGRNA-bdhB (SEQ ID NO : 105) ont été construits en clonant les couples d’amorces respectifs 5’-TCATGATTTCTCCATATTAGCTAG-3’ et 5’-
AAACCTAGCTAATATGGAGAAATC-3’ , 5’-TCATGTTACACTTGGAACAGGCGT-3’ et 5’- AAACACGCCTGTTCCAAGTGTAAC-3’, 5’-TCATTTCCGGCAGTAGGATCCCCA-3’ et 5’- AAACTGGGGATCCTACTGCCGGAA-3’ , 5’ -TC AT GCTT ATT ACGAC AT A AC AC A-3’ et 5’- AAACTGTGTTATGTCGTAATAAGC-3’ au sein du plasmide pGRNAind (SEQ ID NO : 82) digéré par Bsal.
Le plasmide pGRNA-D bdhB (SEQ ID NO : 79) a été construit en clonant le fragment d’ADN obtenu par assemblage par PCR chevauchante des produits PCR obtenus avec les amorces 5’- ATGCATGGATCCAAACGAACCCAAAAAGAAAGTTTC-3’ et 5’-
GGTT GATTTC A A ATCT GT GT A A ACCT ACCG-3’ d’une part, 5’-
ACACAGATTTGAAATCAACCACTTTAACCC-3’ et 5’-
AT GC AT GT C G ACTCTT A AG A AC AT GT AT A A AGT ATGG- 3’ d’autre part, dans le vecteur pGRNA-bdhB digéré par BamHI et Sacl.
Le plasmide pGRNA-AbdhAAbdhB (SEQ ID NO : 80) a été construit en clonant le fragment d’ADN obtenu par assemblage par PCR chevauchante des produits PCR obtenus avec les amorces 5’- ATGCATGGATCCAAACGAACCCAAAAAGAAAGTTTC-3’ et 5’-
GCT A AGTTTT A A ATCT GT GT A A ACCT ACCG-3’ d’une part, 5’-
AC AC AGATTT A A A ACTT AGC AT ACTTCTT ACC- 3’ et 5’-
ATGCATGTCGACCTTCTAATCTCCTCTACTATTTTAG -3’ d’autre part, dans le vecteur pGRNA- bdhB digéré par BamHI et Sacl.
Transformation
C. acetobutylicum DSM 792 a été transformée selon le protocole décrit par Mermelstein et al, 1993. La sélection de transformants de C. acetobutylicum DSM 792 contenant déjà un plasmide d’expression de Cas9 (pCas9md ou pCas9acr) transformés avec un plasmide contenant une cassette d’expression d’un ARNg a été réalisée sur milieu 2YTG solide contenant de l’érythromycine (40 mg.l 1), du thiamphénicol (15 mg.l 1) et du lactose (40 nM).
Induction de l’expression de cas9
L’induction de l’expression de cas9 a été réalisée via la croissance des transformants obtenus sur un milieu 2YTG solide contenant de l’érythromycine (40 mg.l 1), du thiamphénicol (15 mg.l 1) et l’agent inducteur de l’expression de cas9 et de l’ARNg, l’aTc (1 mg.l 1).
Amplification du locus bdh
Le contrôle de l’édition du génome de C. acetobutylicum DSM 792 au niveau du locus des gènes bdhA et bdhB a été réalisé par PCR à l’aide de l’enzyme Q5® High-Fidelity DNA Polymerase (NEB) à l’aide des amorces VI (5’ - AC AC ATT GA AGGGAGCTTTT-3’ ) et V2 (5’- GGCAACAACATCAGGCCTTT- 3’).
Résultats
Efficacité de transformation
Afin d’évaluer l’impact de l’insertion du gène acrIIA4 sur la fréquence de transformation du plasmide d’expression de cas9, différents plasmides d’expression d’ARNg ont été transformés dans la souche DSM 792 contenant pCas9ind (SEQ ID NO : 22) ou pCas9acr (SEQ ID NO : 23), et les transformants ont été sélectionnés sur un milieu supplémenté en lactose. Les fréquences de transformations obtenues sont présentées en Figure 21.
Génération de mutants AbdhB et AbdhAAbdhB
Le plasmide de ciblage contenant la cassette d’expression de l’ARNg ciblant bdhB (pGRNA-bdhB - SEQ ID NO : 105) ainsi que deux plasmides dérivés contenant des matrices de réparation permettant la délétion du gène bdhB seul (pG R N A-AN///# - SEQ ID NO : 79) ou des gènes bdhA et bdhB (pGRNA- AbdhAAbdhB - SEQ ID NO : 80) ont été transformés dans la souche DSM 792 contenant pCas9md (SEQ ID NO : 22) ou pCas9acr (SEQ ID NO : 23). Les fréquences de transformation obtenues sont présentées dans le Tableau 2 : [Tableau 2]
DSM 792
pCas9md pCas9acr
pEC750C 32,6 ± 27,1 ufc.pg 1 24,9 ± 27,8 ufc.pg 1
pGRNA-bdhB 0 ufc.pg 1 17,0 ± 10,7 ufc.pg 1
pGRNA-AbdliB 0 ufc.pg 1 13,3 ± 4,8 ufc.pg 1
pGRNA -AbdhAAbdhB 0 ufc.pg 1 33,1 ± 13,4 ufc.pg 1
Fréquences de transformation de la souche DSM 792 contenant pCas9md ou pCas9aCr avec des plasmides ciblant bdhB. Les fréquences sont exprimées en nombre de transformants obtenus par pg d’ADN utilisé lors de la transformation, et représentent les moyennes d’au moins deux expériences indépendantes.
Les transformants obtenus ont subi une phase d’induction de l’expression du système CRISPR/Cas9 via un passage sur milieu supplémenté en anhydrotétracycline, aTc (Figure 22).
Les modifications désirées ont été confirmées par PCR sur l’ADN génomique de deux colonies résistantes à l’aTc (Figure 23).
Conclusions
L’outil génétique basé sur CRISPR/Cas9 décrit dans Wasels et al. (2017) utilise deux plasmides :
- le premier plasmide, pCas9ind, contient cas9 sous contrôle d’un promoteur inductible à l’aTc, et
- le deuxième plasmide, dérivé de pEC750C, contient la cassette d’expression d’un ARNg (placé sous le contrôle d’un second promoteur inductible à l’aTc) ainsi qu’une matrice d’édition permettant de réparer la cassure double brin induite par le système.
Cependant, les inventeurs ont observé que certains ARNg semblaient encore être trop toxiques, malgré le contrôle de leur expression ainsi que de celle de Cas9 à l’aide de promoteurs inductibles à l’aTc, limitant en conséquence l’efficacité de transformation des bactéries par l’outil génétique et donc la modification du chromosome.
Afin d’améliorer cet outil génétique, le plasmide d’expression de cas9 a été modifié, via l’insertion d’un gène anti-CRISPR, acrIIA4, sous contrôle d’un promoteur inductible au lactose. Les efficacités de transformation de différents plasmides d’expression d’ARNg ont ainsi pu être améliorées de manière très significative, permettant l’obtention de transformants pour tous les plasmides testés.
Il a également été possible de réaliser l’édition du locus bdhB au sein du génome de C. acetobutylicum DSM 792, à l’aide de plasmides qui n’avaient pas pu être introduits dans la souche DSM 792 contenant pCas9md. Les fréquences de modification observées sont les mêmes que celles observées précédemment (Wasels et al, 2017), avec 100% des colonies testées modifiées. En conclusion, la modification du plasmide d’expression de cas9 permet un meilleur contrôle du complexe ribonucléoprotéique Cas9-ARNg, facilitant avantageusement l’obtention de transformants dans lesquels l’action de Cas9 peut être déclenchée afin d’obtenir des mutants d’intérêt.
EXEMPLE n°2
Matériels et méthodes
Conditions de culture
C. beijerinckii DSM 6423 a été cultivée en milieu 2YTG (Tryptone 16 g L 1, extrait de levure 10 g L 1, glucose 5 g L 1, NaCl 4 g L 1). E. coli NEB 10-beta et INV 110 ont été cultivées en milieu LB (Tryptone 10 g L 1, extrait de levure 5 g L 1, NaCl 5 g L 1). Les milieux solides ont été réalisés en ajoutant 15 g L 1 d’agarose aux milieux liquides. De l’érythromycine (à des concentrations de 20 ou 500 mg L 1 respectivement en milieu 2YTG ou LB), du chloramphénicol (25 ou 12,5 mg L 1 respectivement en LB solide ou liquide) et du thiamphénicol (15 mg L 1 en milieu 2YTG) ou de la spectinomycine (à des concentrations de 100 ou 650 mg L 1 respectivement en milieu LB ou 2YTG) ont été utilisés si nécessaire.
Acides nucléiques et vecteurs plasmidiques
Toutes les enzymes et kits utilisés l’ont été en suivant les recommandations des fournisseurs.
Les tests de PCR sur colonie ont respecté le protocole suivant :
Une colonie isolée de C. beijerinckii DSM 6423 est resuspendue dans 100 pL de Tris 10 mM pH 7,5 EDTA 5 mM. Cette solution est chauffée à 98 °C pendant 10 min sans agitation. 0,5 pL de ce lysat bactérien peuvent alors être utilisés comme matrice de PCR dans des réactions de 10 pL avec la Phire (Thermo Scientifrc), la Phusion (Thermo Scientifrc), la Q5 (NEB) ou la KAPA2G Robust (Sigma- Aldrich) polymerase.
La liste des amorces ayant servies à l’ensemble des constructions (nom/séquence d’ADN) est détaillée ci-dessous :
AcatB_fwd : T GTT AT GG ATT AT A AGCGGCTCGAGGACGTC A A ACC AT GTT A ATC ATT GC AcatB_rev : AATCTATCACTGATAGGGACTCGAGCAATTTCACCAAAGAATTCGCTAGC AcatB_gRNA_rev
AATCTATCACTGATAGGGACTCGAGGGGCAAAAGTGTAAAGACAAGCTTC
RH076 CAT AT A AT A A A AGGA A ACCTCTT GATCG
RH077 ATT GCC AGCCT A AC ACTT GG
RH001 ATCTCCATGGACGCGTGACGTCGACATAAGGTACCAGGAATTAGAGCAGC
RH002 TCTATCTCCAGCTCTAGACCATTATTATTCCTCCAAGTTTGCT RH003 : AT A AT GGTCT AGAGCT GGAGAT AGATT ATTT GGT ACT A AG
RH004 : TATGACCATGATTACGAATTCGAGCTCGAAGCGCTTATTATTGCATTAGC pEX-fwd : C AGATT GT ACT GAGAGT GC ACC
pEX-rev : GT GAGCGG AT A AC A ATTTC AC AC
pEC750C-fwd : CA AT ATTCC AC A AT ATT AT ATT AT A AGCT AGC
M13-rev : C AGGA A AC AGCT AT GAC
RHO 10 : CGGAT ATT GC ATT ACC AGT AGC
RHO 11 : TTATCAATCTCTTACACATGGAGC
RH025 : T AGT AT GCCGCC ATT ATT AC GAC A
RH 134 : GTCGACGTGGAATTGTGAGC
pNF2_fwd : GGGCGC ACTT AT AC ACC ACC
pNF2_rev : T GCT ACGC ACCCCCT A A AGG
RH021 ACTTGGGTCG ACC ACG AT A A A AC A AGGTTTT A AGG
RH022 T ACC AGGG ATCCGT ATT A AT GT A ACT AT GAT ATC A ATTCTT G aad9-fwd2 AT GC AT GGTCCC A AT GA AT AGGTTT AC ACTT ACTTT AGTTTT AT GG aad9-rev AT GCGAGTT A AC A ACTTCT A A A ATCT GATT ACC A ATT AG
RH031 AT GC AT GGATCCC A AT GA AT AGGTTT AC ACTT ACTTT AGTTTT AT GG
RH032 AT GCGAGAGCTC A ACTTCT A A A ATCT GATT ACC A ATT AG
RH 138 AT GC AT GGATCCGTCT GAC AGTT ACC AGGTCC
RH 139 ATGCGAGAGCTCC AATTGTTC AAAAAAATAATGGCGGAG
RH 140
RH141
Les neuf vecteurs plasmidiques suivants ont été préparés :
- Plasmide N°1 : pEX-A258-Aca/R (SEQ ID NO : 17)
Il contient le fragment d’ADN synthétisé A catB cloné dans le plasmide pEX-A258. Ce fragment A catB comprend i) une cassette d’expression d’un ARN guide ciblant le gène catB (gène de résistance au chloramphénicol codant une chloramphénicol-O-acetyltransférase - SEQ ID NO : 18) de C. beijerinckii DSM6423 sous le contrôle d’un promoteur inductible à l’anhydrotetracycline (cassette d’expression : SEQ ID NO : 19), et ii) une matrice d’édition (SEQ ID NO : 20) comprenant 400 pb homologues situées en amont et en aval du gène catB.
- Plasmide N°2 : pCas9ind-A catB (cf. Figure 2 et SEQ ID NO : 21)
Il contient le fragment A catB amplifié par PCR (amorces AcatB_fwd et AcatB_rev) et cloné dans le pCas9ind (décrit dans la demande de brevet WO2017/064439 - SEQ ID NO : 22) après digestion des différents ADN par l’enzyme de restriction Xhol.
- Plasmide N°3 : pCas9acr (cf. Figure 3 et SEQ ID NO : 23) - Plasmide N°4 : pEC750S-wppHR (cf. Figure 4 et SEQ ID NO : 24)
Il contient une matrice de réparation (SEQ ID NO : 25) utilisée pour la délétion du gène upp et constituée par deux fragments d’ADN homologues en amont et en aval du gène upp (tailles respectives : 500 (SEQ ID NO : 26) et 377 (SEQ ID NO : 27) paires de bases). L’assemblage a été obtenu à l’aide du système de clonage Gibson (New England Biolabs, Gibson assembly Master Mix 2X). Pour ce faire, les parties amont et aval ont été amplifiée par PCR à partir de l’ ADN génomique de la souche DSM 6423 (cf. Maté de Gerando et al. , 2018 et numéro d’accession PRJEB 11626 (https://www.ebi.ac.uk/ena/data/view/PRJEB 11626)) à l’aide des amorces respectives RH001 / RH002 et RH003 / RH004. Ces deux fragments ont ensuite été assemblés dans le pEC750S linéarisé au préalable par restriction enzymatique (enzymes de restriction Sali et Sacl).
- Plasmide N°5 : pEX-A2-gRNA-«pp (cf. Figure 5 et SEQ ID NO : 28)
Ce plasmide comprend le fragment d’ADN gRNA-upp correspondant à une cassette d’expression (SEQ ID NO : 29) d’un ARN guide ciblant le gène upp (protospacer ciblant upp (SEQ ID NO :31)) sous le contrôle d’un promoteur constitutif (ARN non codant de séquence SEQ ID NO : 30), inséré dans un plasmide de réplication nommé pEX-A2.
- Plasmide N°6 : pEC750S-A«pp (cf. Figure 6 et SEQ ID NO : 32)
Il possède comme base le plasmide pEC750S-«ppHR (SEQ ID NO : 24) et contient en plus le fragment d’ADN comportant une cassette d’expression d’un ARN guide ciblant le gène upp sous le contrôle d’un promoteur constitutif.
Ce fragment a été inséré dans un pEX-A2, appelé pEX-A2-gRNA-upp. L’insert a ensuite été amplifié par PCR avec les amorces pEX-fwd et pEX-rev, puis digéré avec les enzymes de restriction Xhol et Ncol. Enfin, ce fragment a été cloné par ligation dans le pEC750S-«ppHR préalablement digéré par les mêmes enzymes de restriction pour obtenir le pEC750S-A«pp.
- Plasmide N°7 : pEC750C-Aupp (cf. Figure 7 et SEQ ID NO : 33)
La cassette comportant l’ ARN guide ainsi que la matrice de réparation ont ensuite été amplifiés avec les amorces pEC750C-fwd et M13-rev. L’amplicon a été digéré par restriction enzymatique avec les enzymes Xhol et Sacl, puis cloné par ligation enzymatique dans le pEC750C pour obtenir le pEC750C- Aupp.
- Plasmide N°8 : pGRNA-pNF2 (cf. Figure 8 et SEQ ID NO : 34)
Ce plasmide a comme base pEC750C et contient une cassette d’expression d’un ARN guide ciblant le plasmide pNF2 (SEQ ID NO : 118).
- Plasmide N°9 : pCas9ind-gRNA_ca/B (cf. Figure 16 et SEQ ID NO : 38).
Il contient la séquence codant pour l’ARN guide ciblant le locus catB amplifiée par PCR (amorces AcatB_fwd et AcatB_gRNA_rev) et clonée dans le pCas9ind (décrit dans la demande de brevet WO2017/064439) après digestion des différents ADN par l’enzyme de restriction Xhol et ligation.
- Plasmide N°10 : pNF3 (cf. Figure 25 et SEQ ID NO : 119) Il contient une partie du pNF2, comprenant notamment l’origine de réplication et un gène codant pour une protéine de réplication de plasmide (CIBE_p20001), amplifiée avec les amorces RH021 et RH022. Ce produit de PCR a ensuite été cloné au niveau des sites de restriction Sali et BamHI dans le plasmide pUC19 (SEQ ID NO : 117).
- Plasmide N°l l : pEC751S (cf. Figure 26 et SEQ ID NO : 121)
Il contient tous les éléments du pEC750C (SEQ ID NO : 106), sauf le gène de résistance au chloramphénicol catP (SEQ ID NO : 70). Ce dernier a été remplacé par le gène aad9 d’ Enterococcus faecalis (SEQ ID NO : 130), qui confère une résistance à la spectinomycine. Cet élément a été amplifié avec les amorces aad9-fwd2 et aad9-rev à partir du plasmide pMTL007S-El (SEQ ID NO : 120) et cloné dans les sites Avall et Hpal du pEC750C, à la place du gène catP (SEQ ID NO : 70).
- Plasmide N°12 : pNF3S (cf. Figure 27 et SEQ ID NO : 123)
Il contient tous les éléments du pNF3, avec une insertion du gène aad9 (amplifié avec les amorces RH031 et RH032 à partir du pEC751S) entre les sites BamHI et Sacl.
- Plasmide N°13 : pNF3E (cf. Figure 28 et SEQ ID NO : 124)
Il contient tous les éléments du pNF3, avec une insertion du gène ermB de Clostridium difficile (SEQ ID NO : 131) sous le contrôle du promoteur miniPthl. Cet élément a été amplifié à partir du pFWOl avec les amorces RH138 et RH139 et cloné entre les sites BamHI et Sacl du pNF3E.
- Plasmide N°14 : pNF3C (cf. Figure 29 et SEQ ID NO : 125)
Il contient tous les éléments du pNF3, avec une insertion du gène catP de Clostridium perfringens (SEQ ID NO : 70). Cet élément a été amplifié à partir du pEC750C avec les amorces RH140 et RH141 et cloné entre les sites BamHI et Sacl du pNF3E.
Résultats n°l
Transformation de la souche C. beijerinckii DSM 6423
Les plasmides ont été introduits et répliqués dans une souche de E. coli dam dcm (INV 110, Invitrogen). Ceci permet d’éliminer les méthylations de type Dam et Dcm sur le plasmide pCas9ind-Aca/B avant de l’introduire par transformation dans la souche DSM 6423 selon le protocole décrit par Mermelstein et al. (1993), avec les modifications suivantes : la souche est transformée avec une quantité plus importante de plasmide (20 pg), à une DOeoo de 0,8, et à l’aide des paramètres d’électroporation suivants : 100 W, 25 pF, 1400 V. L’étalement sur boite de Pétri contenant de l’érythromycine (20 pg/mL) a ainsi permis d’obtenir des transformants de C. beijerinckii DSM 6423 contenant le plasmide pCas9ind-Aca/B.
Induction de l’expression de cas9 et obtention de la souche C. beijerinckii DSM 6423 AcatB
Plusieurs colonies résistantes à l’érythromycine ont ensuite été reprises dans 100 pL de milieu de culture (2YTG) puis diluées en série jusqu’ à un facteur de dilution de 104 dans du milieu de culture. Pour chaque colonie, huit pL de chaque dilution ont été déposés sur une boîte de Pétri contenant de l’érythromycine et de l’anhydrotétracycline (200 ng/mL) permettant d’induire l’expression du gène codant la nucléase Cas9.
Après extraction d’ADN génomique, la délétion du gène catB au sein des clones ayant poussés sur cette boite a été vérifiée par PCR, à l’aide des amorces RH076 et RH077 (cf. Figure 9).
Vérification de la sensibilité de la souche C. beijerinckii DSM 6423 D catB au thiamphénicol
Pour s’assurer que la délétion du gène catB confère bien une sensibilité nouvelle au thiamphénicol, des analyses comparatives sur milieu gélosé ont été réalisées. Des précultures de C. beijerinckii DSM 6423 et C. beijerinckii DSM 6423 A catB ont été réalisées sur milieu 2YTG puis 100 pL de ces précultures ont été étalés sur des milieux gélosés 2YTG supplémentée ou non en thiamphénicol à une concentration de 15 mg/L. La figure 10 permet d’observer que seule la souche initiale C. beijerinckii DSM 6423 est capable de pousser sur un milieu supplémenté en thiamphénicol.
Délétion du gène upp par l’outil CRISPR-Cas9 dans la souche C. beijerinckii DSM 6423 AcatB
Un clone de la souche C. beijerinckii DSM 6423 AcatB a été au préalable transformé avec le vecteur pCas9acr ne présentant pas de méthylation aux niveaux des motifs reconnus par les méthyltransférases de type dam et dcm (préparé à partir d’une bactérie Escherichia coli présentant le génotype dam dcmj. La vérification de la présence du plasmide pCas9aCr maintenu dans la souche C. beijerinckii DSM 6423 a été vérifiée par PCR sur colonie avec les amorces RH025 et RH 134.
Un clone résistant à l’érythromycine a ensuite été transformé avec pEC750C-Awpp préalablement déméthylé. Les colonies ainsi obtenues ont été sélectionnées sur du milieu contenant de l’érythromycine (20 pg/mL), du thiamphénicol (15 pg/mL) et du lactose (40 mM).
Plusieurs de ces clones ont ensuite été resuspendus dans 100 pL de milieu de culture (2YTG) puis dilués en série dans du milieu de culture (jusqu’à un facteur de dilution de 104). Cinq pL de chaque dilution ont été déposés sur une boîte de Pétri contenant de l’érythromycine, du thiamphénicol et de l’anhydrotétracycline (200 ng/mL) (cf. Figure 11).
Pour chaque clone, deux colonies résistantes à l’aTc ont été testées par colonie PCR avec des amorces destinées à amplifier le locus upp (cf. Figure 12).
Délétion du plasmide naturel pNF2 par l’outil CRISPR-Cas9 dans la souche C. beijerinckii DSM 6423 AcatB
Un clone de la souche C. beijerinckii DSM 6423 AcatB a été au préalable transformé avec le vecteur pCas9md ne présentant pas de méthylation aux niveaux des motifs reconnus par les méthyltransférases de type Dam et Dcm (préparé à partir d’une bactérie Escherichia coli présentant le génotype dam dcm). La présence du plasmide pCas9md au sein de la souche C. beijerinckii DSM6423 a été vérifiée par PCR avec les amorces pCas9md_fwd (SEQ ID NO : 42) et pCas9;nd _rev (SEQ ID NO : 43) (cf. Figure 13). Un clone résistant à l’érythromycine a ensuite été utilisé pour transformer le pGRNA-pNF2, préparé à partir d’une bactérie Escherichia coli présentant le génotype dam dcm .
Plusieurs colonies obtenues sur du milieu contenant de l’érythromycine (20 pg/mL) et du thiamphénicol (15 pg/mL) ont été resuspendues dans du milieu de culture et diluées en série jusqu’à un facteur de dilution de 104. Huit pL de chaque dilution ont été déposés sur une boîte de Pétri contenant de l’érythromycine, du thiamphénicol et de l’anhydrotétracycline (200 ng/mL) afin d’induire l’expression du système CRISPR/Cas9.
L’absence du plasmide naturel pNF2 a été vérifiée par PCR avec les amorces pNF2_fwd (SEQ ID NO: 39) et pNF2_rev (SEQ ID NO : 40) (cf. Figure 14).
Conclusions
Au cours de ce travail, les inventeurs sont parvenus à introduire et maintenir différents plasmides au sein de la souche Clostridium beijerinckii DSM 6423. Ils sont parvenus à supprimer le gène catB à l’aide d’un outil de type CRISPR-Cas9 basé sur l’utilisation d’un seul plasmide. La sensibilité au thiamphénicol des souches recombinantes obtenues a été confirmée par des tests en milieu gélosé.
Cette délétion leur a permis d’utiliser l’outil CRISPR-Cas9 nécessitant deux plasmides décrit dans la demande de brevet FR1854835. Deux exemples permettant de démontrer l’intérêt de cette application ont été réalisés : la délétion du gène upp et l’élimination d’un plasmide naturel non essentiel pour la souche Clostridium beijerinckii DSM 6423.
Résultats n°2
Transformation des souches de C. beijerinckii
Les plasmides préparés dans la souche d’E. coli NEB 10-beta sont également utilisés pour transformer la souche C. beijerinckii NCIMB 8052. En revanche, pour C. beijerinckii DSM 6423, les plasmides sont préalablement introduits et répliqués dans une souche de E. coli dam dcm (INV110, Invitrogen). Ceci permet d’éliminer les méthylations de type Dam et Dcm sur les plasmides d’intérêt avant de les introduire par transformation dans la souche DSM 6423.
La transformation est autrement réalisée similairement pour chaque souche, c’est-à-dire selon le protocole décrit par Mermelstein et al. 1992, avec les modifications suivantes : la souche est transformée avec une quantité plus importante de plasmide (5-20 pg), à une DCLoo de 0,6-0, 8, et les paramètres d’électroporation sont 100 W, 25 pF, 1400 V. Après 3h de régénération dans du 2YTG, les bactéries sont étalées sur boîte de Pétri (2YTG agar) contenant l’antibiotique souhaité (érythromycine : 20-40 pg/mL ; thiamphénicol : 15 pg/mL ; spectinomycine : 650 pg/mL). Comparaison des efficacités de transformation des souches de C. beijerinckii DSM 6423
Des transformations ont été réalisées en duplicat biologique dans les souches de C. beijerinckii suivantes : DSM 6423 sauvage, DSM 6423 AcatB et DSM 6423 AcalB ApNF2 (Figure 30). Pour cela, le vecteur pCas9md, notablement difficile à utiliser pour modifier une bactérie car ne permettant pas de bonnes efficacités de transformation, a été utilisé. Il comporte de plus un gène conférant à la souche une résistance à l’érythromycine, antibiotique pour lequel les trois souches sont sensibles.
Les résultats indiquent une augmentation de l’efficacité de transformation d’un facteur d’environ 15-20 imputable à la perte du plasmide naturel pNF2.
L’efficacité de transformation a également été testée pour le plasmide pEC750C, qui confère une résistance au thiamphénicol, uniquement dans les souches DSM 6423 AcatB (IFP962 AcalB) et DSM 6423 AcatB ApNF2 (IFP963 AcatB ApNF2), puisque la souche sauvage est résistante à cet antibiotique (Figure 31). Pour ce plasmide, le gain en efficacité de transformation est encore plus flagrant (amélioration d’un facteur d’environ 2000).
Comparaison des efficacités de transformation des plasmides pNF3 avec d’autres plasmides
Afin de déterminer l’efficacité de transformation de plasmides contenant l’origine de réplication du plasmide naturel pNF2, les plasmides pNF3E et pNF3C ont été introduits dans la souche C. beijerinckii DSM 6423 AcatB ApNF2. L’utilisation de vecteurs contenant des gènes de résistance à l’érythromycine ou au chloamphénicol permet de comparer l’efficacité de transformation du vecteur en fonction de la nature du gène de résistance. Les plasmides pFWOl et pEC750C ont également été transformés. Ces deux plasmides contiennent des gènes de résistance à des antibiotiques différents (respectivement l’érythromycine et le thiamphénicol) et sont couramment utilisés pour transformer C. beijerinckii et C. acetobutylicum.
Comme montré dans la Figure 32, les vecteurs basés sur le pNF3 présentent une excellente efficacité de transformation, et sont notamment utilisables chez C. beijerinckii DSM 6423 AcatB ApNF2. En particulier, le pNF3E (qui contient un gène de résistance à l’érythromycine) montre une efficacité de transformation nettement supérieure à celle de pFWOl, qui comprend le même gène de résistance. Ce même plasmide n’a pas pu être introduit dans la souche C. beijerinckii DSM 6423 sauvage (0 colonies obtenues avec 5 pg de plasmides transformés en duplicat biologique), ce qui démontre l’impact de la présence du plasmide naturel pNF2.
Vérification de la transformabilité des plasmides pNF3 dans d’autres souches/espèces
Pour illustrer la possibilité d’utiliser ce nouveau plasmide dans d’autres souches solvantogènes de Clostridium, les inventeurs ont réalisé une analyse comparative des efficacités de transformation des plasmides pFWOl, pNF3E et pNF3S dans la souche ABE C. beijerinckii NCIMB 8052 (Figure 33). La souche NCIMB 8052 étant naturellement résistante au thiamphénicol, le pNF3S, conférant une résistance à la spectinomycine, a été utilisé à la place du pNF3C. Les résultats démontrent que la souche NCIMB 8052 est transformable avec les plasmides basés sur le pNF3, ce qui prouve que ces vecteurs sont applicables à l’espèce C. beijerinckii au sens large.
L’applicabilité de la suite de vecteurs de synthèse basés sur le pNF3 a également été testée dans la souche référence DSM 792 de C. acetobutylicum. Un essai de transformation a ainsi montré la possibilité de transformer cette souche par le plasmide pNF3C (Efficacité de transformation de 3 colonies observées par pg d’ADN transformé contre 120 colonies/pg pour le plasmide pEC750C).
Vérification de la compatibilité des plasmides pNF3 avec l’outil génétique décrit dans la demande FR18/73492
La demande de brevet FR 18/73492 décrit la souche D catB ainsi que l’utilisation d’un système CRISPR/Cas9 à deux plasmides nécessitant l’utilisation d’un gène de résistance à l’érythromycine et d’un gène de résistance au thiamphénicol. Pour démontrer l’intérêt de la nouvelle suite de plasmides pNF3, le vecteur pNF3C a été transformé dans la souche D catB contenant déjà le plasmide pCas9aCr. La transformation, réalisée en duplicat, a montré une efficacité de transformation de 0,625 ± 0,125 colonies/pg d’ADN (moyenne ± erreur standard), ce qui prouve qu’un vecteur basé sur le pNF3C peut être utilisé en combinaison avec le pCas9, Cr dans la souche Aral B.
Parallèlement à ces résultats, une partie du plasmide pNF2 comprenant son origine de réplication (SEQ ID NO : 118) a pu être réutilisée avec succès pour créer une nouvelle suite de vecteurs navettes (SEQ ID NO : 119, 123, 124 et 125), modifiables à façon, permettant notamment leur réplication dans une souche d’E. coli ainsi que leur réintroduction chez C. beijerinckii DSM 6423. Ces nouveaux vecteurs présentent des efficacités de transformation avantageuses pour réaliser de l’édition génétique par exemple chez C. beijerinckii DSM 6423 et ses dérivées, en particulier à l’aide de l’outil CRISPR/Cas9 comprenant deux acides nucléiques différents.
Ces nouveaux vecteurs ont également pu être testés avec succès dans une aube souche de C. beijerinckii (NCIMB 8052), et d’espèce de Clostridium (en particulier C. acetobutylicum), démonbant leur applicabilité dans d’autres organismes du phylum des Firmicutes. Un test est également réalisé sur Bacillus.
Conclusions
Ces résultats démontrent que la suppression du plasmide naturel pNF2 augmente significativement les fréquences de transformation de la bactérie qui le contenait (d’un facteur d’environ 15 pour le pFWOl et d’un facteur d’environ 2000 pour le pEC750C). Ce résultat est particulièrement intéressant dans le cas des bactéries du genre Clostridium, connues pour être difficiles à transformer, et en particulier pour la souche C. beijerinckii DSM 6423 qui souffre naturellement d’une efficacité de transformation faible (inférieure à 5 colonies/pg de plasmide). REFERENCES
- Banerjee, A., Leang, C., Ueki, T., Nevin, K. P., & Lovley, D. R. (2014). Lactose-inducible System for metabolic engineering of Clostridium ljungdahlii. Applied and environmental microbiology, 80(8), 2410-2416.
- Chen J.-S., Hiu S.F. (1986) Acetone-butanol-isopropanol production by Clostridium beijerinckii (synonym, Clostridium butylicum). Biotechnol. Lett. 8:371-376.
- Cui, L., & Bikard, D. (2016). Conséquences of Cas9 cleavage in the chromosome of Escherichia coli. Nucleic acids research, 44(9), 4243-4251.
- Currie, D. H., Herring, C. D., Guss, A. M., Oison, D. G., Hogsett, D. A., & Lynd, L. R. (2013). Functional heterologous expression of an engineered full length CipA from Clostridium thermocellum in Thermoanaerobacterium saccharolyticum. Biotechnology for biofuels, 6(1), 32.
- DiCarlo, J. E., Norville, J. E., Mali, P., Rios, X., Aach, J., & Church, G. M. (2013). Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas Systems. Nucleic acids research, 41(7), 4336-4343.
- Dong, H., Tao, W., Zhang, Y., & Li, Y. (2012). Development of an anhydrotetracycline-inducible gene expression System for solvent-producing Clostridium acetobutylicum: A useful tool for strain engineering. Metabolic engineering, 14(1), 59-67.
- Dong, D., Guo, M., Wang, S., Zhu, Y., Wang, S., Xiong, Z., ... & Huang, Z. (2017). Structural basis of CRISPR-SpyCas9 inhibition by an anti-CRISPR protein. Nature, 546(7658), 436.
- Dupuy, B., Mani, N., Katayama, S., & Sonenshein, A. L. (2005). Transcription activation of a UV- inducible Clostridium perfringens bacteriocin gene by a novel s factor. Molecular microbiology , 55(4), 1196-1206.
- Egholm, M., Buchardt, O., Nielsen, P. E., & Berg, R. H. (1992). Peptide nucleic acids (PNA). Oligonucleotide analogs with an achiral peptide backbone. Journal of the American Chemical Society, 114(5), 1895-1897.
- Fonfara, I., Le Rhun, A., Chylinski, K., Makarova, K. S., Lecrivain, A. L., Bzdrenga, J., ... & Charpentier, E. (2013). Phylogeny of Cas9 détermines functional exchangeability of dual-RNA and Cas9 among orthologous type II CRISPR-Cas Systems. Nucleic acids research, 42(4), 2577-2590.
- Garcia-Doval C, Jinek M. Molecular architectures and mechanisms of Class 2 CRISPR-associated nucleases. Curr Opin Struct Biol. 2017 Dec;47:157-166. doi: 10.1016/j. sbi.2017.10.015 Ajouter au projet Citavi par DOI. Epub 2017 Nov 3. Review.
- George H. A., Johnson J.L., Moore W. E. C., Holdeman, L. V., Chen J. S. (1983) Acetone, Isopropanol, and Butanol Production by Clostridium beijerinckii (syn. Clostridium butylicum ) and Clostridium aurantibutyricum. Appl. Env. Microbiol. 45: 1160-1163.
- Gonzales y Tucker RD, Frazee B. View from the front lines: an emergency medicine perspective on clostridial infections in injection drug users. Anaerobe. 2014 Dec; 30: 108-15. - Hartman, A. H., Liu, H., & Melville, S. B. (2011). Construction and characterization of a lactose- inducible promoter System for controlled gene expression in Clostridium perfringens. Applied and environmental microbiology, 77(2), 471-478.
- Heap, J. T., Ehsaan, M., Cooksley, C. M., Ng, Y. K., Cartman, S. T., Winzer, K., & Minton, N. P. (2012). Intégration of DNA into bacterial chromosomes from plasmids without a counter-selection marker. Nucleic acids research, 40(8), e59-e59.
- Heap, J. T., Kuehne, S. A., Ehsaan, M., Cartman, S. T., Cooksley, C. M., Scott, J. C., & Minton, N. P. (2010). The ClosTron: mutagenesis in Clostridium refined and streamlined. Journal of microbiological methods, 80(1), 49-55.
- Heap, J. T., Pennington, O. J., Cartman, S. T., Carter, G. P., & Minton, N. P. (2007). The ClosTron: a universal gene knock-out System for the genus Clostridium. Journal of microbiological methods, 70(3), 452-464.
- Heap, J. T., Pennington, O. J., Cartman, S. T., & Minton, N. P. (2009). A modular System for Clostridium shuttle plasmids. Journal of microbiological methods, 78(1), 79-85.
- Hidalgo-Cantabrana, C., O’Flaherty, S., & Barrangou, R. (2017). CRISPR-based engineering ofnext- generation lactic acid bacteria. Current opinion in microbiology, 37, 79-87.
- Hiu S. F., Zhu C.-X., Yan R.-T., Chen J.-S. (1987) Butanol-ethanol dehydrogenase and butanol- ethanol-isopropanol dehydrogenase: different alcohol dehydrogenases in two strains of Clostridium beijerinckii (Clostridium butylicum). Appl. Env. Microbiol. 53:697-703.
- Huang, H., Chai, C., Li, N., Rowe, P., Minton, N. P., Yang, S., & Gu, Y. (2016). CRISPR/Cas9-based efficient genome editing in Clostridium ljungdahlii, an autotrophic gas-fermenting bacterium. ACS synthetic biology, 5(12), 1355-1361.
- Huggins, A.S., Bannam, T.L. and Rood, J.I. (1992) Comparative sequence analysis of the catB gene from Clostridium butyricum. Antimicrob. Agents Chemother. 36, 2548-2551.
- Ismaiel A. A., Zhu C.X., Colby G.D., Chen, J. S. (1993). Purification and characterization of a primary- secondary alcohol dehydrogenase from two strains of Clostridium beijerinckii. J. Bacteriol. 175:5097- 5105.
- Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., & Charpentier, E. (2012). A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science, 337(6096), 816-821.
- Jones D.T., Woods D.R. (1986) Acetone-butanol fermentation revisited. Microbiological Reviews 50:484-524.
- Kolek J., Sedlar K., Provaznik I., Patakova P. (2016). Dam and Dcm méthylations prevent gene transfer into Clostridium pasteurianum NRRL B-598: development of methods for electrotransformation, conjugation, and sonoporation. Biotechnol Biofuels. 9: 14. - Li, Q., Chen, J., Minton, N. P., Zhang, Y., Wen, Z., Liu, J., ... & Gu, Y. (2016). CRISPR-based genome editing and expression control Systems in Clostridium acetobutylicum and Clostridium beijerinckii. Biotechnology journal, 11(7), 961-972.
- Makarova, K. S., Haft, D. H., Barrangou, R., Brouns, S. J., Charpentier, E., Horvath, P., ... & Van Der Oost, J. (2011). Evolution and classification of the CRISPR-Cas Systems. Nature Reviews Microbiology, 9(6), 467.
- Makarova, K. S., Wolf, Y. I., Alkhnbashi, O. S., Costa, F., Shah, S. A., Saunders, S. J., ... & Horvath, P. (2015). An updated evolutionary classification of CRISPR-Cas Systems. Nature Reviews Microbiology, 13(11), 722.
- Marino, N. D., Zhang, J. Y., Borges, A. L., Sousa, A. A., Leon, L. M., Rauch, B. J., ... & Bondy- Denomy, J. (2018). Discovery of widespread type I and type V CRISPR-Cas inhibitors. Science, 362(6411), 240-242.
- Maté de Gérando, H., Wasels, F., Bisson, A., Clément, B., Bidard, F., Jourdier E., Lopez-Contreras A., Lopes Ferreira N. (2018). Genome and transcriptome of the natural isopropanol producer Clostridium beijerinckii DSM 6423. BMC genomics. 19:242.
- Mearls, E. B., Oison, D. G., Herring, C. D., & Lynd, L. R. (2015). Development of a regulatable plasmid-based gene expression System for Clostridium thermocellum. Applied microbiology and biotechnology, 99(18), 7589-7599.
- Mermelstein L.D., Welker N.E., Bennett G.N., Papoutsakis E.T. (1993). Expression of cloned homologous fermentative genes in Clostridium acetobutylicum ATCC 824 10: 190-195.
- Mermelstein L.D., Welker N.E., Bennett G.N., Papoutsakis E.T. (1993). Expression of cloned homologous fermentative genes in Clostridium acetobutylicum ATCC 824 10: 190-195.
- Moon HG, Jang YS, Cho C, Lee J, Binkley R, Lee S Y. One hundred years of clostridial butanol fermentation. FEMS Microbiol Lett. 2016 Feb;363(3).
- Nagaraju, S., Davies, N. K., Walker, D. J. F., Kôpke, M., & Simpson, S. D. (2016). Genome editing of Clostridium autoethanogenum using CRISPR/Cas9. Biotechnology for biofuels, 9(1), 219.
- Nariya, H., Miyata, S., Kuwahara, T., & Okabe, A. (2011). Development and characterization of a xylose-inducible gene expression System for Clostridium perfringens. Applied and environmental microbiology, 77(23), 8439-8441.
- Newcomb, M., Millen, J., Chen, C. Y., & Wu, J. D. (2011). Co-transcription of the ce IC gene cluster in Clostridium thermocellum. Applied microbiology and biotechnology, 90(2), 625-634.
- Pawluk, A., Davidson, A. R., & Maxwell, K. L. (2018). Anti-CRISPR: Discovery, mechanism and function. Nature Reviews Microbiology, 16(1), 12
- Poehlein A., Solano J.D.M., Flitsch S. K., Krabben P., Winzer K., Reid S.J., Jones D.T., Green E., Minton N.P., Daniel R., Dürre P. (2017). Microbial solvent formation revisited by comparative genome analysis. Biotechnol Biofuels. 10:58. - Pyne, M. E., Bruder, M. R., Moo-Young, M., Chung, D. A., & Chou, C. P. (2016). Harnessing heterologous and endogenous CRISPR-Cas machineries for efficient markerless genome editing in Clostridium. Scientific reports, 6.
- Rauch, B. J., Silvis, M. R., Hultquist, J. F., Waters, C. S., McGregor, M. J., Krogan, N. J., & Bondy- Denomy, J. (2017). Inhibition of CRISPR-Cas9 with bactériophage proteins. Cell, 168(1-2), 150-158.
- Rajewska M., Wegrzyn K, Konieczny I., FEMS Microbiol Rev. 2012 Mar; 36(2). AT-rich région and repeated sequences - the essential éléments of réplication origins ofbacterial replicons :408-34.
- Ransom, E. M., Ellermeier, C. D., & Weiss, D. S. (2015). Use of mCherry red fluorescent protein for studies of protein localization and gene expression in Clostridium difficile. Applied and environmental microbiology, 81(5), 1652-1660.
- Rogers P., Chen J.-S., Zidwick M. (2006) in The prokaryotes. 3rd édition, Vol. 1, edited by Dworkin M (Springer, New York, USA, 2006). 3rd édition, Vol. 1, pp. 672-755.
- Schwarz S, Kehrenberg C, Doublet B, Cloeckaert A. Molecular basis of bacterial résistance to chloramphénicol and florfenicol. FEMS Microbiol Rev. 2004 Nov;28(5):519-42.
- Stella S, Alcôn P, Montoya G. Class 2 CRISPR-Cas RNA-guided endonucleases: Swiss Army knives of genome editing. Nat Struct Mol Biol. 2017 Nov;24(l l):882-892. doi: 10.1038/nsmb.3486
- Wang, S., Dong, S., Wang, P., Tao, Y., & Wang, Y. (2017). Genome Editing in Clostridium saccharoperbutylacetonicum NI -4 with the CRISPR-Cas9 System. Applied and Environmental Microbiology, 83(10), e00233-17.
- Wang Y, Li X, Milne CB, et al. Development of a gene knockout System using mobile group II introns (Targetron) and genetic disruption of acid production pathways in Clostridium beijerinckii. Appl Environ Microbiol. 2013; 79(19): 5853-63.
- Wang, Y. et al. Markerless chromosomal gene délétion in Clostridium beijerinckii using CRISPR/Cas9 System. J. Biotechnol.2015. 200: 1-5.
- Wang, Y., Zhang, Z. T., Seo, S. O., Lynn, P., Lu, T., Jin, Y. S., & Blaschek, H. P. (2016). Bacterial genome editing with CRISPR-Cas9: délétion, Intégration, single nucléotide modification, and désirable “clean” mutant sélection in Clostridium beijerinckii as an example. ACS synthetic biology, 5(7), 721- 732.
- Wasels, F., Jean-Marie, J., Collas, F., Lôpez-Contreras, A. M., & Ferreira, N. L. (2017). A two-plasmid inducible CRISPR/Cas9 genome editing tool for Clostridium acetobutylicum. Journal of microbiological methods. 140:5-11.
- Xu, T., Li, Y., Shi, Z., Hemme, C. L., Li, Y., Zhu, Y., ... & Zhou, J. (2015). Efficient genome editing in Clostridium cellulolyticum via CRISPR-Cas9 nickase. Applied and environmental microbiology, 81(13), 4423-4431.
- Yadav, R., Kumar, V., Baweja, M., & Shukla, P. (2018). Gene editing and genetic engineering approaches for advanced probiotics: A Review. Critical reviews in food science and nutrition, 58(10), 1735-1746.- Yue Chen, Bruce A. McClane, Derek J. Fisher, Julian I. Rood, Phalguni Gupta; Construction of an Alpha Toxin Gene Knockout Mutant of Clostridium perfringens Type A by Use of a Mobile Group II Intron; Appl. Environ. Microbiol. Nov 2005, 71 (11) 7542-7547; DOI: 10.1128/AEM.71.11.7542-7547.2005.
- Zhang, J., Liu, Y. J., Cui, G. Z., & Cui, Q. (2015). A novel arabinose-inducible genetic operation System developed for Clostridium cellulolyticum. Biotechnology for biofuels, 8(1), 36.
- Zhang C., Tinggang L. Jianzhong H. (2018) Characterization and genome analysis of a butanol- isopropanol-producing Clostridium beijerinckii strain BGS1. Biotechnol Biofuels (2018) 11:280.
- Zhong, J., Karberg, M., & Lambowitz, A. M. (2003). Targeted and random bacterial gene disruption using a group II intron (targetron) vector containing a retrotransposition-activated selectable marker. Nucleic acids research, 31(6), 1656-1664.

Claims

REVENDICATIONS
1. Acide nucléique reconnaissant le gène catB de séquence SEQ ID NO : 18 ou une séquence identique à au moins 70% à celle-ci au sein du génome d’une bactérie du genre Clostridium.
2. Acide nucléique selon la revendication 1, caractérisé en ce que ledit acide nucléique est sélectionné parmi une cassette d’expression et un vecteur, de préférence un plasmide.
3. Acide nucléique selon la revendication 1 ou 2, caractérisé en ce que l’acide nucléique comprend un ARN guide (ARNg) et/ou une matrice de modification.
4. Acide nucléique selon l’une des revendications 1 à 3, caractérisé en ce que la bactérie Clostridium est une bactérie capable de produire de l’isopropanol à l’état sauvage.
5. Acide nucléique selon l’une des revendications 1 à 4, caractérisé en ce que la bactérie Clostridium est une bactérie C. beijerinckii dont le sous-clade est sélectionnée parmi DSM 6423, LMG
7814, LMG 7815, NRRL B-593, NCCB 27006 et un sous-clade présentant au moins 95% d’identité avec la souche DSM6423.
6. Acide nucléique selon l’une des revendications 2 à 5, caractérisé en ce qu’il s’agit du plasmide pCas9ind-Aca/B de séquence SEQ ID NO : 21 ou du plasmide pCas9ind-gRNA_ca/B de séquence SEQ ID NO : 38.
7. Utilisation d’un acide nucléique selon l’une des revendications 2 à 6 pour transformer et/ou modifier génétiquement une bactérie Clostridium capable de produire de l’isopropanol à l’état sauvage.
8. Utilisation d’un acide nucléique reconnaissant le gène catB de séquence SEQ ID NO : 18 ou une séquence identique à au moins 70% à celle-ci au sein du génome de C. beijerinckii DSM 6423 pour transformer et/ou modifier génétiquement une bactérie C. beijerinckii DSM 6423.
9. Utilisation d’un acide nucléique selon l’une des revendications 1 à 6, ledit acide nucléique ne présentant pas de méthylation aux niveaux des motifs reconnus par les méthyltransférases de type Dam et Dcm, pour transformer un sous-clade C. beijerinckii sélectionné parmi DSM 6423, LMG 7814, LMG
7815, NRRL B-593, NCCB 27006 et un sous-clade présentant au moins 95%, de préférence 97%, d’identité avec la souche DSM 6423.
10. Procédé pour transformer, et de préférence modifier génétiquement, une bactérie du genre Clostridium à l’aide d’un outil de modification génétique, caractérisé en ce qu’il comprend une étape de transformation de la bactérie par introduction dans ladite bactérie d’un acide nucléique selon l’une des revendications 1 à 6.
11. Procédé selon la revendication 10, caractérisé en ce que la bactérie est transformée à G aide d’un outil CRISPR utilisant une enzyme responsable de la coupure d’au moins un brin de la séquence cible codant ou contrôlant la transcription d’une amphénicol-O-acetyltransférase.
12. Bactérie du genre Clostridium modifiée génétiquement obtenu(e) à l’aide du procédé selon la revendication 10 ou 11.
13. Bactérie C. beijerinckii DSM6423 AcatB déposée sous le numéro LMG P-31151.
14. Utilisation de la bactérie modifiée génétiquement selon la revendication 12, ou de la bactérie C. beijerinckii DSM6423 AcatB déposée sous le numéro LMG P-31151 selon revendication 13, pour produire un solvant, de préférence l’isopropanol, ou un mélange de solvants, de préférence à l’échelle industrielle.
15. Kit comprenant (i) un acide nucléique selon l’une des revendications 2 à 6 et (ii) au moins un outil sélectionné parmi les éléments d’un outil de modification génétique ; un acide nucléique en tant qu’ARNg ; un acide nucléique en tant que matrice de réparation ; au moins une paire d’amorces ; et un inducteur permettant l’expression d’une protéine codée par ledit outil.
EP19848893.4A 2018-12-20 2019-12-20 Bacteries clostridium genetiquement modifiees, preparation et utilisations de celles-ci Pending EP3898970A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FR1873492A FR3090691B1 (fr) 2018-12-20 2018-12-20 Bacteries clostridium genetiquement modifiees, preparation et utilisations de celles-ci
PCT/FR2019/053227 WO2020128379A1 (fr) 2018-12-20 2019-12-20 Bacteries clostridium genetiquement modifiees, preparation et utilisations de celles-ci

Publications (1)

Publication Number Publication Date
EP3898970A1 true EP3898970A1 (fr) 2021-10-27

Family

ID=67185129

Family Applications (1)

Application Number Title Priority Date Filing Date
EP19848893.4A Pending EP3898970A1 (fr) 2018-12-20 2019-12-20 Bacteries clostridium genetiquement modifiees, preparation et utilisations de celles-ci

Country Status (9)

Country Link
US (1) US20230109758A1 (fr)
EP (1) EP3898970A1 (fr)
JP (1) JP7555599B2 (fr)
KR (1) KR20210118826A (fr)
CN (1) CN113614229B (fr)
BR (1) BR112021011983A2 (fr)
CA (1) CA3123468A1 (fr)
FR (1) FR3090691B1 (fr)
WO (1) WO2020128379A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024200980A1 (fr) 2023-03-31 2024-10-03 IFP Energies Nouvelles Bacteries clostridium modifiees, outil d'edition genetique du plasmide psol de bacteries clostridium, et utilisations

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR3096373B1 (fr) * 2019-05-24 2024-09-13 Ifp Energies Now Outil genetique optimisé pour modifier les bacteries
CN119776393A (zh) * 2024-12-16 2025-04-08 东北大学 一种新型高效的巴氏梭菌遗传转化方法

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ATE443760T1 (de) * 2006-05-31 2009-10-15 Novozymes As Chloramphenicolresistenz-selektion bei bacillus licheniformis
GB0612301D0 (en) * 2006-06-21 2006-08-02 Morvus Technology Ltd DNA molecules and methods
CN101903530A (zh) * 2007-10-12 2010-12-01 加利福尼亚大学董事会 被改造以产生异丙醇的微生物
WO2009115114A1 (fr) * 2008-03-18 2009-09-24 Metabolic Explorer Polypeptide à activité de glyoxalase iii, polynucléotide codant pour ce polypeptide et utilisations
WO2009131040A1 (fr) * 2008-04-25 2009-10-29 財団法人地球環境産業技術研究機構 Bactéries corynéformes génétiquement modifiées capables de produire de l’isopropanol
FR2981089B1 (fr) * 2011-10-11 2016-05-20 Ifp Energies Now Production d'isopropanol par des souches recombinantes ameliorees
WO2013109982A1 (fr) * 2012-01-19 2013-07-25 Butrolix Llc Procédés de production améliorée de butanol par clostridia
FR3037076B1 (fr) * 2015-06-04 2018-11-09 IFP Energies Nouvelles Souches mutantes du genre clostridium beijerinckii
FR3042506B1 (fr) * 2015-10-16 2018-11-30 IFP Energies Nouvelles Outil genetique de transformation de bacteries clostridium

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024200980A1 (fr) 2023-03-31 2024-10-03 IFP Energies Nouvelles Bacteries clostridium modifiees, outil d'edition genetique du plasmide psol de bacteries clostridium, et utilisations
FR3147288A1 (fr) 2023-03-31 2024-10-04 IFP Energies Nouvelles Bacteries clostridium modifiees, outil d’edition genetique du plasmide psol de bacteries clostridium, et utilisations

Also Published As

Publication number Publication date
CA3123468A1 (fr) 2020-06-25
CN113614229A (zh) 2021-11-05
US20230109758A1 (en) 2023-04-13
BR112021011983A2 (pt) 2021-09-14
FR3090691A1 (fr) 2020-06-26
WO2020128379A1 (fr) 2020-06-25
KR20210118826A (ko) 2021-10-01
JP7555599B2 (ja) 2024-09-25
FR3090691B1 (fr) 2023-06-09
CN113614229B (zh) 2024-12-10
JP2022516025A (ja) 2022-02-24

Similar Documents

Publication Publication Date Title
US11946067B2 (en) Optimized genetic tool for modifying Clostridium bacteria
EP3362559B1 (fr) Outil genetique de transformation de bacteries clostridium
CN109072245B (zh) 用于c1固定菌的crispr/cas系统
EP4166662A1 (fr) Procédés améliorés de modification d'acides nucléiques cibles
WO2020128379A1 (fr) Bacteries clostridium genetiquement modifiees, preparation et utilisations de celles-ci
CA3141382A1 (fr) Outil genetique optimise pour modifier les bacteries
US12385023B2 (en) CRISPR-Cas system for clostridium genome engineering and recombinant strains produced thereof
WO2017055712A1 (fr) Nouvelles souches bacteriennes pour la production de vanilline
CA3001815C (fr) Outil genetique de transformation de bacteries clostridium
WO2024200980A1 (fr) Bacteries clostridium modifiees, outil d'edition genetique du plasmide psol de bacteries clostridium, et utilisations
FR3111642A1 (fr) Souches de bacteriesclostridiumresistantes au 5-fluorouracile, outils genetiques et utilisations de ceux-ci
FR3025803A1 (fr) Cassette d'expression et leurs utilisations

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20210715

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

17Q First examination report despatched

Effective date: 20240801