Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
  • C12N15/102—Mutagenizing nucleic acids
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
  • C07K14/33—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Clostridium (G)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
  • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
  • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
  • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/10—Transferases (2.)
  • C12N9/1025—Acyltransferases (2.3)
  • C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
  • C12N9/1033—Chloramphenicol O-acetyltransferase (2.3.1.28)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/14—Hydrolases (3)
  • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
  • C12N9/22—Ribonucleases RNAses, DNAses
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
  • C12P7/00—Preparation of oxygen-containing organic compounds
  • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
  • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
  • C12P7/00—Preparation of oxygen-containing organic compounds
  • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
  • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
  • C12P7/06—Ethanol, i.e. non-beverage
  • C12P7/065—Ethanol, i.e. non-beverage with microorganisms other than yeasts
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
  • C12P7/00—Preparation of oxygen-containing organic compounds
  • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
  • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
  • C12P7/16—Butanols
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Y—ENZYMES
  • C12Y203/00—Acyltransferases (2.3)
  • C12Y203/01—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
  • C12Y203/01028—Chloramphenicol O-acetyltransferase (2.3.1.28)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/10—Type of nucleic acid
  • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2800/00—Nucleic acids vectors
  • C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
• • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
  • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
  • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
  • Y02E50/00—Technologies for the production of fuel of non-fossil origin
  • Y02E50/10—Biofuels, e.g. bio-diesel

Definitions

• the present invention relates to the genetic modification of bacteria of the genus Clostridium, typically of solventogenic bacteria of the genus Clostridium, in particular of bacteria possessing in the wild state a gene coding for an amphenicol-O-acetyltransferase. It thus relates to methods, tools and kits allowing such a genetic modification, in particular the elimination or modification of a coding sequence, or controlling the transcription of a coding sequence, an amphenicol-O-acetyltransferase, genetically modified bacteria. obtained and their uses, in particular for producing a solvent, preferably on an industrial scale.
• Clostridium contains Gram-positive, strict anaerobic and sporulating bacteria, belonging to the phylum Firmicutes. Clostridia are a group of importance to the scientific community for several reasons. The first is that a certain number of serious diseases (eg tetanus, botulism) are due to infections of pathogenic members of this family (Gonzales et al., 2014) The second is the possibility of using so-called acidogenic or solventogenic strains in biotechnology (John & Wood, 1986, and Moon et al., 2016).
• Clostridia naturally have the capacity to transform a large variety of sugars to produce chemical species of interest, and more particularly acetone, butanol, and ethanol (John & Wood, 1986). during a fermentation process called ABE.
• IBE fermentation is possible in certain particular species, during which acetone is reduced in variable proportion to isopropanol (Chen et al., 1986, George et al., 1983) thanks to the presence in the genome of these strains of genes encoding secondary alcohol dehydrogenases (s-ADH; Ismael et al., 1993, Hiu et al., 1987).
• C. acetobutylicum and C. beijerinckii with respective references C. acetobutylicum ATCC 824 (also designated DSM 792 or LMG 5710) and C. beijerinckii NCIMB 8052 which are the model strains for the study of ABE type fermentation.
• Clostridium strains naturally capable of carrying out IBE fermentation are few in number and predominantly belong to the Clostridium beijerinckii species (cf. Zhang et al., 2018, Table 1). These strains are typically selected from C. butylicum LMD 27.6, C. aurantibutylicum NCIB 10659, C. beijerinckii LMD 27.6, C. beijerinckii VPI2968, C. beijerinckii NRRL B-593, C. beijerinckii ATCC 6014, C. beijerinckii McClung 3081 , C. isopropylicum IAM 19239, C. beijerinckii DSM 6423, C. sp. A1424, C. beijerinckii optinoii, and C. beijerinckii BGS1.
• Clostridium bacteria naturally capable of producing isopropanol, in particular naturally capable of carrying out an IBE fermentation, which has been genetically modified, in particular a strain genetically modified so as to make sensitive to an antibiotic belonging to the class of amphenicols such as chloramphenicol or thiamphenicol, preferably to allow the optimized production of isopropanol.
• the inventors describe, in the context of the present invention and for the first time, a genetically modified C. beijerinckii bacterium, as well as the tools allowing a genetic modification of bacteria of the genus Clostridium, typically of solventogenic bacteria of the genus Clostridium naturally (ie to in the wild) capable of producing isopropanol, in particular naturally capable of carrying out an IBE fermentation, in particular of bacteria comprising in the wild a gene conferring on the bacteria resistance to one or more antibiotics, in particular a gene encoding an amphenicol-O-acetyltransferase, for example a chloramphenicol-O-acetyltransferase or a thiamphenicol-O-acetyltransferase.
• a preferred genetically modified bacterium according to the invention is a bacterium which does not express an enzyme which gives it resistance to one or more antibiotics, in particular a bacterium which does not express an amphenicol-O-acetyltransferase, for example a bacterium lacking the gene. catB or unable to express said gene.
• a preferred genetically modified bacterium according to the invention is the bacterium identified in the present description as C. beijerinckii DSM 6423 A catB as registered under the deposit number LMG P-31151 (also identified as Clostridium beijerinckii IFP962 delta catB) at the Belgian Co-ordinated Collections of Micro-organisms (“BCCM”, KL Ledeganckstraat 35, B-9000 Gent - Belgium) on December 6, 2018.
• BCCM Belgian Co-ordinated Collections of Micro-organisms
• KL Ledeganckstraat 35, B-9000 Gent - Belgium Belgian Co-ordinated Collections of Micro-organisms
• a particular object described by the inventors is a nucleic acid recognizing (binding at least in part), and preferably targeting, ie recognizing and allowing the cutting, in the genome of a bacterium of interest, of at least one strand i ) a coding sequence, ii) a sequence controlling the transcription of a coding sequence, or iii) a sequence flanking the coding sequence, an enzyme allowing said bacteria of interest to grow in a culture medium containing an antibiotic, typically an antibiotic belonging to the class of amphenicols, preferably selected from chloramphenicol, thiamphenicol, azidamfenicol and florfenicol, typically an amphenicol-O-acetyltransferase such as a chloramphenicol-O-acetyltransferase or a thiamphenicol -O- acetyltransferase
• the inventors also describe the use of such a nucleic acid to transform and / or genetically modify a bacterium of the genus Clostridium, preferably a bacterium of the genus Clostridium naturally capable of producing isopropanol, in particular a bacterium of the genus Clostridium capable to carry out an IBE fermentation.
• the inventors describe in particular the use of a nucleic acid recognizing the catB gene of sequence SEQ ID NO: 18 or a sequence identical to at least 70% thereof within the genome of C. beijerinckii DSM 6423 for transforming and / or genetically modify a C. beijerinckii DSM 6423 bacteria.
• the bacterium capable of producing isopropanol in the wild can be, for example, a bacterium selected from a C. beijerinckii bacterium, a C. diolis bacterium, a C. puniceum bacteria, a C. butyricum bacteria, a C. bacteria. saccharoperbutylacetonicum, C. botulinum bacteria, C. drakei bacteria, C. scatologenes bacteria, C. perfringens bacteria, and C. tunisiense bacteria, preferably a bacteria selected from C. beijerinckii bacteria, C. diolis bacteria , a bacterium C. puniceum and a bacteria C. saccharoperbutylacetonicum.
• a bacterium naturally capable of producing isopropanol which is particularly preferred is a bacterium C. beijerinckii.
• the nucleic acid recognizing, and preferably targeting, i) a sequence coding for an amphenicol-O-acetyltransferase, ii) a sequence controlling the transcription of such a sequence, or iii) a sequence flanking such a sequence is used to transform a subclade of C. beijerinckii selected from DSM 6423, LMG 7814, LMG 7815, NRRL B-593, NCCB 27006 and a subclade having at least 97% identity with the strain DSM 6423.
• the inventors also describe a process for transforming, and preferably genetically modifying, a bacterium of the genus Clostridium.
• This method comprises a step of transforming said bacterium by introduction into this bacterium of a nucleic acid recognizing, and preferably targeting, i) a coding sequence, ii) a sequence controlling the transcription of a coding sequence, or iii) a sequence flanking a sequence encoding an enzyme of interest, preferably an amphenicol-O-acetyltransferase.
• This process is typically carried out using a modification tool genetics, for example using a genetic modification tool selected from a CRISPR tool, a tool based on the use of type II introns and an allelic exchange tool.
• genetically transformed and modified bacteria using such a method, of which the bacteria C. beijerinckii DSM 6423 AcatB is an example.
• Another aspect described by the inventors relates to the use of a bacterium genetically modified according to the invention, preferably of the bacterium C. beijerinckii DSM 6423 AcatB as registered under the deposit number LMG P-31151, or a genetically modified version thereof, to produce a solvent, preferably isopropanol, or a mixture of solvents, preferably on an industrial scale.
• a bacterium genetically modified according to the invention preferably of the bacterium C. beijerinckii DSM 6423 AcatB as registered under the deposit number LMG P-31151, or a genetically modified version thereof, to produce a solvent, preferably isopropanol, or a mixture of solvents, preferably on an industrial scale.
• kits in particular a kit comprising a nucleic acid described in the present text and a genetic modification tool, in particular a genetic modification tool selected from among the elements of a genetic tool selected from a CRISPR tool, a tool based on the use of type II introns and an allelic exchange tool; a nucleic acid as guide RNA (gRNA); nucleic acid as a repair matrix; at least one pair of primers; and an inducer for the expression of a protein encoded by said tool.
• gRNA guide RNA
• CRISPR Clustered Regularly Interspaced Short Palindromie Repeats
• Cas Cas (CRISPR-associated protein) technology.
• This method is based on the use of an enzyme called nuclease (typically a Cas type nuclease in the case of the CRISPR / Cas genetic tool, such as the Cas9 protein from Streptococcus pyogenes), which will, guided by a molecule of RNA, make a double strand cut within a DNA molecule (target sequence of interest).
• the sequence of guide RNA (gRNA) will determine the nuclease cleavage site, giving it very high specificity ( Figure 17).
• a double strand cut in an essential DNA molecule being lethal for an organism will depend on its capacity to repair it (cf. for example Cui & Bikard, 2016).
• the repair of a double strand cut depends on a homologous recombination mechanism requiring an intact copy of the cleaved sequence.
• the inventors have developed and described a more efficient genetic tool for modifying bacteria, suitable for bacteria, typically for bacteria belonging to the phylum Firmicutes, in particular for bacteria of the genus Clostridium, based on the use of two distinct nucleic acids, typically of two plasmids (cf. WO2017064439, Wasels et al., 2017 and Figure 3) which notably solves this problem.
• the first nucleic acid of this tool allows the expression of cas9 and a second nucleic acid, specific for the modification to be carried out, contains one or more cassettes of expression of gRNA as well as a matrix of repair allowing the replacement of a portion of the bacterial DNA targeted by Cas9 by a sequence of interest.
• the toxicity of the system is limited by placing cas9 and / or the cassette (s) of expression of gRNA under the control of inducible promoters.
• the inventors have recently improved this tool by making it possible to very significantly increase the efficiency of bansformation and therefore the obtaining, in number and useful quantity (in particular in the context of selection of robust strains for production on an industrial scale).
• genetically modified bacteria of interest cf. FR 18/54835.
• at least one nucleic acid comprises a sequence coding for an anti-CRISPR protein ("acr"), placed under the control of an inducible promoter. This anti-CRISPR protein represses the activity of the guide DNA / RNA endonuclease complex.
• bacteria belonging to the phylum Firmicutes is meant, in the context of this description, bacteria belonging to the class of Clostridia, Mollicutes, Bacilli or Togobacteria, preferably to the class of Clostridia or Bacilli.
• Particular bacteria belonging to the phylum Firmicutes include for example bacteria of the genus Clostridium, bacteria of the genus Bacillus or bacteria of the genus Lactobacillus.
• bacteria of the genus Bacillus is meant in particular B. amyloliquefaciens, B. thurigiensis, B. coagulans, B. cereus, B. anthracis or even B. subtilis.
• bacteria of the genus Clostridium is meant in particular the species of Clostridium said to be of industrial interest, typically the solventogenic or acetogenic bacteria of the genus Clostridium.
• the expression “bacteria of the genus Clostridium” includes wild bacteria as well as the strains derived from these, genetically modified in order to improve their performance (for example overexpressing the genes ctfA, ctfB and adc) without having been exposed to CRISPR system.
• kits of Clostridium of industrial interest are meant the species capable of producing, by fermentation, solvents and acids such as butyric acid or acetic acid, from sugars or from sugars, typically from sugars comprising 5 carbon atoms such as xylose, arabinose or fructose, sugars comprising 6 carbon atoms such as glucose or mannose, polysaccharides such as cellulose or hemicelluloses and / or any other source of carbon assimilable and usable by bacteria of the genus Clostridium (CO, CO2, and methanol for example).
• solvents and acids such as butyric acid or acetic acid
• solventogenic bacteria of interest are bacteria of the genus Clostridium producing acetone, butanol, ethanol and / or isopropanol, such as the strains identified in the literature as “ABE strain” [strains producing fermentations allowing the production of acetone, butanol and ethanol] and "IBE strain” [strains carrying out fermentations allowing the production of isopropanol (by reduction of acetone), butanol and ethanol].
• Solventogenic bacteria of the genus Clostridium can be selected for example from C. acetobutylicum, C. cellulolyticum, C. phytofermentans, C. beijerinckii, C. saccharobutylicum, C.
• saccharoperbutylacetonicum C. sporogenes, C. butyricum, C. aurantibutyricum and C. tyrobutyricum, preferably from C. acetobutylicum, C. beijerinckii, C. butyricum, C. tyrobutyricum and C. cellulolyticum, and even more preferably from C. acetobutylicum and C. beijerinckii.
• Bacteria of the genus Clostridium naturally producing isopropanol typically having in their genome an adh gene encoding a primary / secondary alcohol dehydrogenase which allows the reduction of acetone to isopropanol, are distinguished both genetically and functionally from bacteria capable of the natural state of an ABE fermentation.
• the inventors have advantageously succeeded, in the context of the present invention, in genetically modifying a bacterium of the genus Clostridium naturally producing isopropanol, the bacterium C. beijerinckii DSM 6423, as well as the reference strain C. acetobutylicum DSM 792.
• the inventors thus describe, for the first time, a solventogenic bacterium of the genus Clostridium naturally (ie in the wild) capable of producing isopropanol, in particular naturally capable of carrying out an IBE fermentation, which has been genetically modified, as well as the tools, in particular the genetic tools, which made it possible to obtain it.
• These tools have the advantage of considerably facilitating the transformation and genetic modification of bacteria capable, in the wild, of producing isopropanol, in particular of carrying out an IBE fermentation, in particular those carrying a gene encoding an enzyme responsible for resistance to an antibiotic.
• the inventors have succeeded in removing from the C. beijerinckii DSM 6423 strain its natural plasmid pNF2.
• the inventors have in particular managed to make sensitive to an amphenicol, a bacterium naturally carrying (carrying in the wild state) a gene encoding an enzyme responsible for the resistance to these antibiotics.
• amphenicols of interest in the context of the invention are chloramphenicol, thiamphenicol, G azidamfenicol and florfenicol (Schwarz S. et al., 2004), in particular chloramphenicol and thiamphenicol.
• a first aspect of the invention thus relates to a genetic tool which can be used to genetically transform and / or modify a bacterium of interest, typically a bacterium as described in the present text belonging to the phylum of Firmicutes, for example a bacterium of the genus Clostridium, of the genus Bacillus or of the genus Lactobacillus, preferably a solventogenic bacterium of the genus Clostridium naturally (ie in the wild) capable of producing isopropanol, in particular naturally capable of effecting an IBE fermentation, preferably a naturally resistant bacterium one or more antibiotics, such as C. beijerinckii bacteria.
• a preferred bacterium has in the state wild both a bacterial chromosome and at least one DNA molecule distinct from chromosomal DNA.
• this genetic tool consists of a nucleic acid (also identified in the present text as “nucleic acid of interest”) recognizing (binding at least in part), and preferably targeting, ie recognizing and allowing the cutting, in the genome of a bacterium of interest, of at least one strand i) of a sequence coding for an enzyme allowing the bacteria of interest to grow in a culture medium containing an antibiotic vis-à-vis of which it confers resistance to it, ii) of a sequence controlling the transcription of a sequence coding for an enzyme allowing the bacteria of interest to grow in a culture medium containing an antibiotic vis-à-vis which it confers on it a resistance, or iii) a sequence flanking a sequence encoding an enzyme allowing the bacteria of interest to grow in a culture medium containing an antibiotic against which it confers resistance to it.
• This nucleic acid of interest is typically used in the context of the present invention to suppress the recognized sequence of the genome of the bacteria or to modify its expression, for example to modulate / regulate its expression, in particular to inhibit it, preferably for modify it so as to render said bacteria incapable of expressing a protein, in particular a functional protein, from said sequence.
• the recognized sequence is also identified in the present text as “target sequence” or “targeted sequence”.
• the nucleic acid of interest comprises at least one region complementary to the target sequence identical to 100% or identical to at least 80%, preferably 85%, 90%, 95%, 96% , 97%, 98% or 99% at least to the region / portion / DNA sequence targeted within the bacterial genome and is capable of hybridizing to all or part of the complementary sequence of said region / portion / sequence, typically with a sequence comprising at least 1 nucleotide, preferably at least 1, 2, 3, 4, 5, 10, 14, 15, 20, 25, 30, 35 or 40 nucleotides, typically between 1, 10 or 20 and 1000 nucleotides, for example between 1, 10 or 20 and 900, 800, 700, 600, 500, 400, 300 or 200 nucleotides, between 1, 10 or 20 and 100 nucleotides, between 1, 10 or 20 and 50 nucleotides, or between 1, 10 or 20 and 40 nucleotides, for example between 10 and 40 nucleotides, between 10 and 30 nucleotides, between 10 and 20 nucleotides, between
• the nucleic acid of interest comprises at least two complementary regions each of a target sequence, identical to 100% or identical to at least 80%, preferably 85%, 90%, 95 %, 96%, 97%, 98% or 99% at least to said region / portion / DNA sequence targeted within the bacterial genome.
• These regions are capable of hybridizing to all or part of the sequence complementary to said region / portion / sequence, typically to a sequence as described above comprising at least 1 nucleotide, preferably at least 100 nucleotides, typically between 100 and 1000 nucleotides.
• the regions complementary to the target sequence present within the nucleic acid of interest can recognize, preferably target, the 5 'and 3' flanking regions of the targeted sequence in a genetic modification tool as described in the present text, for example the ClosTron® genetic tool, the Targetron® genetic tool or an ACE®-type allelic exchange tool.
• the target sequence is a sequence encoding an amphenicol-O-acetyltransferase, for example a chloramphenicol-O-acetyltransferase or a thiamphenicol-O-acetyltransferase, controlling the transcription of such a sequence or flanking such a sequence, within the genome a bacterium of interest of the genus Clostridium capable of growing in a culture medium containing one or more antibiotics belonging to the class of amphenicols, for example chloramphenicol and / or thiamphenicol.
• an amphenicol-O-acetyltransferase for example a chloramphenicol-O-acetyltransferase or a thiamphenicol-O-acetyltransferase
• the recognized sequence is the sequence SEQ ID NO: 18 corresponding to the catB gene (CIBE_3859) encoding a chloramphenicol-O-acetyltransferase from C. beijerinckii DSM 6423 or an amino acid sequence identical to at least 70 %, 75%, 80%, 85%, 90% or 95% to said chloramphenicol-O-acetyltransferase, or a sequence comprising all or at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% of the sequence SEQ ID NO: 18.
• the recognized sequence can be a sequence comprising at least 1 nucleotide, preferably at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35 or 40 nucleotides, typically between 1 and 40 nucleotides, preferably a sequence comprising 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 , 26, 27, 28, 29 or 30 nucleotides of the sequence SEQ ID NO: 18.
• amino acid sequences identical to at least 70% to chloramphenicol-O-acetyltransferase coded by the sequence SEQ ID NO: 18 correspond to the sequences identified in the NCBI database under the following references: WP_077843937.1, SEQ ID NO: 44 (WP_063843219.1), SEQ ID NO: 45 (WP_078116092.1), SEQ ID NO: 46 (WP_077840383.1), SEQ ID NO: 47 (WP_077307770.1), SEQ ID NO: 48 (WP_103699368 .1), SEQ ID NO: 49 (WP_087701812.1), SEQ ID NO: 50 (WP_017210112.1), SEQ ID NO: 51 (WP_077831818.1), SEQ ID NO: 52 (WP_012059398.1), SEQ ID NO: 53 (WP_077363893.1), SEQ ID NO: 54 (WP_015393553.1), SEQ ID NO: 55 (WP_02
• amino acid sequences which are at least 75% identical to chloramphenicol-O-acetyltransferase coded by the sequence SEQ ID NO: 18 correspond to the sequences WP_077843937.1, WP 063843219.1, WP_078116092.1, WP_077840383.1, WP_077307770.1,
• amino acid sequences identical to at least 90% to chloramphenicol-O-acetyltransferase coded by the sequence SEQ ID NO: 18, are the sequences WP_077843937.1, WP_063843219.1, WP_078116092.1, WP_077840383.1, WP_077307770.1, WP_103699368.1,
• amino acid sequences which are at least 95% identical to chloramphenicol-O-acetyltransferase encoded by the sequence SEQ ID NO: 18 correspond to the sequences
• WP_077363893.1 WP_015393553.1, WP_023973814.1, and WP_026887895.1.
• Preferred amino acid sequences identical to at least 99% chloramphenicol-O-acetyltransferase coded by the sequence SEQ ID NO: 18, are the sequences WP_077843937.1, SEQ ID NO: 44 (WP_063843219.1) and SEQ ID NO: 45 (WP_078116092.1).
• a particular sequence identical to the sequence SEQ ID NO: 18 is the sequence identified in the NCBI database under the reference WP_077843937.1.
• the target sequence is the sequence SEQ ID NO: 68 corresponding to the catQ gene coding for a chloramphenicol-O-acetyltransferase from C. perfringens whose amino acid sequence corresponds to SEQ ID NO: 66 (WP_063843220. 1), or a sequence identical to at least 70%, 75%, 80%, 85%, 90% or 95% to said chloramphenicol-O-acetyltransferase, or a sequence comprising all or at least 70%, 75%, 80 %, 85%, 90%, 95%, 96%, 97%, 98% or 99% of the sequence SEQ ID NO: 68.
• the recognized sequence can be a sequence comprising at least 1 nucleotide, preferably at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35 or 40 nucleotides, typically between 1 and 40 nucleotides, preferably a sequence comprising 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides of the sequence SEQ ID NO: 68.
• the recognized sequence is selected from a nucleic acid sequence catB (SEQ ID NO: 18), catQ (SEQ ID NO 68), catD (SEQ ID NO: 69, Schwarz S. and al., 2004) or catP (SEQ ID NO: 70, Schwarz S. et al., 2004) known to those skilled in the art, naturally present in a bacterium of the genus Clostridium or introduced artificially into such a bacterium.
• catB nucleic acid sequence catB
• catQ SEQ ID NO: 68
• catD SEQ ID NO: 69, Schwarz S. and al., 2004
• catP SEQ ID NO: 70, Schwarz S. et al., 2004
• the target sequence can also be a sequence controlling the transcription of a coding sequence as described above (coding an enzyme allowing the bacteria of interest to grow in a culture medium containing an antibiotic against which it confers resistance), typically a promoter sequence, for example the promoter sequence (SEQ ID NO: 73) of the catB gene or that (SEQ ID NO: 74) of the catQ gene.
• a promoter sequence for example the promoter sequence (SEQ ID NO: 73) of the catB gene or that (SEQ ID NO: 74) of the catQ gene.
• the nucleic acid of interest used as a genetic tool, then recognizes, and is therefore typically capable of binding to a sequence controlling the transcription of a coding sequence as described above.
• the target sequence can be a sequence flanking a coding sequence as described above (coding an enzyme allowing the bacteria of interest to grow in a culture medium containing an antibiotic vis-à-vis which it confers resistance to it), for example a sequence flanking the catB gene of sequence SEQ ID NO: 18 or a sequence identical to at least 70% thereof.
• flanking sequence typically comprises 1, 10 or 20 and 1000 nucleotides, for example between 1, 10 or 20 and 900, 800, 700, 600, 500, 400, 300 or 200 nucleotides, between 1, 10 or 20 and 100 nucleotides , between 1, 10 or 20 and 50 nucleotides, or between 1, 10 or 20 and 40 nucleotides, for example between 10 and 40 nucleotides, between 10 and 30 nucleotides, between 10 and 20 nucleotides, between 20 and 30 nucleotides, between 15 and 40 nucleotides, between 15 and 30 nucleotides or between 15 and 20 nucleotides.
• the target sequence corresponds to the pair of sequences flanking such a coding sequence, each flanking sequence typically comprising at least 20 nucleotides, typically between 100 and 1000 nucleotides, preferably between 200 and 800 nucleotides.
• nucleic acid is meant within the meaning of the invention, any natural, synthetic, semi-synthetic or recombinant DNA or RNA molecule, optionally chemically modified (ie comprising non-natural bases, modified nucleotides comprising by example a modified bond, modified bases and / or modified sugars), or optimized so that the codons of the transcripts synthesized from the coding sequences are the codons most frequently found in a bacterium of the genus Clostridium for its use at it.
• the optimized codons are typically codons rich in adenine ("A") and thymine (“T”) bases.
• C cysteine
• D aspartic acid
• E glutamic acid
• F phenylalanine
• G glycine
• H histidine
• I isoleucine
• K lysine
• L leucine
• M methionine
• N asparagine
• P proline
• Q glutamine
• R arginine
• S serine
• T threonine
• V valine
• W tryptophan
• Y tyrosine.
• the nucleic acid of interest used as a genetic tool to transform and / or genetically modify a bacterium of interest, is a DNA fragment i) recognizing a coding sequence, ii) controlling the transcription of a coding sequence, or iii) flanking a coding sequence, an enzyme of interest, preferably an amphenicol-O-acetyltransferase, for example a chloramphenicol-O-acetyltransferase or a thiamphenicol -O- acetyltransferase, within the genome of a bacterium of the genus Clostridium, in particular of a solventogenic bacterium of the genus Clostridium naturally capable of producing isopropanol, in particular naturally capable of effecting an IBE fermentation.
• an enzyme of interest preferably an amphenicol-O-acetyltransferase, for example a chloramphenicol-O-acetyltransferase or
• the bacterium capable of naturally producing isopropanol can for example be a bacterium selected from a C. beijerinckii bacteria, a C. diolis bacteria, a C. puniceum bacteria, a C. butyricum bacterium, a C. saccharoperbutylacetonicum bacteria, a bacterium C. botulinum, a C. drakei bacteria, a C. scatologenes bacteria, a C. perfringens bacteria, and a C. tunisiense bacteria, preferably a bacteria selected from a C. beijerinckii bacteria, a C. diolis bacteria, a C bacteria puniceum and a bacterium C. saccharoperbutylacetonicum.
• a particularly preferred bacterium capable of producing isopropanol in the wild is C. beijerinckii.
• the bacterium of the genus Clostridium is a bacterium C. beijerinckii, the subclade of which is selected from DSM 6423, LMG 7814, LMG 7815, NCCB 27006 and a subclade having at least 90%, 95%, 96 %, 97%, 98% or 99% identity with the DSM 6423 strain.
• the nucleic acid of interest according to the invention is capable of suppressing the recognized sequence (“target sequence”) from the genome of the bacteria or of modifying its expression, for example of modulating it, in particular of the inhibit, preferably modify it so as to render said bacterium incapable of expressing a protein, preferably an amphenicol-O-acetyltransferase, in particular a functional protein, from said sequence.
• target sequence the recognized sequence
• a protein preferably an amphenicol-O-acetyltransferase, in particular a functional protein
• This nucleic acid of interest is typically in the form of an expression cassette (or “construction”) such as for example a nucleic acid comprising a transcriptional promoter linked in an operational manner (in the sense understood by man of the trade) to one or more (coding) sequences of interest, for example an operon comprising several coding sequences of interest, the expression products of which contribute to the achievement of a function of interest within the bacterium, or a nucleic acid further comprising an activator sequence and / or a transcription terminator; or in the form of a vector, circular or linear, single or double strand, for example a plasmid, a phage, a cosmid, an artificial or synthetic chromosome, comprising one or more expression cassettes as defined above.
• the vector is a plasmid.
• the nucleic acids of interest can be constructed by conventional techniques well known to those skilled in the art and can comprise one or more promoters, origins of bacterial replication (ORI sequences), termination, selection genes, for example antibiotic resistance genes, and sequence (s) (for example "region (s) flanked (s) ”) allowing targeted insertion of the cassette or vector.
• cassettes and expression vectors can be integrated into the genome by techniques well known to those skilled in the art.
• ORI sequences of interest can be chosen from pIP404, rAMbI, pCB 102, repH (origin of replication in C. acetobutylicum), ColEl or rep (origin of replication in E. coli), or any other origin of replication allowing maintenance of the vector, typically the plasmid, within a Clostridium cell.
• Termination sequences of interest can be chosen from those of the adc, thl genes, of the bcs operon, or of any other terminator, well known to those skilled in the art, allowing the stopping of transcription within of Clostridium.
• Selection genes (resistance genes) of interest can be chosen from ermB, catP, bla, tetA, tetM, and / or any other gene for resistance to ampicillin, erythromycin, chloramphenicol, thiamphenicol, tetracycline or any other antibiotic which can be used to select bacteria of the genus Clostridium well known to those skilled in the art.
• the selection gene used is not a gene for resistance to chloramphenicol and / or thiamphenicol , and is preferably none of the catB, catQ, catD or catP genes.
• the nucleic acid of interest comprises one or more guide RNAs (gRNA) targeting a sequence (“target sequence”, “targeted sequence” or “recognized sequence”) coding, controlling the transcription of a sequence encoding, or flanking a sequence encoding, an enzyme of interest, in particular an amphenicol-O-acetyltransferase, and / or a modification matrix (also identified in the present text as an “editing matrix”), by example a matrix making it possible to eliminate or modify all or part of the target sequence, preferably with the aim of inhibiting or suppressing the expression of the target sequence, typically a matrix comprising homologous sequences (corresponding) to the sequences located in upstream and downstream of the target sequence as described above, typically sequences (homologous to said sequences located upstream and downstream of the target sequence) each comprising between 10 or 20 base pairs and 1000, 15 00 or 2000 base pairs, for example between 100, 200, 300, 400 or 500 base pairs and 1000, 1200, 1300,
• gRNA
• a particular genetic tool according to the invention comprises several (at least two) nucleic acids of interest as described above, said nucleic acids of interest being different from each other.
• the nucleic acid of interest used as a genetic tool to genetically transform and / or modify a bacterium of interest is a nucleic acid recognizing a coding sequence, a sequence controlling the transcription, or a flanking sequence, a sequence coding for an enzyme conferring on the bacteria resistance to one or more antibiotics, and capable of suppressing said sequence within the genome of this bacterium or of rendering it non-functional, in particular a nucleic acid showing no methylation at the levels of the patterns recognized by the Dam and Dcm methyltransferases (prepared from an Escherichia coli bacterium having the dam-dcm- genotype).
• the nucleic acid of interest used as a genetic tool is a nucleic acid which does not exhibit methylation at the levels of the motifs recognized by methyltransferases of the Dam and Dcm type, typically a nucleic acid of which adenosine ("A") ) of the GATC motif and / or the second cytosine “C” of the CCWGG motif (W possibly corresponding to an adenosine (“A”) or to a thymine (“T”)) are demethylated.
• A adenosine
• C the second cytosine
• a nucleic acid which does not exhibit methylation at the levels of the patterns recognized by the Dam and Dcm methyltransferases can typically be prepared from an Escherichia coli bacterium having the dam dcm genotype (for example Escherichia coli INV 110, Invitrogen).
• This same nucleic acid can comprise other methylations carried out for example by EcoKI type methyltransferases, the latter targeting the adenines (“A”) of the AAC (N6) GTGC and GCAC (N6) GTT (N which may correspond to n ' whatever basis).
• the targeted sequence corresponds to a gene coding for an amphenicol-O-acetyltransferase, for example a chloramphenicol-O-acetyltransferase such as the catB gene, to a sequence controlling the transcription of this gene, or to a flanking sequence this gene.
• an amphenicol-O-acetyltransferase for example a chloramphenicol-O-acetyltransferase such as the catB gene
• a nucleic acid of particular interest used as a genetic tool in the context of the invention is for example a vector, preferably a plasmid, for example the plasmid pCas9ind-Aca / B of sequence SEQ ID NO: 21 or the plasmid pCas9ind- gRNA_ca / B of sequence SEQ ID NO: 38 described in the experimental part of the present description, in particular a version of said sequence which does not have methylation at the level of the patterns recognized by methyltransferases of Dam and Dcm type.
• the present description also relates to the use of a nucleic acid of interest as described in the present text for transforming and / or genetically modifying a bacterium of interest, in particular a solventogenic bacterium of the genus Clostridium capable in the wild. to produce isopropanol, in particular capable in the wild of carrying out IBE fermentation.
• a bacterium capable of producing isopropanol in the wild, in particular capable of carrying out an IBE fermentation in the wild can be for example a bacterium selected from a bacterium C. beijerinckii, a bacterium C. diolis, C. puniceum bacteria, C. butyricum bacteria, C. saccharoperbutylacetonicum bacteria, C.
• botulinum bacteria from preferably a bacterium selected from a C. beijerinckii bacterium, a C. diolis bacteria, a C. puniceum bacteria and a C. saccharoperbutylacetonicum bacteria.
• a bacteria (naturally) capable of producing isopropanol in the wild, in particular capable of carrying out IBE fermentation in the wild, which is particularly preferred is a bacterium C. beijerinckii.
• the acetogenic bacteria of interest are bacteria which produce acids and / or solvents from CO2 and 3 ⁇ 4.
• Acetogenic bacteria of the genus Clostridium can be selected for example from C. aceticum, C. thermoaceticum, C. ljungdahlii, C. autoethanogenum, C. difficile, C. scatologenes and C. carboxydivorans.
• the bacterium of the genus Clostridium concerned is an "ABE strain", preferably the DSM 792 strain (also designated ATCC 824 or LMG 5710 strain) from C. acetobutylicum, or the NCIMB 8052 strain from C. beijerinckii.
• the bacterium of the genus Clostridium concerned is an "IBE strain", typically one of the C. beijerinckii bacteria identified in the present description, for example a C. beijerinckii bacterium whose subclade is selected among DSM 6423, LMG 7814, LMG 7815, NRRL B-593, NCCB 27006, or a bacterium C. aurantibutyricum DSZM 793 (Georges et al., 1983), and a subclade of such a bacterium C. beijerinckii or C aurantibutyricum having at least 90%, 95%, 96%, 97%, 98% or 99% identity with the strain DSM 6423.
• a bacteria C. beijerinckii, or a subclade of bacteria C. beijerinckii, particularly preferred (e) lacks the plasmid pNF2.
• the respective genomes of subclades LMG 7814, LMG 7815, NRRL B-593 and NCCB 27006 on the one hand, and DSZM 793 on the other hand, have percent sequence identity of at least 97% with the genome of the DSM 6423 subclade.
• the bacteria C. beijerinckii is the subclade bacterium DSM 6423.
• the bacteria C. beijerinckii is a strain C. beijerinckii IFP963 AcatB ApNF2 (registered on February 20, 2019 under the deposit number LMG P-31277 with the BCCM-LMG collection, and also identified in the present text as C. beijerinckii DSM 6423 AcatB ApNF2).
• the bacterium intended to be transformed, and preferably genetically modified is according to a particular embodiment a bacterium which has been exposed to a first stage of transformation and to a first stage of genetic modification using a nucleic acid or genetic tool according to the invention which has made it possible to delete at least one extrachromosomal DNA molecule (typically at least one plasmid) naturally present within said bacterium in the wild.
• Another aspect described by the inventors relates to a process for transforming, and preferably further genetically modifying, a bacterium of the genus Clostridium using a genetic tool according to the invention, typically using a nucleic acid of interest according to the invention as described above.
• This method comprises a step of transforming the bacterium by introducing into said bacterium the nucleic acid of interest described in the present text.
• the method may further comprise a step of obtaining, recovering, selecting or isolating the transformed bacterium, i.e. of the bacterium presenting the desired recombination / modifications / modifications / optimizations.
• the method for transforming, and preferably genetically modifying, a bacterium of the genus Clostridium involves a genetic modification tool, for example a genetic modification tool selected from a CRISPR tool, a tool based on the use of type II introns (for example the Targetron® tool or the ClosTron® tool) and an allelic exchange tool (for example the ACE® tool), and comprises a step of transformation of the bacteria by introduction into said bacterium of a nucleic acid of interest according to the invention as described above.
• a genetic modification tool for example a genetic modification tool selected from a CRISPR tool, a tool based on the use of type II introns (for example the Targetron® tool or the ClosTron® tool) and an allelic exchange tool (for example the ACE® tool)
• a genetic modification tool for example a genetic modification tool selected from a CRISPR tool, a tool based on the use of type II introns (for example the Targetron® tool or the Clos
• the present invention is typically advantageously implemented when the genetic modification tool selected to transform, and preferably genetically modify, a bacterium of the genus Clostridium, is intended to be used on a bacterium such as C. beijerinckii, carrier of the wild state of a gene encoding an enzyme responsible for resistance to one or more antibiotics, and that the implementation of said genetic tool comprises a step of transformation of said bacterium using a nucleic acid allowing the expression of a marker of resistance to an antibiotic to which this bacterium is resistant in the wild and / or a step of selection of bacteria transformed and / or genetically modified using said antibiotic (to which the bacterium is resistant to wild state).
• a modification advantageously achievable thanks to the present invention for example using a genetic modification tool selected from a CRISPR tool, a tool based on the use of type II introns and an allelic exchange tool, consists in removing a sequence coding for an enzyme conferring on the bacteria resistance to one or more antibiotics, or in rendering this sequence non-functional.
• Another modification advantageously achievable thanks to the present invention consists in genetically modifying a bacterium in order to improve its performance, for example its performance in the production of a solvent or of a mixture of solvents of interest, said bacterium having previously already was modified by the invention to make it sensitive to an antibiotic to which it was resistant in the wild.
• the method according to the invention is based on the use of (implements) the CRISPR technology / genetic tool (Clustered Regularly Interspaced Short Palindromie Repeats), in particular the CRISPR genetic tool / Case (CRISPR-associated protein).
• CRISPR technology / genetic tool Clustered Regularly Interspaced Short Palindromie Repeats
• CRISPR genetic tool / Case CRISPR-associated protein
• nuclease typically a Cas type nuclease in the case of the CRISPR / Cas genetic tool, such as the Cas9 protein (CRISPR-associated protein 9) of Streptococcus pyogenes
• CRISPR-associated protein 9 the Cas9 protein (CRISPR-associated protein 9) of Streptococcus pyogenes
• gRNA guide RNA
• the present invention can be implemented on a bacterium of the genus Clostridium using a CRISPR / classic case genetic tool using a single plasmid comprising a nuclease, a gRNA and a repair matrix as described by Wang et al. (2015).
• the CRISPR / Cas system contains two distinct essential elements, ie i) an endonuclease, in this case the nuclease associated with the CRISPR system, Cas, and ii) a guide RNA.
• Guide RNA is in the form of a chimeric RNA which consists of the combination of a bacterial CRISPR RNA (crRNA) and a trans-activating CRISPR RNA.
• the gRNA combines the targeting specificity of the cRNA corresponding to the "spacer sequences" which serve as guides for the Cas proteins, and the conformational properties of the trRNA in a single transcript.
• the target genomic sequence can be changed permanently using a repair template provided.
• Those skilled in the art can easily define the sequence and structure of the gRNAs according to the chromosomal region or the mobile genetic element to be targeted using well known techniques (see for example the article by DiCarlo et al., 2013).
• the introduction into the bacterium of the elements (nucleic acids or gRNA) of the genetic tool is carried out by any method, direct or indirect, known to those skilled in the art, for example by transformation, conjugation, microinjection, transfection, electroporation, etc., preferably by electroporation (Mermelstein et al, 1993).
• the inventors have recently developed and described a genetic tool for modifying bacteria, suitable for bacteria of the genus Clostridium and usable in the context of the present invention, based on the use of two plasmids (cf. WO2017 / 064439, Wasels et al ., 2017, and Figure 15 associated with this description).
• the "first" plasmid of this tool allows the expression of the Cas nuclease and a "second" plasmid, specific to the modification to be carried out, contains one or more cassettes of expression of gRNA (targeting typically different regions of bacterial DNA) as well as a repair matrix allowing, by a homologous recombination mechanism, the replacement of a portion of the bacterial DNA targeted by Cas with a sequence of interest.
• gRNA targeting typically different regions of bacterial DNA
• the cas gene and / or the gRNA expression cassette (s) are placed under the control of constitutive or inducible, preferably inducible, expression promoters known to those skilled in the art (for example described in WO2017 / 064439 and incorporated by reference to the present description), and preferably different but inducible by the same inducing agent.
• the gRNAs can be natural, synthetic or produced by recombinant techniques. These gRNAs can be prepared by any methods known to those skilled in the art, such as, for example, chemical synthesis, in vivo transcription or amplification techniques. When multiple gRNAs are used, the expression of each gRNA can be controlled by a different promoter. Preferably, the promoter used is the same for all the gRNAs. The same promoter can in a particular embodiment be used to allow the expression of several, for example of only a few, or in other words of all or part of the gRNAs intended to be expressed.
• At least one of said "first" and “second” nucleic acids further codes for one or more RNAs guides (gRNA) or the genetic tool further comprises one or more guide RNAs, each guide RNA comprising an RNA binding structure with G Cas enzyme and a sequence complementary to the targeted portion of the bacterial DNA, and iii) at least one of said “first” and “second” nucleic acids further comprises a sequence coding for an anti-CRISPR protein placed under the control of an inducible promoter, or the genetic tool further comprises a “third” nucleic acid coding for a anti-CRISPR protein placed under the control of an inducible promoter, preferably different from the promoters controlling the expression of Cas and / or of the RNA (s) and inducible by an inducing agent vane.
• gRNA RNAs guides
• the anti-CRISPR protein is capable of inhibiting, preferably neutralizing, the action of nuclease, preferably during the phase of introduction of the nucleic acid sequences of the genetic tool into the bacterial strain of interest.
• a particular process involving CRISPR technology capable of being implemented in the context of the present invention for transforming, and typically for genetically modifying by homologous recombination, a bacterium of the genus Clostridium, comprises the following steps:
• step b) culturing the transformed bacterium obtained at the end of step a) on a medium which does not contain (or under conditions which do not involve) the agent inducing the expression of the anti-CRISPR protein, typically allowing expression of the Cas / gRNA ribonucleoprotein complex.
• the method further comprises, during or after step b), a step of inducing the expression of the inducible promoter (s) controlling the expression of Cas and / or of the guide RNA (s) when such or such promoters are present within the genetic tool, in order to allow the genetic modification of interest of the bacterium once said genetic tool is introduced into said bacterium.
• the induction is carried out using a substance which makes it possible to remove the inhibition of expression linked to the selected inducible promoter.
• the method comprises an additional step c) of elimination of the nucleic acid containing the repair matrix (the bacterial cell then being considered as "cure” of said nucleic acid) and / or of elimination guide RNA (s) or sequences encoding the guide RNA (s) introduced with the genetic tool during step a).
• the method comprises one or more additional steps, subsequent to step b) or to step c), of introducing an umpteenth, for example third, quabidiag, fifth, etc., nucleic acid containing a repair matrix distinct from that (s) already introduced and one or more guide RNA expression cassettes allowing the integration of the sequence of interest contained in said distinct repair matrix in a targeted area of the genome of the bacteria, in the presence of an agent inducing the expression of the anti-CRISPR protein, each additional step being followed by a step of culturing the bacteria thus transformed on a medium not containing the agent inducing the expression of the anti-CRISPR protein, typically allowing the expression of the ribonucleoprotein complex Cas / gRNA.
• the bacteria is transformed using a CRISPR tool or a method, such as those described above, using (for example coding) an enzyme responsible for cutting at least one strand of the target sequence of interest, in which the enzyme is in a particular mode a nuclease, preferably a Cas type nuclease, preferably selected from a Cas9 enzyme and a MAD7 enzyme.
• a nuclease preferably a Cas type nuclease, preferably selected from a Cas9 enzyme and a MAD7 enzyme.
• the target sequence of interest is a sequence, for example the catB gene, coding for an enzyme which confers on the bacteria resistance to one or more antibiotics, preferably to one or more antibiotics belonging to the class of amphenicols, typically an amphenicol-O-acetyltransferase such as a chloramphenicol-O-acetyltransferase, a sequence controlling the transcription of the coding sequence or a sequence flanking said coding sequence.
• Cas9 proteins usable in the present invention include, but are not limited to, the Cas9 proteins of S. pyogenes (cf. SEQ ID NO: 1 of application WO2017 / 064439 and NCBI entry number: WP_010922251.1), Streptococcus thermophilus, Streptococcus mutans, Campylobacter jejuni, Pasteurella multocida, Francisella novicida, Neisseria meningitidis, Neisseria lactamica and Lministeronella pneumophila (cf. Fonfara et al, 2013; Makarova et al, 2015).
• S. pyogenes cf. SEQ ID NO: 1 of application WO2017 / 064439 and NCBI entry number: WP_010922251.1
• Streptococcus thermophilus cf. SEQ ID NO: 1 of application WO2017 / 064439 and NCBI entry number: WP_010922251.1
• the nuclease MAD7 (whose amino acid sequence corresponds to the sequence SEQ ID NO: 72), also identified as "Case 12" or “Cpfl", can otherwise be advantageously used in the context of the present invention by combining with one or more RNAs known to those skilled in the art capable of binding to such a nuclease (cf. Garcia-Doval et al., 2017 and Stella S. et al., 2017).
• the sequence coding for the nuclease MAD7 is a sequence optimized for being easily expressed in strains of Clostridium, preferably the sequence SEQ ID NO: 71.
• the anti-CRISPR protein is typically a protein " anti-Cas ”, ie a protein capable of inhibiting or preventing / neutralizing the action of Cas, and / or a protein capable of inhibiting or preventing / neutralizing the action of a CRISPR / Case, for example of a CRISPR / Cas type II system when the nuclease is a Cas9 nuclease.
• the anti-CRISPR protein is advantageously an “anti-Cas9” protein, for example selected from AcrlIAl, AcrIIA2, AcrIIA3, AcrIIA4, AcrIIA5, AcrlICl, AcrIIC2 and AcrIIC3 (Pawluk et al, 2018).
• the “anti-Cas9” protein is AcrIIA2 or AcrIIA4.
• Such a protein is typically capable of very significantly limiting, ideally preventing, the action of Cas9, for example by binding to the enzyme Cas9.
• an “anti-MAD7” protein for example the AcrVAl protein (Marino et al, 2018).
• the editing / repair template may itself include one or more nucleic acid sequences or portions of nucleic acid sequence corresponding to natural sequences and / or synthetic, coding and / or non-coding.
• the matrix can also comprise one or more “foreign” sequences, ie naturally absent from the genome of bacteria belonging to the genus Clostridium or from the genome of particular species of said genus.
• the matrix can also include a combination of sequences.
• the genetic tool used in the context of the present invention allows the repair matrix to guide the incorporation into the bacterial genome of a nucleic acid of interest, typically of a DNA sequence or portion of sequence comprising at least 1 base pair (bp), preferably at least 1, 2, 3, 4, 5, 10, 15, 20, 50, 100, 1,000, 10,000, 100,000 or 1,000,000 bp, typically between 1 bp and 20 kb, for example 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or 13 kb, or between 1 bp and 10 kb, preferably between 10 bp and 10 kb or between 1 kb and 10 kb, for example between lpb and 5 kb, between 2 kb and 5 kb, or between 2.5 or 3 kb and 5 kb.
• bp base pair
• the expression of the DNA sequence of interest allows the bacteria of the genus Clostridium to ferment (typically simultaneously) several different sugars, for example at least two different sugars, typically at least two different sugars among the sugars comprising 5 carbon atoms (such as glucose or mannose) and / or among the sugars comprising 6 carbon atoms (such as xylose, arabinose or fructose), preferably at least three different sugars, selected for example from glucose, xylose and mannose; glucose, arabinose and mannose; and glucose xylose and arabinose.
• the DNA sequence of interest codes for at least one product of interest, preferably a product promoting the production of solvent by the bacterium of the genus Clostridium, typically at least one protein of interest, for example an enzyme; a membrane protein such as a transporter; a protein from the maturation of other proteins (chaperone protein); a transcription factor; or a combination of these.
• the method according to the invention is based on the use of type II introns, and for example implements the ClosTron® genetic technology / tool or the Targetron® genetic tool.
• Targetron® technology is based on the use of a reprogrammable group II intron (based on the Lactococcus lactis intron Ll.ltrB), capable of integrating the bacterial genome quickly at a desired locus (Chen et al., 2005 , Wang et al., 2013), typically for the purpose of inactivating a targeted gene.
• the mechanisms of recognition of the edited area as well as of insertion into the genome by back-splicing are based on a homology between the intron and said area on the one hand, and on the activity of a protein (ltrA) d 'somewhere else.
• ClosTron® technology is based on a similar approach, supplemented by the addition of a selection marker in the intron sequence (Heap et al., 2007).
• This marker makes it possible to select the integration of the intron into the genome, and therefore facilitates the obtaining of the desired mutants.
• This genetic system also exploits type I introns. Indeed, the selection marker (called RAM for retrotransposition-activated marker) is interrupted by such a genetic element, which prevents its expression from the plasmid (a more precise description of the system: Zhong et al.). Splicing of this genetic element occurs before integration into the genome, which makes it possible to obtain a chromosome having an active form of the resistance gene.
• An optimized version of the system includes FLP / FRT sites upstream and downstream of this gene, which makes it possible to use the FRT recombinase to eliminate the resistance gene (Heap et al., 2010).
• the method according to the invention is based on the use of an allelic exchange tool, and for example implements the ACE® technology / genetic tool.
• the ACE® technology is based on the use of an auxotrophic mutant (for uracil in C. acetobutylicum ATCC 824 by deletion of the pyrE gene, which also causes resistance to 5-fluoroorotic acid (A-5-FO) ; Heap et al., 2012).
• the system uses the allelic exchange mechanism, well known to those skilled in the art. Following a transformation with a pseudo-suicide vector (with very low copies), the integration of the latter into the bacterial chromosome by a first allelic exchange event is selected thanks to the resistance gene initially present on the plasmid.
• the integration step can be carried out in two different ways, either within the pyrE locus or within another locus:
• the pyrE gene is also placed on the plasmid, without however being expressed (no functional promoter).
• the second recombination restores a functional pyrE gene and can then be selected by auxotrophy (minimum medium, containing no uracil).
• auxotrophy minimum medium, containing no uracil
• the non-functional pyrE gene also having a selectable character (sensitivity to A-5-FO), other integrations can then be envisaged on the same model, by successively alternating the state of pyrE between functional and non-functional.
• a genomic zone allowing expression of the counter-selection marker after recombination is targeted (typically, as an operon after another gene, preferably a highly expressed gene). This second recombination is then selected by auxotrophy (minimum medium containing no uracil).
• the targeted sequence is preferably a sequence flanking the sequence encoding an enzyme of interest, preferably, as explained above, an amphenicol-O-acetyltransferase.
• Another subject of the invention relates to a transformed and / or genetically modified bacterium, typically a bacterium of the genus Clostridium belonging to a species or corresponding to one of the subclades described by the inventors, obtained using a process as described by the inventors in the present text, as well as any derived bacteria, clone, mutant or genetically modified version thereof.
• a transformed and / or genetically modified bacterium typically a bacterium of the genus Clostridium belonging to a species or corresponding to one of the subclades described by the inventors, obtained using a process as described by the inventors in the present text, as well as any derived bacteria, clone, mutant or genetically modified version thereof.
• a bacterium thus transformed and / or genetically modified typical of the invention is a bacterium no longer expressing an enzyme conferring resistance to one or more antibiotics, in particular a bacterium no longer expressing an amphenicol-O-acetyltransferase, for example a bacterium expressing in the wild the catB gene, and devoid of said catB gene or incapable of expressing said catB gene once transformed and / or genetically modified thanks to the invention.
• the bacterium thus transformed and / or genetically modified thanks to the invention is made sensitive to an amphenicol, for example to an amphenicol as described in the present text, in particular to chloramphenicol or thiamphenicol.
• a particular example of a genetically modified bacterium preferred according to the invention is the bacteria identified in the present description as C. beijerinckii DSM 6423 D catB as registered under the deposit number LMG P-31151 with the Belgian Co-ordinated Collections of Micro-organisms (“BCCM”, KL Ledeganckstraat 35, B-9000 Gent - Belgium) on December 6, 2018.
• BCCM Belgian Co-ordinated Collections of Micro-organisms
• KL Ledeganckstraat 35, B-9000 Gent - Belgium Belgian Co-ordinated Collections of Micro-organisms
• the description also relates to any derived bacteria, clone, mutant or genetically modified version of said bacteria remaining sensitive to an amphenicol such than thiamphenicol and / or chloramphenicol.
• the transformed and / or genetically modified bacterium according to the invention does not express an enzyme which gives it resistance to one or more antibiotics, in particular an amphenicol-O-acetyltransferase such as chloramphenicol-O- acetyltransferase, for example the bacteria C. beijerinckii DSM 6423 D catB, is still capable of being transformed, and preferably genetically modified.
• an enzyme which gives it resistance to one or more antibiotics in particular an amphenicol-O-acetyltransferase such as chloramphenicol-O- acetyltransferase, for example the bacteria C. beijerinckii DSM 6423 D catB
• a nucleic acid for example a plasmid as described in the present description, for example in the experimental part.
• An example of a nucleic acid capable of being advantageously used is the plasmid pCas9 aCr of sequence SEQ ID NO: 23 (described in
• a particular aspect of the invention relates in fact to the use of a bacterium genetically modified according to the invention, preferably the bacterium C. beijerinckii DSM 6423 AcatB deposited under the number LMG P-31151 or a genetically modified version of the latter, for example using one of the genetic tools or methods described in this text, to produce, through the expression of the nucleic acid (s) of interest introduced voluntarily into its genome, one or more several solvents, preferably at least isopropanol, preferably on an industrial scale.
• a bacterium genetically modified according to the invention preferably the bacterium C. beijerinckii DSM 6423 AcatB deposited under the number LMG P-31151 or a genetically modified version of the latter, for example using one of the genetic tools or methods described in this text, to produce, through the expression of the nucleic acid (s) of interest introduced voluntarily into its genome, one or more several solvents, preferably at least isopropanol, preferably on an industrial scale
• the invention also relates to a kit (kit) comprising (i) a nucleic acid of interest according to the invention, typically a DNA fragment recognizing a coding sequence, or controlling the transcription of a coding sequence, an enzyme of interest in a bacterium of the genus Clostridium, in particular in a bacterium capable of carrying out an IBE fermentation as described in the present text, and (ii) at least one tool, preferably several tools, selected from among the elements of a tool genetic modification making it possible to transform, and typically genetically modify a bacterium of the genus Clostridium, in order to produce an improved variant of said bacterium; nucleic acid as gRNA; nucleic acid as a repair matrix; at least one pair of primers, for example a pair of primers as described in the context of the present invention; and an inducer allowing the expression of a protein coded by said tool, for example a nuclease of the Cas9 or MAD7 type.
• kit comprising (i)
• the genetic modification tool for transforming, and typically genetically modifying a bacteria of the genus Clostridium may for example be selected from a CRISPR tool, a tool based on the use of type II introns and an allelic exchange tool , as explained above.
• the kit may also comprise one or more inducers adapted to the selected inducible promoter (s) possibly used within the genetic tool to control the expression of the nuclease used and / or one or more guide RNAs.
• inducers adapted to the selected inducible promoter (s) possibly used within the genetic tool to control the expression of the nuclease used and / or one or more guide RNAs.
• a particular kit according to the invention allows the expression of a nuclease comprising a label (or "tag").
• kits according to the invention may also comprise one or more consumables such as a culture medium, at least one competent bacterium of the genus Clostridium (ie conditioned for transformation), at least one gRNA, a nuclease, one or several selection molecules, or an explanatory note.
• consumables such as a culture medium, at least one competent bacterium of the genus Clostridium (ie conditioned for transformation), at least one gRNA, a nuclease, one or several selection molecules, or an explanatory note.
• the description also relates to the use of a kit according to the invention, or of one or more of the elements of this kit, for the implementation of a process of transformation and ideally of genetic modification of a bacterium of the genus Clostridium described in the present text, and / or for the production of solvent (s) or biofuel (s), or mixtures thereof, preferably on an industrial scale, using a bacterium of the genus Clostridium, preferably a bacterium of the genus Clostridium naturally producing isopropanol.
• Solvents capable of being produced are typically acetone, butanol, ethanol, isopropanol or a mixture thereof, typically an ethanol / isopropanol, butanol / isopropanol, or ethanol / butanol mixture, preferably a isopropanol / butanol mixture.
• bacteria transformed according to the invention typically allows the production per year on an industrial scale of at least 100 tonnes of acetone, at least 100 tonnes of ethanol, at least 1000 tonnes of isopropanol , at least 1,800 tonnes of butanol, or at least 40,000 tonnes of a mixture thereof.
• the examples and figures below are intended to illustrate the invention more fully without limiting its scope.
• Figure 1 represents the classification of 30 Clostridium solventogenic strains, according to Poehlein et al., 2017. Note that the subclade C. beijerinckii NRRL B-593 is also identified in the literature as C. beijerinckii DSM 6423.
• Figure 2 represents the Map of the plasmid pCas9ind-Aca / B
• Figure 3 represents the Map of the plasmid pCas9acr
• Figure 4 represents the Map of the plasmid pEC750S- “ppHR
• FIG 5 shows the Map of the plasmid pEX-A2-gRNA-wpp.
• Figure 6 represents the Map of the plasmid pEC750S-A “pp.
• FIG 7 shows the Map of plasmid pEC750C-A "pp
• Figure 8 represents the Map of pGRNA-pNF2
• Figure 9 represents the PCR Amplification of the catB gene in the clones resulting from the bacterial transformation of the C. beijerinckii DSM 6423 strain.
• Figure 10 represents the Growth of C. beijerinckii DSM6423 WT and Aral B strains on 2YTG medium and 2YTG thiamphenicol selective medium.
• Figure 11 represents the Induction of the CRISPR / Cas9acr system in transformants of the C. beijerinckii DSM 6423 strain containing pCas9, Cr and a gRNA expression plasmid targeting upp, with or without repair matrix .
• Em erythromycin
• Tm thiamphenicol
• aTc anhydrotetracycline
• ND undiluted.
• FIG. 12A represents the Modification of the upp locus of C. beijerinckii DSM 6423 via the CRISPR / Cas9 system.
• FIG. 12A represents the genetic organization of the upp locus: genes, target site of the gRNA and repair matrices, associated with the regions of corresponding homologies on F genomic DNA.
• the priming hybridization sites for PCR verification (RH010 and RH011) are also indicated.
• Figure 12 represents the Modification of the upp locus of C. beijerinckii DSM 6423 via the CRISPR / Cas9 system.
• Figure 12B shows the amplification of the upp locus using primers RH010 and RH011. An amplification of 1680 bp is expected in the case of a wild-type gene, against 1090 bp for a modified upp gene.
• M size marker 100 bp - 3 kb (Lonza); WT, wild strain.
• Figure 13 represents the PCR Amplification verifying the presence of the plasmid pCas9i nd . in C. beijerinckii 6423 A catB.
• Figure 14 represents the PCR Amplification (“900 bp) verifying the presence or not of the natural plasmid pNF2 before induction (positive control 1 and 2) then after induction on medium containing aTc from the CRISPR-Cas9 system .
• Figure 15 represents the genetic tool for modification of bacteria, adapted to bacteria of the genus Clostridium, based on the use of two plasmids (cf. WO2017 / 064439, Wasels et al., 2017).
• Figure 16 represents the Map of the plasmid pCas9ind-gRNA_ca / R.
• Figure 17 represents the CRISPR / Cas9 system used for genome editing as a genetic tool allowing to create, using the nuclease Cas9, one or more double strand cleavages in F directed genomic DNA (s) by gRNA.
• GRNA guide RNA
• PAM Protospacer Adjacent Motif. Figure modified from Jinek et al, 2012.
• Figure 18 represents the repair by homologous recombination of a double strand cut induced by Cas9.
• PAM Protospacer Adjacent Motif.
• Figure 19 shows the use of CRISPR / Cas9 at Clostridium.
• ermB erythromycin resistance gene
• catP SEQ ID NO: 70
• tetR gene whose expression product represses transcription from Pcm-tet02 / l
• Pcm-2tet01 and Pcm-tet02 / l anhydrotetracycycline-inducible promoters, "aTc” (Dong et al., 2012); miniPthl, constitutive promoter (Dong et al., 2012).
• Figure 20 shows the map of plasmid pCas9, Cr ( SEQ ID NO: 23).
• ermB erythromycin resistance gene
• rep origin of replication in E. coli
• repH origin of replication in C. acetobutylicum
• Tthl thiolase terminator
• miniPthl constitutive promoter
• Pcm-tet02 / l promoter repressed by the product of tetR and inducible by G anhydrotetracycline, "aTc” (Dong et al., 2012)
• Pbgal promoter repressed by the lacR product and inducible by lactose (Hartman et al., 2011); acrIIA4, gene encoding the anti-CRISPR protein AcrII14; bgaR, a gene whose expression product represses transcription from Pbgal.
• Figure 21 represents the relative transformation rate of C. acetobutylicum DSM 792 containing pCas9i nd (SEQ ID NO: 22) or pCas9 aCr (SEQ ID N: 23).
• the frequencies are expressed in number of transformants obtained per pg of DNA used during the transformation, related to the transformation frequencies of pEC750C (SEQ ID NO: 106), and represent the means of at least two independent experiments.
• Figure 22 represents the induction of the CRISPR / Cas9 system in transformants of the strain DSM 792 containing pCas9, Cr and a gRNA expression plasmid targeting bdhB, with (SEQ ID NO: 79 and SEQ ID NO: 80) or without (SEQ ID NO: 105) repair matrix.
• Em erythromycin; Tm, thiamphenicol; aTc, anhydrotetracycline; ND, undiluted.
• FIG. 23 represents the modification of the bdh locus of C. acetobutylicum DSM792 via the CRISPR / Cas9 system.
• Figure 23 A represents the genetic organization of the bdh locus. The homologies between the repair matrix and genomic DNA are highlighted using light gray parallelograms. The hybridization sites of primers VI and V2 are also shown.
• Figure 23B represents the modification of the bdh locus of C. acetobutylicum DSM792 via the CRISPR / Cas9 system.
• FIG. 23B represents the amplification of the bdh locus using primers VI and V2.
• FIG. 24 represents the transformation efficiency (in colonies observed per ⁇ g of transformed DNA) for 20 ⁇ g of plasmid pCas9 md in the strain of C. beijerinckii DSM6423.
• the error bars represent the standard error of the mean for a biological triplicate.
• FIG. 25 represents the map of the plasmid pNF3.
• Figure 26 shows the map of plasmid pEC751S.
• Figure 27 shows the map of plasmid pNF3S.
• Figure 28 shows the map of plasmid pNF3E.
• Figure 29 shows the map of plasmid pNF3C.
• FIG. 30 represents the transformation efficiency (in colonies observed per pg of transformed DNA) of the plasmid pCas9i nd in three strains of C. beijerinckii DSM 6423.
• the error bars correspond to the standard deviation from the average for a biological duplicate.
• FIG. 31 represents the transformation efficiency (in colonies observed per pg of transformed DNA) of the plasmid pEC750C in two strains derived from C. beijerinckii DSM 6423.
• the error bars correspond to the standard deviation from the average for a biological duplicate.
• Figure 32 represents the transformation efficiency (in colonies observed per pg of transformed DNA) of the plasmids pEC750C, pNF3C, pFWOl and pNF3E in the strain C. beijerinckii IFP963 A catB ApNF2.
• the error bars correspond to the standard deviation from the mean for a biological triplicate.
• FIG. 33 represents the efficiency of transformation (in colonies observed per pg of transformed DNA) of the plasmids pFWO1, pNF3E and pNF3S in the strain C. beijerinckii NCIMB 8052.
• C. acetobutylicum DSM 792 was cultured in 2YTG medium (Tryptone 16 gl 1 , yeast extract 10 gl 1 , glucose 5 gl 1 , NaCl 4 gl 1 ).
• E. coli NEB10B was cultured in LB medium (Tryptone 10 gl 1 , yeast extract 5 gl 1 , NaCl 5 gl 1 ).
• Solid media were performed by adding 15 gl 1 agarose liquid environments. Erythromycin (at concentrations of 40 or 500 mg.l 1 respectively in 2YTG or LB medium), chloramphenicol (25 or 12.5 mg.l 1 respectively in solid or liquid LB) and thiamphenicol (15 mg. l 1 in medium 2YTG) were used when necessary.
• Manipulation of nucleic acids were used when necessary.
• the plasmid pCas9, Cr (SEQ ID NO: 23), presented in FIG. 20, was constructed by cloning the fragment (SEQ ID NO: 81) containing bgaR and acrIIA4 under the control of the Pbgal promoter synthesized by Eurofins Genomics at the site level Sacl of the vector pCas9 md (Wasels et al, 2017).
• the plasmid pGRNA md (SEQ ID NO: 82) was constructed by cloning an expression cassette (SEQ ID NO: 83) of a gRNA under the control of the promoter Pcm-2tet01 (Dong et al, 2012) synthesized by Eurofins Genomics at the SacI site of the vector pEC750C (SEQ ID NO: 106) (Wasels et al, 2017).
• the plasmids pGRNA-xylB (SEQ ID NO: 102), pGRNA-xylR (SEQ ID NO: 103), pGRNA-glcG (SEQ ID NO: 104) and pGRNA-bdhB (SEQ ID NO: 105) were constructed by cloning the respective primer pairs 5'-TCATGATTTCTCCATATTAGCTAG-3 'and 5'-
• the plasmid pGRNA-D bdhB (SEQ ID NO: 79) was constructed by cloning the DNA fragment obtained by overlapping PCR assembly of the PCR products obtained with the primers 5’- ATGCATGGATCCAAACGAACCCAAAAAGAAAGTTTC-3 ’and 5’-
• the plasmid pGRNA-AbdhAAbdhB (SEQ ID NO: 80) was constructed by cloning the DNA fragment obtained by overlapping PCR assembly of the PCR products obtained with the primers 5’- ATGCATGGATCCAAACGAACCCAAAAAGAAAGTTTC-3 ’and 5’-
• C. acetobutylicum DSM 792 was transformed according to the protocol described by Mermelstein et al, 1993.
• the selection of transformants of C. acetobutylicum DSM 792 already containing an expression plasmid Cas9 (pCas9 md or pCas9 acr ) transformed with a plasmid containing an expression cassette for an gRNA was carried out on solid 2YTG medium containing erythromycin (40 mg.l 1 ), thiamphenicol (15 mg.l 1 ) and lactose (40 nM).
• the induction of the expression of cas9 was carried out via the growth of the transformants obtained on a solid 2YTG medium containing erythromycin (40 mg.l 1 ), thiamphenicol (15 mg.l 1 ) and the inducing agent cas9 expression and gRNA, aTc (1 mg.l 1 ).
• Control of the editing of the genome of C. acetobutylicum DSM 792 at the locus of the bdhA and bdhB genes was carried out by PCR using the enzyme Q5® High-Fidelity DNA Polymerase (NEB) using primers VI (5 '- AC AC ATT GA AGGGAGCTTTT-3') and V2 (5'- GGCAACAACATCAGGCCTTT- 3 ').
• NEB High-Fidelity DNA Polymerase
• the targeting plasmid containing the bdhB-targeting gRNA expression cassette (pGRNA-bdhB - SEQ ID NO: 105) as well as two derived plasmids containing repair matrices allowing the deletion of the bdhB gene alone (pG RN A-AN /// # - SEQ ID NO: 79) or bdhA and bdhB genes (pGRNA- AbdhAAbdhB - SEQ ID NO: 80) were transformed into strain DSM 792 containing pCas9 md (SEQ ID NO: 22) or pCas9 acr ( SEQ ID NO: 23).
• Table 2 [Table 2]
• Transformation frequencies of the DSM 792 strain containing pCas9 md or pCas9 aCr with plasmids targeting bdhB are expressed in number of transformants obtained per pg of DNA used during the transformation, and represent the means of at least two independent experiments.
• the first plasmid, pCas9i nd contains cas9 under the control of an aTc-inducible promoter
• the second plasmid derived from pEC750C, contains the cassette for expression of a gRNA (placed under the control of a second promoter inducible to aTc) as well as an editing matrix making it possible to repair the double strand break system-induced.
• gRNAs still seemed to be too toxic, despite the control of their expression as well as that of Cas9 using promoters inducible to aTc, consequently limiting the efficiency of transformation of bacteria by the genetic tool and therefore the modification of the chromosome.
• the cas9 expression plasmid was modified, via the insertion of an anti-CRISPR gene, acrIIA4, under the control of a lactose-inducible promoter.
• the transformation efficiencies of different gRNA expression plasmids have thus been improved very significantly, making it possible to obtain transformants for all the plasmids tested.
• C. beijerinckii DSM 6423 was cultured in 2YTG medium (Tryptone 16 g L 1 , yeast extract 10 g L 1 , glucose 5 g L 1 , NaCl 4 g L 1 ).
• E. coli NEB 10-beta and INV 110 were cultured in LB medium (Tryptone 10 g L 1 , yeast extract 5 g L 1 , NaCl 5 g L 1 ).
• the solid media were produced by adding 15 g L 1 of agarose to the liquid media.
• Erythromycin at concentrations of 20 or 500 mg L 1 respectively in 2YTG or LB medium
• chloramphenicol 25 or 12.5 mg L 1 respectively in solid or liquid LB
• thiamphenicol 15 mg L 1 in 2YTG medium
• spectinomycin at concentrations of 100 or 650 mg L 1 respectively in LB or 2YTG medium
• AcatB_fwd T GTT AT GG ATT AT A AGCGGCTCGAGGACGTC A A ACC AT GTT A ATC ATT GC AcatB_rev: AATCTATCACTGATAGGGACTCGAGCAATTTCACCAAAGAATTCGCTAGC AcatB_gRNA_rev
• RH002 TCTATCTCCAGCTCTAGACCATTATTATTCCTCCAAGTTTGCT
• RH003 AT A AT GGTCT AGAGCT GGAGAT AGATT ATTT GGT ACT A AG
• RH004 TATGACCATGATTACGAATTCGAGCTCGAAGCGCTTATTATTGCATTAGC pEX-fwd: C AGATT GT ACT GAGAGT GC ACC
• RH025 T AGT AT GCCGCC ATT ATT AC GAC A
• RH 134 GTCGACGTGGAATTGTGAGC
• pNF2_fwd GGGCGC ACTT AT AC ACC ACC
• This fragment A catB contains the synthesized DNA fragment A catB cloned into the plasmid pEX-A258.
• This fragment A catB comprises i) a cassette for expression of a guide RNA targeting the catB gene (chloramphenicol resistance gene coding for a chloramphenicol-O-acetyltransferase - SEQ ID NO: 18) from C. beijerinckii DSM6423 under the control of a promoter inducible to anhydrotetracycline (expression cassette: SEQ ID NO: 19), and ii) an editing matrix (SEQ ID NO: 20) comprising 400 bp homologs located upstream and downstream of the catB gene.
• a guide RNA targeting the catB gene chloramphenicol resistance gene coding for a chloramphenicol-O-acetyltransferase - SEQ ID NO: 18
• SEQ ID NO: 19 promoter inducible to anhydrotetracycline
• Plasmid N ° 3 pCas9acr (cf. Figure 3 and SEQ ID NO: 23)
• Plasmid N ° 4 pEC750S-wppHR (cf. Figure 4 and SEQ ID NO: 24)
• SEQ ID NO: 25 a repair matrix used for the deletion of the upp gene and consisting of two homologous DNA fragments upstream and downstream of the upp gene (respective sizes: 500 (SEQ ID NO: 26) and 377 (SEQ ID NO: 27) base pairs).
• the assembly was obtained using the Gibson cloning system (New England Biolabs, Gibson assembly Master Mix 2X). To do this, the upstream and downstream parts were amplified by PCR from the genomic DNA of the strain DSM 6423 (cf.
• This plasmid comprises the gRNA-upp DNA fragment corresponding to an expression cassette (SEQ ID NO: 29) of a guide RNA targeting the upp gene (protospacer targeting upp (SEQ ID NO: 31)) under the control of a constitutive promoter (non-coding RNA with sequence SEQ ID NO: 30), inserted into a replication plasmid named pEX-A2.
• Its base is the plasmid pEC750S- "ppHR (SEQ ID NO: 24) and additionally contains the DNA fragment comprising a cassette for the expression of a guide RNA targeting the upp gene under the control of a constitutive promoter.
• This fragment was inserted into a pEX-A2, called pEX-A2-gRNA-upp.
• the insert was then amplified by PCR with the primers pEX-fwd and pEX-rev, then digested with the restriction enzymes Xhol and Ncol. Finally, this fragment was cloned by ligation into pEC750S- "ppHR previously digested with the same restriction enzymes to obtain pEC750S-A" pp.
• the cassette containing the guide RNA as well as the repair matrix were then amplified with the primers pEC750C-fwd and M13-rev.
• the amplicon was digested by enzymatic restriction with the enzymes Xhol and Sacl, then cloned by enzymatic ligation in pEC750C to obtain pEC750C-Aupp.
• This plasmid has pEC750C as its base and contains a cassette for the expression of a guide RNA targeting the plasmid pNF2 (SEQ ID NO: 118).
• RNA targeting the catB locus amplified by PCR (primers AcatB_fwd and AcatB_gRNA_rev) and cloned in pCas9ind (described in patent application WO2017 / 064439) after digestion of the various DNAs with the restriction enzyme Xhol and ligation.
• Plasmid N ° 10 pNF3 (cf. Figure 25 and SEQ ID NO: 119) It contains part of pNF2, comprising in particular the origin of replication and a gene coding for a plasmid replication protein (CIBE_p20001), amplified with the primers RH021 and RH022. This PCR product was then cloned at the SalI and BamHI restriction sites in the plasmid pUC19 (SEQ ID NO: 117).
• pEC750C contains all the elements of pEC750C (SEQ ID NO: 106), except the chloramphenicol catP resistance gene (SEQ ID NO: 70).
• SEQ ID NO: 70 The latter has been replaced by the aad9 gene from Enterococcus faecalis (SEQ ID NO: 130), which confers resistance to spectinomycin.
• This element was amplified with the primers aad9-fwd2 and aad9-rev from the plasmid pMTL007S-El (SEQ ID NO: 120) and cloned in the Avall and Hpal sites of pEC750C, in place of the catP gene (SEQ ID NO : 70).
• the plasmids were introduced and replicated in a strain of E. coli dam dcm (INV 110, Invitrogen). This makes it possible to eliminate the Dam and Dcm type methylations on the plasmid pCas9ind-Aca / B before introducing it by transformation into the strain DSM 6423 according to the protocol described by Mermelstein et al. (1993), with the following modifications: the strain is transformed with a larger quantity of plasmid (20 pg), at an ODeoo of 0.8, and using the following electroporation parameters: 100 W, 25 pF , 1400 V.
• a clone of the C. beijerinckii DSM 6423 AcatB strain was previously transformed with the vector pCas9 acr which did not show methylation at the levels of the patterns recognized by dam and dcm type methyltransferases (prepared from an Escherichia coli bacterium having the dam dcmj genotype.
• the verification of the presence of the plasmid pCas9 aCr maintained in the strain C. beijerinckii DSM 6423 was verified by PCR on colony with the primers RH025 and RH 134.
• a clone resistant to erythromycin was then transformed with pEC750C-Awpp previously demethylated.
• the colonies thus obtained were selected on medium containing erythromycin (20 pg / mL), thiamphenicol (15 pg / mL) and lactose (40 mM).
• a clone of the C. beijerinckii DSM 6423 AcatB strain was previously transformed with the vector pCas9 md which does not exhibit methylation at the levels of the patterns recognized by the Dam and Dcm methyltransferases (prepared from an Escherichia coli bacterium having the dam dcm genotype).
• the presence of the plasmid pCas9 md within the strain C. beijerinckii DSM6423 was verified by PCR with the primers pCas9 md _fwd (SEQ ID NO: 42) and pCas9; nd _rev (SEQ ID NO: 43) (see Figure 13).
• An erythromycin-resistant clone was then used to transform pGRNA-pNF2, prepared from an Escherichia coli bacterium having the dam dcm genotype.
• the inventors managed to introduce and maintain different plasmids within the Clostridium beijerinckii DSM 6423 strain. They managed to delete the catB gene using a CRISPR-Cas9 type tool based on the use of a single plasmid. The sensitivity to thiamphenicol of the recombinant strains obtained was confirmed by tests in agar medium.
• Plasmids prepared in the strain of E. coli NEB 10-beta are also used to transform the strain C. beijerinckii NCIMB 8052.
• the plasmids are previously introduced and replicated in a strain of E. coli dam dcm (INV110, Invitrogen). This makes it possible to eliminate the Dam and Dcm methylations on the plasmids of interest before introducing them by transformation into the strain DSM 6423.
• the transformation is otherwise carried out similarly for each strain, that is to say according to the protocol described by Mermelstein et al. 1992, with the following modifications: the strain is transformed with a larger quantity of plasmid (5-20 pg), at a DCLoo of 0.6-0.8, and the electroporation parameters are 100 W, 25 pF, 1400 V. After 3 hours of regeneration in 2YTG, the bacteria are spread on a Petri dish (2YTG agar) containing the desired antibiotic (erythromycin: 20-40 pg / mL; thiamphenicol: 15 pg / mL; spectinomycin: 650 pg / mL). Comparison of transformation efficiencies of C. beijerinckii DSM 6423 strains
• Transformations were carried out in biological duplicate in the following C. beijerinckii strains: wild DSM 6423, DSM 6423 AcatB and DSM 6423 AcalB ApNF2 ( Figure 30).
• the vector pCas9 md notably difficult to use for modifying a bacterium because it does not allow good transformation efficiencies, was used. It also contains a gene which confers resistance to erythromycin, an antibiotic to which the three strains are sensitive.
• the plasmids pNF3E and pNF3C were introduced into the strain C. beijerinckii DSM 6423 AcatB ApNF2.
• the use of vectors containing genes for resistance to erythromycin or to chloamphenicol makes it possible to compare the transformation efficiency of the vector according to the nature of the resistance gene.
• the plasmids pFWOl and pEC750C were also transformed. These two plasmids contain genes for resistance to different antibiotics (erythromycin and thiamphenicol respectively) and are commonly used to transform C. beijerinckii and C. acetobutylicum.
• the vectors based on pNF3 exhibit excellent transformation efficiency, and are in particular usable in C. beijerinckii DSM 6423 AcatB ApNF2.
• pNF3E which contains a gene for resistance to erythromycin shows a transformation efficiency clearly higher than that of pFWOl, which comprises the same resistance gene.
• This same plasmid could not be introduced into the wild C. beijerinckii DSM 6423 strain (0 colonies obtained with 5 ⁇ g of plasmids transformed into biological duplicate), which demonstrates the impact of the presence of the natural plasmid pNF2.
• the inventors carried out a comparative analysis of the transformation efficiencies of the plasmids pFWOl, pNF3E and pNF3S in the strain ABE C. beijerinckii NCIMB 8052 ( Figure 33) .
• the NCIMB 8052 strain being naturally resistant to thiamphenicol, pNF3S, conferring resistance to spectinomycin, was used in place of pNF3C.
• the results demonstrate that the strain NCIMB 8052 is transformable with the plasmids based on pNF3, which proves that these vectors are applicable to the species C. beijerinckii in the broad sense.
• Patent application FR 18/73492 describes the strain D catB as well as the use of a CRISPR / Cas9 system with two plasmids requiring the use of a gene for resistance to erythromycin and a gene for resistance to thiamphenicol.
• the vector pNF3C was transformed into strain D catB already containing the plasmid pCas9 aCr .
• the transformation carried out in duplicate, showed a transformation efficiency of 0.625 ⁇ 0.125 colonies / ⁇ g of DNA (mean ⁇ standard error), which proves that a vector based on pNF3C can be used in combination with pCas9, Cr in the strain Aral B.
• part of the plasmid pNF2 comprising its origin of replication (SEQ ID NO: 118) could be successfully reused to create a new series of shuttle vectors (SEQ ID NO: 119, 123, 124 and 125), customizable, allowing in particular their replication in a strain of E. coli as well as their reintroduction in C. beijerinckii DSM 6423.
• shuttle vectors SEQ ID NO: 119, 123, 124 and 125
• These new vectors have advantageous transformation efficiencies for carrying out genetic editing, for example in C. beijerinckii DSM 6423 and its derivatives, in particular using the tool CRISPR / Cas9 comprising two different nucleic acids.
• PNA Peptide nucleic acids
• ClosTron mutagenesis in Clostridium refined and streamlined. Journal of microbiological methods, 80 (1), 49-55.
• ClosTron a universal gene knock-out System for the genus Clostridium. Journal of microbiological methods, 70 (3), 452-464.

Landscapes

• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Health & Medical Sciences (AREA)
• Organic Chemistry (AREA)
• Engineering & Computer Science (AREA)
• Genetics & Genomics (AREA)
• Wood Science & Technology (AREA)
• Zoology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Engineering & Computer Science (AREA)
• Biotechnology (AREA)
• Biomedical Technology (AREA)
• Biochemistry (AREA)
• General Health & Medical Sciences (AREA)
• Molecular Biology (AREA)
• Microbiology (AREA)
• Biophysics (AREA)
• Plant Pathology (AREA)
• Physics & Mathematics (AREA)
• Medicinal Chemistry (AREA)
• General Chemical & Material Sciences (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Gastroenterology & Hepatology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Virology (AREA)
• Crystallography & Structural Chemistry (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Enzymes And Modification Thereof (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)

Applications Claiming Priority (2)

Publications (1)

Family

ID=67185129

Family Applications (1)

Country Status (9)