EP3870723A1 - Bereitstellung von malonyl-coa in coryneformen bakterien sowie verfahren zur herstellung von polyphenolen und polyketiden mit coryneformen bakterien - Google Patents
Bereitstellung von malonyl-coa in coryneformen bakterien sowie verfahren zur herstellung von polyphenolen und polyketiden mit coryneformen bakterienInfo
- Publication number
- EP3870723A1 EP3870723A1 EP19816511.0A EP19816511A EP3870723A1 EP 3870723 A1 EP3870723 A1 EP 3870723A1 EP 19816511 A EP19816511 A EP 19816511A EP 3870723 A1 EP3870723 A1 EP 3870723A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- bacterial cell
- coryneform
- acid sequence
- nucleic acid
- genes
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1025—Acyltransferases (2.3)
- C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
- C12N1/205—Bacterial isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/52—Genes encoding for enzymes or proenzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1025—Acyltransferases (2.3)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/93—Ligases (6)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/02—Oxygen as only ring hetero atoms
- C12P17/06—Oxygen as only ring hetero atoms containing a six-membered hetero ring, e.g. fluorescein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/22—Preparation of oxygen-containing organic compounds containing a hydroxy group aromatic
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y203/00—Acyltransferases (2.3)
- C12Y203/01—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
- C12Y203/01085—Fatty-acid synthase (2.3.1.85)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y203/00—Acyltransferases (2.3)
- C12Y203/03—Acyl groups converted into alkyl on transfer (2.3.3)
- C12Y203/03001—Citrate (Si)-synthase (2.3.3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y205/00—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5)
- C12Y205/01—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5) transferring alkyl or aryl groups, other than methyl groups (2.5.1)
- C12Y205/01054—3-Deoxy-7-phosphoheptulonate synthase (2.5.1.54)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y403/00—Carbon-nitrogen lyases (4.3)
- C12Y403/01—Ammonia-lyases (4.3.1)
- C12Y403/01023—Tyrosine ammonia-lyase (4.3.1.23)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y604/00—Ligases forming carbon-carbon bonds (6.4)
- C12Y604/01—Ligases forming carbon-carbon bonds (6.4.1)
- C12Y604/01002—Acetyl-CoA carboxylase (6.4.1.2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y604/00—Ligases forming carbon-carbon bonds (6.4)
- C12Y604/01—Ligases forming carbon-carbon bonds (6.4.1)
- C12Y604/01003—Propionyl-CoA carboxylase (6.4.1.3)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/15—Corynebacterium
Definitions
- the present invention relates to a system for the provision of malonyl-CoA in coryneform bacteria.
- the present invention also relates to a method for producing secondary metabolites, such as. B. polyphenols and polyketides with coryneform bacteria.
- stilbenes, flavonoids A large number of different molecules from the groups of polyphenols (stilbenes, flavonoids) and polyketides represent economically interesting secondary metabolites with great potential for pharmacological use.
- the stilbene resveratrol for example, is anti-tumor, anti-bacterial, anti-inflammatory and anti aging effect predicted (Pangeni et al. 2014; https://doi.org/10.1517/17425247.2014.919253).
- the effect in the prevention of cardiovascular diseases is also discussed.
- Similar effects including anti-mutagenic, anti-oxidative, anti-proliferative and anti-atherogenic effects are for flavonoids, e.g. Naringenin or its derivatives are described (Erlund, 2004; https://doi.Org/10.1016/i. Nutres.2004.07.005, Harbone, 2013; https://doi.Org/10.1007/978-1-4899-2915- 0).
- An object of the present invention is therefore a system and To provide methods for the microbial, large-scale production of molecules from the groups of the polyphenols (stilbenes, flavonoids) and the polyketides with coryneform bacteria, which are classified as GRAS.
- Another object of the present invention is to provide a precisely characterized bacterial strain by means of targeted strain construction, which overcomes the known disadvantages.
- a key building block for the synthesis of polyphenols or polyketides is malonyl-CoA. While representatives of the group of flavonoids and stilbenes require 3 moles of malonyl-CoA / mole of product, polyketides are built almost exclusively on the basis of malonyl-CoA units.
- Malonyl-CoA is a central intermediate in the metabolism of bacteria that cannot be transported through the cell membrane, so that extracellular feeding in a microbial manufacturing process is not possible.
- Malonyl-CoA is formed by carboxylation of acetyl-CoA, the end product of glycolysis, in bacterial cells, but microorganisms use malonyl-CoA almost exclusively for the synthesis of fatty acids, which prevents increased availability.
- fatty acid synthesis is a very costly synthesis for the cell, so that consequently the synthesis of malonyl-CoA is strictly regulated.
- An indirect means of increasing the intracellular concentration of malonyl-CoA in microorganisms is, for example, the addition of inhibitors of fatty acid synthesis, such as. B. Cerulenin.
- the production of resveratrol with Corynebacterium glutamicum is also in Kallscheuer et al. (2016, https://doi.Org/10.1016/j.ymben.2016.06.003).
- cerulenin is used to inhibit fatty acid synthesis in order to achieve the formation of resveratrol.
- a major disadvantage of adding cerulenin is that the cells stop growing completely after the addition of cerulenin. This in turn is negative for the malonyl-CoA supply in the cell, which only takes place when it is growing.
- Cerulenin is an antibiotic that selectively irreversibly inhibits fatty acid synthesis (Omura et al; 1976; PMID 791237). As a result of this inhibition, malonyl-CoA is no longer used for the endogenous synthesis of fatty acids and could be available for other uses, such as for the synthesis of secondary metabolites.
- cerulenin is very expensive and would therefore not be very suitable for use in a large-scale or industrially interesting microbial production process.
- Another major disadvantage of cerulenin is that the cells are extremely inhibited in their growth due to the inhibition of fatty acid synthesis and, as a rule, after a short time (one cell division) they can no longer grow.
- Another object of the present invention is therefore to provide a system and method for increasing the concentration of the central metabolite malonyl-CoA in corynform bacteria which is independent of the addition of cerulenin.
- Another object of the present invention is to provide an economically interesting system which is suitable for the biotechnological provision of malonyl-CoA in coryneform bacteria and in which the growth of the cells remains unaffected or is not negatively influenced or even comes to a standstill.
- Another object of the present invention is to provide a method for the microbial production of economically interesting secondary metabolites, such as. B. to provide molecules from the groups of polyphenols (stilbenes, flavonoids) and polyketides in coryneform bacteria, in which the known disadvantages are overcome.
- the present invention relates to a coryneform bacterial cell with an increased supply of malonyl-CoA compared to its original type in which the regulation and / or expression of the genes selected from the group comprising fasB, gltA, accBC and accD1, and / or the functionality of the enzymes encoded by them is specifically modified.
- the invention further relates to a coryneform bacterial cell which has one or more targeted modifications, selected from the group comprising a) reduced or deactivated functionality of the fatty acid synthase FasB; b) mutation or partial or complete deletion of the gene fasB coding for the fatty acid synthase; c) reduced functionality of the promoter operatively linked to the citrate synthase gene gtIA; d) reduced expression of the gene coding for the citrate synthase CS gltA; e) Reduced or deactivated functionality of the operator binding sites (fasO) for the regulator FasR in the promoter regions of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits; f) Depressed expression of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits; g) one or more combinations of a) - f).
- the invention thus also includes a coryneform bacterial cell in which the functionality of the fatty acid synthase FasB is reduced or switched off and / or the gene fasB coding for the fatty acid synthase is specifically mutated, preferably by one or more nucleotide substitutions, or is partially or completely deleted.
- coryneform bacterial cell in which the expression of the gene coding for citrate synthase gltA is reduced by mutation, preferably several nucleotide substitutions, of the operatively linked promoter.
- the present invention also relates to a coryneform bacterial cell in which the functionality of the operator binding sites (fasO) for the regulator FasR in the promoter regions of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits, preferably by one or more nucleotide substitutions is reduced or switched off and the expression of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits is derepressed, preferably increased.
- the functionality of the operator binding sites (fasO) for the regulator FasR in the promoter regions of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits preferably by one or more nucleotide substitutions is reduced or switched off and the expression of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits is derepressed, preferably increased.
- Another object of the present invention is also a coryneform bacterial cell which is a combination of reduced expression and / or activity of citrate synthase (CS) and deregulated, increased expression and / or activity of acetyl- Has CoA carboxylase subunits (AccBC and AccD1).
- CS citrate synthase
- AccBC and AccD1 acetyl- Has CoA carboxylase subunits
- the invention also includes a coryneform bacterial cell which is a combination of reduced expression and / or activity of citrate synthase (CS) and deregulated, increased, expression and / or activity of acetyl-CoA carboxylase subunits (AccBC and AccD1) and reduced or switched off Has functionality of the fatty acid synthase FasB.
- CS citrate synthase
- AccBC and AccD1 acetyl-CoA carboxylase subunits
- the present invention also relates to a coryneform bacterial cell for the production of polyphenols or polyketides, which has modifications of the aforementioned type and in which the catabolic pathway of aromatic components, preferably selected from the group comprising phenylpropanoids and benzoic acid derivatives, is additionally switched off.
- the invention also encompasses a coryneform bacterial cell which additionally encodes genes for a feedback-resistant 3-deoxy-D-arabinoheptulosonate 7-phosphate synthase (aroH), preferably from E. coli, and for a tyrosine ammonium lyase (tal), preferably from Flavobacterium johnsoniae.
- aroH 3-deoxy-D-arabinoheptulosonate 7-phosphate synthase
- tal tyrosine ammonium lyase
- the present invention also relates to a coryneform bacterial cell of the aforementioned type which additionally has enzymes derived from plants or the genes encoding them for polyphenol or polyketide synthesis.
- the coryneform bacterial cell is the genus selected from the group comprising Corynebacterium and Brevibacterium, preferably Corynebacterium glutamicum, particularly preferably Corynebacterium glutamicum ATCC13032 or their specifically genetically modified variants.
- the present invention also relates to a method for the increased provision of malonyl-CoA in coryneform bacteria with the aforementioned coryneform bacteria and a method for the microbial production of polyphenols or polyketides in coryneform bacteria.
- the processes are independent of the addition of cerulenin.
- the present invention also relates to the use of a coryneform bacterial cell according to the invention for increased provision of malonyl-CoA in coryneform bacteria, and the use of a coryneform bacterial cell according to the invention for the production of polyphenols or polyketides with coryneform bacteria.
- the invention also includes a composition containing secondary metabolites selected from the group of polyphenols and polyketides, preferably the stilbenes, flavonoids and polyketides, particularly preferably resveratrol, naringenin and noreugenin, produced using a coryneform according to the invention or a method according to the invention.
- the present invention also relates to the use of a composition according to the invention mentioned above for the production of pharmaceuticals, foods, animal feeds and / or for use in plant physiology.
- the present invention relates to a coryneform bacterial cell with an increased supply of malonyl-CoA compared to its original type in which the regulation and / or expression of the genes selected from the group comprising fasB, gltA, accBC and accD1, and / or the functionality of the they specifically encoded enzymes.
- the invention thus encompasses a coryneform bacterial cell which has one or more targeted modifications selected from the group comprising a) reduced or deactivated functionality of the fatty acid synthase FasB; b) mutation or partial or complete deletion of the gene fasB coding for the fatty acid synthase; c) reduced functionality of the promoter operatively linked to the citrate synthase gene gtIA; d) reduced expression of the gene coding for the citrate synthase CS gltA; e) Reduced or deactivated functionality of the operator binding sites (fasO) for the regulator FasR in the promoter regions of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits; f) Depressed expression of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits; g) one or more combinations of a) - f).
- the invention also encompasses a coryneform bacterial cell in which the functionality of the fatty acid synthase FasB is reduced or switched off and / or the gene fasB coding for the fatty acid synthase is specifically mutated, preferably by one or more nucleotide substitutions, or is partially or completely deleted.
- coryneform bacterial cell in which the expression of the gene coding for citrate synthase gltA is reduced by mutation, preferably several nucleotide substitutions, of the operatively linked promoter.
- the present invention also relates to a coryneform bacterial cell in which the functionality of the operator binding sites (fasO) for the regulator FasR in the promoter regions of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits, preferably by one or more nucleotide substitutions is reduced or switched off and the expression of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits is derepressed, preferably increased.
- the functionality of the operator binding sites (fasO) for the regulator FasR in the promoter regions of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits preferably by one or more nucleotide substitutions is reduced or switched off and the expression of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits is derepressed, preferably increased.
- a new fasO binding site 5 ' is operatively linked in front of the accD1 gene of coryneform bacteria.
- This is advantageously characterized in that, taking into account the amino acid sequence and the best possible codon use in coryneform bacteria, it exhibits a maximum deviation from the native fasO sequence: MTISSPX (FIG. 23).
- the fasO binding sites according to the invention have a nucleic acid sequence according to SEQ ID NO: 13 or 15 in front of the accBD or accD1 genes.
- Another object of the present invention is also a coryneform bacterial cell which is a combination of reduced expression and / or activity of citrate synthase (CS) and deregulated, increased expression and / or activity of the acetyl-CoA carboxylase subunits (AccBC and AccDI) having.
- CS citrate synthase
- AccBC and AccDI acetyl-CoA carboxylase subunits
- the invention also includes a coryneform bacterial cell which is a combination of reduced expression and / or activity of citrate synthase (CS) and deregulated, increased, expression and / or activity of acetyl-CoA carboxylase subunits (AccBC and AccD1) and reduced or switched off Has functionality of the fatty acid synthase FasB.
- CS citrate synthase
- AccBC and AccD1 acetyl-CoA carboxylase subunits
- a coryneform bacterial cell according to the invention is characterized in particular by the fact that the anabolism of malonyl-CoA is specifically increased and at the same time the growth of the cell is unaffected.
- Such a coryneform bacterial cell has not yet been described.
- the catabolic metabolism of malonyl-CoA is switched off, but this has the negative effect that the cells can no longer grow. This is described in a variety of ways.
- B. by the addition of cerulenin.
- lack of growth negatively affects the tightly controlled malonyl CoA supply, i.e. less malonyl-CoA is provided, which proves to be counterproductive.
- the present invention advantageously overcomes such disadvantages.
- the term “original type” is to be understood both as the “wild type” of a coryneform bacterial cell, which z. B. provides a genetically unmodified parent gene or parent enzyme, as well as direct descendants thereof.
- Coryneform wild-type cells of the genus Corynbacterium or Brevibacterium are preferred; coryneform bacterial cells of the wild type Corynebacterium glutamicum are particularly preferred; coryneform bacterial cells of the wild type Corynebacterium glutamicum ATCC 13032 are very particularly preferred.
- the term “original type” thus includes, in addition to the “wild type”, also specifically derived, precisely defined and well-characterized "descendants" of the wild type.
- the “descendants” show changes that are targeted, directed and controlled by means of molecular biological methods and which are homologous, non-recombinant changes, such as: B. nucleotide substitutions or deletions or the adaptation of heterologous nucleic acid sequences to the codon usage (codon usage) of the wild type.
- the resulting descendant is characterized physiologically precisely and does not carry heterologous nucleic acid sequences; neither chromosomally coded nor plasmid coded.
- An example of a “primary type” in the sense of the present invention is a coryneform bacterial cell of the wild type in which the genes responsible for the breakdown of aromatic components are deleted from the genome.
- targeted nucleotide substitutions in the genome are also conceivable, by means of which the wild type remains genetically a homologous, non-recombinant organism. This example is not to be interpreted as limiting the present invention. Since, according to the invention, it is a matter of targeted nucleotide exchanges of the same, homologous host organism, the resulting organism is modified according to the invention in a non-recombinant manner.
- “Homologous” in the sense of the invention is to be understood to mean that the enzymes according to the invention and the nucleic acid sequences according to the invention coding for them and the non-coding nucleic acid sequences according to the invention linked to these in a regulatory manner are derived from a common starting strain of coryneform bacterial cells. According to the invention, “homolog” is used synonymously with the term “not heterologous”.
- An “original type” according to the invention is genetically and physiologically exactly characterized, homologous, non-recombinant and can be equated with the “wild type”. The terms “wild type”, “descendants” and “original type” are used synonymously according to the invention.
- a “reduced or deactivated functionality” relates, for example, both to the functionality of the fatty acid synthase FasB according to the invention at the protein level and to the nucleic acid sequence according to the invention encoding it.
- “Functionality” thus generally comprises the function of a protein or a nucleic acid sequence coding therefor, which can be reduced or switched off, for example, by nucleotide substitution or deletion.
- the “functionality” thus also includes the activity of a protein, which can be changed, such as reduced or switched off.
- the changed activity of a protein can include changes in the active, catalytic center as well as regulatory center.
- a coryneform bacterial cell which is characterized in that it has a modified functionality of an enzyme and / or the coding nucleic acid sequence and / or an operatively linked, regulatory, non-coding nucleic acid sequence.
- Another variant of a coryneform bacterial cell according to the invention is characterized in that the modification is based on changes selected from the group comprising a) change in the regulation or signal structures for gene expression, b) change in the transcription activity of the coding nucleic acid sequence, or c) change in the coding Nucleic acid sequence.
- the invention includes, for example, changes in the signal structures of gene expression, such as, for example, by changing the repressor genes, activator genes, operators, promoters; Attenuators, ribosome binding sites, the start codon, terminators. Also included are the introduction of a stronger or weaker promoter or an inducible promoter into the genome of the coryneform bacterial cell according to the invention or deletions or nucleotide substitutions in coding or non-coding areas, the molecular biological methods being known to the person skilled in the art.
- the present invention relates to a coryneform bacterial cell in which the changes are chromosomally-encoded in the genome or extrachromosomally, ie vector-encoded or plasmid-encoded.
- suitable plasmids are those which are replicated in coryneform bacteria.
- Numerous known plasmid vectors such as e.g. B.
- pZ1 (Menkel et al., Applied and Environmental Microbiology (1989) 64: 549-554), pEKExI (Eikmanns et al., Gene 102: 93-98 (1991)) or pHS2-1 (Sonnen et al., Gene 107: 69-74 (1991)) are based on the cryptic plasmids pHM1519, pBL1 or pGA1.
- Other plasmid vectors such as e.g. B.
- pCG4 US-A 4,489,160
- pNG2 Serwold-Davis et al., FEMS Microbiology Letters 66, 119-124 (1990)
- pAG1 US-A 5,158,891
- Vectors with controllable expression can also be used, such as, for example, pEKEx2 (B. Eikmanns, 1991 Gene 102: 93-8; O. Kirchner 2003, J. Biotechnol.
- Environ Microbiol 60: 126-132 The desired strain is transformed with a vector by conjugation or electroporation of the desired strain, for example C. glutamicum.
- the conjugation method is described, for example, by Schfer et al. (Applied and Environmental Microbiology (1994) 60: 756-759). Methods of transformation are, for example, in Tauch et al. (FEMS Microbiological Leiters (1994) 123: 343-347).
- nucleic acid sequences and / or regulatory structures preferred according to the invention, changes such as e.g. B. includes transitions, transversions or insertions, as well as methods of directed evolution. Instructions for generating such changes can be found in well-known textbooks (R. Knippers "Molecular Genetics", 8th edition, 2001, Georg Thieme Verlag, Stuttgart, Germany). According to the invention, nucleic acid substitutions or deletions are preferred.
- a “reduced or deactivated functionality” refers not only to the functionality of a gene or protein, but also to a changed functionality of regulator binding sites, such as, for example, B. the operator binding site fasO, to which normally a centrally acting regulatory protein, such as. B. fasR binds, and thereby the expression of the coding nucleic acid sequence is repressed.
- “Decreased” or “switched off” in the sense of the present invention also means that the expression of the coding nucleic acid sequence in comparison to the situation in a wild-type or primary-type host cell in the For the purposes of the invention, this has been done poorly or is no longer under the expression control of the regulator.
- a “reduced or deactivated functionality” also refers to a changed functionality of promoter regions in the 5 ′ regulatory region in front of a coding gene. Changes in "functionality” can increase or decrease the activity of the promoter.
- a promoter such as. B. before the gene gtIA coding for citrate synthase in its function and thus activity reduced. As a result, the gene encoded by this promoter is expressed more weakly.
- the regulation mechanisms and their effects in the event of changes are familiar to the skilled worker in all variants.
- modification means “change”, for example also “genetic change”, whereby according to the invention it is meant that although a genetic engineering method is used, no insertions of nucleic acid molecules are generated.
- “modifications” or “changes” mean substitutions and / or deletions, preferably substitutions “modification” “. change” or “genetic change” in the sense of the present invention are also generated in a regulatory, non-coding region of the nucleic acids according to the invention.
- the present invention also relates to a protein coding for a fatty acid synthase FasB isolated from coryneform bacteria, the functionality of which is reduced or switched off and with which an increased provision of malonyl-CoA in coryneform bacteria is made possible, the amino acid sequence selected at least 70% identity to the amino acid sequence from the group containing SEQ ID NO. 2, 4, 6, 8 and 10 or fragments or alleles thereof.
- the invention also includes a fatty acid synthase FasB with an amino acid sequence selected from the group comprising SEQ ID NO. 2, 4, 6, 8 and 10 or fragments or alleles thereof.
- a fatty acid synthase is encoded by a nucleic acid sequence containing at least 70% identity to the nucleic acid sequence selected from the group SEQ ID NO. 1, 3, 5, 7 and 9 or fragments thereof according to the invention.
- the present invention also comprises a fatty acid synthase encoded by a nucleic acid sequence selected from the group SEQ ID NO. 1, 3, 5, 7 and 9 or fragments thereof.
- Proteins coding for an amino acid sequence with at least 75 or 80%, preferably at least 81, 82, 83, 84, 85 or 86% identity, particularly preferably 87, 88, 89, 90% identity, very particularly preferably at least, are also encompassed according to the invention 91, 92, 93, 94, 95% identity or most preferably 96, 97, 98, 99 or 100% identity to the amino acid sequence according to SEQ ID NO. 2, 4, 6, 8 and 10 or fragments or alleles thereof.
- the present invention relates to a fatty acid synthase FasB containing an amino acid sequence according to SEQ ID NO. 2, 4, 6, 8 and 10 or fragments or alleles thereof.
- the present invention also relates to a nucleic acid sequence coding for a fatty acid synthase FasB from coryneform bacteria, the functionality of which is reduced or switched off, selected from the group comprising: a) a nucleic acid sequence containing at least 70% identity to the nucleic acid sequence selected from the group SEQ ID NO. 1, 3, 5, 7 and 9 or fragments thereof, b) a nucleic acid sequence which, under stringent conditions, with a complementary sequence of a nucleic acid sequence selected from the group SEQ ID NO. 1, 3, 5, 7 and 9 or fragments thereof hybridized, c) a nucleic acid sequence selected from the group SEQ ID NO.
- the invention also relates to a fatty acid synthase FasB encoded by a nucleic acid sequence containing at least 70% identity to the nucleic acid sequence according to SEQ ID NO. 1, 3, 5, 7 and 9 or fragments thereof.
- the invention also includes nucleic acid sequences which have at least one 75% or 80%, preferably at least 81, 82, 83, 84, 85 or 86% identity, particularly preferably 87, 88, 89, 90% identity, very particularly preferably at least 91, 92, 93, 94, 95% identity or most preferably 96, 97, 98, 99 or 100% identity to the nucleic acid sequence according to SEQ ID NO. 1, 3, 5, 7 and 9 or fragments thereof.
- the present invention relates to a fatty acid synthase FasB encoded by a nucleic acid sequence according to SEQ ID NO. 1, 3, 5, 7 and 9 or fragments thereof.
- the invention also encompasses a coryneform bacterial cell which has a protein coding for a fatty acid synthase FasB with reduced or deactivated functionality or a nucleic acid sequence coding for a fatty acid synthase FasB with the previously mentioned changed functionality.
- a coryneform bacterial cell which has one or more targeted modifications, selected from the group comprising a) Reduced or deactivated functionality of the fatty acid synthase FasB with at least 70% identity to the amino acid sequence selected from the group containing SEQ ID NO. 2, 4, 6, 8 and 10 or fragments or alleles thereof; b) mutation or partial or complete deletion of the gene fasB coding for the fatty acid synthase with a nucleic acid sequence containing at least 70% identity to the nucleic acid sequence selected from the group SEQ ID NO.
- proteins of the fatty acid synthase FasB from coryneform bacteria and / or nucleic acid sequences encoding a fatty acid synthase FasB from coryneform bacteria are also encoded, in which nucleotide substitutions and corresponding amino acid exchanges are present.
- nucleotide substitutions and corresponding amino acid exchanges are present.
- the functionality of the promoter operatively linked to the citrate synthase gene gltA is also reduced.
- nucleotide substitutions can take place in the binding sites responsible for the binding of the polymerase, or an entire promoter sequence of a weaker promoter can be exchanged for the naturally occurring promoter sequence, or a combination of both, a weaker promoter being additionally weakened by nucleotide substitution. Since, according to the invention, targeted nucleotide exchanges of the same, homologous host organism are involved, the resulting organism is non-recombinantly changed according to the invention.
- “Homologous” in the sense of the invention means that the enzymes according to the invention and the nucleic acid sequences according to the invention coding for them and the invented According to the invention, these regulatory-linked non-coding nucleic acid sequences are related to a common starting strain of coryneform bacterial cells. According to the invention, “homolog” is used synonymously with the term “non-heterologous”.
- nucleic acid sequence in the sense of the present invention means any homologous molecular unit that transports genetic information. This applies accordingly to a homologous gene, preferably a naturally occurring and / or non-recombinant homologous gene, a homologous transgene or codon-optimized homologous genes.
- nucleic acid sequence refers to a nucleic acid sequence or fragments or alleles thereof which encode or express a specific protein.
- nucleic acid sequence preferably refers to a nucleic acid sequence containing regulatory sequences which precede the coding sequence (upstream, upstream, 5 ' non-coding sequence) and follow it (downstream, downstream, 3 ' non-coding sequence).
- naturally occurring gene refers to a gene found in nature, for example from a wild-type strain of a coryneform bacterial cell, with its own regulatory sequences.
- operatively linked region relates to an association of nucleic acid sequences on a single nucleic acid fragment, so that the function of one nucleic acid sequence is influenced by the function of the other nucleic acid sequence.
- operatively linked in the sense of the invention means that the coding sequence is under the control of the regulatory region (in particular the promoter or the regulatory binding site) that controls the expression the coding sequence regulated.
- a new fasO binding site 5 'operatively linked is provided in front of the accD1 ⁇ gene of coryneform bacteria.
- Variants of the present invention also include a reduced or deactivated functionality of the operator binding sites (fasO) for the regulator FasR in the promoter regions of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits.
- fasO operator binding sites
- cct -> aag nucleotide substitutions at positions 20-24 (cctca -> gtacg).
- the present invention thus also relates to a nucleic acid sequence for an operatively linked fasO binding site in the regulatory, non-coding region 5 'in front of the accD1 gene from coryneform bacteria, the nucleotide substitutions according to SEQ ID NO. 15 has.
- the present invention also relates to a coryneform bacterial cell in which the modifications according to the invention are advantageously chromosomally encoded.
- the invention also includes a coryneform bacterial cell that is non-recombinant (non-GMO).
- non-recombinant is to be understood to mean that the genetic material of the coryneform bacterial cells according to the invention is only changed in the way that it occurs naturally, e.g. through natural recombination or natural mutation.
- the coryneform bacterial cells according to the invention are thus distinguished as a non-genetically modified organism (non-GMO).
- the present invention thus provides a system with which the microbial production of malonyl-CoA can be carried out in a significantly simpler, more stable, cheaper and more economical manner. Because all previously known bacterial strains with a malonyl-CoA synthesis capacity require complex media for their growth, which makes cultivation significantly more complex, expensive and therefore uneconomical. Here is especially the addition of inhibitors of fatty acid synthesis, such as. B. Cerulenin called, which is very expensive and is therefore not suitable for use in an industrial manufacturing process. In addition, all malonyl-CoA producers described so far are not GRAS organisms. This creates a disadvantage for use in certain industrial areas (e.g. food and pharmaceutical industries) due to complex approval procedures.
- Coryneform bacteria preferably of the genus Corynebacterium, are generally recognized as safe (GRAS) organism that can be used in all industrial areas. Coryneform bacteria achieve high growth rates and biomass yields on defined media (Grünberger et al., 2012) and there is extensive experience in the industrial use of coryneform bacteria (Becker et al., 2012).
- coryneform bacteria of the genus Corynebacterium or Brevibacterium are included.
- Variants of coryneform bacteria according to the invention are selected from the group comprising Corynebacterium and Brevibacterium, preferably Corynebacterium glutamicum, particularly preferably Corynebacterium glutamicum ATCC 13032, Corynebacterium acetoglutamicum, Corynebacterium thermoaminogenes, Brevibacterium flavumacterium or Brevibacterium lactofer.
- a coryneform bacterial cell is also selected from the group comprising Corynebacterium glutamicum ATCC13032 or specifically modified descendants or primary types, Corynebacterium acetoglutamicum ATCC15806, Corynebacterium acetoacidophilum ATCC 13870, Corynebacterium thermoaminogenium flavib150 Breib1, Brex1, Brex, Brex, Brex, Bacterium, Brex, Brex, Bacterium, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Bre
- the invention also includes a coryneform bacterial cell with one or more of the above-mentioned modifications according to the invention, starting from Corynebacterium glutamicum, preferably Corynebacterium glutamicum ATCC13032, in which the catabolic pathway of aromatic components, preferably selected from the group comprising phenylpropanoids and benzoic acid derivatives, is additionally switched off is.
- Corynebacterium glutamicum preferably Corynebacterium glutamicum ATCC13032
- the catabolic pathway of aromatic components preferably selected from the group comprising phenylpropanoids and benzoic acid derivatives
- coryneform bacterial cell are characterized in that the functionality and / or activity of the enzymes or the expression of the genes encoding them participates in the catabolic pathway of aromatic components by deletions of the gene clusters cg0344-47 (phdBCDE operon), cg2625-40 (cat, ben and pca), cg1226 (pobA) and cg0502 (qsuB) are switched off.
- These cells according to the invention have been changed in a targeted manner and have not arisen through untargeted mutagenesis. They are characterized in an advantageous manner in that they are genetically precisely characterized and the modifications mentioned are achieved by deletions.
- these deletions are chromosomally encoded.
- these cells only have homologous DNA and they are non-recombinantly modified. This distinguishes them, in addition to being a GRAS organism, advantageously for microbial production of products such as B. secondary plant metabolites.
- the coryneform bacterial cell according to the invention is also advantageously characterized in that it does not contain any extrachromosomal DNA, such as, for example, for increased provision of malonyl CoA.
- B. plasmids or vectors needed are extrachromosomal DNA, such as, for example, for increased provision of malonyl CoA.
- bacterial strains with more than 2 plasmids or more than 2 genes per plasmid are generally not stable; second, it must be borne in mind that the microbial production of complex secondary metabolites in bacteria, which is the subject of the invention, is a heterologous expression of the corresponding plant genes for polyphenol and / or polyketide production and thirdly, these desired products or their precursors should not be decomposed again by cell-specific activities, such as, for example, the enzymatic degradation of aromatic components.
- a further, very complex object of the present invention is therefore to provide a system for the increased provision of malonyl-CoA in coryneform bacteria without having to make plasmid-coded changes and at the same time to break down the desired aromatics-containing products and their precursors to prevent in coryneform bacteria, solved in a very advantageous manner by the corynform bacterial cells according to the invention.
- This system of a coryneform bacterial cell which is very advantageous according to the invention, permits great degrees of freedom which plant or other heterologous genes can be introduced into the system extrachromosomally in order to enable stable, microbial production of plant secondary metabolites.
- the present invention also relates to a coryneform bacterial cell which is distinguished by the fact that it provides an increased intracellular concentration of malonyl-CoA regardless of the addition of fatty acid synthesis inhibitors.
- This increased provision of malonyl-CoA as a central intermediate can be used according to the invention for the production of products for the synthesis of which an increased concentration of malonyl-CoA is required, such as, for. B. the fatty acid synthesis or the synthesis of secondary metabolites from plants, such as polyphenols or polyketides.
- the present invention also relates to coryneform bacterial cells for the production of polyphenols or polyketides, which have modifications of the aforementioned type according to the invention and in which the catabolic pathway of aromatic components, preferably selected from the group comprising phenylpropanoids and benzoic acid derivatives, is additionally switched off.
- Coryneform bacteria have their own metabolic pathway to break down phenylpropanoids or benzoic acid derivatives (Kallscheuer et al., 2016; https://doi.org/10.1007/s00253-015-7165-1). This would be counterproductive for the production of polyketides or polyphenols with coryneform bacteria.
- a coryneform bacterial cell which increases Provision of malonyl-CoA is made possible and which is additionally characterized in that the functionality and / or activity of the enzymes or the expression of the genes encoding them, involved in the catabolic pathway of aromatic components, by deletions of the gene clusters cg0344-47 (phdBCDE operon) , cg2625-40 ('cat, ben and pca), cg 1226 (pobA) and cg0502 (qsuB) are switched off.
- These cells according to the invention have been changed in a targeted manner and have not arisen through untargeted mutagenesis.
- these deletions are chromosomally encoded.
- these cells only have homologous DNA and they are non-recombinantly modified. This distinguishes them, in addition to being a GRAS organism, advantageously for microbial production of products such as B. secondary plant metabolites.
- the coryneform bacterial cell according to the invention is also advantageously characterized in that it does not contain any extrachromosomal DNA, such as eg. B. plasmids or vectors needed.
- the present invention also relates to a coryneform bacterial cell which, in addition to the modifications of the aforementioned type according to the invention, has the enzymes derived from plants or the genes encoding them for polyphenol or polyketide synthesis.
- a variant of the present invention also includes a coryneform bacterial cell which has the genes derived from plants for polyphenol or polyketide production, selected from the group comprising the genes 4cl, sts, chs, chi and pcs.
- the coryneform bacterial cell according to the invention with the properties according to the invention described in the manner described above is advantageously characterized in that it can carry out the synthesis of polyketides from 5 malonyl-CoA units.
- the synthesis of polyphenols can also be carried out with the coryneform bacterial cell according to the invention of the type described above, with a supplementation of the corresponding culture medium with a polyphenol precursor, such as. B. p-cumaric acid, the implementation of malonyl-CoA to stilbenes or flavonoids favored.
- the coryneform bacterial cell Starting from glucose as the carbon source, the coryneform bacterial cell according to the invention requires the enzymes 3-deoxy-D-arabinoheptulosonate-7-phosphate synthase and tyrosine ammonium lyase encoded by the genes aroH and tal.
- a coryneform bacterial cell is also encoded which encodes genes for a feedback-resistant 3-deoxy-D-arabinoheptulosonate-7-phosphate synthase (aroH), preferably from E. coli, and for a tyrosine ammonium lyase (valley), preferably from Flavobacertium johnsoniae.
- aroH 3-deoxy-D-arabinoheptulosonate-7-phosphate synthase
- valley tyrosine ammonium lyase
- PCS 5,7-dihydroxy-2-methylchromone synthase activity
- the enzyme 5,7-dihydroxy-2-methylchromone synthase activity is a type III polyketide synthase (EC 2.3.1.216, UniProt Q58VP7, (Abe et al., 2005; https://doi.org /10.1021/ja0431206)
- the PCS from Aloe arborescens is encoded by the pcs gene and annotated as EC 2.3.1.216, UniProt Q58VP7
- the catalytic activity for the synthesis of noreugenin from five molecules of malonyl-CoA is described as a supposed function. According to the invention, the pcs gene from Aloe arborescens was synthesized using C.
- PCS Sh0 r t a 5,7-dihydroxy-2-methylchromone synthase
- PCS Sh0 r t a further structural element is made available, with the help of which plant-based plants are advantageously used Secondary metabolites can be produced in coryneform bacteria.
- the 5,7-dihydroxy-2-methylchromone synthase (PCS Sh0 r t ) according to the invention has an amino acid sequence shortened by 10 N-terminal amino acids.
- the resulting plasmid pMKEx2-pcs ⁇ aC8 -short can be transformed into any of the C.
- glutamicum strains described above the product formation being analyzed after appropriate cultivation and sampling.
- the plasmid is transformed into the C. glutamicum strain DelAro 4 -4c / PcCg-C7-mu / asO.
- the resulting strain C. glutamicum DelAro 4 -4c / PcCg-C7-mu / asO pMKEx2-pcs ia c g -short is grown under standard conditions (CGXII + 4% glucose, 1 mM IPTG, 30 ° C, 130 RPM, 72 h ) and the samples taken are analyzed for product formation using LC-MS (see above).
- a 5,7-dihydroxy-2-methylchromone synthase variant (PCS sho n) according to the invention and the nucleic acid sequence pcs Short encoding it are not yet known.
- the present invention also relates to a protein with an increased 5,7-dihydroxy-2-methylchromone synthase activity (PCS short ) in one of the previously described coryneform bacterial cells according to the invention for the synthesis of polyketides in coryne-shaped bacteria, the amino acid sequence being at least 70% identical to the amino acid sequence according to SEQ ID NO.
- a 5,7-dihydroxy-2-methylchromone synthase is included, containing an amino acid sequence as shown in SEQ ID NO. 20 or fragments or alleles thereof.
- a 5,7-dihydroxy-2-methylchromone synthase encoded by a nucleic acid sequence containing at least 70% identity to the nucleic acid sequence according to SEQ ID NO is also included according to the invention. 19 or fragments thereof.
- a 5,7-dihydroxy-2-methylchromone synthase is encoded, encoded by a nucleic acid sequence according to SEQ ID NO. 19 or fragments thereof.
- a nucleic acid sequence (pcs short ) is encoded, coding for a 5,7-dihydroxy-2-methylchromone synthase with increased activity for polyketide production in coryneform bacteria selected from the group comprising: a) a nucleic acid sequence containing at least 70% identity to the nucleic acid sequence according to SEQ ID NO. 19 or fragments thereof, b) a nucleic acid sequence which under stringent conditions with a complementary sequence of a nucleic acid sequence according to SEQ ID NO. 19 or fragments thereof hybridized, c) a nucleic acid sequence according to SEQ ID NO.
- PCS Short 5,7-dihydroxy-2-methylchromone synthase
- the present invention also relates to a coryneform bacterial cell of the type described above, which encodes a protein with an increased 5,7-dihydroxy-2-methylchromone synthase activity (PCS sh0 r t ) and / or a nucleic acid sequence for a 5,7 - Dihdroxy-2-methylchromone synthase (PCS sh0 r t ) with increased activity in coryneform bacteria.
- PCS sh0 r t a protein with an increased 5,7-dihydroxy-2-methylchromone synthase activity
- PCS short a protein with an increased 5,7-dihydroxy-2-methylchromone synthase activity
- Another variant of the present invention also comprises a protein with an increased 5,7-dihydroxy-2-methylchromone synthase activity (PCS sh0rt ) according to SEQ ID NO. 20th
- genes derived from plants or other heterologous systems such as, for example, aroH, tal and / or the genes for polyphenol synthesis, preferably stilbene and / or flavonoid synthesis, particularly mentioning the genes sts, chs, chi or the genes for polyketide synthesis, preferably pcs Sh0rt , were adapted and optimized for expression in coryneform bacteria to the bacterial codon usage (codon usage) of these coryneform bacteria, preferably that of Corynebacterium glutamicum.
- the proportion of heterologous nucleic acid sequences is thereby reduced according to the invention and the expression in coryneform bacterial cells is advantageously supported.
- a coryneform bacterial cell of the aforementioned type is also included, in which the plant genes are present under the expression control of an inducible promoter.
- an IPTG-inducible promoter preferably the T7 promoter.
- a coryneform bacterial cell according to the invention in which the gene 4cl coding for 4-cumarat-CoA ligase (4CL) is present under the expression control of an inducible promoter, the inducible promoter and the gene linked to it regulatively was integrated into the genome of the coryneform bacterial cell, ie chromosomally encoded.
- an IPTG-inducible promoter preferably the T7 promoter, is used.
- the present invention also relates to extrachromosomal systems, such as vectors or plasmids, with the properties required for the expression of the genes required for the synthesis of polyphenols or polyketides.
- the plasmid or vector-encoded genes are subject to an inducible promoter, preferably an IPTG-inducible promoter, preferably the T7 promoter.
- an inducible promoter has the advantage according to the invention that the expression of the genes required for the secondary metabolites can be controlled in a targeted manner, ie switched on, depending on the growth or cultivation conditions of the coryneform bacterial cells according to the invention.
- the corynform bacterial cells according to the invention of the type described above can thus first be cultured for the increased provision of malonyl-CoA, which then, after specific induction of the expression of the required genes, continues to the desired ones Products.
- the present invention also relates to a coryneform bacterial cell which has genes selected from the group comprising a) 4cl and sts for the synthesis of polyphenols, preferably stilbenes, particularly preferably resveratrol, or b) chs and chi for the synthesis of polyphenols Flavonoids, particularly preferably naringenin, or c) pcs short for the synthesis of polyketides, preferably noreugenin, under the control of an inducible promoter, preferably one with an IPTG-inducible promoter, particularly preferably the T7 promoter.
- the present invention is advantageously characterized in that the genes or regions linked to them in a regulatory manner for the increased provision of malonyl-CoA are integrated into the genome of the cells according to the invention, that is to say are chromosomally encoded.
- This creates degrees of freedom to insert further heterologous genes into the cells in a plasmid-encoded manner without overwhelming the cell.
- the known disadvantages that bacterial cells cannot be stably propagated with more than 2 plasmids or the major disadvantage that plasmids with more than 2 heterologous genes generally do not produce a satisfactory result in terms of stability or expression is due to the system which is very advantageous according to the invention of a coryneform bacterial cell. Due to its structure, it offers great degrees of freedom, which plant or other heterologous genes can be introduced extrachromosomally into the system, in order to enable a stable, microbial production of plant secondary metabolites based on malonyl-CoA.
- coryneform bacterial cell which has genes selected from the group comprising a) fasB and / or gltA and / or accBCDI, the functionality and / or expression of which has been specifically modified for increased provision of malonyl-CoA , and b) cg0344-47 (phdBCDE operon), cg2625-40 (cat, ben and pca), cg 1226 (pobA) and cg0502 (qsuB) their functionality for the degradation of aromatic components, preferably from the group containing phenylpropanoids or benzoic acid - Derivatives, is turned off, and c) pcS short coding for a protein with an increased 5,7-dihydroxy-2-methylchromone synthase activity (PCS sh0rt ) for the synthesis of polyketides, preferably noreugenin, or d) optionally aroH and tal for
- the genes according to the invention or the regulatory regions from a) and b) operatively linked to them are present encoded in the genome.
- the genes or the regulatory regions from c) - f) operatively linked to them are plasmid-encoded. According to the invention, combinations of these are conceivable for the production of polyketides, preferably noreugenin, such as, for. B.
- Combinations are conceivable for the production of polyphenols, preferably flavonoids, more preferably naringenin, such as. B. with variants of fasB (substitution or deletion mutants) and Acg0344-47 (phdBCDE operon) and Acg2625-40 (cat, ben and pca) and Acg1226 (pobA) and Acg0502 (qsuB) and aroH and tal and chs and chi; with gtIA and Acg0344-47 ⁇ phdBCDE operon) and Acg2625-40 (cat, ben and pca) and Acg1226 (pobA) and Acg0502 (qsuB) and aroH and tal and chs and chi; with gtIA and accBCDI and Acg0344-47 (phdBCDE operon) and Acg2625-40 (cat, ben and pca) and Acg1226 (pobA) and Ac
- coryneform bacterial cell of the aforementioned type with the aforementioned variations in gene combinations which has genes selected from the group containing a) fasB gene according to a nucleic acid sequence selected from the group containing SEQ ID NO. 1, 3, 5, 7, and 9 or fragments thereof, coding for fatty acid synthases FasB selected from the group comprising SEQ ID NO. 2, 4, 6, 8, and 10 or fragments or alleles thereof and / or gltA gene with an operatively linked promoter region according to SEQ ID NO. 11 and / or accBCDI gene clusters with operatively linked fasO binding sites selected from the group containing SEQ ID NO.
- the present invention also relates to a method for the increased provision of malonyl-CoA in coryneform bacteria comprising the steps: a) providing a solution containing water and a C6-carbon source; b) microbial conversion of the C6 carbon source in a solution according to step a) to malonyl-CoA in the presence of a coryneform bacterial cell according to the invention in which the regulation and / or expression of the genes selected from the group comprising fasB, gtIA, accBC and accD1 and / or the functionality of the enzymes encoded by it is specifically modified.
- solution is to be understood as meaning “medium”, “culture medium”, “culture broth” or “culture solution”.
- microbial is to be understood as synonymous with “biotechnological” or “fermentative”.
- implementation is to be understood as synonymous with “metabolism”, “metabolism” or “cultivation”.
- preparation is according to the invention synonymous to understand “separation", “concentration” or “purification”.
- the culture medium to be used should suitably meet the requirements of the respective microorganisms. Descriptions of culture media of various microorganisms are contained in the manual “Manual of Methods for General Bacteriology” of the American Society for Bacteriology (Washington D.C., USA, 1981).
- sugar and carbohydrates such as e.g. Glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose, oils and fats such as B. soybean oil, sunflower oil, peanut oil and coconut oil, fatty acids such as. As palmitic acid, stearic acid and linoleic acid, alcohols such as. B.
- glycerol and ethanol and organic acids such as.
- B. acetic acid can be used. These substances can be used individually or as a mixture.
- Organic nitrogen-containing compounds such as peptones, yeast extract, meat extract, malt extract, corn steep liquor, soybean meal and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate can be used as the nitrogen source.
- the nitrogen sources can be used individually or as a mixture.
- Potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts can be used as the source of phosphorus.
- the culture medium should also contain salts of metals such as e.g.
- the feedstocks mentioned can be added to the culture in the form of a single batch or can be added in a suitable manner during the cultivation.
- Basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or acidic compounds such as hydrochloric acid, phosphoric acid or sulfuric acid are used in a suitable manner to control the pH of the culture.
- Anti-foam agents such as e.g. Fatty acid polyglycol esters are used.
- suitable selectively acting substances e.g. Antibiotics.
- oxygen or gas mixtures containing oxygen e.g. Air entered the culture.
- the temperature of the culture is usually 20 ° C to 45 ° C and preferably 25 ° C to 40 ° C.
- the present invention relates to methods in which the cultivation is carried out discontinuously or continuously, preferably in batch, fed-batch, repeated fed-batch or continuous mode.
- the microbial conversion of the C6 carbon source takes place in a coryneform bacteria according to the invention containing one of the variants of fasB described according to the invention, in which the fatty acid synthase FasB is reduced or switched off and / or for the Gene encoding fatty acid synthase is specifically mutated, preferably by one or more nucleotide substitutions, or is partially or completely deleted.
- the microbial conversion of the C6 carbon source takes place in a coryneform bacterial cell according to the invention containing a gene gltA coding for citrate synthase according to the invention, which by mutation, preferably several nucleotide substitutions, of the operatively linked promoter its expression is reduced.
- the microbial conversion of the C6 carbon source takes place in a coryneform bacterial cell according to the invention containing the genes accBC and accD1 according to the invention, in which the functionality of the operator binding sites (fasO) for the regulator FasR in the promoter regions of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits, preferably by one or more nucleotide substitutions, is reduced or switched off and the expression of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits is de-expressed, preferred is increased.
- the functionality of the operator binding sites (fasO) for the regulator FasR in the promoter regions of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits preferably by one or more nucleotide substitutions
- the microbial conversion of the C6 carbon source takes place in a coryneform bacterial cell according to the invention, which is a combination of reduced expression and / or activity of citrate synthase (CS) and deregulated, increased,
- the microbial conversion of the C6 carbon source takes place in a coryneform bacterial cell according to the invention, which is a combination of reduced expression and / or activity of citrate synthase (CS) and deregulated, increased,
- the microbial conversion of the C6 carbon source takes place in a coryneform bacterial cell according to the invention of the genus Corynebacterium or Brevibacterium.
- the microbial conversion of the C6 carbon source takes place in a coryneform bacterial cell according to the invention selected from the group containing Corynebacterium glutamicum, particularly preferably Corynebacterium glutamicum ATCC 13032, Corynebacterium acetoglutamicum, Corynebacterium thermoaminogenes, Breum , Brevibacterium lactofermentum or Brevibacterium divaricatum.
- the invention also includes a variant of the method according to the invention for increased provision of malonyl-CoA.
- the microbial conversion of the C6 carbon source takes place in a coryneform bacterial cell according to the invention, such as, for example, B. Corynebacterium glutamicum ATCC13032 or specifically modified derivatives or primary types thereof, such as. B. Corynebacterium glutamicum ATCC13032 in which the catabolic pathway of aromatic components, preferably selected from the group comprising phenylpropanoids and benzoic acid derivatives, is also switched off.
- the present invention also relates to a process for the microbial production of polyphenols or polyketides in coryneform bacteria, comprising the steps: a) providing a solution comprising water and a C6 carbon source, b) microbial conversion of the C6 carbon source in a solution according to step a) to polyphenols or polyketides, in the presence of a coryneform bacterial cell according to the invention, malonyl-CoA first being provided in an increased concentration as an intermediate and being further reacted for the microbial synthesis of polyphenols or polyketides; c) induction of the expression of heterologous or plant genes under the control of an inducible promoter by adding a suitable inductor in step b), d) optionally the preparation of the desired product.
- a coryneform bacterial cell which has genes selected from the group comprising: a) fasB and / or gltA and / or accBCDI, their functionality and / or expression for an increased supply of malonyl-CoA is specifically modified, and b) cg0344-47 ⁇ phdBCDE operon), cg2625-40 (cat, ben and pca), cg 1226 (pobA) and cg0502 (qsuB) their functionality for the degradation of aromatic Components, preferably from the group containing phenylpropanoids or benzoic acid derivatives, are switched off, and c) pcs short coding for a protein with an increased 5,7-dihydroxy-2-methylchromone synthase activity (PCS short ) for the synthesis of polyketides , preferably Noreugenin or d) aroH and tal for the precursor synthesis of
- polyketides preferably noreugenin
- combinations are conceivable, such as, for. B. with variants of fasB (substitution mutants or deletion mutants) and Acg0344-47 ⁇ phdBCDE operon) and Acg2625-40 ⁇ cat, ben and pca) and Acg1226 ⁇ pobA) and Acg0502 ⁇ qsuB) and pcs shor1 ; or with gtIA and Acg0344-47 ⁇ phdBCDE operon) and Acg2625-40 ⁇ cat, ben and pca) and Acg1226 ⁇ pobA) and Acg0502 ⁇ qsuB) and pcs short ; or with gtIA and accBCDI and Acg0344-47 ⁇ phdBCDE-Operon) and Acg2625-40 ⁇ cat, ben and pca) and Acg1226 ⁇ pobA)
- the solution in step b) is supplemented with the polyphenol precursor, preferably p-cumaric acid.
- “preparation” is to be understood as meaning “separation”, “extraction”, “concentration” or “purification”.
- the product preparation is optional in the process according to the invention for the production of polyketides and polyphenols, since the coryneformer according to the invention is advantageous due to the advantageous, targeted parent construction Bacteria the production of only one secondary metabolite is achieved, such as. B. resveratrol or naringenin or noreugenin. As a result, the separation of several different products, such as. B. resveratrol and naringenin, not required from the culture solution. This is another advantage of the present invention.
- the process according to the invention is advantageously characterized in that it is independent of the addition of inhibitors of fatty acid synthesis, for example cerulenin.
- a further extraction, processing of the cells, cell extracts or cell supernatants are known to the person skilled in the art and can be carried out in a known manner.
- cultivation takes place in a discontinuous or continuous, preferably batch, fed-batch, repeated fed-batch or continuous mode.
- a discontinuous or continuous preferably batch, fed-batch, repeated fed-batch or continuous mode.
- the present invention also relates to the use of a coryneform bacterial cell according to the invention of the type described above and / or one or more proteins according to the invention and / or one or more nucleotide sequences according to the invention for the increased provision of malonyl-CoA in coryneform bacteria.
- the present invention also relates to the use of a coryneform bacterial cell according to the invention and / or one or more proteins and / or one or more nucleotide sequences according to the invention for the production of polyketide or polyphenol, preferably for the production of noreugenin or for the production of stilbenes, particularly preferably resveratrol , or for the production of flavonoids, particularly preferably naringenin.
- the present invention also relates to a composition containing secondary metabolites selected from the group of polyphenols and polyketides, preferably the stilbenes, flavonoids or polyketides, particularly preferably resveratrol, naringenin and / or noreugenin, produced with a coryneform bacterial cell according to the invention and / or one or more according to the invention Proteins and / or one or more nucleotide sequences according to the invention and / or a method according to the invention of the type described above.
- secondary metabolites selected from the group of polyphenols and polyketides, preferably the stilbenes, flavonoids or polyketides, particularly preferably resveratrol, naringenin and / or noreugenin
- the present invention furthermore relates to the use of resveratrol, naringenin and / or noreugenin produced with a coryneform bacterial cell according to the invention and / or according to a method according to the invention and / or the use of a composition of the type described above for the production of pharmaceuticals, foods, animal feeds, and / or for use in plant physiology.
- the composition according to the invention can contain further substances which are advantageous in the production of the desired products. A selection is known to the person skilled in the art from the prior art.
- Table 1 shows an overview of bacterial strains of the present invention.
- Table 2 shows an overview of plasmids of the present invention.
- Table 3 shows an overview of the SEQ ID NOs of the present invention.
- FIG. 1 shows plasmid pK19mobsacB-fasß-E622 for the amino acid substitution E622K in the fasß gene (cg2743), coding for a fatty acid synthase FasB with reduced functionality.
- FIG. 2 shows plasmid pK19mobsacB-fasß-G1361 D for the amino acid substitution G1361 D in the fasß gene (cg2743), coding for a fatty acid synthase FasB with reduced functionality.
- Figure 3 shows plasmid pK19mobsacB-fasß-G2153D, for the amino acid substitution G2153D in the fasß gene (cg2743), coding for a fatty acid synthase FasB with reduced functionality.
- FIG. 4 shows plasmid pK19mobsacB-fasß-G2668S for the amino acid substitution G2668S in the fasß gene (cg2743), coding for a fatty acid synthase FasB with reduced functionality.
- FIG. 5 shows plasmid pK19mobsacB -AfasB for the in-frame deletion of fasB (cg2743), for a fatty acid synthase FasB whose functionality is switched off.
- FIG. 6 shows plasmid pK19mobsacB-P 5 / M :: P tiap / l- C7 for the chromosomal integration of the gene 4cl from Petroselinum crispum codon-optimized for C. glutamicum under control of the IPTG-inducible T7 promoter at the deletion locus Acg0344-47 (Acg 0344-47 :: P 7- 4clp cCg )
- FIG. 7 shows plasmid pK19mobsacB-mufasO-accßC for mutating the fasO binding site in front of the genes accBC (cg0802), coding for an acetylCoA carboxylase subunit.
- FIG. 8 shows plasmid pK19mobsacB-mufasO-accD7 for mutating the fasO binding site in front of the accD1 gene (cg0812), coding for an acetylCoA carboxylase subunit, taking into account the ATG start codon and the amino acid sequence of accD1.
- FIG. 9 shows plasmid pMKEx2-sts Ah- 4d Pc for expression of the genes codon-optimized for C. glutamicum for a stilbene synthase (sts) from Arachis hypogea and a 4 Cumarat CoA ligase ⁇ 4c! From Petroselinum crispum under the control of the IPTG- inducible T7 promoter
- FIG. 10 shows plasmid pMKEx2-chs Ph -chi Ph for expressing the genes codon-optimized for C. glutamicum for a chalcone synthase (chs) from Petunia x hybrida and a chalcone isomerase (chi) from Petunia x hybrida under the control of the IPTG-inducible T7 promoter
- FIG. 11 shows plasmid pMKEx2-pcs A3 -short for expressing a shortened variant of the gene optimized for C. glutamicum codon-optimized for a pentaketide chromone synthase (pcs) from aloe arborescens
- FIG. 12 shows plasmid pK19mobsacB-cg0344-47-del with which the phdBCDE operon (cg0344-47), which codes for genes which are involved in the catabolism of phenylpropanoids, such as, for. B. p-cumaric acid, is deleted from the genome.
- FIG. 13 shows plasmid pK19mobsacB-cg2625-40-del with which the genes cat, ben and pca (cg2625-40), which are essential for the breakdown of 4-hydroxybenzoate, catechol, benzoate and protocatechuate, are deleted from the genome.
- FIG. 14 shows plasmid pK19mobsacB-Acg0344-47 :: P T7 -4c / Pc for the chromosomal integration of a variant of the 4cl gene from Petroselinum crispum codon-optimized for C. glutamicum, under the control of the T7 promoter (PT7- 4C / Pc ), to the deletion locus Dcg0344-47.
- FIG. 15 shows plasmid pK19mobsacB-cg0502-del with which the gene qsuB (cg0502), essential for the accumulation of protocatechuate, is deleted from the genome.
- Figure 16 shows plasmid pK19mobsacB-cg1226-del with which the gene phobA (cg1226), coding for 4-hydroxybenzoate-3-hydroxylase and essential for the breakdown of 4-hydroxybenzoate, catechol, benzoate and protocatechuate, is deleted from the genome.
- gene phobA cg12266
- FIG. 17 shows plasmid pEKEx3-aro / - / £ c -fa / P c g with the genes coding for a feedback-resistant 3-deoxy-D-arabinoheptulosonate-7-phosphate synthase (aroH), preferably from E. coli (aroH Ec ), as well as for a tyrosine ammonium lyase (tal) adapted to the codon use of C. glutamicum, preferably from Flavobacertium johnsoniae (tal Fj ) ⁇
- This plasmid is used in the synthesis of polyphenols or polyketides during growth starting from glucose.
- FIG. 18 shows plasmid pMKEx2_sfS / u, _4c / Pc for the expression of the genes sfs from Arachis hypogea (sts Ah ) and 4c / from Petroselinum crispum (4c / Pc ) in coryneform bacterial cells.
- FIG. 19 shows plasmid pMKEX2-cf / s P / , -c / i / ' P / , for the expression of the genes chs and chi from Petunia x hybrida (chs Ph and chip h ) in coryneform bacterial cells.
- FIG. 20 shows plasmid pMKEx2 _pcs Aa for the expression of pcs from Aloe arborescens (pcs Aa ) with adaptation to the codon use of coryneform bacterial cells.
- FIG. 21 shows plasmid pMKEx2 _pcs Aa - short for the expression of the gene variant of pcs from Aloe arborescens (pcs Aa ) in coryneform bacterial cells.
- FIG. 22 shows a sequence comparison of the native promoter region P daP A of C. glutami- cum wild-type gene with the P dapA- C7 promoter according to the invention, which replaces the native gtlA promoter before the gtlA gene from Corynebacterium glutamicum according to the invention.
- the promoter region PgltA :: PdapA-C7 according to the invention has, in addition to the exchange of the promoter region of gtIA (PgtIA) for the promoter of dapA (PdapA), also nucleotide substitutions at positions 95 (a-> t) and 96 (g-> a ) in front of the start codon ATG from gtIA.
- FIG. 23 shows an overview of the fasO binding sites 5 'operatively linked before the genes accBC and accD1 with nucleotide substitutions according to the invention, resulting in a loss of binding of the fasR regulator and an increased functionality or expression of the accBCD1 genes .
- An overview of fasO-accD1 sequences is also shown.
- the accD1 start codon underlined (AS sequence translated accordingly from here), highlighted in gray: conserved areas of the fasO binding motif that have to be mutated to prevent FasR binding red: differences to the native sequence.
- FIG. 24 shows a diagram with malonyl-CoA concentrations (measured in the form of mM malonate) in coryneform bacterial cells according to the invention.
- the plasmid pK19mobsacB-PgltA PdapA-C7 (FIG. 6)
- the flanking areas were chosen so that a 540 base pair chromosomal fragment, which carries the native gltA promoter region with the two transcription start and operator sequences, can be deleted.
- a 20 base pair large linker was inserted between the two edges up and down, which has the interfaces Nsi ⁇ and Xho ⁇ .
- the C7 variant of the dapA promoter was then subcloned via these interfaces.
- the upstream fragment up was amplified with the primer pair PgltA-up-s / PgltA-up-as
- the downstream flank was amplified with the primer pair PgltA-down-s / PgltA-down-as.
- the generated DNA fragments were checked for the expected base pair size using gel electrophoretic analysis on a 1% agarose gel.
- the nucleotide sequences of the inner primers (PgltA-up-as / PgltA-down-s) were chosen so that the two amplified fragments up and down contain mutually complementary overhangs (including the described A / s / l / X /
- the purified fragments accumulate via the complementary sequences and serve each other both as primers and as templates (overlap-extension PCR).
- the A540 fragment generated in this way was amplified in a final PCR with the two outer primers (facing away from the gene) from the first PCR (PgltA-up-s / PgltA-down-as).
- the deletion fragment was used in a triple molar excess. compared to the linearized vector backbone pK19mobsacB.
- the entire batch volume was used for the transformation of chemically competent E. coli DH5a cells by means of heat shock at 42 ° C. for 90 seconds. Following the heat shock, the cells were regenerated on ice for 90 seconds before they were provided with 800 pL LB medium and regenerated at 37 ° C. in a thermomixer (Ependorf, Hamburg) at 900 RPM for 60 minutes.
- the primer pair univ / rsp was used as the DNA primer for the colony PCR, which binds specifically to the pK19mobsacB vector backbone and, if the fragments used are correctly ligated, forms a PCR product of a specific size, which is checked by gel electrophoresis has been. Clones whose PCR product indicated a correct assembly of pK19mobsacB-D540 were grown overnight in LB medium with kanamycin (50 pg / mL) for the isolation of the plasmids.
- the plasmids were then isolated with the NucleoSpin Plasmid (NoLid) -KA (Macherey-Nagel, Düren) and sequenced with the above-mentioned amplification and colony PCR primers.
- the C7 variant of the dapA promoter was amplified with the primer pair PdapA-s / PdapA-as and checked for the expected base pair size by means of gel electrophoretic analysis on a 1% agarose gel.
- the generated fragment was cleaned with the NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) according to the attached protocol.
- both the generated PdapA fragment and the target vector pk19mobsacB-A540 were digested with the FastDigest variants (Thermo Fisher Scientific) of the restriction enzymes Xho ⁇ and Nsi ⁇ .
- the restriction mixtures of the fragments mentioned were cleaned using the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren).
- the PdapA fragment was used in a triple molar excess compared to the linearized vector backbone pk19mobsacB-A540.
- the entire batch volume for the transformation of chemically competent E. coli DH5a cells was determined by heat shock at 42 ° C. for 90 seconds used. Following the heat shock, the cells were regenerated on ice for 90 seconds before they were provided with 800 ml of LB medium and regenerated at 37 ° C. in a thermal mixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes.
- the primer pair univ / rsp was used as the DNA primer for the colony PCR. It binds specifically to the pK19mobsacB vector backbone and, if the fragments used are correctly ligated, forms a PCR product of a specific size, which was checked by gel electrophoresis. Clones whose PCR product indicated correct assembly of pk19mobsacB-PgltA :: PdapA-C7 were grown overnight in LB medium with kanamycin (50 pg / mL) for the isolation of the plasmids. The plasmids were then isolated with the NudeoSpin plasmid (NoLid) KW (Macherey-Nagel, Düren) and sequenced with the amplification and colony PCR primers mentioned.
- the Levan sucrase encoded by sacB is formed in addition to the kanamycin resistance. This enzyme catalyzes the polymerization of sucrose into toxic levan, so that there is an induced lethality when sucrose grows (Bramucci & Nagarajan, 1996). Accordingly, colonies that have integrated the mutation plasmid into their genome via homologous recombination are resistant to kanamycin and sensitive to sucrose.
- the corresponding genomic region was amplified by colony PCR (primer pair chk-PgltA-s / chk-PgltA-as) and checked for the expected fragment size using gel electrophoresis.
- PCR products that indicate a promoter exchange were cleaned with the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) and used to verify the exchange with the primers chk-PgltA-s and chk-PgltA-as sequenced.
- the promoter region PgltA :: PdapA-C7 according to the invention has, in addition to the exchange of the promoter region of gtIA for dapA, also nucleotide substitutions at positions 95 (a-> t) and 96 (g-> a) before the start codon ATG (FIG. 22).
- PgltA-up-as TATG C AT GTTT CT C G AGT GG G CC G AAC AAAT AT GTTT GAAAG G
- PgltA-down-s CCCACTCGAGAAACATGCATAGCGTTTTCAATAGTTCGGTGTC
- PgltA-down-as CCCCCCGGGGGGCCTAGGGAAAGGATGATCTCGTAGCC
- PdapA-s CCAATGCATTGGTTCTGCAGTTATCACACCCAAGAGCTAAAAAT
- PdapA-as CCGCTCGAGCGGCTCCGGTCTTAGCTGTTAAACCT
- chk-PgltA-as TCGAGTGGGTTCAGCTGGTCC
- the primer pair mu-accXX-up-s / mu-accXX-up-as was used to generate the upstream fragment, the downstream flank was primed with the primer pair mu-accXX-down-s / mu-accXX-down-as amplified.
- Coding XX stands for one of the two acc gene variants (accBC or accD1).
- the nucleotide sequences of the inner primers (facing the gene to be deleted) fasB- (cg2743) -up-as / fasB- (cg2743) -down-s) were chosen so that the two amplified fragments up and down complement each other Overhangs are included, which are prerequisites for the subsequent Gibson assembly.
- the planned mutations within the respective fasO binding site are introduced via these primers.
- the generated DNA fragments were checked for the expected base pair size by gel electrophoretic analysis on a 1% agarose gel and then cleaned with the NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) according to the enclosed protocol .
- the pK19-mobsacB empty vector was linearized with the FastDigestA / ariante (Thermo Fisher Scientific) of the restriction enzyme EcoRI.
- the restriction mixture was cleaned using the NucleoSpin Gel and PCR Clean-up Kit (Mache rey-Nagel, Düren).
- the amplified fragments were used in a three-fold molar excess compared to the linearized vector backbone pK19mobsacB.
- the DNA fragments were provided with a prepared Gibson Assembly Master Mix, which contains an isothermal reaction buffer and the enzymes required for assembly (T5 exonuclease, phusion DNA polymerase and Taq DNA ligase).
- the fragments are assembled at 50 ° C. for 60 minutes in a thermal cycler. After the fragments had been assembled, the entire batch volume was used for the transformation of chemically competent E. coli DH5a cells by means of heat shock at 42 ° C. for 90 seconds.
- the cells were regenerated on ice for 90 seconds before they were provided with 800 ⁇ l LB medium and regenerated at 37 ° C. in a thermomixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes. Then 100 ⁇ l of the cell suspension were spread on LB agar plates with kanamycin (50 pg / ml) and incubated at 37 ° C. overnight. The correct assembly of the mutation plasmids in the grown transformants was checked by means of colony PCR. The 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this. The DNA template was the PCR approach by the Add cells to the grown colonies buried.
- the cells are lysed by the initial denaturation step of the PCR protocol at 95 ° C. for 3 minutes, so that the DNA template was released and was accessible to the DNA polymerase.
- the primer pair univ / rsp was used as the DNA primer for the colony PCR. It binds specifically to the pK19mobsacB vector backbone and, if the fragments used are correctly assembled, forms a PCR product of a specific size, which is checked by gel electrophoresis has been.
- Clones whose PCR product indicates a correct assembly of the mutation plasmids pK19mobsacB-mufasO-accBC or pK19mobsacB-mufasO-accD1 were grown overnight in LB medium with kanamycin (50 pg / mL) for the isolation of the plasmids.
- the plasmids were then isolated with the NucleoSpin Plasmid (NoLid) -K ⁇ t (Macherey-Nagel, Düren) and sequenced with the amplification and colony PCR primers mentioned.
- the Levan sucrase encoded by sacB is formed in addition to the kanamycin resistance. This enzyme catalyzes the polymerization of sucrose into toxic levan, so that there is an induced lethality when sucrose grows (Bramucci & Nagarajan, 1996). Accordingly, colonies that have integrated the mutation plasmid into their genome via homologous recombination are resistant to kanamycin and sensitive to sucrose.
- a total of 50 of the clones grown on the BHI 10% sucrose (w / v) plate were selected and streaked out to check the successful excision of pK19mobsacß on BHI-Kan 25 and BHI 10% sucrose (w / v) and overnight at 30 ° C incubated.
- the plasmid should be removed completely this is shown by a sensitivity to kanamycin and a resistance to sucrose of the respective clone.
- the second recombination event can also restore the wild-type situation.
- the corresponding genomic region was amplified by colony PCR (primer pair chk_accXX_s / chk_accXX_as).
- the PCR products were cleaned with the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) and sequenced with the primers chk_accXX_s / chk_accXX_as to verify the mutation.
- nucleotide substitutions are thus present in the fasO binding site in front of accBC at positions 1 1 -13 (tga -> gtc) and 20-22 (cct -> aag).
- the fasO binding site in front of accD1 there are nucleotide substitutions at positions 20-24 (cctca -> gtacg).
- the fasO binding sites according to the invention have a nucleic acid sequence according to SEQ ID NO: 13 or 15 in front of the accBD or accD1 genes.
- mu-accBC-up-s ATCCCCGGGTACCGAGCTCGAACCAGCGCGCGTTCGTG mu-accBC-up-as: TT ACG ACT ATT CTGG G G G AATT CTTCT GTTTT AGG C AG GA
- mu-accBC-down-s AG AAGAATT CCCCC AGAAT AGT CGTAAGT AAGCAT AT CT G
- mu-accBC-down-as TTGTAAAACGACGGCCAGTGGCCTTGGCGGTATCTGCG chk-accBC-s: GTTCGGCCACTCCGATGTCCGCCTG
- chk-accBC-as GCCTTGATGGCGATTGGGAGACC
- mu-accD1 -up-s ATCCCCGGGTACCGAGCTCGTCATTCAACGCATCCATGA
- mu-accD1-up-as CTAATGGTCATGTTTTGAAATCGTAGCGGTAGGCGGGG mu-accD1-down-s: ACCGCTACGATTT CAAAACAT GACCATTAGT AGCCCTTT G
- chk-accD1 -as GATCACGTCTGGGCCGGTAACGAAC Deletion of the gene fasB to switch off the functionality of the fatty acid protein FasB for integration into the genome of coryneform bacterial cells
- flanking fragments required for the homologous recombination event were amplified by PCR starting from isolated genomic C. glutamicum DNA.
- the primer pair fasB- (cg2743) -up-s / fasB- (cg2743) -up-as was used to generate the upstream fragment, the downstream flank was primed with the primer pair fasB- (cg2743) -down-s / fasB - (cg2743) -down-as amplified.
- the nucleotide sequences of the inner primers (facing the gene to be deleted) fasB- (cg2743) - up-as / fasB- (cg2743) -down-s) were chosen so that the two amplified fragments up and down complementary overhangs included, which are prerequisites for the subsequent Gibson assembly.
- the DNA fragments were checked for the expected base pair size using gel electrophoretic analysis on a 1% agarose gel and then cleaned using the NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) according to the enclosed protocol.
- the pK19-mobsacB empty vector was linearized with the Fast Digest variant (Thermo Fisher Scientific) of the restriction enzyme EcoRI.
- the restriction mixture was cleaned with the NucleoSpin Gel and PCR clean-up kit (Macherey-Nagel, Düren).
- the amplified fragments were used in a three-fold molar excess compared to the linearized vector backbone pK19mobsacB.
- the DNA fragments were provided with a prepared Gibson Assembly Master Mix, which contains an isothermal reaction buffer and the enzymes required for assembly (T5 exonuclease, phusion DNA polymerase and Taq DNA ligase).
- the fragments are assembled at 50 ° C. for 60 minutes in a thermal cycler. After the fragments had been assembled, the entire batch volume was used for the transformation of chemically competent E. coli DH5a cells by means of heat shock at 42 ° C. for 90 seconds.
- the cells were regenerated on ice for 90 seconds before they were provided with 800 ml of LB medium and regenerated at 37 ° C. in a thermomixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes. Subsequently, 100 ml of the cell suspension were spread on LB agar plates with kanamycin (50 pg / ml) and incubated at 37 ° C. overnight. The correct assembly of the Mutation plasmids in the grown transformants were checked by colony PCR. The 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this. The DNA template was added to the PCR approach by adding cells from the grown colonies.
- the cells are lysed by the initial denaturation step of the PCR protocol at 95 ° C. for 3 minutes, so that the DNA template was released and was accessible to the DNA polymerase.
- the primer pair univ / rsp was used as the DNA primer for the colony PCR, which binds specifically to the pK19mobsacB vector backbone and, if the fragments used are correctly assembled, forms a PCR product of a specific size, which was checked by gel electrophoresis.
- Clones whose PCR product indicated a correct assembly of the deletion plasmid pK19mobsacB-AfasB were grown overnight in LB medium with kamanycin (50 pg / mL) for the isolation of the plasmids.
- the plasmids were then isolated with the NucleoSpin plasmid (NoLid) -K ⁇ t (Macherey-Nagel, Düren) and sequenced with the amplification and colony PCR primers mentioned.
- the levan-sucrase encoded by sacB is formed in addition to the kanamycin resistance.
- This enzyme catalyzes the polymerization of sucrose into toxic levan, so that there is an induced lethality when sucrose grows (Bramucci & Nagarajan, 1996). Accordingly, colonies that have integrated the deletion plasmid into their genome via homologous recombination are resistant to kanamycin and sensitive to sucrose.
- a total of 50 of the clones grown on the BHI 10% sucrose (w / v) plate were selected and used to check the successful excision of pK19 mobsacB on BHI-Kan 25 and BHI 10% sucrose (w / v) and incubated overnight at 30 ° C. If the plasmid has been completely removed, this is shown by a sensitivity to kanamycin and a resistance to sucrose of the respective clone.
- the second recombination event (excision) can, in addition to the desired deletion, also lead to the restoration of the wild-type situation.
- the successful deletion in the clones obtained after excision was checked via the expected fragment size upon deletion of the clones obtained by means of colony PCR.
- the primers chk-fasB-s / chk-fasB-as used were chosen so that they bind in the chromosome outside the deleted DNA area and also outside the amplified flanking gene areas.
- chk-fasB-s GG AGGAT ACAT CCACGGT CATT G
- chk-fasB-as CGCTATGAGTT C AG GAT GTT GAT CG
- Nucleotide substitution in the gene encodes a fatty acid synthesis with reduced functionality for integration into the genome of coryneform bacterial cells
- glutamicum DelAro 4 -4d Pc cells were grown in 5 ml BHI medium (test tube, 30 ° C, 170 RPM) to an OD 6 oonm of 5 to ensure that the exponential growth phase was reached.
- the whole cell mutagenesis was carried out by adding methylnitronitrosoguanidine (MNNG) dissolved in DMSO (final concentration 0.1 mg / mL) for 15 minutes at 30 ° C.
- MNNG methylnitronitrosoguanidine
- DMSO final concentration 0.1 mg / mL
- the treated cells were washed twice with 45 ml NaCl, 0.9% (w / v), resuspended in 10 ml BHI medium and then regenerated for 3 hours at 30 ° C. and 170 RPM.
- the mutated cells were stored as glycerol stocks at -30 ° C. in BHI medium with 40% (w / v) glycerol.
- dilutions of the cell libraries were plated on BHI agar plates so that individual colonies could be picked.
- Individual clones were picked at random and cultivated for the determination of malonyl-CoA provision according to the described LC-MS / MS protocol.
- the genome of the clones for which an improved provision of malonyl-CoA could be measured was then sequenced.
- selected mutations were integrated into the background of C. glutamicum DelAro 4 -4d Pc .
- the malonyl-CoA provision was then measured again by means of LC-MS / MS in order to check whether the introduced mutations have the suspected positive influence on the malonyl-CoA provision.
- the primer pair Sbfl_XXX_s / OL_XXX_as was used to generate the upstream fragment, the downstream flank was amplified with the primer pair OL_XXX_s / Xbal_XXX-as.
- Coding XXX stands here for the amino acid substitution to be inserted at a specific position in the fatty acid synthase B.
- the DNA fragments were checked for the expected base pair size using gel electrophoretic analysis on a 1% agarose gel.
- the nucleotide sequences of the inner primers (facing the codon to be mutated) (OL_XXX_as / OL_XXX_s) were chosen so that the two amplified fragments up and down contain mutually complementary overhangs.
- the purified fragments In a second PCR (without the addition of DNA primers), the purified fragments accumulate via the complementary sequences and serve both as a primer and as a template (overlap-extension PCR).
- the mutation fragment generated in this way was amplified in a final PCR with the two outer primers (facing away from the gene) from the first PCR (Sbfl_XXX_s / Xbal_XXX-as). After electrophoretic separation on a 1% TAE agarose gel, the final mutation fragment was isolated from the gel using the NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) according to the attached protocol.
- both the mutation fragments and the pK19-mobsacB empty vector were linearized with the FastDigest variants (Thermo Fisher Scientific) of the restriction enzymes Sbf ⁇ and Xba ⁇ .
- the restriction approaches of the fragments mentioned were cleaned using the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren).
- a mutation fragment was used in a three-fold molar excess compared to the linearized vector backbone pK19mobsacB.
- the entire batch volume was used for the transformation of chemically competent E. coli DFI5a cells by means of flash shock at 42 ° C. for 90 seconds. Following the flash shock, the cells were regenerated on ice for 90 seconds before they were provided with 800 pL LB medium and regenerated at 37 ° C. in a thermomixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes. Subsequently, 100 pL of the cell suspension were spread on LB agar plates with kanamycin (50 pg / ml) and incubated at 37 ° C. overnight. The correct assembly of the mutation plasmids in the grown transformants was checked by means of colony PCR.
- the 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this.
- the DNA template was added to the PCR approach by adding cells from the grown colonies. The cells were lysed by the initial denaturation step of the PCR protocol at 95 ° C. for 3 minutes, so that the DNA template was released and was accessible to the DNA polymerase.
- the primer pair univ / rsp was used as the DNA primer for the colony PCR. It binds specifically to the pK19mobsacB vector backbone and, if the fragments used are correctly ligated, forms a PCR product of a specific size, which was checked by gel electrophoresis.
- Clones whose PCR product indicated that the respective mutation plasmid pK19mobsacB-fasB-XXX was correctly assembled were grown overnight in LB medium with kanamycin (50 pg / mL) for the isolation of the plasmids.
- the plasmids were then isolated with the NucleoSpin Plasmid (NoLid) -K ⁇ t (Macherey-Nagel, Düren) and sequenced with the amplification and colony PCR primers mentioned.
- the Levan sucrase encoded by sacB is formed in addition to the kanamycin resistance.
- This enzyme catalyzes the polymerization of sucrose into toxic levan, so that there is an induced lethality when growing on sucrose (Bramucci & Nagarajan, 1996). Accordingly, colonies that have integrated the mutation plasmid into their genome via homologous recombination are resistant to kanamycin and sensitive to sucrose. The excision of pK19 / nobsacß took place in a second recombination event over the now double DNA regions, in which the codon to be mutated from the chromosome was ultimately exchanged for the introduced mutation fragment.
- cells which showed the phenotype described were incubated in a test tube with 3 ml of BHI medium (without addition of kanamycin) for 3 hours at 30 ° C. and 170 RPM. Subsequently, 100 ⁇ l of a 1:10 dilution were spread on BHI-Kan 25 plates and BHI-10% sucrose (w / v) plates and incubated at 30 ° C. overnight.
- the corresponding genomic region was amplified by colony PCR (primer pair Sbfl_XXX_s / Xbal_XXX-as).
- the PCR products were cleaned with the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) and sequenced with the primers Sbfl_XXX_s, OL_XXX_as, OL_XXX_s and Xbal_XXX-as to verify the mutation.
- OL_622-s GT ACCGCT GCGAT GGCAACCAAGAAAGCAACCACCT CCCAG
- OL 622-as GACGGCCTGGGAGGTGGTTGCTTTCTTGGTTGCCATCGCA
- Sbfl 622-s AAAACCTGCAGGGGCTGAGCTCGCTGGTGGCGGACAGGTTAC
- Xbal 622-as GGGGTCT AG AACGT CCTT AT CAAT GACGGGCACAAAGTT CAC
- OL 1361 -s C CT CAC C C AGTT CAC C C AG GTG G AC AT G G C AACT CTGGGCGTT
- Xbal 1361-as GG AAT CT AG AT CG G CG G AAG C AG CCTT G AAAT C AG C C AAG AT CTC pK19mobsacB-fasB-G2153D
- Sbfl 2153-s AAAACCTGCAGGTTGGCCACGTCAGGTTGCACCAAGCTTCGATG
- Xbal 2153-as AAAATCTAGACCGAGCTCGCCGGCGCCAACGATGACGACCATC
- OL_G2668S-s AGTCCGACTTCGTTGTCGCATCCGGCTTCGATGCCCTGTCC
- OL_G2668S-as GGACAGGGCATCGAAGCCGGATGCGACAACGAAGTCGGACT Sbfl
- G2668S-s AAAACCTGCAGGCACTGACCTGGCCGACT
- proteins of the fatty acid synthase FasB from coryneform bacteria and / or nucleic acid sequences encoding a fatty acid synthase FasB from coryneform bacteria are encoded, in which nucleotide substitutions and corresponding amino acid exchanges are present.
- Such variants are described, for example, in SEQ ID NO. 1 with a nucleotide substitution at position 1864 (g -> a), in SEQ ID NO. 3 with a nucleotide substitution at position 4082 (g -> a), in SEQ ID NO. 5 with a nucleotide substitution at position 6458 (g -> a), in SEQ ID NO. 7 with a nucleotide substitution at positions 8002-8004 (ggt-> tcc) and in SEQ ID NO. 9 with a deletion of positions 25-8943.
- the target gene is then deleted as described (Niebisch & Bott, 2001; https://doi.org/10.1007/s002030100262).
- the deletion fragment required for this is generated by means of cross-over-PCR (Link et al., 1997; https://doi.org/10.1128/jb.179.20.6228- 6237.1997).
- bp flanking fragments are generated, which are located in the chromosome upstream and downstream of the gene to be deleted.
- the nucleotide sequences of the inner primers (facing the gene to be deleted) are selected such that the two amplified fragments contain overhangs which are complementary to one another.
- the purified fragments accumulate via the complementary sequences and serve each other both as a primer and as a template.
- the deletion fragment generated in this way is amplified in a final PCR with the two outer primers (facing away from the gene) from the first PCR.
- the final deletion fragment with the NucleoSpin ® Gel and PCR Clean-up Kit (Macherey-Nagel, Duren) is isolated according to the protocol attached thereto from the gel.
- the deletion fragment is then ligated with the vector pK19 mobsacB over the inserted and hydrolyzed restriction sites. Chemically competent E.
- coli DH5 cells are then transformed with the entire ligation approach.
- the grown transformants are checked for the correct ligation product by colony PCR; positive deletion plasmids are isolated and sequenced.
- the DNA sequence to be inserted is cloned between the flanking regions of the target locus. The following steps are identical for both deletions and insertions. For the sake of simplicity, we only speak of deletion plasmids.
- the Levan sucrase encoded by sacB is formed in addition to the kanamycin resistance.
- This enzyme catalyzes the polymerization of sacchar rose to the toxic levan, so that there is an induced lethality when growing on sucrose (Bramucci & Nagarajan, 1996 ;, PMID 8899981). Accordingly, colonies that have integrated the deletion plasmid into their genome via homologous recombination are resistant to kanamycin and sensitive to sucrose.
- a total of 50 of the clones grown on the BHI 10% sucrose (w / v) plate are selected and streaked out to check the successful excision of pK19 mobsacB on BHI-Kan 25 and BHI 10% sucrose (w / v) and overnight at 30 ° C incubated. If the plasmid has been completely removed, this is shown by a sensitivity to kanamycin and a resistance to sucrose of the respective clone.
- the second recombination event (excision) can, in addition to the desired gene deletion, also lead to the restoration of the wild-type situation.
- the successful deletion in the clones obtained after excision is checked via the expected fragment size upon deletion of the gene or gene cluster by means of colony PCR of the clones obtained.
- the primers used are chosen so that they bind in the chromosome outside the deleted DNA area and also outside the amplified flanking gene areas.
- strains are constructed starting from the strain C. glutamicum ATCC 13032, which in the coding region of the homologous fatty acid synthase gene fasB nucleotide substitutions (Cg130232-fasB-E622K, Cg130232-fasB-G1361 D, Cg 130232-fasB-G2153E, Cg130232-fasB-G2668S) or deleted areas (Cg 13032-AfasB), changes in the homologous fasO binding site in front of the gene cluster accBCDI (Cg130232-mufasO), and a homologous promoter region with reduced activity in front of the gene coding for the citrate synthase gtIA (Cg 13032-C7).
- These strains are characterized by the fact that they are non-recombinantly modified and are thus characterized as non-GMOs.
- the C. glutamicum MB001 (DE3) strain is chosen as the starting strain for the construction of C. glutamicum DelAro -4cl PcCg .
- This is a prophage-free C. glutamicum ATCC13032 wild-type strain (strain C. glutamicum MB001; Baumgart et al, 2013b, https://doi.org/10.1 128 / AEM.01634-13), which is described below has a chromosomally integrated T7 polymerase, which allows the use of the strong and inducible T7 promoter (strain C.
- glutamicum MB001 (DE3); (Kortmann et al., 2015; https://doi.org/10.1111/1751- 7915.12236) This promoter is also located on the pMK-Ex2 plasmids which are used for the expression of genes of plant origin involved in the synthesis of the respective product.
- strain C. glutamicum DelAro 3 is constructed by deleting the gene (clusters) cg0344-47, cg2625-40 and cg1226 (Kallscheuer et al., 2016, https: // doi .Org / 10.1016 / j.ymben.2016.06.003).
- Cg0344-47 is the phdBCDE operon, which codes for genes that are involved in the catabolism of phenylpropanoids, such as. B. p-cumaric acid is involved.
- Dehydroshikimate Dehydratase QsuB catalyzes the thermodynamically irreversible conversion of the shikimate-path intermediate 3-dehydroshikimate to protocatechuate and thus leads to an undesired loss of intermediates in the synthetic route of aromatic amino acids.
- the deletion of qsuB reduced the accumulation of protocatechuate.
- the gene cg0502 (qsuB) is additionally deleted in the constructed strain C. glutamicum DelAro 3 , resulting in the strain C. glutamicum DelAro 4 .
- the primer pair cgXXXX-XX-up-s / cgXXXX-XX-up-as was used to generate the upstream fragment, the downstream flank was used with the primer pair cgXXXX-XX-down-s / cgXXXX-XX-down-as amplified.
- the coding XXXX-XX stands for the cg numbers of the genes to be deleted.
- the primer pair cg0344-47-up-s / cg0344- 47-up-as is used for the deletion of the gene clusters cg0344-47 and analogously for the deletion of the gene clusters cg2625-40 the primer pair cg2625-40-up-s / cg2625 -40-up-as.
- the generated DNA fragments were checked for the expected base pair size using gel electrophoretic analysis on a 1% agarose gel.
- nucleotide sequences of the inner primers (facing the gene to be deleted) (cgXXXX-XX-up-as / cgXXXX-XX-down-s) were chosen so that the two amplified fragments up and down complementary to each other slopes included.
- cg0344-47 this is the primer pair cg0344-47-up-as / cg0344-47-down-s and analogously for the gene cluster cg2625-40 the primer pair cg2625-40-up-as / cg2625-40-down-s .
- the purified fragments In a second PCR (without the addition of DNA primers), the purified fragments accumulate via the complementary sequences and serve both as primers and as templates (overlap-extension PCR).
- the deletion fragment generated in this way was amplified in a final PCR with the two outer primers (facing away from the gene) from the first PCR (cgXXXX-XX-up-s / cgXXXX-XX-down-as).
- the gene cluster cg0344-47 this is the primer pair cg0344-47-up-s / cg0344-47-down-as and analogously for the gene cluster cg2625-40 the primer pair cg2625-40-up-s / cg2625-40-down-as .
- the final deletion fragment was isolated from the gel using the NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) according to the attached protocol.
- both the deletion fragments and the pK19-mobsacB empty vector were linearized with the FastDigest - ⁇ / a variants (Thermo Fisher Scientific) of the restriction enzymes Xba ⁇ and EcoRI.
- the restriction mixtures of the fragments mentioned were cleaned using the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren).
- a Rapid DNA Ligation Kit Thermo Fisher Scientific
- one of the two deletion fragments was used in a three-fold molar excess compared to the linearized vector backbone pK19mobsacB.
- the entire batch volume was used for the transformation of chemically competent E. coli DH5a cells by means of heat shock at 42 ° C. for 90 seconds. Following the heat shock, the cells were regenerated on ice for 90 seconds before they were provided with 800 pL LB medium and regenerated at 37 ° C. in a thermomixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes. Subsequently, 100 pL of the cell suspension were spread on LB agar plates with kanamycin (50 pg / ml) and incubated at 37 ° C. overnight. The correct assembly of the deletion plasmids in the grown transformants was checked by means of colony PCR.
- the 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this.
- the DNA template was added to the PCR approach by adding cells from the grown colonies. The cells were lysed by the initial denaturation step of the PCR protocol at 95 ° C. for 3 minutes, so that the DNA template was released and was accessible to the DNA polymerase.
- the primer pair univ / rsp was used as the DNA primer for the colony PCR, which binds specifically to the pK19mobsacB vector backbone and, in the event of a correct ligation of the fragments used, forms a PCR product of a specific size, which was checked by gel electrophoresis.
- NoLid NucleoSpin Plasmid
- the Levan sucrase encoded by sacB is formed in addition to the kanamycin resistance.
- This enzyme catalyzes the polymerization of saccharose into toxic levan, so that there is an induced lethality when sucrose grows (Bramucci & Nagarajan, 1996). Accordingly, colonies that have integrated the deletion plasmid into their genome via homologous recombination are resistant to kanamycin and sensitive to sucrose.
- a total of 50 clones grown on the BHI 10% sucrose (w / v) plate were selected and% sucrose (w / v) streaked and incubated overnight at 30 ° C. If the plasmid has been completely removed, this is shown by a sensitivity to kanamycin and a resistance to saccha rose of the respective clone.
- the second recombination event (excision) can, in addition to the desired gene deletion, also lead to the restoration of the wild-type situation.
- the successful deletion in the clones obtained after excision was checked via the expected fragment size upon deletion of the gene or gene cluster by means of colony PCR of the clones obtained.
- the primers del-cgXXXX-XX-s / del-cgXXXX-as were used so that they bind in the chromosome outside of the deleted DNA area and also outside of the amplified flanking gene areas.
- this is the primer pair del-cg0344-47-s / del-cg0344-47-as and analogously for the gene cluster cg2625-40 the primer pair del-cg2625-40-s / del-cg2625-40-as.
- CTCTCT AG AG CG GT G G CG AT GAT G ATCTTC GAG
- cg0344-47-up-as AAGCATATGAGCCAAGTACTATCAACGCGTCAGGGCGACT
- cg2625-40-down-s TTGAGCACGCGTTGCATATGT G AACT CGAGACGGTC
- both the amplified 4cl Pc gene and the plasmid pK19mobsacB-cg0344-47 ⁇ del were linearized with the FastDigest variants (Thermo Fisher Scientific) of the restriction enzymes Mlu ⁇ and Nde I.
- the restriction mixtures of the fragments mentioned were cleaned using the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren).
- the 4c / Pc fragment in a triple molar excess was shot against the linearized vector backbone pK19mobsacB-cg0344-47-del.
- the entire batch volume was used for the transformation of chemically competent E. coli DH5a cells by means of heat shock at 42 ° C. for 90 seconds. Following the heat shock, the cells were regenerated on ice for 90 seconds before they were provided with 800 ⁇ l LB medium and regenerated at 37 ° C. in a thermomixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes.
- the primer pair univ / rsp was used as the DNA primer for the colony PCR, which binds specifically to the pK19mobsacB vector backbone and, in the event of a correct ligation of the fragments used, forms a PCR product of a specific size, which was checked by gel electrophoresis.
- Clones whose PCR product indicated a correct assembly of the insertion plasmid pK19mobsacB-Acg0344-47 :: P T7 -4d Pc were grown overnight in LB medium with kanamycin (50 pg / mL) for the isolation of the plasmids.
- the plasmids were then isolated using the NucleoSpin Plasmid (NoLid) kit (Macherey-Nagel, Düren) and sequenced using the amplification and colony PCR primers mentioned.
- the levan sucrase encoded by sacB is formed in addition to the kanamycin resistance.
- This enzyme catalyzes the polymerization of sucrose into toxic levan, so that there is an induced lethality when sucrose grows (Bramucci & Nagarajan, 1996). Accordingly, are colonies that Insertion plasmid integrated into their genome via homologous recombination, resistant to kanamycin and sensitive to sucrose.
- a total of 50 of the clones grown on the BHI 10% sucrose (w / v) plate were selected and streaked to check the successful excision of pK19 mobsacB on BHI-Kan 25 and BHI 10% sucrose (w / v) and overnight at 30 ° C incubated. If the plasmid has been completely removed, this is shown by a sensitivity to kanamycin and a resistance to sucrose of the respective clone.
- the second recombination event (excision) can, in addition to the desired P T7 -4c / Pc insertion, also lead to the restoration of the wild-type situation.
- the successful insertion in the clones obtained after excision was checked via the expected fragment size when the gene or gene cluster was inserted by means of colony PCR of the clones obtained.
- the primers del-cg0344-47-s / del-cg0344-47-as were used in such a way that they bind in the chromosome outside the insertion locus and also outside the amplified flanking gene regions.
- PCR fragments which indicate an insertion of the PT7-4C / PC construct were purified using the Nucleo-Spin Gel and PCR clean-up kit (Macherey-Nagel, Düren) and, to check the insertion, using the primers del-cg0344- 47-s, cg0344-47-up-s, Mlul-PT7-4CLPcCg-s, Ndel- 4CLPcCg-as, cg0344-47-down-as and del-cg0344-47-as sequenced.
- Mlul-PT7-4CLPcCg-s TC CT AC G CGTT AAT ACG ACT C ACT AT AGGG AG AT C AAG
- Ndel-4CLPcCg-as GGACGTT CAT ATGTTACTTT GGCAGAT CACCGG ATGCG
- ATC del-cg0344-47-s AG AGATT CACCCT CGGCGAT GAG cg0344-47-up-s: CTCTCTAGAGCGGTGGCGATGATGATCTTCGAG cg 0344-47-down-as: GACGAATT CGT GT GGCCACCACCT CAAT CT GT G del-cg0344-47-as: GACCCGCAATGGTGTCGCCAG
- flanking fragments required for the homologous recombination event were amplified by PCR starting from isolated genomic C. glutami cum DNA.
- the primer pair cg0502-up-s / cg0502-up-as was used to generate the upstream fragment, the downstream flank was amplified with the primer pair cg0502-down-s / cg0502-down-as.
- the DNA fragments generated were checked for the expected base pair size by means of gel electrophoretic analysis on a 1% agarose gel.
- the nucleotide sequences of the inner primers (facing the gene to be deleted) (cg0502-up-as / cg0502-down-s) were chosen so that the two amplified fragments up and down contain complementary overhangs.
- the purified fragments In a second PCR (without the addition of DNA primers), the purified fragments accumulate via the complementary sequences and serve both as primers and as templates (overlap-extension PCR).
- the deletion fragment generated in this way was amplified in a final PCR with the two outer primers (facing away from the gene) from the first PCR (cg0502-up-s / cg0502-down-as). After electrophoretic separation on a 1% TAE agarose gel, the final deletion fragment was isolated from the gel using the NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) according to the enclosed protocol.
- both the deletion fragment and the pK19-mobsacB empty vector were linearized with the Fast Digest variants (Thermo Fisher Scientific) of the restriction enzymes Hind ⁇ and ßamHI.
- the restriction mixtures of the fragments mentioned were cleaned with the NucleoSpin Gel and PCR Clean-up-K ⁇ t (Macherey-Nagel, Düren).
- the deletion fragment was used in a three-fold molar excess compared to the linearized vector backbone pK19mobsacB.
- the entire batch volume was used for the transformation of chemically competent E. coli DH5a cells by means of heat shock at 42 ° C. for 90 seconds. Following the heat shock, the cells were regenerated on ice for 90 seconds before they were provided with 800 pL LB medium and regenerated at 37 ° C. in a thermomixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes. Subsequently, 100 pL of the cell suspension were spread on LB agar plates with kanamycin (50 pg / ml) and incubated at 37 ° C. overnight. The correct assembly of the deletion plasmids in the grown transformants was checked by colony PCR.
- the 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this.
- the DNA template was added to the PCR approach by adding cells from the grown colonies. The cells are lysed by the initial denaturation step of the PCR protocol at 95 ° C. for 3 minutes, so that the DNA template was released and was accessible to the DNA polymerase.
- the primer pair univ / rsp was used as the DNA primer for the colony PCR, which binds specifically to the pK19mobsacB vector backbone and, in the event of correct ligation of the fragments used, forms a PCR product of a specific size, which was checked by gel electrophoresis.
- Clones whose PCR product indicated a correct assembly of the deletion plasmid pK19mobsacB-cg0502-del were grown overnight in LB medium with kanamycin (50 pg / mL) for the isolation of the plasmids.
- the plasmids were then cut with the NucleoSpin Plasmid (NoLid) -KW. (Macherey-Nagel, Düren) isolated and sequenced with the aforementioned amplification and colony PCR primers.
- the levan sucrase encoded by sacB is formed in addition to the kanamycin resistance.
- This enzyme catalyzes the polymerization of sucrose into toxic levan, so that there is an induced lethality when growing on sucrose (Bramucci & Nagarajan, 1996). Accordingly, colonies that have integrated the deletion plasmid into their genome via homologous recombination are resistant to kanamycin and sensitive to sucrose.
- a total of 50 of the clones grown on the BHI 10% sucrose (w / v) plate were selected and streaked to check the successful excision of pK19 mobsacB on BHI-Kan 25 and BHI 10% sucrose (w / v) and overnight at 30 ° C incubated. If the plasmid has been completely removed, this is shown by a sensitivity to kanamycin and a resistance to sucrose of the respective clone.
- the second recombination event (excision) can, in addition to the desired gene deletion, also lead to the restoration of the wild-type situation.
- the successful deletion in the clones obtained after excision was checked via the expected fragment size upon deletion of the gene or gene cluster by means of colony PCR of the clones obtained.
- the primers del-cg0502-s / del-cg0502-as used were chosen so that they bind in the chromosome outside the deleted DNA area and also outside the amplified flanking gene areas.
- del-cg0502-s GT GAACATT GT GTTT ACT GT GTGGGCACT GT C del-cg0502-as: T GAT GTT CAGGCCGTT GAAGCCAAGGT AGAG univ: CGCCAGGGTTTTCCCAGTCACGAC rsp: CACAGGAAACAGCTAT GACCAT G
- flanking fragments required for the homologous recombination event were amplified by PCR on the basis of isolated genomic C. glutami cum DNA.
- the primer pair cg1226-up-s / cg1226-up-as was used to generate the upstream fragment, the downstream flank was matched with the Primer pair cg1226-down-s / cg1226-down-as amplified.
- the DNA fragments generated were checked for the expected base pair size by means of gel electrophoretic analysis on a 1% agarose gel.
- the nucleotide sequences of the inner primers (facing the gene to be deleted) (cg1226-up-as / cg1226-down-s) were chosen such that the two amplified fragments up and down contain complementary overhangs.
- the purified fragments In a second PCR (without the addition of DNA primers), the purified fragments accumulate via the complementary sequences and serve both as primers and as templates (overlap-extension PCR).
- the deletion fragment thus generated was amplified in a final PCR with the two outer primers (facing away from the gene) from the first PCR (cg1226-up-s / cg1226-down-as). After electrophoretic separation on a 1% TAE agarose gel, the final deletion fragment was isolated from the gel using the NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) according to the enclosed protocol.
- both the deletion fragment and the pK19-mobsacB empty vector were linearized with the Fast Digest variants (Thermo Fisher Scientific) of the restriction enzymes Hind ⁇ and SamHI.
- the restriction mixtures of the fragments mentioned were cleaned with the NucleoSpin Gel and PCR Clean-up-Kti (Macherey-Nagel, Düren).
- the deletion fragment was used in a three-fold molar excess compared to the linearized vector backbone pK19mobsacB.
- the entire batch volume was used for the transformation of chemically competent E. coli DH5a cells by means of heat shock at 42 ° C. for 90 seconds. Following the heat shock, the cells were regenerated on ice for 90 seconds before they were provided with 800 pL LB medium and regenerated at 37 ° C. in a thermomixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes. Subsequently, 100 pL of the cell suspension were spread on LB agar plates with kanamycin (50 pg / ml) and incubated at 37 ° C. overnight. The correct assembly of the deletion plasmids in the grown transformants was checked by colony PCR.
- the 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this.
- the DNA template was added to the PCR approach by adding cells from the grown colonies. The cells were lysed by the initial denaturation step of the PCR protocol at 95 ° C. for 3 minutes, so that the DNA template was released and was accessible to the DNA polymerase.
- the primer pair univ / rsp was used as the DNA primer for the colony PCR, which binds specifically to the pK19mobsacB vector backbone and, in the case of correct ligation of the fragments used, forms a PCR product of a specific size, which was checked by gel electrophoresis.
- the Levan-Sucrase encoded by sacB is formed. This enzyme catalyzes the polymerization of sucrose into toxic levan, so that there is an induced lethality when growing on sucrose (Bramucci & Nagarajan, 1996). Accordingly, colonies that have integrated the deletion plasmid into their genome via homologous recombination are resistant to kanamycin and sensitive to sucrose.
- a total of 50 of the clones grown on the BHI 10% sucrose (w / v) plate were selected and streaked to check the successful excision of pK19 mobsacB on BHI-Kan 25 and BHI 10% sucrose (w / v) and overnight at 30 ° C incubated. If the plasmid has been completely removed, this is shown by a sensitivity to kanamycin and a resistance to sucrose of the respective clone.
- the second recombination event (excision) can also lead to the restoration of the wild-type situation.
- the successful deletion in the clones obtained after excision was checked via the expected fragment size upon deletion of the gene or gene cluster by means of colony PCR of the clones obtained.
- the primers del-cg1226-s / del-cg1226-as used were selected so that they bind in the chromosome outside the deleted DNA area and also outside the amplified flanking gene areas.
- CTACCACGCTTCGAGGTATAAACGCTC down-cg1226-as: AGT GAATT CCAAGGAAGGCGGTTGCTACTGC del-cg01226-s: T AAAT G GTG G AG AT AC C AAACT GT G AAG C del-cg1226-as: CG AGTT CTT CTTCGTGGTTACTCCGCCCTCGCACCG AG G AAAC AG CTAT G AC CAT G
- glutamicum is chemically synthesized by GeneArt Gene Synthesis (Thermo Fisher Scientific) as a string DNA fragment and used as a DNA template for the amplification of tal FJCg with the primer pair talFj-s / talFj-as .
- the generated DNA fragments are checked for the expected base pair size using gel electrophoretic analysis on a 1% agarose gel.
- the plasmid pEKEx3 is linearized with the FastDigest variants (Thermo Fisher Scientific) of the restriction enzymes BamH ⁇ and EcoRI.
- the genes aroH Ec or tal FjCg amplified with the given primer pairs are hydrolyzed with the restriction enzymes ⁇ a / nHI and Sapl or Sapl and EcoRI.
- the restriction mixtures of the fragments mentioned are cleaned using the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren).
- the two inserts aroH Ec and tal FjCg are used in a three-fold molar excess compared to the linearized vector backbone pEKEx3. After the fragments have been ligated, the entire batch volume is used for the transformation of chemically competent E.
- coli DH5a cells by means of heat shock at 42 ° C. for 90 seconds. Following the heat shock, the cells are regenerated on ice for 90 seconds before they are provided with 800 pL LB medium and regenerated at 37 ° C in a thermomixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes. Subsequently, 100 pL of the cell suspension were spread on LB agar plates with spectonomycin (100 pg / ml) and incubated at 37 ° C. overnight. The correct assembly of the fragments used in the grown transformants is checked by colony PCR. The 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) is used for this.
- the DNA template was the PCR approach buried here by adding cells of the grown colonies.
- the cells are lysed by the initial denaturation step of the PCR protocol at 95 ° C. for 3 minutes, so that the DNA template is released and is accessible to the DNA polymerase.
- the primer pair chk_pEKEx3_s / chk_pEKEx3_as is used as the DNA primer for the colony PCR. It binds specifically to the pEKEx3 vector backbone and, if the fragments used are correctly ligated, forms a PCR product of a specific size, which is checked by gel electrophoresis.
- aroHEc-s CT CGGATCCAAGGAGGT CATAT CAT GAACAGAACGACGAA
- aroHEc-as TACGCTCTTCTGATTTAGAAGCGGGTATCTACCGCAGAGGCGAG talFj-s: TTCGCT CTT CAAT CT GGCAAGG AGGG AT CCGTAT G AACACCAT CA
- talFj-as AT CG AATT CTTAGTTGTTG AT C AG GTG ATC CTT C ACCTT CTG C
- AC chk_pEKEx3_s GC AAAT ATT CT G AAAT G AG CTGTT G AC AATT AAT CAT C
- chk_pEKEx3_as C GTTCT G ATTT AAT CTGTAT C AG G CT G AAAAT CTTCTC
- heterologous genes for the synthesis of polyphenols or polyketides in coryne-shaped bacterial cells
- the genes sts Ah and 4cl Pc were amplified by PCR with the primer pair stsAh-s / stsAh-as and 4clPc-s / 4clPc-as, which is specific for the respective gene.
- the generated DNA fragments were checked for the expected base pair size using gel electrophoretic analysis on a 1% agarose gel.
- the plasmid pMKEx2 _sts Ah _4cl Pc was linearized with the FastDigestA / variants (Thermo Fisher Scientific) of the restriction enzymes Nco ⁇ and ßamHI.
- the sts Ah and 4cl Pc genes amplified with the given primer pairs were hydrolyzed with the restriction enzymes L / col and Kpn ⁇ or Kpn ⁇ and ßamHI.
- the restriction approaches of the fragments mentioned were cleoSpin Gel and PCR Clean-up-Kit (Macherey-Nagel, Düren) cleaned.
- the two inserts sts Ah and 4cl Pc were used in a three-fold molar excess compared to the linearized vector backbone pMKEx2. After ligation of the fragments, the entire batch volume was used for the transformation of chemically competent E.
- coli DH5a cells by means of heat shock at 42 ° C. for 90 seconds. Following the heat shock, the cells were regenerated on ice for 90 seconds before they were provided with 800 pL LB medium and regenerated at 37 ° C. in a thermomixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes. Subsequently, 100 pL of the cell suspension were spread on LB agar plates with kanamycin (50 pg / ml) and incubated at 37 ° C. overnight. The correct assembly of the fragments used in the grown transformants was checked by colony PCR. The 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this.
- the DNA template was added to the PCR approach by adding cells from the grown colonies.
- the cells were lysed by the initial denaturation step of the PCR protocol at 95 ° C. for 3 minutes, so that the DNA template was released and was accessible to the DNA polymerase.
- the primer pair chk_pMKEx2_s / chk_pMKEx2_as was used as the DNA primer for the colony PCR. rese was checked. Clones whose PCR product indicated correct assembly of the plasmid pMKEx2 _sts Ah _4cl Pc were grown overnight in LB medium with kanamycin (50 gg / mL) for the isolation of the plasmids. The plasmids were then isolated with the NucleoSpin Plasmid (NoLid) -K ⁇ t (Macherey-Nagel, Düren) and sequenced with the amplification and colony PCR primers mentioned.
- 4clPc-s AGCGGTACCT AAG GAG GT GG AC AAT G G G CG ATT G C GT GG C AC
- 4clPc-as CT GGGATCCAGGACTAGTTT CCAGAGT ACT ATT ACTTT GGCA
- GATCACCGGATGCGATC chk_pMKEx2-s CCCTCAAGACCCGTTTAGAGGC chk_pMKEx2-as: TTAAT ACGACT CACT AT AGGGG AATT GT G AGC
- the generated DNA fragments were checked for the expected base pair size by means of gel electrophoretic analysis on a 1% agarose gel.
- the plasmid pMKEX2-chs Ph -chi Ph the plasmid pMKEx2 was linearized with the FastDigest variants (Thermo Fisher Scientific) of the restriction enzymes Xba ⁇ and Bam-Hl.
- the genes chs Ph and chi Ph amplified with the given primer pairs were hydrolyzed with the restriction enzymes Xba ⁇ and L / col or Nco ⁇ and ßamHI.
- the restriction mixtures of the fragments mentioned were cleaned using the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren).
- the two inserts chs Ph and chi Ph were used in a three-fold molar excess compared to the linearized vector backbone pMKEx2.
- the entire batch volume was used for the transformation of chemically competent E. coli DH5a cells by means of heat shock at 42 ° C. for 90 seconds.
- the cells were regenerated on ice for 90 seconds before they were provided with 800 pL LB medium and regenerated at 37 ° C. in a thermomixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes. Subsequently, 100 pL of the cell suspension were spread on LB agar plates with kanamycin (50 pg / ml) and incubated at 37 ° C. overnight. The correct assembly of the fragments used in the grown transformants was checked by colony PCR. The 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this. The DNA template was added to the PCR approach by adding cells from the grown colonies.
- the cells are lysed by the initial denaturation step of the PCR protocol at 95 ° C. for 3 minutes, so that the DNA template was released and was accessible to the DNA polymerase.
- the primer pair chk_pMKEx2_s / chk_pMKEx2_as was used as DNA primer for the colony PCR, which binds specifically to the pMKEx2 vector backbone and, if the fragments used are correctly ligated, is included PCR product of specific size, which was checked by gel electrophoresis.
- Clones whose PCR product indicated a correct assembly of the plasmid pMKEx2_ chs Ph and chip h were grown overnight in LB medium with kanamycin (50 pg / mL) for the isolation of the plasmids.
- the plasmids were then isolated with the NucleoSpin Plasmid (NoLid) -K ⁇ t (Macherey-Nagel, Düren) and sequenced with the amplification and colony PCR primers mentioned.
- CGCAAG chsPh-as CTCCCATGGTTAGGTTGCCACGGAGTGCAGCAC chiPh-s: CT CCCATGGTGCT AAAGGAGGT CGAAGAT GTCCCCACCAGT G
- TCCGTGACCAAG chiPh-as CT GGGAT CCTTACACGCCGAT CACT GGGATGGT G chk_pMKEx2-s: CCCTCAAGACCCGTTTAGAGGC chk_pMKEx2-as: TT AAT ACG ACT CACT AT AGGGG AATT GT G AGC
- the pcs Aa gene was amplified by PCR with the primer pair Gibson-PCS-s / Gibson-PCS-as or Gibson-PCS-short-s / Gibson-PCS-as in order to determine the native and the shortened pcs Aa - Generate sequence.
- the DNA fragments were checked for the expected base pair size using gel electrophoretic analysis on a 1% agarose gel and then cleaned using the NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) according to the enclosed protocol.
- the plasmid pMKEx2 -sts Ah -4d Pc with the FastDigestA / ariante (Thermo Fisher Scientific) was used Restriction enzymes Nco ⁇ and Seal linearized. The restriction mixture was separated on a 1% agarose gel.
- the expected fragment of the vector backbone was cleaned from the gel using the Nucleo Spin Gel and PCR clean-up kit (Macherey-Nagel, Düren).
- Gibson assembly Gibson assembly (Gibson et al., 2009a)
- one amplified fragment cs Aa or pcs Aa - short
- the DNA fragments were provided with a prepared Gibson Assembly Master Mix, which contains an isothermal reaction buffer and the enzymes required for assembly (T5 exonuclease, phusion DNA polymerase and Taq DNA ligase).
- the fragments are assembled at 50 ° C.
- the entire batch volume was used for the transformation of chemically competent E. coli DH5oc cells by means of heat shock at 42 ° C. for 90 seconds. Following the heat shock, the cells were regenerated on ice for 90 seconds before they were provided with 800 ml of LB medium and regenerated at 37 ° C. in a thermomixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes. Subsequently, 100 ml of the cell suspension were spread on LB agar plates with kanamycin (50 pg / ml) and incubated at 37 ° C. overnight.
- kanamycin 50 pg / ml
- the correct assembly of the expression plasmids in the grown transformants was checked by colony PCR.
- the 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this.
- the DNA template was added to the PCR approach by adding cells from the grown colonies. The cells are lysed by the initial denaturation step of the PCR protocol at 95 ° C. for 3 minutes, so that the DNA template was released and was accessible to the DNA polymerase.
- the primer pair chk_pMKEx2_s / chk_pMKEx2_as was used as the DNA primer for the colony PCR, which binds specifically to the pMKEx2 vector backbone and, if the fragments used are correctly assembled, forms a PCR product of a specific size, which was checked by gel electrophoresis.
- Clones whose PCR product indicated a correct assembly of the expression plasmids construction rMKEc2-ro5 L3 and pMKEx2-pcs Aa - short were grown overnight in LB medium with kanamycin (50 pg / mL) for the isolation of the plasmids. The plasmids were then isolated using the NucleoSpin Plasmid (NoLid) KW (Macherey-Nagel, Düren) and sequenced using the amplification and colony PCR primers mentioned.
- chk_pMKEx2-s CCCTCAAGACCCGTTTAGAGGC
- chk_pMKEx2-as TT AAT ACG ACT CACT AT AGGGG AATT GT G
- the strains are first incubated for 6-8 hours in 5 ml BHI medium (Brain heart infusion, Difco Laboratories, Detroit, USA) in test tubes at 170 RPM (first preculture) and then used for 50 Inoculate ml of CGXII medium in a 500 ml baffle flask (with two opposite baffles). This second preculture is incubated at 30 ° C and 130 RPM overnight.
- BHI medium Brain heart infusion, Difco Laboratories, Detroit, USA
- the CGXII main culture (50 ml in a 500 ml baffle flask) is grown with the overgrown second preculture to an OD 600 nm of 1.0 (malonyl-CoA measurement) or 5.0 (production of naringenin, resveratrol or noreugenin ) inoculated.
- 1.0 malonyl-CoA measurement
- 5.0 production of naringenin, resveratrol or noreugenin
- 5 mM p-cumaric acid (previously dissolved in 80 ml DMSO) is optionally supplemented.
- heterologous genes which are either chromosomally integrated or introduced plasmid-based, is increased by adding 1 mM isopropyl- ⁇ -D- thiogalactopyranoside (IPTG) induced 90 minutes after inoculum. At the times indicated, 1 ml of culture is removed and stored at -20 ° C until use.
- IPTG isopropyl- ⁇ -D- thiogalactopyranoside
- 1 ml of culture is removed and stored at -20 ° C until use.
- the product determination (malonyl-CoA or polyphenols or polyketides) is carried out as described below.
- resveratrol, or naringenin or noreugenin from the cultivation solution can optionally be further processed, ie separated, purified and / or concentrated.
- the determination of the biomass during cultivation for the measurement of malonyl-CoA provision or the production of polyphenols or polyketides is carried out by measuring the optical density at a wavelength of 600 nm (OD 6 oonm) with the Ultrospec 3300 per UVA / isible spectrophotometer (Amersham Biosciences, Freiburg). For this purpose, 100 pL sample volume of the respective cultivation are removed and so comparable thinned that the measured OD 60 o n m in the linear measuring range of the photometer of 0, was from 2 to 0.6. By adjusting for the dilution factor, the actual OD 60 o n m of the culture is calculated. If a stronger dilution factor of> 1:10 (e.g. 1: 100) is pipetted, this is carried out sequentially (example: for a 1: 100 dilution, 1:10 was diluted twice).
- a stronger dilution factor of> 1:10 e.g. 1: 100
- the sample preparation for the quantification of the intracellular malonyl-CoA level was carried out as previously described (Kallscheuer et al., 2016). 5 mL of the culture is quenched in 15 ml ice-cold 60% MeOH in H 2 0 in a triplicate and then centrifuged. The malonyl-CoA concentration is determined in the cell extract and in the culture supernatant. In addition, the analysis is carried out in the supernatants obtained after quenching. For the supernatant samples of the culture and after quenching, filtration is carried out through 0.2 pm cellulose acetate filter. 250 pL of the culture supernatant are diluted with 750 pL 60% MeOH, the quenching supernatant was used undiluted.
- the malonyl-CoA concentration in the samples obtained is quantified by means of LC-MS / MS analysis using an Agilent 1260 Infinity HPLC system (Agilent Technologies, Waldbronn, Germany) at 40 ° C with a 150 * 2.1 mm Sequant ZIC-pHILIC column with 5 pm particle size and a 20 * 2.1 mm guard column (Merck, Darmstadt, Germany).
- the separation is carried out with 10 mM ammonium acetate (pH 9.2) (buffer A) and acetonitrile (buffer B). Before each injection, the column was equilibrated with 90% buffer B for 15 min.
- the following gradient is used for the separation (injection volume 5 pL): 0 min: 90% B, 1 min: 90% B, 10 min: 70% B, 25 min: 65% B, 35 min: 10% B, 45 min: 10% B, 55 min: 10% B.
- the measurement is carried out with an ESI-QqTOF-MS (TripleTOF 6600, AB Sciex, Darmstadt, Germany) with an lonDrive ion source.
- the software analyst TF 1.7 (AB Sciex, Concord, ON, Canada) is used for data analysis.
- the optimal collision energies for the strongest transitions of malonyl-CoA (852.1> 79) and malonate (103> 59) are -130 eV and -1 1 eV, respectively. These are determined using the metabolite standards. During the elution, the transitions mentioned and those of the internal standards (855.1> 79 and 106> 61) were used for the measurement in the MS / MS High Sensitivity Mode with the optimal collision energies.
- the 12 C- 13 C isotope ratio was used to quantify both metabolites.
- the standard line was determined by linear regression of the isotope ratios and the standard concentrations. To determine the dynamic range, the measurement signals for the highest concentrations were removed so that R 2 was greater than 0.99.
- the reduced data set was then log 10 transformed to evenly weight lower concentrations. In the log 10 transformed values, measurement signals of the lowest concentrations are rejected, so that R 2 was greater than 0.99.
- malonate (malonyl-CoA) titers are determined using coryneform bacterial cells according to the invention (FIG. 24).
- the wild type C. glutamicum ATCC 13032 or its descendant the original type C. glutamicum DelAro 4 -4c / PcCg has a malonate titer of 0.508 pM under standard conditions.
- DelAro 4 -4clp cCg fasB- E622K, DelAro 4 -4c / PcCg asß-G1361 D, DelAro 4 -4c / PcCg asß-G2153E and DelAro 4 -4cl PcCg fasB- G2668S have malonate titer of 1. 148 pM, 0.658 pM, 0.694 and 0.484 pM, respectively.
- the fasB deletion strain DelAro 4 -4cl Pc c g AfasB even reaches 1.909 pM malonate. With the strain C.
- glutamicum DelAro 4 -4clp cC8 -C7 0.741 pM malonate are achieved.
- the strains C. glutamicum DelAro 4 -4cl PcC8 -C7 mufasO or C. glutamicum DelAro 4 -4cl PcC8 -C7 mufasO AfasB have a titer of 2.261 pM malonate or 3.645 pM malonate.
- the LC-MS analysis of the respective products in the extracts was carried out as described using an ultra-high performance liquid chromatography 1290 Infinity System coupled to a 6130 quadrupole LC-MS system (Agilent, Waldbronn, Germany) (Kallscheuer et al., 2016).
- a Kinetex 1.7 pm C18 column with 100 A pore size (50 mm ⁇ 2.1 mm [internal diameter]; Phenomenex, Torrance, CA, USA) at 50 ° C. was used for the chromatographic separation.
- 0.1% acetic acid (phase A) and acetonitrile + 0.1% acetic acid (phase B) were used as mobile phases at a flow rate of 0.5 ml / min.
- the mass spectrometer was operated in negative electrospray ionization mode (ESI); data was recorded in selected ion monitoring mode (SIM). Pure product standards of various concentrations in acetonitrile were used for the quantification.
- the measured areas for the [M-H] mass signals (m / z 271 for naringenin, m / z 191 for noreugenin, m / z 227 for resveratroi) were linear for concentrations up to 250 mg / l.
- Benzoate served as the internal standard (final concentration 100 mg / l, m / z 121 for benzoate).
- a calibration curve was calculated based on the ratio of the measured areas of the analyte to the internal standard.
- the following polyphenol or polyketide titers are determined with the coryneform bacterial cells according to the invention, in each case under standard conditions with growth to glucose or glucose supplemented with p-cumaric acid.
- the wild type C. glutamicum ATCC 13032 or its descendant the original type C. glutamicum DelAro 4 -4c / PcCg pMKEx2-stsAh-4clPc has a resveratrol titer of 8 mg / L or 12 mg / L under standard conditions.
- the fasB deletion strain DelAro 4 -4cl PcCg AfasB pMKEx2- stsAh-4clPc even reaches 9.49 mg / L or 37 mg / L resveratrol.
- the strain C. glutamicum DelAro 4 -4cl PcC8 -C7 pMKEx2-stsAh-4clPc 14 mg / L or 1 13 mg / L Resveratrol are achieved.
- glutamicum DelAro 4 -4cl Pc c g -C7-mufasO-AfasB pMKEx2-stsAh-4clPc have a titer of 22. 85 mg / L or 262 mg / L resveratrol and 22.73 mg / L and 260 mg / L resveratrol.
- the coryneform bacterial cells according to the invention have the following titers, in each case under standard conditions with growth to glucose or glucose supplemented with p-cumaric acid.
- the wild type C. glutamicum ATCC 13032 or its descendant the original type C. glutamicum DelAro 4 -4c / p cCg pMKEx2-chsPh-chiPh has a naringenin titer of 1 mg / L or 2.1 mg / L under standard conditions.
- the fasB deletion strain DelAro 4 -4cl PcCg AfasB pMKEx2-chsPh-chiPh even reaches 2, 15 mg / L and 9.61 mg / L naringenin.
- the strain C. glutamicum DelAro 4 -4cl PcC8 -C7 pMKEx2-chsPh-chiPh 3.5 mg / L and 18.5 mg / L naringeninin are achieved.
- glutamicum DelAro 4 -4cl PcC8 -C7-mufasO-AfasB pMKEx2-chsPh-chiPh have a titer of 10.59 mg / L or 65 mg / L naringenin and 9.83 mg / L and 60 mg / L naringenin.
- the coryneform bacterial cells according to the invention have the following noreugenin titer under standard conditions when growing on glucose. No noreugenin (0.002 mg / L) could be detected for the wild type C. glutamicum ATCC 13032 pMKEx2-pcs Aa c g -s h ort or its descendant of the original type C. glutamicum DelAro 4 -4clp cCg pMKEx2-pcs AaC8-short will. The strains C.
- DelAro 4 -4c / p cCg asß-E622K pMKEx2-pcs AaCg-Sh ort
- DelAro 4 -4c / p cCg fasB- G2668S pMKEx2-pcs AaCg-Sh or t have noreugenin titers of 0.004 mg / L, 0.003 mg / L, 0.003 mg / L and 0.003 mg / L Noreugenin on.
- strain C glutamicum DelAro 4 -4cl Pc c g -C7 pMKEx2-pcs AaCg-Sh or t 0.86 mg / L noreugenin is determined.
- the strain C. glutamicum DelAro 4 -4cl PcC8 -C7-mufasO pMKEx2-pcs AaCg.Sho r t has a titer of 4.4 mg / L noreugenin.
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
Description
Claims
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DE102018008670.5A DE102018008670A1 (de) | 2018-10-26 | 2018-10-26 | Bereitstellung von Malonyl-CoA in coryneformen Bakterien sowie Verfahren zur Hestellung von Polyphenolen und Polyketiden mit coryneformen Bakterien |
| PCT/DE2019/000248 WO2020083415A1 (de) | 2018-10-26 | 2019-09-21 | Bereitstellung von malonyl-coa in coryneformen bakterien sowie verfahren zur herstellung von polyphenolen und polyketiden mit coryneformen bakterien |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP3870723A1 true EP3870723A1 (de) | 2021-09-01 |
Family
ID=68807957
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP19816511.0A Pending EP3870723A1 (de) | 2018-10-26 | 2019-09-21 | Bereitstellung von malonyl-coa in coryneformen bakterien sowie verfahren zur herstellung von polyphenolen und polyketiden mit coryneformen bakterien |
Country Status (6)
| Country | Link |
|---|---|
| US (1) | US20220033786A1 (de) |
| EP (1) | EP3870723A1 (de) |
| JP (1) | JP7554183B2 (de) |
| CN (1) | CN112969782A (de) |
| DE (1) | DE102018008670A1 (de) |
| WO (1) | WO2020083415A1 (de) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110713962B (zh) * | 2019-09-06 | 2022-06-21 | 南京农业大学 | 一株高产丙二酰辅酶a的基因工程菌及其构建方法和应用 |
| CN116536310A (zh) * | 2022-01-26 | 2023-08-04 | 廊坊梅花生物技术开发有限公司 | 启动子、产苏氨酸重组微生物及其应用 |
| CN114606279A (zh) * | 2022-03-21 | 2022-06-10 | 陕西科技大学 | 一种以酪氨酸为底物合成柚皮素的方法 |
| CN115678934A (zh) * | 2022-11-07 | 2023-02-03 | 陕西科技大学 | 一种利用大肠杆菌和谷氨酸棒杆菌共培养合成圣草酚的方法 |
| CN116218809B (zh) * | 2023-03-13 | 2026-04-14 | 中国科学院微生物研究所 | 查尔酮合成酶突变体及其应用 |
| CN120555382B (zh) * | 2025-06-03 | 2026-03-24 | 中国科学院天津工业生物技术研究所 | 4-羟基苯甲酸羟化酶突变体及其在合成没食子酸或其盐中的应用 |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPS5835197A (ja) | 1981-08-26 | 1983-03-01 | Kyowa Hakko Kogyo Co Ltd | プラスミドpcg2 |
| GB2165546B (en) | 1984-08-21 | 1989-05-17 | Asahi Chemical Ind | A plasmid containing a gene for tetracycline resistance and dna fragments derived therefrom |
| DE19929365A1 (de) * | 1999-06-25 | 2000-12-28 | Basf Lynx Bioscience Ag | Teilsequenzen der Gene des Primär- und Sekundärmetabolismus aus Corynebacterium glutamicum und ihr Einsatz zur mikrobiellen Herstellung von Primär- und Sekundärmetaboliten |
| US6884614B1 (en) * | 1999-07-01 | 2005-04-26 | Basf Aktiengesellschaft | Corynebacterium glutamicum genes encoding phosphoenolpyruvate: sugar phosphotransferase system proteins |
| CN101416957B (zh) * | 2008-12-10 | 2011-06-01 | 亚宝药业集团股份有限公司 | 白藜芦醇或柚皮素预防和治疗糖尿病肾病的应用 |
| EP2529023A4 (de) * | 2010-01-27 | 2015-06-10 | Opx Biotechnologies Inc | Mikroorganismusherstellung aus chemischen produkten mit hoher strömungskraft sowie entsprechende zusammensetzungen, verfahren und systeme |
| JP2016165225A (ja) * | 2013-07-09 | 2016-09-15 | 味の素株式会社 | 有用物質の製造方法 |
-
2018
- 2018-10-26 DE DE102018008670.5A patent/DE102018008670A1/de active Pending
-
2019
- 2019-09-21 CN CN201980070881.5A patent/CN112969782A/zh active Pending
- 2019-09-21 WO PCT/DE2019/000248 patent/WO2020083415A1/de not_active Ceased
- 2019-09-21 JP JP2021516952A patent/JP7554183B2/ja active Active
- 2019-09-21 EP EP19816511.0A patent/EP3870723A1/de active Pending
- 2019-09-21 US US17/285,539 patent/US20220033786A1/en active Pending
Also Published As
| Publication number | Publication date |
|---|---|
| JP7554183B2 (ja) | 2024-09-19 |
| JP2022503822A (ja) | 2022-01-12 |
| CN112969782A (zh) | 2021-06-15 |
| US20220033786A1 (en) | 2022-02-03 |
| WO2020083415A1 (de) | 2020-04-30 |
| WO2020083415A8 (de) | 2021-05-20 |
| DE102018008670A1 (de) | 2020-04-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3870723A1 (de) | Bereitstellung von malonyl-coa in coryneformen bakterien sowie verfahren zur herstellung von polyphenolen und polyketiden mit coryneformen bakterien | |
| EP2862932B1 (de) | Gene zur Codierung von biofilmbildungshemmenden Proteinen und Verfahren zur Herstellung von L-Lysin mittels eines bakteriellen Stamms mit den inaktivierten Genen | |
| EP2553113B1 (de) | Verfahren zur herstellung von l-ornithin unter verwendung von lyse überexprimierenden bakterien | |
| DE60030988T2 (de) | Verfahren zur Herstellung Von L-Aminosäuren durch Erhöhung des zellulären NADPH | |
| KR101766964B1 (ko) | L-라이신 생산능을 가지는 코리네박테리움 속 미생물 및 이를 이용한 l-라이신 생산방법 | |
| EP2692729A1 (de) | Verfahren zur biotechnologischen Herstellung von Dihydrochalkonen | |
| DE69735192T2 (de) | Mikrobische herstellung von substanzen aus dem aromatischen metabolismus / i | |
| EP2089525B1 (de) | Allele des oxyr-gens aus coryneformen bakterien | |
| KR101429814B1 (ko) | Gdh 활성 조절을 통해 l-쓰레오닌 생산능이 향상된 코리네박테리움 속 미생물 및 이를 이용한 l-쓰레오닌 생산 방법 | |
| EP3050971B1 (de) | Verfahren zur enzymatischen Herstellung eines 4-O-methylierten Zimtsäureamids | |
| KR101740807B1 (ko) | L-라이신 생산능을 가지는 코리네박테리움 속 미생물 및 이를 이용한 l-라이신 생산방법 | |
| DE60312592T2 (de) | Verfahren zur Herstellung von L-Lysin unter Verwendung Coryneformer Bakterien die ein attenuiertes Malat Enzym-gen enthalten | |
| DE102004009454A1 (de) | Verfahren zur fermentativen Herstellung von L-Aminosäuren unter Verwendung von rekombinanten Mikroorganismen | |
| EP1244776B1 (de) | Tetrahydropyrimidin-dioxygenase-gen, dadurch kodierte polypeptide und verfahren zur deren herstellung | |
| EP1259622B1 (de) | Nukleotidsequenzen kodierend fur proteine beteiligt an der biosynthese von l-serin, verbessertes verfahren zur mikrobiellen herstellung von l-serin sowie ein dazu geeigneter genetisch veranderter mikroorganismus | |
| EP4389881A1 (de) | Genetisch modifizierter mikroorganismus und dessen verwendung zur herstellung von d-chiro-inositol | |
| WO2022161569A1 (de) | Herstellung von 3,4-dihydroxybenzoat aus d-xylose mit coryneformen bakterien | |
| EP1841859B1 (de) | Allele des mqo-gens aus coryneformen bakterien | |
| DE102005049527B4 (de) | Verfahren zur Herstellung von L-Serin, Gensequenz, Vektoren sowie Mikroorganismus | |
| EP1659174A2 (de) | Allele des metK-Gens aus coryneformen Bakterien | |
| EP3820999A1 (de) | D-xylose-dehydrogenase aus coryneformen bakterien und verfahren zur herstellung von d-xylonat | |
| WO2015082441A1 (en) | Shuttle vectors and expression vectors for amycolatopsis | |
| KR101617126B1 (ko) | 신규 pstS 프로모터 및 이를 이용한 페닐프로파노이드의 제조방법 | |
| DE10231297A1 (de) | Nukleotidsequenzen coryneformer Bakterien codierend für an der Biosynthese von L-Serin beteiligte Proteine sowie Verfahren zur Herstellung von L-Serin | |
| DE10026758A1 (de) | Verfahren zur fermentativen Herstellung von D-Pantothensäure unter Verwendung corymeformer Bakterien |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: UNKNOWN |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20210420 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| DAV | Request for validation of the european patent (deleted) | ||
| DAX | Request for extension of the european patent (deleted) | ||
| PUAG | Search results despatched under rule 164(2) epc together with communication from examining division |
Free format text: ORIGINAL CODE: 0009017 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: EXAMINATION IS IN PROGRESS |
|
| 17Q | First examination report despatched |
Effective date: 20250624 |
|
| B565 | Issuance of search results under rule 164(2) epc |
Effective date: 20250624 |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: C12R 1/15 20060101AFI20250618BHEP |