EP3870723A1 - Provision of malonyl-coa in coryneform bacteria and method for producing polyphenoles and polyketides with coryneform bacteria - Google Patents

Provision of malonyl-coa in coryneform bacteria and method for producing polyphenoles and polyketides with coryneform bacteria

Info

Publication number
EP3870723A1
EP3870723A1 EP19816511.0A EP19816511A EP3870723A1 EP 3870723 A1 EP3870723 A1 EP 3870723A1 EP 19816511 A EP19816511 A EP 19816511A EP 3870723 A1 EP3870723 A1 EP 3870723A1
Authority
EP
European Patent Office
Prior art keywords
bacterial cell
coryneform
acid sequence
nucleic acid
genes
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP19816511.0A
Other languages
German (de)
French (fr)
Inventor
Jan Marienhagen
Lars MILKE
Nicolai KALLSCHEUER
Michael Bott
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Forschungszentrum Juelich GmbH
Original Assignee
Forschungszentrum Juelich GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Forschungszentrum Juelich GmbH filed Critical Forschungszentrum Juelich GmbH
Publication of EP3870723A1 publication Critical patent/EP3870723A1/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C12N1/205—Bacterial isolates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93—Ligases (6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/02—Oxygen as only ring hetero atoms
    • C12P17/06—Oxygen as only ring hetero atoms containing a six-membered hetero ring, e.g. fluorescein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/22—Preparation of oxygen-containing organic compounds containing a hydroxy group aromatic
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y203/00—Acyltransferases (2.3)
    • C12Y203/01—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C12Y203/01085—Fatty-acid synthase (2.3.1.85)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y203/00—Acyltransferases (2.3)
    • C12Y203/03—Acyl groups converted into alkyl on transfer (2.3.3)
    • C12Y203/03001—Citrate (Si)-synthase (2.3.3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y205/00—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5)
    • C12Y205/01—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5) transferring alkyl or aryl groups, other than methyl groups (2.5.1)
    • C12Y205/01054—3-Deoxy-7-phosphoheptulonate synthase (2.5.1.54)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y403/00—Carbon-nitrogen lyases (4.3)
    • C12Y403/01—Ammonia-lyases (4.3.1)
    • C12Y403/01023—Tyrosine ammonia-lyase (4.3.1.23)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y604/00—Ligases forming carbon-carbon bonds (6.4)
    • C12Y604/01—Ligases forming carbon-carbon bonds (6.4.1)
    • C12Y604/01002—Acetyl-CoA carboxylase (6.4.1.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y604/00—Ligases forming carbon-carbon bonds (6.4)
    • C12Y604/01—Ligases forming carbon-carbon bonds (6.4.1)
    • C12Y604/01003—Propionyl-CoA carboxylase (6.4.1.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/15—Corynebacterium

Definitions

  • the present invention relates to a system for the provision of malonyl-CoA in coryneform bacteria.
  • the present invention also relates to a method for producing secondary metabolites, such as. B. polyphenols and polyketides with coryneform bacteria.
  • stilbenes, flavonoids A large number of different molecules from the groups of polyphenols (stilbenes, flavonoids) and polyketides represent economically interesting secondary metabolites with great potential for pharmacological use.
  • the stilbene resveratrol for example, is anti-tumor, anti-bacterial, anti-inflammatory and anti aging effect predicted (Pangeni et al. 2014; https://doi.org/10.1517/17425247.2014.919253).
  • the effect in the prevention of cardiovascular diseases is also discussed.
  • Similar effects including anti-mutagenic, anti-oxidative, anti-proliferative and anti-atherogenic effects are for flavonoids, e.g. Naringenin or its derivatives are described (Erlund, 2004; https://doi.Org/10.1016/i. Nutres.2004.07.005, Harbone, 2013; https://doi.Org/10.1007/978-1-4899-2915- 0).
  • An object of the present invention is therefore a system and To provide methods for the microbial, large-scale production of molecules from the groups of the polyphenols (stilbenes, flavonoids) and the polyketides with coryneform bacteria, which are classified as GRAS.
  • Another object of the present invention is to provide a precisely characterized bacterial strain by means of targeted strain construction, which overcomes the known disadvantages.
  • a key building block for the synthesis of polyphenols or polyketides is malonyl-CoA. While representatives of the group of flavonoids and stilbenes require 3 moles of malonyl-CoA / mole of product, polyketides are built almost exclusively on the basis of malonyl-CoA units.
  • Malonyl-CoA is a central intermediate in the metabolism of bacteria that cannot be transported through the cell membrane, so that extracellular feeding in a microbial manufacturing process is not possible.
  • Malonyl-CoA is formed by carboxylation of acetyl-CoA, the end product of glycolysis, in bacterial cells, but microorganisms use malonyl-CoA almost exclusively for the synthesis of fatty acids, which prevents increased availability.
  • fatty acid synthesis is a very costly synthesis for the cell, so that consequently the synthesis of malonyl-CoA is strictly regulated.
  • An indirect means of increasing the intracellular concentration of malonyl-CoA in microorganisms is, for example, the addition of inhibitors of fatty acid synthesis, such as. B. Cerulenin.
  • the production of resveratrol with Corynebacterium glutamicum is also in Kallscheuer et al. (2016, https://doi.Org/10.1016/j.ymben.2016.06.003).
  • cerulenin is used to inhibit fatty acid synthesis in order to achieve the formation of resveratrol.
  • a major disadvantage of adding cerulenin is that the cells stop growing completely after the addition of cerulenin. This in turn is negative for the malonyl-CoA supply in the cell, which only takes place when it is growing.
  • Cerulenin is an antibiotic that selectively irreversibly inhibits fatty acid synthesis (Omura et al; 1976; PMID 791237). As a result of this inhibition, malonyl-CoA is no longer used for the endogenous synthesis of fatty acids and could be available for other uses, such as for the synthesis of secondary metabolites.
  • cerulenin is very expensive and would therefore not be very suitable for use in a large-scale or industrially interesting microbial production process.
  • Another major disadvantage of cerulenin is that the cells are extremely inhibited in their growth due to the inhibition of fatty acid synthesis and, as a rule, after a short time (one cell division) they can no longer grow.
  • Another object of the present invention is therefore to provide a system and method for increasing the concentration of the central metabolite malonyl-CoA in corynform bacteria which is independent of the addition of cerulenin.
  • Another object of the present invention is to provide an economically interesting system which is suitable for the biotechnological provision of malonyl-CoA in coryneform bacteria and in which the growth of the cells remains unaffected or is not negatively influenced or even comes to a standstill.
  • Another object of the present invention is to provide a method for the microbial production of economically interesting secondary metabolites, such as. B. to provide molecules from the groups of polyphenols (stilbenes, flavonoids) and polyketides in coryneform bacteria, in which the known disadvantages are overcome.
  • the present invention relates to a coryneform bacterial cell with an increased supply of malonyl-CoA compared to its original type in which the regulation and / or expression of the genes selected from the group comprising fasB, gltA, accBC and accD1, and / or the functionality of the enzymes encoded by them is specifically modified.
  • the invention further relates to a coryneform bacterial cell which has one or more targeted modifications, selected from the group comprising a) reduced or deactivated functionality of the fatty acid synthase FasB; b) mutation or partial or complete deletion of the gene fasB coding for the fatty acid synthase; c) reduced functionality of the promoter operatively linked to the citrate synthase gene gtIA; d) reduced expression of the gene coding for the citrate synthase CS gltA; e) Reduced or deactivated functionality of the operator binding sites (fasO) for the regulator FasR in the promoter regions of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits; f) Depressed expression of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits; g) one or more combinations of a) - f).
  • the invention thus also includes a coryneform bacterial cell in which the functionality of the fatty acid synthase FasB is reduced or switched off and / or the gene fasB coding for the fatty acid synthase is specifically mutated, preferably by one or more nucleotide substitutions, or is partially or completely deleted.
  • coryneform bacterial cell in which the expression of the gene coding for citrate synthase gltA is reduced by mutation, preferably several nucleotide substitutions, of the operatively linked promoter.
  • the present invention also relates to a coryneform bacterial cell in which the functionality of the operator binding sites (fasO) for the regulator FasR in the promoter regions of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits, preferably by one or more nucleotide substitutions is reduced or switched off and the expression of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits is derepressed, preferably increased.
  • the functionality of the operator binding sites (fasO) for the regulator FasR in the promoter regions of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits preferably by one or more nucleotide substitutions is reduced or switched off and the expression of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits is derepressed, preferably increased.
  • Another object of the present invention is also a coryneform bacterial cell which is a combination of reduced expression and / or activity of citrate synthase (CS) and deregulated, increased expression and / or activity of acetyl- Has CoA carboxylase subunits (AccBC and AccD1).
  • CS citrate synthase
  • AccBC and AccD1 acetyl- Has CoA carboxylase subunits
  • the invention also includes a coryneform bacterial cell which is a combination of reduced expression and / or activity of citrate synthase (CS) and deregulated, increased, expression and / or activity of acetyl-CoA carboxylase subunits (AccBC and AccD1) and reduced or switched off Has functionality of the fatty acid synthase FasB.
  • CS citrate synthase
  • AccBC and AccD1 acetyl-CoA carboxylase subunits
  • the present invention also relates to a coryneform bacterial cell for the production of polyphenols or polyketides, which has modifications of the aforementioned type and in which the catabolic pathway of aromatic components, preferably selected from the group comprising phenylpropanoids and benzoic acid derivatives, is additionally switched off.
  • the invention also encompasses a coryneform bacterial cell which additionally encodes genes for a feedback-resistant 3-deoxy-D-arabinoheptulosonate 7-phosphate synthase (aroH), preferably from E. coli, and for a tyrosine ammonium lyase (tal), preferably from Flavobacterium johnsoniae.
  • aroH 3-deoxy-D-arabinoheptulosonate 7-phosphate synthase
  • tal tyrosine ammonium lyase
  • the present invention also relates to a coryneform bacterial cell of the aforementioned type which additionally has enzymes derived from plants or the genes encoding them for polyphenol or polyketide synthesis.
  • the coryneform bacterial cell is the genus selected from the group comprising Corynebacterium and Brevibacterium, preferably Corynebacterium glutamicum, particularly preferably Corynebacterium glutamicum ATCC13032 or their specifically genetically modified variants.
  • the present invention also relates to a method for the increased provision of malonyl-CoA in coryneform bacteria with the aforementioned coryneform bacteria and a method for the microbial production of polyphenols or polyketides in coryneform bacteria.
  • the processes are independent of the addition of cerulenin.
  • the present invention also relates to the use of a coryneform bacterial cell according to the invention for increased provision of malonyl-CoA in coryneform bacteria, and the use of a coryneform bacterial cell according to the invention for the production of polyphenols or polyketides with coryneform bacteria.
  • the invention also includes a composition containing secondary metabolites selected from the group of polyphenols and polyketides, preferably the stilbenes, flavonoids and polyketides, particularly preferably resveratrol, naringenin and noreugenin, produced using a coryneform according to the invention or a method according to the invention.
  • the present invention also relates to the use of a composition according to the invention mentioned above for the production of pharmaceuticals, foods, animal feeds and / or for use in plant physiology.
  • the present invention relates to a coryneform bacterial cell with an increased supply of malonyl-CoA compared to its original type in which the regulation and / or expression of the genes selected from the group comprising fasB, gltA, accBC and accD1, and / or the functionality of the they specifically encoded enzymes.
  • the invention thus encompasses a coryneform bacterial cell which has one or more targeted modifications selected from the group comprising a) reduced or deactivated functionality of the fatty acid synthase FasB; b) mutation or partial or complete deletion of the gene fasB coding for the fatty acid synthase; c) reduced functionality of the promoter operatively linked to the citrate synthase gene gtIA; d) reduced expression of the gene coding for the citrate synthase CS gltA; e) Reduced or deactivated functionality of the operator binding sites (fasO) for the regulator FasR in the promoter regions of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits; f) Depressed expression of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits; g) one or more combinations of a) - f).
  • the invention also encompasses a coryneform bacterial cell in which the functionality of the fatty acid synthase FasB is reduced or switched off and / or the gene fasB coding for the fatty acid synthase is specifically mutated, preferably by one or more nucleotide substitutions, or is partially or completely deleted.
  • coryneform bacterial cell in which the expression of the gene coding for citrate synthase gltA is reduced by mutation, preferably several nucleotide substitutions, of the operatively linked promoter.
  • the present invention also relates to a coryneform bacterial cell in which the functionality of the operator binding sites (fasO) for the regulator FasR in the promoter regions of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits, preferably by one or more nucleotide substitutions is reduced or switched off and the expression of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits is derepressed, preferably increased.
  • the functionality of the operator binding sites (fasO) for the regulator FasR in the promoter regions of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits preferably by one or more nucleotide substitutions is reduced or switched off and the expression of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits is derepressed, preferably increased.
  • a new fasO binding site 5 ' is operatively linked in front of the accD1 gene of coryneform bacteria.
  • This is advantageously characterized in that, taking into account the amino acid sequence and the best possible codon use in coryneform bacteria, it exhibits a maximum deviation from the native fasO sequence: MTISSPX (FIG. 23).
  • the fasO binding sites according to the invention have a nucleic acid sequence according to SEQ ID NO: 13 or 15 in front of the accBD or accD1 genes.
  • Another object of the present invention is also a coryneform bacterial cell which is a combination of reduced expression and / or activity of citrate synthase (CS) and deregulated, increased expression and / or activity of the acetyl-CoA carboxylase subunits (AccBC and AccDI) having.
  • CS citrate synthase
  • AccBC and AccDI acetyl-CoA carboxylase subunits
  • the invention also includes a coryneform bacterial cell which is a combination of reduced expression and / or activity of citrate synthase (CS) and deregulated, increased, expression and / or activity of acetyl-CoA carboxylase subunits (AccBC and AccD1) and reduced or switched off Has functionality of the fatty acid synthase FasB.
  • CS citrate synthase
  • AccBC and AccD1 acetyl-CoA carboxylase subunits
  • a coryneform bacterial cell according to the invention is characterized in particular by the fact that the anabolism of malonyl-CoA is specifically increased and at the same time the growth of the cell is unaffected.
  • Such a coryneform bacterial cell has not yet been described.
  • the catabolic metabolism of malonyl-CoA is switched off, but this has the negative effect that the cells can no longer grow. This is described in a variety of ways.
  • B. by the addition of cerulenin.
  • lack of growth negatively affects the tightly controlled malonyl CoA supply, i.e. less malonyl-CoA is provided, which proves to be counterproductive.
  • the present invention advantageously overcomes such disadvantages.
  • the term “original type” is to be understood both as the “wild type” of a coryneform bacterial cell, which z. B. provides a genetically unmodified parent gene or parent enzyme, as well as direct descendants thereof.
  • Coryneform wild-type cells of the genus Corynbacterium or Brevibacterium are preferred; coryneform bacterial cells of the wild type Corynebacterium glutamicum are particularly preferred; coryneform bacterial cells of the wild type Corynebacterium glutamicum ATCC 13032 are very particularly preferred.
  • the term “original type” thus includes, in addition to the “wild type”, also specifically derived, precisely defined and well-characterized "descendants" of the wild type.
  • the “descendants” show changes that are targeted, directed and controlled by means of molecular biological methods and which are homologous, non-recombinant changes, such as: B. nucleotide substitutions or deletions or the adaptation of heterologous nucleic acid sequences to the codon usage (codon usage) of the wild type.
  • the resulting descendant is characterized physiologically precisely and does not carry heterologous nucleic acid sequences; neither chromosomally coded nor plasmid coded.
  • An example of a “primary type” in the sense of the present invention is a coryneform bacterial cell of the wild type in which the genes responsible for the breakdown of aromatic components are deleted from the genome.
  • targeted nucleotide substitutions in the genome are also conceivable, by means of which the wild type remains genetically a homologous, non-recombinant organism. This example is not to be interpreted as limiting the present invention. Since, according to the invention, it is a matter of targeted nucleotide exchanges of the same, homologous host organism, the resulting organism is modified according to the invention in a non-recombinant manner.
  • “Homologous” in the sense of the invention is to be understood to mean that the enzymes according to the invention and the nucleic acid sequences according to the invention coding for them and the non-coding nucleic acid sequences according to the invention linked to these in a regulatory manner are derived from a common starting strain of coryneform bacterial cells. According to the invention, “homolog” is used synonymously with the term “not heterologous”.
  • An “original type” according to the invention is genetically and physiologically exactly characterized, homologous, non-recombinant and can be equated with the “wild type”. The terms “wild type”, “descendants” and “original type” are used synonymously according to the invention.
  • a “reduced or deactivated functionality” relates, for example, both to the functionality of the fatty acid synthase FasB according to the invention at the protein level and to the nucleic acid sequence according to the invention encoding it.
  • “Functionality” thus generally comprises the function of a protein or a nucleic acid sequence coding therefor, which can be reduced or switched off, for example, by nucleotide substitution or deletion.
  • the “functionality” thus also includes the activity of a protein, which can be changed, such as reduced or switched off.
  • the changed activity of a protein can include changes in the active, catalytic center as well as regulatory center.
  • a coryneform bacterial cell which is characterized in that it has a modified functionality of an enzyme and / or the coding nucleic acid sequence and / or an operatively linked, regulatory, non-coding nucleic acid sequence.
  • Another variant of a coryneform bacterial cell according to the invention is characterized in that the modification is based on changes selected from the group comprising a) change in the regulation or signal structures for gene expression, b) change in the transcription activity of the coding nucleic acid sequence, or c) change in the coding Nucleic acid sequence.
  • the invention includes, for example, changes in the signal structures of gene expression, such as, for example, by changing the repressor genes, activator genes, operators, promoters; Attenuators, ribosome binding sites, the start codon, terminators. Also included are the introduction of a stronger or weaker promoter or an inducible promoter into the genome of the coryneform bacterial cell according to the invention or deletions or nucleotide substitutions in coding or non-coding areas, the molecular biological methods being known to the person skilled in the art.
  • the present invention relates to a coryneform bacterial cell in which the changes are chromosomally-encoded in the genome or extrachromosomally, ie vector-encoded or plasmid-encoded.
  • suitable plasmids are those which are replicated in coryneform bacteria.
  • Numerous known plasmid vectors such as e.g. B.
  • pZ1 (Menkel et al., Applied and Environmental Microbiology (1989) 64: 549-554), pEKExI (Eikmanns et al., Gene 102: 93-98 (1991)) or pHS2-1 (Sonnen et al., Gene 107: 69-74 (1991)) are based on the cryptic plasmids pHM1519, pBL1 or pGA1.
  • Other plasmid vectors such as e.g. B.
  • pCG4 US-A 4,489,160
  • pNG2 Serwold-Davis et al., FEMS Microbiology Letters 66, 119-124 (1990)
  • pAG1 US-A 5,158,891
  • Vectors with controllable expression can also be used, such as, for example, pEKEx2 (B. Eikmanns, 1991 Gene 102: 93-8; O. Kirchner 2003, J. Biotechnol.
  • Environ Microbiol 60: 126-132 The desired strain is transformed with a vector by conjugation or electroporation of the desired strain, for example C. glutamicum.
  • the conjugation method is described, for example, by Schfer et al. (Applied and Environmental Microbiology (1994) 60: 756-759). Methods of transformation are, for example, in Tauch et al. (FEMS Microbiological Leiters (1994) 123: 343-347).
  • nucleic acid sequences and / or regulatory structures preferred according to the invention, changes such as e.g. B. includes transitions, transversions or insertions, as well as methods of directed evolution. Instructions for generating such changes can be found in well-known textbooks (R. Knippers "Molecular Genetics", 8th edition, 2001, Georg Thieme Verlag, Stuttgart, Germany). According to the invention, nucleic acid substitutions or deletions are preferred.
  • a “reduced or deactivated functionality” refers not only to the functionality of a gene or protein, but also to a changed functionality of regulator binding sites, such as, for example, B. the operator binding site fasO, to which normally a centrally acting regulatory protein, such as. B. fasR binds, and thereby the expression of the coding nucleic acid sequence is repressed.
  • “Decreased” or “switched off” in the sense of the present invention also means that the expression of the coding nucleic acid sequence in comparison to the situation in a wild-type or primary-type host cell in the For the purposes of the invention, this has been done poorly or is no longer under the expression control of the regulator.
  • a “reduced or deactivated functionality” also refers to a changed functionality of promoter regions in the 5 ′ regulatory region in front of a coding gene. Changes in "functionality” can increase or decrease the activity of the promoter.
  • a promoter such as. B. before the gene gtIA coding for citrate synthase in its function and thus activity reduced. As a result, the gene encoded by this promoter is expressed more weakly.
  • the regulation mechanisms and their effects in the event of changes are familiar to the skilled worker in all variants.
  • modification means “change”, for example also “genetic change”, whereby according to the invention it is meant that although a genetic engineering method is used, no insertions of nucleic acid molecules are generated.
  • “modifications” or “changes” mean substitutions and / or deletions, preferably substitutions “modification” “. change” or “genetic change” in the sense of the present invention are also generated in a regulatory, non-coding region of the nucleic acids according to the invention.
  • the present invention also relates to a protein coding for a fatty acid synthase FasB isolated from coryneform bacteria, the functionality of which is reduced or switched off and with which an increased provision of malonyl-CoA in coryneform bacteria is made possible, the amino acid sequence selected at least 70% identity to the amino acid sequence from the group containing SEQ ID NO. 2, 4, 6, 8 and 10 or fragments or alleles thereof.
  • the invention also includes a fatty acid synthase FasB with an amino acid sequence selected from the group comprising SEQ ID NO. 2, 4, 6, 8 and 10 or fragments or alleles thereof.
  • a fatty acid synthase is encoded by a nucleic acid sequence containing at least 70% identity to the nucleic acid sequence selected from the group SEQ ID NO. 1, 3, 5, 7 and 9 or fragments thereof according to the invention.
  • the present invention also comprises a fatty acid synthase encoded by a nucleic acid sequence selected from the group SEQ ID NO. 1, 3, 5, 7 and 9 or fragments thereof.
  • Proteins coding for an amino acid sequence with at least 75 or 80%, preferably at least 81, 82, 83, 84, 85 or 86% identity, particularly preferably 87, 88, 89, 90% identity, very particularly preferably at least, are also encompassed according to the invention 91, 92, 93, 94, 95% identity or most preferably 96, 97, 98, 99 or 100% identity to the amino acid sequence according to SEQ ID NO. 2, 4, 6, 8 and 10 or fragments or alleles thereof.
  • the present invention relates to a fatty acid synthase FasB containing an amino acid sequence according to SEQ ID NO. 2, 4, 6, 8 and 10 or fragments or alleles thereof.
  • the present invention also relates to a nucleic acid sequence coding for a fatty acid synthase FasB from coryneform bacteria, the functionality of which is reduced or switched off, selected from the group comprising: a) a nucleic acid sequence containing at least 70% identity to the nucleic acid sequence selected from the group SEQ ID NO. 1, 3, 5, 7 and 9 or fragments thereof, b) a nucleic acid sequence which, under stringent conditions, with a complementary sequence of a nucleic acid sequence selected from the group SEQ ID NO. 1, 3, 5, 7 and 9 or fragments thereof hybridized, c) a nucleic acid sequence selected from the group SEQ ID NO.
  • the invention also relates to a fatty acid synthase FasB encoded by a nucleic acid sequence containing at least 70% identity to the nucleic acid sequence according to SEQ ID NO. 1, 3, 5, 7 and 9 or fragments thereof.
  • the invention also includes nucleic acid sequences which have at least one 75% or 80%, preferably at least 81, 82, 83, 84, 85 or 86% identity, particularly preferably 87, 88, 89, 90% identity, very particularly preferably at least 91, 92, 93, 94, 95% identity or most preferably 96, 97, 98, 99 or 100% identity to the nucleic acid sequence according to SEQ ID NO. 1, 3, 5, 7 and 9 or fragments thereof.
  • the present invention relates to a fatty acid synthase FasB encoded by a nucleic acid sequence according to SEQ ID NO. 1, 3, 5, 7 and 9 or fragments thereof.
  • the invention also encompasses a coryneform bacterial cell which has a protein coding for a fatty acid synthase FasB with reduced or deactivated functionality or a nucleic acid sequence coding for a fatty acid synthase FasB with the previously mentioned changed functionality.
  • a coryneform bacterial cell which has one or more targeted modifications, selected from the group comprising a) Reduced or deactivated functionality of the fatty acid synthase FasB with at least 70% identity to the amino acid sequence selected from the group containing SEQ ID NO. 2, 4, 6, 8 and 10 or fragments or alleles thereof; b) mutation or partial or complete deletion of the gene fasB coding for the fatty acid synthase with a nucleic acid sequence containing at least 70% identity to the nucleic acid sequence selected from the group SEQ ID NO.
  • proteins of the fatty acid synthase FasB from coryneform bacteria and / or nucleic acid sequences encoding a fatty acid synthase FasB from coryneform bacteria are also encoded, in which nucleotide substitutions and corresponding amino acid exchanges are present.
  • nucleotide substitutions and corresponding amino acid exchanges are present.
  • the functionality of the promoter operatively linked to the citrate synthase gene gltA is also reduced.
  • nucleotide substitutions can take place in the binding sites responsible for the binding of the polymerase, or an entire promoter sequence of a weaker promoter can be exchanged for the naturally occurring promoter sequence, or a combination of both, a weaker promoter being additionally weakened by nucleotide substitution. Since, according to the invention, targeted nucleotide exchanges of the same, homologous host organism are involved, the resulting organism is non-recombinantly changed according to the invention.
  • “Homologous” in the sense of the invention means that the enzymes according to the invention and the nucleic acid sequences according to the invention coding for them and the invented According to the invention, these regulatory-linked non-coding nucleic acid sequences are related to a common starting strain of coryneform bacterial cells. According to the invention, “homolog” is used synonymously with the term “non-heterologous”.
  • nucleic acid sequence in the sense of the present invention means any homologous molecular unit that transports genetic information. This applies accordingly to a homologous gene, preferably a naturally occurring and / or non-recombinant homologous gene, a homologous transgene or codon-optimized homologous genes.
  • nucleic acid sequence refers to a nucleic acid sequence or fragments or alleles thereof which encode or express a specific protein.
  • nucleic acid sequence preferably refers to a nucleic acid sequence containing regulatory sequences which precede the coding sequence (upstream, upstream, 5 ' non-coding sequence) and follow it (downstream, downstream, 3 ' non-coding sequence).
  • naturally occurring gene refers to a gene found in nature, for example from a wild-type strain of a coryneform bacterial cell, with its own regulatory sequences.
  • operatively linked region relates to an association of nucleic acid sequences on a single nucleic acid fragment, so that the function of one nucleic acid sequence is influenced by the function of the other nucleic acid sequence.
  • operatively linked in the sense of the invention means that the coding sequence is under the control of the regulatory region (in particular the promoter or the regulatory binding site) that controls the expression the coding sequence regulated.
  • a new fasO binding site 5 'operatively linked is provided in front of the accD1 ⁇ gene of coryneform bacteria.
  • Variants of the present invention also include a reduced or deactivated functionality of the operator binding sites (fasO) for the regulator FasR in the promoter regions of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits.
  • fasO operator binding sites
  • cct -> aag nucleotide substitutions at positions 20-24 (cctca -> gtacg).
  • the present invention thus also relates to a nucleic acid sequence for an operatively linked fasO binding site in the regulatory, non-coding region 5 'in front of the accD1 gene from coryneform bacteria, the nucleotide substitutions according to SEQ ID NO. 15 has.
  • the present invention also relates to a coryneform bacterial cell in which the modifications according to the invention are advantageously chromosomally encoded.
  • the invention also includes a coryneform bacterial cell that is non-recombinant (non-GMO).
  • non-recombinant is to be understood to mean that the genetic material of the coryneform bacterial cells according to the invention is only changed in the way that it occurs naturally, e.g. through natural recombination or natural mutation.
  • the coryneform bacterial cells according to the invention are thus distinguished as a non-genetically modified organism (non-GMO).
  • the present invention thus provides a system with which the microbial production of malonyl-CoA can be carried out in a significantly simpler, more stable, cheaper and more economical manner. Because all previously known bacterial strains with a malonyl-CoA synthesis capacity require complex media for their growth, which makes cultivation significantly more complex, expensive and therefore uneconomical. Here is especially the addition of inhibitors of fatty acid synthesis, such as. B. Cerulenin called, which is very expensive and is therefore not suitable for use in an industrial manufacturing process. In addition, all malonyl-CoA producers described so far are not GRAS organisms. This creates a disadvantage for use in certain industrial areas (e.g. food and pharmaceutical industries) due to complex approval procedures.
  • Coryneform bacteria preferably of the genus Corynebacterium, are generally recognized as safe (GRAS) organism that can be used in all industrial areas. Coryneform bacteria achieve high growth rates and biomass yields on defined media (Grünberger et al., 2012) and there is extensive experience in the industrial use of coryneform bacteria (Becker et al., 2012).
  • coryneform bacteria of the genus Corynebacterium or Brevibacterium are included.
  • Variants of coryneform bacteria according to the invention are selected from the group comprising Corynebacterium and Brevibacterium, preferably Corynebacterium glutamicum, particularly preferably Corynebacterium glutamicum ATCC 13032, Corynebacterium acetoglutamicum, Corynebacterium thermoaminogenes, Brevibacterium flavumacterium or Brevibacterium lactofer.
  • a coryneform bacterial cell is also selected from the group comprising Corynebacterium glutamicum ATCC13032 or specifically modified descendants or primary types, Corynebacterium acetoglutamicum ATCC15806, Corynebacterium acetoacidophilum ATCC 13870, Corynebacterium thermoaminogenium flavib150 Breib1, Brex1, Brex, Brex, Brex, Bacterium, Brex, Brex, Bacterium, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Bre
  • the invention also includes a coryneform bacterial cell with one or more of the above-mentioned modifications according to the invention, starting from Corynebacterium glutamicum, preferably Corynebacterium glutamicum ATCC13032, in which the catabolic pathway of aromatic components, preferably selected from the group comprising phenylpropanoids and benzoic acid derivatives, is additionally switched off is.
  • Corynebacterium glutamicum preferably Corynebacterium glutamicum ATCC13032
  • the catabolic pathway of aromatic components preferably selected from the group comprising phenylpropanoids and benzoic acid derivatives
  • coryneform bacterial cell are characterized in that the functionality and / or activity of the enzymes or the expression of the genes encoding them participates in the catabolic pathway of aromatic components by deletions of the gene clusters cg0344-47 (phdBCDE operon), cg2625-40 (cat, ben and pca), cg1226 (pobA) and cg0502 (qsuB) are switched off.
  • These cells according to the invention have been changed in a targeted manner and have not arisen through untargeted mutagenesis. They are characterized in an advantageous manner in that they are genetically precisely characterized and the modifications mentioned are achieved by deletions.
  • these deletions are chromosomally encoded.
  • these cells only have homologous DNA and they are non-recombinantly modified. This distinguishes them, in addition to being a GRAS organism, advantageously for microbial production of products such as B. secondary plant metabolites.
  • the coryneform bacterial cell according to the invention is also advantageously characterized in that it does not contain any extrachromosomal DNA, such as, for example, for increased provision of malonyl CoA.
  • B. plasmids or vectors needed are extrachromosomal DNA, such as, for example, for increased provision of malonyl CoA.
  • bacterial strains with more than 2 plasmids or more than 2 genes per plasmid are generally not stable; second, it must be borne in mind that the microbial production of complex secondary metabolites in bacteria, which is the subject of the invention, is a heterologous expression of the corresponding plant genes for polyphenol and / or polyketide production and thirdly, these desired products or their precursors should not be decomposed again by cell-specific activities, such as, for example, the enzymatic degradation of aromatic components.
  • a further, very complex object of the present invention is therefore to provide a system for the increased provision of malonyl-CoA in coryneform bacteria without having to make plasmid-coded changes and at the same time to break down the desired aromatics-containing products and their precursors to prevent in coryneform bacteria, solved in a very advantageous manner by the corynform bacterial cells according to the invention.
  • This system of a coryneform bacterial cell which is very advantageous according to the invention, permits great degrees of freedom which plant or other heterologous genes can be introduced into the system extrachromosomally in order to enable stable, microbial production of plant secondary metabolites.
  • the present invention also relates to a coryneform bacterial cell which is distinguished by the fact that it provides an increased intracellular concentration of malonyl-CoA regardless of the addition of fatty acid synthesis inhibitors.
  • This increased provision of malonyl-CoA as a central intermediate can be used according to the invention for the production of products for the synthesis of which an increased concentration of malonyl-CoA is required, such as, for. B. the fatty acid synthesis or the synthesis of secondary metabolites from plants, such as polyphenols or polyketides.
  • the present invention also relates to coryneform bacterial cells for the production of polyphenols or polyketides, which have modifications of the aforementioned type according to the invention and in which the catabolic pathway of aromatic components, preferably selected from the group comprising phenylpropanoids and benzoic acid derivatives, is additionally switched off.
  • Coryneform bacteria have their own metabolic pathway to break down phenylpropanoids or benzoic acid derivatives (Kallscheuer et al., 2016; https://doi.org/10.1007/s00253-015-7165-1). This would be counterproductive for the production of polyketides or polyphenols with coryneform bacteria.
  • a coryneform bacterial cell which increases Provision of malonyl-CoA is made possible and which is additionally characterized in that the functionality and / or activity of the enzymes or the expression of the genes encoding them, involved in the catabolic pathway of aromatic components, by deletions of the gene clusters cg0344-47 (phdBCDE operon) , cg2625-40 ('cat, ben and pca), cg 1226 (pobA) and cg0502 (qsuB) are switched off.
  • These cells according to the invention have been changed in a targeted manner and have not arisen through untargeted mutagenesis.
  • these deletions are chromosomally encoded.
  • these cells only have homologous DNA and they are non-recombinantly modified. This distinguishes them, in addition to being a GRAS organism, advantageously for microbial production of products such as B. secondary plant metabolites.
  • the coryneform bacterial cell according to the invention is also advantageously characterized in that it does not contain any extrachromosomal DNA, such as eg. B. plasmids or vectors needed.
  • the present invention also relates to a coryneform bacterial cell which, in addition to the modifications of the aforementioned type according to the invention, has the enzymes derived from plants or the genes encoding them for polyphenol or polyketide synthesis.
  • a variant of the present invention also includes a coryneform bacterial cell which has the genes derived from plants for polyphenol or polyketide production, selected from the group comprising the genes 4cl, sts, chs, chi and pcs.
  • the coryneform bacterial cell according to the invention with the properties according to the invention described in the manner described above is advantageously characterized in that it can carry out the synthesis of polyketides from 5 malonyl-CoA units.
  • the synthesis of polyphenols can also be carried out with the coryneform bacterial cell according to the invention of the type described above, with a supplementation of the corresponding culture medium with a polyphenol precursor, such as. B. p-cumaric acid, the implementation of malonyl-CoA to stilbenes or flavonoids favored.
  • the coryneform bacterial cell Starting from glucose as the carbon source, the coryneform bacterial cell according to the invention requires the enzymes 3-deoxy-D-arabinoheptulosonate-7-phosphate synthase and tyrosine ammonium lyase encoded by the genes aroH and tal.
  • a coryneform bacterial cell is also encoded which encodes genes for a feedback-resistant 3-deoxy-D-arabinoheptulosonate-7-phosphate synthase (aroH), preferably from E. coli, and for a tyrosine ammonium lyase (valley), preferably from Flavobacertium johnsoniae.
  • aroH 3-deoxy-D-arabinoheptulosonate-7-phosphate synthase
  • valley tyrosine ammonium lyase
  • PCS 5,7-dihydroxy-2-methylchromone synthase activity
  • the enzyme 5,7-dihydroxy-2-methylchromone synthase activity is a type III polyketide synthase (EC 2.3.1.216, UniProt Q58VP7, (Abe et al., 2005; https://doi.org /10.1021/ja0431206)
  • the PCS from Aloe arborescens is encoded by the pcs gene and annotated as EC 2.3.1.216, UniProt Q58VP7
  • the catalytic activity for the synthesis of noreugenin from five molecules of malonyl-CoA is described as a supposed function. According to the invention, the pcs gene from Aloe arborescens was synthesized using C.
  • PCS Sh0 r t a 5,7-dihydroxy-2-methylchromone synthase
  • PCS Sh0 r t a further structural element is made available, with the help of which plant-based plants are advantageously used Secondary metabolites can be produced in coryneform bacteria.
  • the 5,7-dihydroxy-2-methylchromone synthase (PCS Sh0 r t ) according to the invention has an amino acid sequence shortened by 10 N-terminal amino acids.
  • the resulting plasmid pMKEx2-pcs ⁇ aC8 -short can be transformed into any of the C.
  • glutamicum strains described above the product formation being analyzed after appropriate cultivation and sampling.
  • the plasmid is transformed into the C. glutamicum strain DelAro 4 -4c / PcCg-C7-mu / asO.
  • the resulting strain C. glutamicum DelAro 4 -4c / PcCg-C7-mu / asO pMKEx2-pcs ia c g -short is grown under standard conditions (CGXII + 4% glucose, 1 mM IPTG, 30 ° C, 130 RPM, 72 h ) and the samples taken are analyzed for product formation using LC-MS (see above).
  • a 5,7-dihydroxy-2-methylchromone synthase variant (PCS sho n) according to the invention and the nucleic acid sequence pcs Short encoding it are not yet known.
  • the present invention also relates to a protein with an increased 5,7-dihydroxy-2-methylchromone synthase activity (PCS short ) in one of the previously described coryneform bacterial cells according to the invention for the synthesis of polyketides in coryne-shaped bacteria, the amino acid sequence being at least 70% identical to the amino acid sequence according to SEQ ID NO.
  • a 5,7-dihydroxy-2-methylchromone synthase is included, containing an amino acid sequence as shown in SEQ ID NO. 20 or fragments or alleles thereof.
  • a 5,7-dihydroxy-2-methylchromone synthase encoded by a nucleic acid sequence containing at least 70% identity to the nucleic acid sequence according to SEQ ID NO is also included according to the invention. 19 or fragments thereof.
  • a 5,7-dihydroxy-2-methylchromone synthase is encoded, encoded by a nucleic acid sequence according to SEQ ID NO. 19 or fragments thereof.
  • a nucleic acid sequence (pcs short ) is encoded, coding for a 5,7-dihydroxy-2-methylchromone synthase with increased activity for polyketide production in coryneform bacteria selected from the group comprising: a) a nucleic acid sequence containing at least 70% identity to the nucleic acid sequence according to SEQ ID NO. 19 or fragments thereof, b) a nucleic acid sequence which under stringent conditions with a complementary sequence of a nucleic acid sequence according to SEQ ID NO. 19 or fragments thereof hybridized, c) a nucleic acid sequence according to SEQ ID NO.
  • PCS Short 5,7-dihydroxy-2-methylchromone synthase
  • the present invention also relates to a coryneform bacterial cell of the type described above, which encodes a protein with an increased 5,7-dihydroxy-2-methylchromone synthase activity (PCS sh0 r t ) and / or a nucleic acid sequence for a 5,7 - Dihdroxy-2-methylchromone synthase (PCS sh0 r t ) with increased activity in coryneform bacteria.
  • PCS sh0 r t a protein with an increased 5,7-dihydroxy-2-methylchromone synthase activity
  • PCS short a protein with an increased 5,7-dihydroxy-2-methylchromone synthase activity
  • Another variant of the present invention also comprises a protein with an increased 5,7-dihydroxy-2-methylchromone synthase activity (PCS sh0rt ) according to SEQ ID NO. 20th
  • genes derived from plants or other heterologous systems such as, for example, aroH, tal and / or the genes for polyphenol synthesis, preferably stilbene and / or flavonoid synthesis, particularly mentioning the genes sts, chs, chi or the genes for polyketide synthesis, preferably pcs Sh0rt , were adapted and optimized for expression in coryneform bacteria to the bacterial codon usage (codon usage) of these coryneform bacteria, preferably that of Corynebacterium glutamicum.
  • the proportion of heterologous nucleic acid sequences is thereby reduced according to the invention and the expression in coryneform bacterial cells is advantageously supported.
  • a coryneform bacterial cell of the aforementioned type is also included, in which the plant genes are present under the expression control of an inducible promoter.
  • an IPTG-inducible promoter preferably the T7 promoter.
  • a coryneform bacterial cell according to the invention in which the gene 4cl coding for 4-cumarat-CoA ligase (4CL) is present under the expression control of an inducible promoter, the inducible promoter and the gene linked to it regulatively was integrated into the genome of the coryneform bacterial cell, ie chromosomally encoded.
  • an IPTG-inducible promoter preferably the T7 promoter, is used.
  • the present invention also relates to extrachromosomal systems, such as vectors or plasmids, with the properties required for the expression of the genes required for the synthesis of polyphenols or polyketides.
  • the plasmid or vector-encoded genes are subject to an inducible promoter, preferably an IPTG-inducible promoter, preferably the T7 promoter.
  • an inducible promoter has the advantage according to the invention that the expression of the genes required for the secondary metabolites can be controlled in a targeted manner, ie switched on, depending on the growth or cultivation conditions of the coryneform bacterial cells according to the invention.
  • the corynform bacterial cells according to the invention of the type described above can thus first be cultured for the increased provision of malonyl-CoA, which then, after specific induction of the expression of the required genes, continues to the desired ones Products.
  • the present invention also relates to a coryneform bacterial cell which has genes selected from the group comprising a) 4cl and sts for the synthesis of polyphenols, preferably stilbenes, particularly preferably resveratrol, or b) chs and chi for the synthesis of polyphenols Flavonoids, particularly preferably naringenin, or c) pcs short for the synthesis of polyketides, preferably noreugenin, under the control of an inducible promoter, preferably one with an IPTG-inducible promoter, particularly preferably the T7 promoter.
  • the present invention is advantageously characterized in that the genes or regions linked to them in a regulatory manner for the increased provision of malonyl-CoA are integrated into the genome of the cells according to the invention, that is to say are chromosomally encoded.
  • This creates degrees of freedom to insert further heterologous genes into the cells in a plasmid-encoded manner without overwhelming the cell.
  • the known disadvantages that bacterial cells cannot be stably propagated with more than 2 plasmids or the major disadvantage that plasmids with more than 2 heterologous genes generally do not produce a satisfactory result in terms of stability or expression is due to the system which is very advantageous according to the invention of a coryneform bacterial cell. Due to its structure, it offers great degrees of freedom, which plant or other heterologous genes can be introduced extrachromosomally into the system, in order to enable a stable, microbial production of plant secondary metabolites based on malonyl-CoA.
  • coryneform bacterial cell which has genes selected from the group comprising a) fasB and / or gltA and / or accBCDI, the functionality and / or expression of which has been specifically modified for increased provision of malonyl-CoA , and b) cg0344-47 (phdBCDE operon), cg2625-40 (cat, ben and pca), cg 1226 (pobA) and cg0502 (qsuB) their functionality for the degradation of aromatic components, preferably from the group containing phenylpropanoids or benzoic acid - Derivatives, is turned off, and c) pcS short coding for a protein with an increased 5,7-dihydroxy-2-methylchromone synthase activity (PCS sh0rt ) for the synthesis of polyketides, preferably noreugenin, or d) optionally aroH and tal for
  • the genes according to the invention or the regulatory regions from a) and b) operatively linked to them are present encoded in the genome.
  • the genes or the regulatory regions from c) - f) operatively linked to them are plasmid-encoded. According to the invention, combinations of these are conceivable for the production of polyketides, preferably noreugenin, such as, for. B.
  • Combinations are conceivable for the production of polyphenols, preferably flavonoids, more preferably naringenin, such as. B. with variants of fasB (substitution or deletion mutants) and Acg0344-47 (phdBCDE operon) and Acg2625-40 (cat, ben and pca) and Acg1226 (pobA) and Acg0502 (qsuB) and aroH and tal and chs and chi; with gtIA and Acg0344-47 ⁇ phdBCDE operon) and Acg2625-40 (cat, ben and pca) and Acg1226 (pobA) and Acg0502 (qsuB) and aroH and tal and chs and chi; with gtIA and accBCDI and Acg0344-47 (phdBCDE operon) and Acg2625-40 (cat, ben and pca) and Acg1226 (pobA) and Ac
  • coryneform bacterial cell of the aforementioned type with the aforementioned variations in gene combinations which has genes selected from the group containing a) fasB gene according to a nucleic acid sequence selected from the group containing SEQ ID NO. 1, 3, 5, 7, and 9 or fragments thereof, coding for fatty acid synthases FasB selected from the group comprising SEQ ID NO. 2, 4, 6, 8, and 10 or fragments or alleles thereof and / or gltA gene with an operatively linked promoter region according to SEQ ID NO. 11 and / or accBCDI gene clusters with operatively linked fasO binding sites selected from the group containing SEQ ID NO.
  • the present invention also relates to a method for the increased provision of malonyl-CoA in coryneform bacteria comprising the steps: a) providing a solution containing water and a C6-carbon source; b) microbial conversion of the C6 carbon source in a solution according to step a) to malonyl-CoA in the presence of a coryneform bacterial cell according to the invention in which the regulation and / or expression of the genes selected from the group comprising fasB, gtIA, accBC and accD1 and / or the functionality of the enzymes encoded by it is specifically modified.
  • solution is to be understood as meaning “medium”, “culture medium”, “culture broth” or “culture solution”.
  • microbial is to be understood as synonymous with “biotechnological” or “fermentative”.
  • implementation is to be understood as synonymous with “metabolism”, “metabolism” or “cultivation”.
  • preparation is according to the invention synonymous to understand “separation", “concentration” or “purification”.
  • the culture medium to be used should suitably meet the requirements of the respective microorganisms. Descriptions of culture media of various microorganisms are contained in the manual “Manual of Methods for General Bacteriology” of the American Society for Bacteriology (Washington D.C., USA, 1981).
  • sugar and carbohydrates such as e.g. Glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose, oils and fats such as B. soybean oil, sunflower oil, peanut oil and coconut oil, fatty acids such as. As palmitic acid, stearic acid and linoleic acid, alcohols such as. B.
  • glycerol and ethanol and organic acids such as.
  • B. acetic acid can be used. These substances can be used individually or as a mixture.
  • Organic nitrogen-containing compounds such as peptones, yeast extract, meat extract, malt extract, corn steep liquor, soybean meal and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate can be used as the nitrogen source.
  • the nitrogen sources can be used individually or as a mixture.
  • Potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts can be used as the source of phosphorus.
  • the culture medium should also contain salts of metals such as e.g.
  • the feedstocks mentioned can be added to the culture in the form of a single batch or can be added in a suitable manner during the cultivation.
  • Basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or acidic compounds such as hydrochloric acid, phosphoric acid or sulfuric acid are used in a suitable manner to control the pH of the culture.
  • Anti-foam agents such as e.g. Fatty acid polyglycol esters are used.
  • suitable selectively acting substances e.g. Antibiotics.
  • oxygen or gas mixtures containing oxygen e.g. Air entered the culture.
  • the temperature of the culture is usually 20 ° C to 45 ° C and preferably 25 ° C to 40 ° C.
  • the present invention relates to methods in which the cultivation is carried out discontinuously or continuously, preferably in batch, fed-batch, repeated fed-batch or continuous mode.
  • the microbial conversion of the C6 carbon source takes place in a coryneform bacteria according to the invention containing one of the variants of fasB described according to the invention, in which the fatty acid synthase FasB is reduced or switched off and / or for the Gene encoding fatty acid synthase is specifically mutated, preferably by one or more nucleotide substitutions, or is partially or completely deleted.
  • the microbial conversion of the C6 carbon source takes place in a coryneform bacterial cell according to the invention containing a gene gltA coding for citrate synthase according to the invention, which by mutation, preferably several nucleotide substitutions, of the operatively linked promoter its expression is reduced.
  • the microbial conversion of the C6 carbon source takes place in a coryneform bacterial cell according to the invention containing the genes accBC and accD1 according to the invention, in which the functionality of the operator binding sites (fasO) for the regulator FasR in the promoter regions of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits, preferably by one or more nucleotide substitutions, is reduced or switched off and the expression of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits is de-expressed, preferred is increased.
  • the functionality of the operator binding sites (fasO) for the regulator FasR in the promoter regions of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits preferably by one or more nucleotide substitutions
  • the microbial conversion of the C6 carbon source takes place in a coryneform bacterial cell according to the invention, which is a combination of reduced expression and / or activity of citrate synthase (CS) and deregulated, increased,
  • the microbial conversion of the C6 carbon source takes place in a coryneform bacterial cell according to the invention, which is a combination of reduced expression and / or activity of citrate synthase (CS) and deregulated, increased,
  • the microbial conversion of the C6 carbon source takes place in a coryneform bacterial cell according to the invention of the genus Corynebacterium or Brevibacterium.
  • the microbial conversion of the C6 carbon source takes place in a coryneform bacterial cell according to the invention selected from the group containing Corynebacterium glutamicum, particularly preferably Corynebacterium glutamicum ATCC 13032, Corynebacterium acetoglutamicum, Corynebacterium thermoaminogenes, Breum , Brevibacterium lactofermentum or Brevibacterium divaricatum.
  • the invention also includes a variant of the method according to the invention for increased provision of malonyl-CoA.
  • the microbial conversion of the C6 carbon source takes place in a coryneform bacterial cell according to the invention, such as, for example, B. Corynebacterium glutamicum ATCC13032 or specifically modified derivatives or primary types thereof, such as. B. Corynebacterium glutamicum ATCC13032 in which the catabolic pathway of aromatic components, preferably selected from the group comprising phenylpropanoids and benzoic acid derivatives, is also switched off.
  • the present invention also relates to a process for the microbial production of polyphenols or polyketides in coryneform bacteria, comprising the steps: a) providing a solution comprising water and a C6 carbon source, b) microbial conversion of the C6 carbon source in a solution according to step a) to polyphenols or polyketides, in the presence of a coryneform bacterial cell according to the invention, malonyl-CoA first being provided in an increased concentration as an intermediate and being further reacted for the microbial synthesis of polyphenols or polyketides; c) induction of the expression of heterologous or plant genes under the control of an inducible promoter by adding a suitable inductor in step b), d) optionally the preparation of the desired product.
  • a coryneform bacterial cell which has genes selected from the group comprising: a) fasB and / or gltA and / or accBCDI, their functionality and / or expression for an increased supply of malonyl-CoA is specifically modified, and b) cg0344-47 ⁇ phdBCDE operon), cg2625-40 (cat, ben and pca), cg 1226 (pobA) and cg0502 (qsuB) their functionality for the degradation of aromatic Components, preferably from the group containing phenylpropanoids or benzoic acid derivatives, are switched off, and c) pcs short coding for a protein with an increased 5,7-dihydroxy-2-methylchromone synthase activity (PCS short ) for the synthesis of polyketides , preferably Noreugenin or d) aroH and tal for the precursor synthesis of
  • polyketides preferably noreugenin
  • combinations are conceivable, such as, for. B. with variants of fasB (substitution mutants or deletion mutants) and Acg0344-47 ⁇ phdBCDE operon) and Acg2625-40 ⁇ cat, ben and pca) and Acg1226 ⁇ pobA) and Acg0502 ⁇ qsuB) and pcs shor1 ; or with gtIA and Acg0344-47 ⁇ phdBCDE operon) and Acg2625-40 ⁇ cat, ben and pca) and Acg1226 ⁇ pobA) and Acg0502 ⁇ qsuB) and pcs short ; or with gtIA and accBCDI and Acg0344-47 ⁇ phdBCDE-Operon) and Acg2625-40 ⁇ cat, ben and pca) and Acg1226 ⁇ pobA)
  • the solution in step b) is supplemented with the polyphenol precursor, preferably p-cumaric acid.
  • “preparation” is to be understood as meaning “separation”, “extraction”, “concentration” or “purification”.
  • the product preparation is optional in the process according to the invention for the production of polyketides and polyphenols, since the coryneformer according to the invention is advantageous due to the advantageous, targeted parent construction Bacteria the production of only one secondary metabolite is achieved, such as. B. resveratrol or naringenin or noreugenin. As a result, the separation of several different products, such as. B. resveratrol and naringenin, not required from the culture solution. This is another advantage of the present invention.
  • the process according to the invention is advantageously characterized in that it is independent of the addition of inhibitors of fatty acid synthesis, for example cerulenin.
  • a further extraction, processing of the cells, cell extracts or cell supernatants are known to the person skilled in the art and can be carried out in a known manner.
  • cultivation takes place in a discontinuous or continuous, preferably batch, fed-batch, repeated fed-batch or continuous mode.
  • a discontinuous or continuous preferably batch, fed-batch, repeated fed-batch or continuous mode.
  • the present invention also relates to the use of a coryneform bacterial cell according to the invention of the type described above and / or one or more proteins according to the invention and / or one or more nucleotide sequences according to the invention for the increased provision of malonyl-CoA in coryneform bacteria.
  • the present invention also relates to the use of a coryneform bacterial cell according to the invention and / or one or more proteins and / or one or more nucleotide sequences according to the invention for the production of polyketide or polyphenol, preferably for the production of noreugenin or for the production of stilbenes, particularly preferably resveratrol , or for the production of flavonoids, particularly preferably naringenin.
  • the present invention also relates to a composition containing secondary metabolites selected from the group of polyphenols and polyketides, preferably the stilbenes, flavonoids or polyketides, particularly preferably resveratrol, naringenin and / or noreugenin, produced with a coryneform bacterial cell according to the invention and / or one or more according to the invention Proteins and / or one or more nucleotide sequences according to the invention and / or a method according to the invention of the type described above.
  • secondary metabolites selected from the group of polyphenols and polyketides, preferably the stilbenes, flavonoids or polyketides, particularly preferably resveratrol, naringenin and / or noreugenin
  • the present invention furthermore relates to the use of resveratrol, naringenin and / or noreugenin produced with a coryneform bacterial cell according to the invention and / or according to a method according to the invention and / or the use of a composition of the type described above for the production of pharmaceuticals, foods, animal feeds, and / or for use in plant physiology.
  • the composition according to the invention can contain further substances which are advantageous in the production of the desired products. A selection is known to the person skilled in the art from the prior art.
  • Table 1 shows an overview of bacterial strains of the present invention.
  • Table 2 shows an overview of plasmids of the present invention.
  • Table 3 shows an overview of the SEQ ID NOs of the present invention.
  • FIG. 1 shows plasmid pK19mobsacB-fasß-E622 for the amino acid substitution E622K in the fasß gene (cg2743), coding for a fatty acid synthase FasB with reduced functionality.
  • FIG. 2 shows plasmid pK19mobsacB-fasß-G1361 D for the amino acid substitution G1361 D in the fasß gene (cg2743), coding for a fatty acid synthase FasB with reduced functionality.
  • Figure 3 shows plasmid pK19mobsacB-fasß-G2153D, for the amino acid substitution G2153D in the fasß gene (cg2743), coding for a fatty acid synthase FasB with reduced functionality.
  • FIG. 4 shows plasmid pK19mobsacB-fasß-G2668S for the amino acid substitution G2668S in the fasß gene (cg2743), coding for a fatty acid synthase FasB with reduced functionality.
  • FIG. 5 shows plasmid pK19mobsacB -AfasB for the in-frame deletion of fasB (cg2743), for a fatty acid synthase FasB whose functionality is switched off.
  • FIG. 6 shows plasmid pK19mobsacB-P 5 / M :: P tiap / l- C7 for the chromosomal integration of the gene 4cl from Petroselinum crispum codon-optimized for C. glutamicum under control of the IPTG-inducible T7 promoter at the deletion locus Acg0344-47 (Acg 0344-47 :: P 7- 4clp cCg )
  • FIG. 7 shows plasmid pK19mobsacB-mufasO-accßC for mutating the fasO binding site in front of the genes accBC (cg0802), coding for an acetylCoA carboxylase subunit.
  • FIG. 8 shows plasmid pK19mobsacB-mufasO-accD7 for mutating the fasO binding site in front of the accD1 gene (cg0812), coding for an acetylCoA carboxylase subunit, taking into account the ATG start codon and the amino acid sequence of accD1.
  • FIG. 9 shows plasmid pMKEx2-sts Ah- 4d Pc for expression of the genes codon-optimized for C. glutamicum for a stilbene synthase (sts) from Arachis hypogea and a 4 Cumarat CoA ligase ⁇ 4c! From Petroselinum crispum under the control of the IPTG- inducible T7 promoter
  • FIG. 10 shows plasmid pMKEx2-chs Ph -chi Ph for expressing the genes codon-optimized for C. glutamicum for a chalcone synthase (chs) from Petunia x hybrida and a chalcone isomerase (chi) from Petunia x hybrida under the control of the IPTG-inducible T7 promoter
  • FIG. 11 shows plasmid pMKEx2-pcs A3 -short for expressing a shortened variant of the gene optimized for C. glutamicum codon-optimized for a pentaketide chromone synthase (pcs) from aloe arborescens
  • FIG. 12 shows plasmid pK19mobsacB-cg0344-47-del with which the phdBCDE operon (cg0344-47), which codes for genes which are involved in the catabolism of phenylpropanoids, such as, for. B. p-cumaric acid, is deleted from the genome.
  • FIG. 13 shows plasmid pK19mobsacB-cg2625-40-del with which the genes cat, ben and pca (cg2625-40), which are essential for the breakdown of 4-hydroxybenzoate, catechol, benzoate and protocatechuate, are deleted from the genome.
  • FIG. 14 shows plasmid pK19mobsacB-Acg0344-47 :: P T7 -4c / Pc for the chromosomal integration of a variant of the 4cl gene from Petroselinum crispum codon-optimized for C. glutamicum, under the control of the T7 promoter (PT7- 4C / Pc ), to the deletion locus Dcg0344-47.
  • FIG. 15 shows plasmid pK19mobsacB-cg0502-del with which the gene qsuB (cg0502), essential for the accumulation of protocatechuate, is deleted from the genome.
  • Figure 16 shows plasmid pK19mobsacB-cg1226-del with which the gene phobA (cg1226), coding for 4-hydroxybenzoate-3-hydroxylase and essential for the breakdown of 4-hydroxybenzoate, catechol, benzoate and protocatechuate, is deleted from the genome.
  • gene phobA cg12266
  • FIG. 17 shows plasmid pEKEx3-aro / - / £ c -fa / P c g with the genes coding for a feedback-resistant 3-deoxy-D-arabinoheptulosonate-7-phosphate synthase (aroH), preferably from E. coli (aroH Ec ), as well as for a tyrosine ammonium lyase (tal) adapted to the codon use of C. glutamicum, preferably from Flavobacertium johnsoniae (tal Fj ) ⁇
  • This plasmid is used in the synthesis of polyphenols or polyketides during growth starting from glucose.
  • FIG. 18 shows plasmid pMKEx2_sfS / u, _4c / Pc for the expression of the genes sfs from Arachis hypogea (sts Ah ) and 4c / from Petroselinum crispum (4c / Pc ) in coryneform bacterial cells.
  • FIG. 19 shows plasmid pMKEX2-cf / s P / , -c / i / ' P / , for the expression of the genes chs and chi from Petunia x hybrida (chs Ph and chip h ) in coryneform bacterial cells.
  • FIG. 20 shows plasmid pMKEx2 _pcs Aa for the expression of pcs from Aloe arborescens (pcs Aa ) with adaptation to the codon use of coryneform bacterial cells.
  • FIG. 21 shows plasmid pMKEx2 _pcs Aa - short for the expression of the gene variant of pcs from Aloe arborescens (pcs Aa ) in coryneform bacterial cells.
  • FIG. 22 shows a sequence comparison of the native promoter region P daP A of C. glutami- cum wild-type gene with the P dapA- C7 promoter according to the invention, which replaces the native gtlA promoter before the gtlA gene from Corynebacterium glutamicum according to the invention.
  • the promoter region PgltA :: PdapA-C7 according to the invention has, in addition to the exchange of the promoter region of gtIA (PgtIA) for the promoter of dapA (PdapA), also nucleotide substitutions at positions 95 (a-> t) and 96 (g-> a ) in front of the start codon ATG from gtIA.
  • FIG. 23 shows an overview of the fasO binding sites 5 'operatively linked before the genes accBC and accD1 with nucleotide substitutions according to the invention, resulting in a loss of binding of the fasR regulator and an increased functionality or expression of the accBCD1 genes .
  • An overview of fasO-accD1 sequences is also shown.
  • the accD1 start codon underlined (AS sequence translated accordingly from here), highlighted in gray: conserved areas of the fasO binding motif that have to be mutated to prevent FasR binding red: differences to the native sequence.
  • FIG. 24 shows a diagram with malonyl-CoA concentrations (measured in the form of mM malonate) in coryneform bacterial cells according to the invention.
  • the plasmid pK19mobsacB-PgltA PdapA-C7 (FIG. 6)
  • the flanking areas were chosen so that a 540 base pair chromosomal fragment, which carries the native gltA promoter region with the two transcription start and operator sequences, can be deleted.
  • a 20 base pair large linker was inserted between the two edges up and down, which has the interfaces Nsi ⁇ and Xho ⁇ .
  • the C7 variant of the dapA promoter was then subcloned via these interfaces.
  • the upstream fragment up was amplified with the primer pair PgltA-up-s / PgltA-up-as
  • the downstream flank was amplified with the primer pair PgltA-down-s / PgltA-down-as.
  • the generated DNA fragments were checked for the expected base pair size using gel electrophoretic analysis on a 1% agarose gel.
  • the nucleotide sequences of the inner primers (PgltA-up-as / PgltA-down-s) were chosen so that the two amplified fragments up and down contain mutually complementary overhangs (including the described A / s / l / X /
  • the purified fragments accumulate via the complementary sequences and serve each other both as primers and as templates (overlap-extension PCR).
  • the A540 fragment generated in this way was amplified in a final PCR with the two outer primers (facing away from the gene) from the first PCR (PgltA-up-s / PgltA-down-as).
  • the deletion fragment was used in a triple molar excess. compared to the linearized vector backbone pK19mobsacB.
  • the entire batch volume was used for the transformation of chemically competent E. coli DH5a cells by means of heat shock at 42 ° C. for 90 seconds. Following the heat shock, the cells were regenerated on ice for 90 seconds before they were provided with 800 pL LB medium and regenerated at 37 ° C. in a thermomixer (Ependorf, Hamburg) at 900 RPM for 60 minutes.
  • the primer pair univ / rsp was used as the DNA primer for the colony PCR, which binds specifically to the pK19mobsacB vector backbone and, if the fragments used are correctly ligated, forms a PCR product of a specific size, which is checked by gel electrophoresis has been. Clones whose PCR product indicated a correct assembly of pK19mobsacB-D540 were grown overnight in LB medium with kanamycin (50 pg / mL) for the isolation of the plasmids.
  • the plasmids were then isolated with the NucleoSpin Plasmid (NoLid) -KA (Macherey-Nagel, Düren) and sequenced with the above-mentioned amplification and colony PCR primers.
  • the C7 variant of the dapA promoter was amplified with the primer pair PdapA-s / PdapA-as and checked for the expected base pair size by means of gel electrophoretic analysis on a 1% agarose gel.
  • the generated fragment was cleaned with the NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) according to the attached protocol.
  • both the generated PdapA fragment and the target vector pk19mobsacB-A540 were digested with the FastDigest variants (Thermo Fisher Scientific) of the restriction enzymes Xho ⁇ and Nsi ⁇ .
  • the restriction mixtures of the fragments mentioned were cleaned using the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren).
  • the PdapA fragment was used in a triple molar excess compared to the linearized vector backbone pk19mobsacB-A540.
  • the entire batch volume for the transformation of chemically competent E. coli DH5a cells was determined by heat shock at 42 ° C. for 90 seconds used. Following the heat shock, the cells were regenerated on ice for 90 seconds before they were provided with 800 ml of LB medium and regenerated at 37 ° C. in a thermal mixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes.
  • the primer pair univ / rsp was used as the DNA primer for the colony PCR. It binds specifically to the pK19mobsacB vector backbone and, if the fragments used are correctly ligated, forms a PCR product of a specific size, which was checked by gel electrophoresis. Clones whose PCR product indicated correct assembly of pk19mobsacB-PgltA :: PdapA-C7 were grown overnight in LB medium with kanamycin (50 pg / mL) for the isolation of the plasmids. The plasmids were then isolated with the NudeoSpin plasmid (NoLid) KW (Macherey-Nagel, Düren) and sequenced with the amplification and colony PCR primers mentioned.
  • the Levan sucrase encoded by sacB is formed in addition to the kanamycin resistance. This enzyme catalyzes the polymerization of sucrose into toxic levan, so that there is an induced lethality when sucrose grows (Bramucci & Nagarajan, 1996). Accordingly, colonies that have integrated the mutation plasmid into their genome via homologous recombination are resistant to kanamycin and sensitive to sucrose.
  • the corresponding genomic region was amplified by colony PCR (primer pair chk-PgltA-s / chk-PgltA-as) and checked for the expected fragment size using gel electrophoresis.
  • PCR products that indicate a promoter exchange were cleaned with the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) and used to verify the exchange with the primers chk-PgltA-s and chk-PgltA-as sequenced.
  • the promoter region PgltA :: PdapA-C7 according to the invention has, in addition to the exchange of the promoter region of gtIA for dapA, also nucleotide substitutions at positions 95 (a-> t) and 96 (g-> a) before the start codon ATG (FIG. 22).
  • PgltA-up-as TATG C AT GTTT CT C G AGT GG G CC G AAC AAAT AT GTTT GAAAG G
  • PgltA-down-s CCCACTCGAGAAACATGCATAGCGTTTTCAATAGTTCGGTGTC
  • PgltA-down-as CCCCCCGGGGGGCCTAGGGAAAGGATGATCTCGTAGCC
  • PdapA-s CCAATGCATTGGTTCTGCAGTTATCACACCCAAGAGCTAAAAAT
  • PdapA-as CCGCTCGAGCGGCTCCGGTCTTAGCTGTTAAACCT
  • chk-PgltA-as TCGAGTGGGTTCAGCTGGTCC
  • the primer pair mu-accXX-up-s / mu-accXX-up-as was used to generate the upstream fragment, the downstream flank was primed with the primer pair mu-accXX-down-s / mu-accXX-down-as amplified.
  • Coding XX stands for one of the two acc gene variants (accBC or accD1).
  • the nucleotide sequences of the inner primers (facing the gene to be deleted) fasB- (cg2743) -up-as / fasB- (cg2743) -down-s) were chosen so that the two amplified fragments up and down complement each other Overhangs are included, which are prerequisites for the subsequent Gibson assembly.
  • the planned mutations within the respective fasO binding site are introduced via these primers.
  • the generated DNA fragments were checked for the expected base pair size by gel electrophoretic analysis on a 1% agarose gel and then cleaned with the NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) according to the enclosed protocol .
  • the pK19-mobsacB empty vector was linearized with the FastDigestA / ariante (Thermo Fisher Scientific) of the restriction enzyme EcoRI.
  • the restriction mixture was cleaned using the NucleoSpin Gel and PCR Clean-up Kit (Mache rey-Nagel, Düren).
  • the amplified fragments were used in a three-fold molar excess compared to the linearized vector backbone pK19mobsacB.
  • the DNA fragments were provided with a prepared Gibson Assembly Master Mix, which contains an isothermal reaction buffer and the enzymes required for assembly (T5 exonuclease, phusion DNA polymerase and Taq DNA ligase).
  • the fragments are assembled at 50 ° C. for 60 minutes in a thermal cycler. After the fragments had been assembled, the entire batch volume was used for the transformation of chemically competent E. coli DH5a cells by means of heat shock at 42 ° C. for 90 seconds.
  • the cells were regenerated on ice for 90 seconds before they were provided with 800 ⁇ l LB medium and regenerated at 37 ° C. in a thermomixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes. Then 100 ⁇ l of the cell suspension were spread on LB agar plates with kanamycin (50 pg / ml) and incubated at 37 ° C. overnight. The correct assembly of the mutation plasmids in the grown transformants was checked by means of colony PCR. The 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this. The DNA template was the PCR approach by the Add cells to the grown colonies buried.
  • the cells are lysed by the initial denaturation step of the PCR protocol at 95 ° C. for 3 minutes, so that the DNA template was released and was accessible to the DNA polymerase.
  • the primer pair univ / rsp was used as the DNA primer for the colony PCR. It binds specifically to the pK19mobsacB vector backbone and, if the fragments used are correctly assembled, forms a PCR product of a specific size, which is checked by gel electrophoresis has been.
  • Clones whose PCR product indicates a correct assembly of the mutation plasmids pK19mobsacB-mufasO-accBC or pK19mobsacB-mufasO-accD1 were grown overnight in LB medium with kanamycin (50 pg / mL) for the isolation of the plasmids.
  • the plasmids were then isolated with the NucleoSpin Plasmid (NoLid) -K ⁇ t (Macherey-Nagel, Düren) and sequenced with the amplification and colony PCR primers mentioned.
  • the Levan sucrase encoded by sacB is formed in addition to the kanamycin resistance. This enzyme catalyzes the polymerization of sucrose into toxic levan, so that there is an induced lethality when sucrose grows (Bramucci & Nagarajan, 1996). Accordingly, colonies that have integrated the mutation plasmid into their genome via homologous recombination are resistant to kanamycin and sensitive to sucrose.
  • a total of 50 of the clones grown on the BHI 10% sucrose (w / v) plate were selected and streaked out to check the successful excision of pK19mobsacß on BHI-Kan 25 and BHI 10% sucrose (w / v) and overnight at 30 ° C incubated.
  • the plasmid should be removed completely this is shown by a sensitivity to kanamycin and a resistance to sucrose of the respective clone.
  • the second recombination event can also restore the wild-type situation.
  • the corresponding genomic region was amplified by colony PCR (primer pair chk_accXX_s / chk_accXX_as).
  • the PCR products were cleaned with the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) and sequenced with the primers chk_accXX_s / chk_accXX_as to verify the mutation.
  • nucleotide substitutions are thus present in the fasO binding site in front of accBC at positions 1 1 -13 (tga -> gtc) and 20-22 (cct -> aag).
  • the fasO binding site in front of accD1 there are nucleotide substitutions at positions 20-24 (cctca -> gtacg).
  • the fasO binding sites according to the invention have a nucleic acid sequence according to SEQ ID NO: 13 or 15 in front of the accBD or accD1 genes.
  • mu-accBC-up-s ATCCCCGGGTACCGAGCTCGAACCAGCGCGCGTTCGTG mu-accBC-up-as: TT ACG ACT ATT CTGG G G G AATT CTTCT GTTTT AGG C AG GA
  • mu-accBC-down-s AG AAGAATT CCCCC AGAAT AGT CGTAAGT AAGCAT AT CT G
  • mu-accBC-down-as TTGTAAAACGACGGCCAGTGGCCTTGGCGGTATCTGCG chk-accBC-s: GTTCGGCCACTCCGATGTCCGCCTG
  • chk-accBC-as GCCTTGATGGCGATTGGGAGACC
  • mu-accD1 -up-s ATCCCCGGGTACCGAGCTCGTCATTCAACGCATCCATGA
  • mu-accD1-up-as CTAATGGTCATGTTTTGAAATCGTAGCGGTAGGCGGGG mu-accD1-down-s: ACCGCTACGATTT CAAAACAT GACCATTAGT AGCCCTTT G
  • chk-accD1 -as GATCACGTCTGGGCCGGTAACGAAC Deletion of the gene fasB to switch off the functionality of the fatty acid protein FasB for integration into the genome of coryneform bacterial cells
  • flanking fragments required for the homologous recombination event were amplified by PCR starting from isolated genomic C. glutamicum DNA.
  • the primer pair fasB- (cg2743) -up-s / fasB- (cg2743) -up-as was used to generate the upstream fragment, the downstream flank was primed with the primer pair fasB- (cg2743) -down-s / fasB - (cg2743) -down-as amplified.
  • the nucleotide sequences of the inner primers (facing the gene to be deleted) fasB- (cg2743) - up-as / fasB- (cg2743) -down-s) were chosen so that the two amplified fragments up and down complementary overhangs included, which are prerequisites for the subsequent Gibson assembly.
  • the DNA fragments were checked for the expected base pair size using gel electrophoretic analysis on a 1% agarose gel and then cleaned using the NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) according to the enclosed protocol.
  • the pK19-mobsacB empty vector was linearized with the Fast Digest variant (Thermo Fisher Scientific) of the restriction enzyme EcoRI.
  • the restriction mixture was cleaned with the NucleoSpin Gel and PCR clean-up kit (Macherey-Nagel, Düren).
  • the amplified fragments were used in a three-fold molar excess compared to the linearized vector backbone pK19mobsacB.
  • the DNA fragments were provided with a prepared Gibson Assembly Master Mix, which contains an isothermal reaction buffer and the enzymes required for assembly (T5 exonuclease, phusion DNA polymerase and Taq DNA ligase).
  • the fragments are assembled at 50 ° C. for 60 minutes in a thermal cycler. After the fragments had been assembled, the entire batch volume was used for the transformation of chemically competent E. coli DH5a cells by means of heat shock at 42 ° C. for 90 seconds.
  • the cells were regenerated on ice for 90 seconds before they were provided with 800 ml of LB medium and regenerated at 37 ° C. in a thermomixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes. Subsequently, 100 ml of the cell suspension were spread on LB agar plates with kanamycin (50 pg / ml) and incubated at 37 ° C. overnight. The correct assembly of the Mutation plasmids in the grown transformants were checked by colony PCR. The 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this. The DNA template was added to the PCR approach by adding cells from the grown colonies.
  • the cells are lysed by the initial denaturation step of the PCR protocol at 95 ° C. for 3 minutes, so that the DNA template was released and was accessible to the DNA polymerase.
  • the primer pair univ / rsp was used as the DNA primer for the colony PCR, which binds specifically to the pK19mobsacB vector backbone and, if the fragments used are correctly assembled, forms a PCR product of a specific size, which was checked by gel electrophoresis.
  • Clones whose PCR product indicated a correct assembly of the deletion plasmid pK19mobsacB-AfasB were grown overnight in LB medium with kamanycin (50 pg / mL) for the isolation of the plasmids.
  • the plasmids were then isolated with the NucleoSpin plasmid (NoLid) -K ⁇ t (Macherey-Nagel, Düren) and sequenced with the amplification and colony PCR primers mentioned.
  • the levan-sucrase encoded by sacB is formed in addition to the kanamycin resistance.
  • This enzyme catalyzes the polymerization of sucrose into toxic levan, so that there is an induced lethality when sucrose grows (Bramucci & Nagarajan, 1996). Accordingly, colonies that have integrated the deletion plasmid into their genome via homologous recombination are resistant to kanamycin and sensitive to sucrose.
  • a total of 50 of the clones grown on the BHI 10% sucrose (w / v) plate were selected and used to check the successful excision of pK19 mobsacB on BHI-Kan 25 and BHI 10% sucrose (w / v) and incubated overnight at 30 ° C. If the plasmid has been completely removed, this is shown by a sensitivity to kanamycin and a resistance to sucrose of the respective clone.
  • the second recombination event (excision) can, in addition to the desired deletion, also lead to the restoration of the wild-type situation.
  • the successful deletion in the clones obtained after excision was checked via the expected fragment size upon deletion of the clones obtained by means of colony PCR.
  • the primers chk-fasB-s / chk-fasB-as used were chosen so that they bind in the chromosome outside the deleted DNA area and also outside the amplified flanking gene areas.
  • chk-fasB-s GG AGGAT ACAT CCACGGT CATT G
  • chk-fasB-as CGCTATGAGTT C AG GAT GTT GAT CG
  • Nucleotide substitution in the gene encodes a fatty acid synthesis with reduced functionality for integration into the genome of coryneform bacterial cells
  • glutamicum DelAro 4 -4d Pc cells were grown in 5 ml BHI medium (test tube, 30 ° C, 170 RPM) to an OD 6 oonm of 5 to ensure that the exponential growth phase was reached.
  • the whole cell mutagenesis was carried out by adding methylnitronitrosoguanidine (MNNG) dissolved in DMSO (final concentration 0.1 mg / mL) for 15 minutes at 30 ° C.
  • MNNG methylnitronitrosoguanidine
  • DMSO final concentration 0.1 mg / mL
  • the treated cells were washed twice with 45 ml NaCl, 0.9% (w / v), resuspended in 10 ml BHI medium and then regenerated for 3 hours at 30 ° C. and 170 RPM.
  • the mutated cells were stored as glycerol stocks at -30 ° C. in BHI medium with 40% (w / v) glycerol.
  • dilutions of the cell libraries were plated on BHI agar plates so that individual colonies could be picked.
  • Individual clones were picked at random and cultivated for the determination of malonyl-CoA provision according to the described LC-MS / MS protocol.
  • the genome of the clones for which an improved provision of malonyl-CoA could be measured was then sequenced.
  • selected mutations were integrated into the background of C. glutamicum DelAro 4 -4d Pc .
  • the malonyl-CoA provision was then measured again by means of LC-MS / MS in order to check whether the introduced mutations have the suspected positive influence on the malonyl-CoA provision.
  • the primer pair Sbfl_XXX_s / OL_XXX_as was used to generate the upstream fragment, the downstream flank was amplified with the primer pair OL_XXX_s / Xbal_XXX-as.
  • Coding XXX stands here for the amino acid substitution to be inserted at a specific position in the fatty acid synthase B.
  • the DNA fragments were checked for the expected base pair size using gel electrophoretic analysis on a 1% agarose gel.
  • the nucleotide sequences of the inner primers (facing the codon to be mutated) (OL_XXX_as / OL_XXX_s) were chosen so that the two amplified fragments up and down contain mutually complementary overhangs.
  • the purified fragments In a second PCR (without the addition of DNA primers), the purified fragments accumulate via the complementary sequences and serve both as a primer and as a template (overlap-extension PCR).
  • the mutation fragment generated in this way was amplified in a final PCR with the two outer primers (facing away from the gene) from the first PCR (Sbfl_XXX_s / Xbal_XXX-as). After electrophoretic separation on a 1% TAE agarose gel, the final mutation fragment was isolated from the gel using the NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) according to the attached protocol.
  • both the mutation fragments and the pK19-mobsacB empty vector were linearized with the FastDigest variants (Thermo Fisher Scientific) of the restriction enzymes Sbf ⁇ and Xba ⁇ .
  • the restriction approaches of the fragments mentioned were cleaned using the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren).
  • a mutation fragment was used in a three-fold molar excess compared to the linearized vector backbone pK19mobsacB.
  • the entire batch volume was used for the transformation of chemically competent E. coli DFI5a cells by means of flash shock at 42 ° C. for 90 seconds. Following the flash shock, the cells were regenerated on ice for 90 seconds before they were provided with 800 pL LB medium and regenerated at 37 ° C. in a thermomixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes. Subsequently, 100 pL of the cell suspension were spread on LB agar plates with kanamycin (50 pg / ml) and incubated at 37 ° C. overnight. The correct assembly of the mutation plasmids in the grown transformants was checked by means of colony PCR.
  • the 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this.
  • the DNA template was added to the PCR approach by adding cells from the grown colonies. The cells were lysed by the initial denaturation step of the PCR protocol at 95 ° C. for 3 minutes, so that the DNA template was released and was accessible to the DNA polymerase.
  • the primer pair univ / rsp was used as the DNA primer for the colony PCR. It binds specifically to the pK19mobsacB vector backbone and, if the fragments used are correctly ligated, forms a PCR product of a specific size, which was checked by gel electrophoresis.
  • Clones whose PCR product indicated that the respective mutation plasmid pK19mobsacB-fasB-XXX was correctly assembled were grown overnight in LB medium with kanamycin (50 pg / mL) for the isolation of the plasmids.
  • the plasmids were then isolated with the NucleoSpin Plasmid (NoLid) -K ⁇ t (Macherey-Nagel, Düren) and sequenced with the amplification and colony PCR primers mentioned.
  • the Levan sucrase encoded by sacB is formed in addition to the kanamycin resistance.
  • This enzyme catalyzes the polymerization of sucrose into toxic levan, so that there is an induced lethality when growing on sucrose (Bramucci & Nagarajan, 1996). Accordingly, colonies that have integrated the mutation plasmid into their genome via homologous recombination are resistant to kanamycin and sensitive to sucrose. The excision of pK19 / nobsacß took place in a second recombination event over the now double DNA regions, in which the codon to be mutated from the chromosome was ultimately exchanged for the introduced mutation fragment.
  • cells which showed the phenotype described were incubated in a test tube with 3 ml of BHI medium (without addition of kanamycin) for 3 hours at 30 ° C. and 170 RPM. Subsequently, 100 ⁇ l of a 1:10 dilution were spread on BHI-Kan 25 plates and BHI-10% sucrose (w / v) plates and incubated at 30 ° C. overnight.
  • the corresponding genomic region was amplified by colony PCR (primer pair Sbfl_XXX_s / Xbal_XXX-as).
  • the PCR products were cleaned with the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) and sequenced with the primers Sbfl_XXX_s, OL_XXX_as, OL_XXX_s and Xbal_XXX-as to verify the mutation.
  • OL_622-s GT ACCGCT GCGAT GGCAACCAAGAAAGCAACCACCT CCCAG
  • OL 622-as GACGGCCTGGGAGGTGGTTGCTTTCTTGGTTGCCATCGCA
  • Sbfl 622-s AAAACCTGCAGGGGCTGAGCTCGCTGGTGGCGGACAGGTTAC
  • Xbal 622-as GGGGTCT AG AACGT CCTT AT CAAT GACGGGCACAAAGTT CAC
  • OL 1361 -s C CT CAC C C AGTT CAC C C AG GTG G AC AT G G C AACT CTGGGCGTT
  • Xbal 1361-as GG AAT CT AG AT CG G CG G AAG C AG CCTT G AAAT C AG C C AAG AT CTC pK19mobsacB-fasB-G2153D
  • Sbfl 2153-s AAAACCTGCAGGTTGGCCACGTCAGGTTGCACCAAGCTTCGATG
  • Xbal 2153-as AAAATCTAGACCGAGCTCGCCGGCGCCAACGATGACGACCATC
  • OL_G2668S-s AGTCCGACTTCGTTGTCGCATCCGGCTTCGATGCCCTGTCC
  • OL_G2668S-as GGACAGGGCATCGAAGCCGGATGCGACAACGAAGTCGGACT Sbfl
  • G2668S-s AAAACCTGCAGGCACTGACCTGGCCGACT
  • proteins of the fatty acid synthase FasB from coryneform bacteria and / or nucleic acid sequences encoding a fatty acid synthase FasB from coryneform bacteria are encoded, in which nucleotide substitutions and corresponding amino acid exchanges are present.
  • Such variants are described, for example, in SEQ ID NO. 1 with a nucleotide substitution at position 1864 (g -> a), in SEQ ID NO. 3 with a nucleotide substitution at position 4082 (g -> a), in SEQ ID NO. 5 with a nucleotide substitution at position 6458 (g -> a), in SEQ ID NO. 7 with a nucleotide substitution at positions 8002-8004 (ggt-> tcc) and in SEQ ID NO. 9 with a deletion of positions 25-8943.
  • the target gene is then deleted as described (Niebisch & Bott, 2001; https://doi.org/10.1007/s002030100262).
  • the deletion fragment required for this is generated by means of cross-over-PCR (Link et al., 1997; https://doi.org/10.1128/jb.179.20.6228- 6237.1997).
  • bp flanking fragments are generated, which are located in the chromosome upstream and downstream of the gene to be deleted.
  • the nucleotide sequences of the inner primers (facing the gene to be deleted) are selected such that the two amplified fragments contain overhangs which are complementary to one another.
  • the purified fragments accumulate via the complementary sequences and serve each other both as a primer and as a template.
  • the deletion fragment generated in this way is amplified in a final PCR with the two outer primers (facing away from the gene) from the first PCR.
  • the final deletion fragment with the NucleoSpin ® Gel and PCR Clean-up Kit (Macherey-Nagel, Duren) is isolated according to the protocol attached thereto from the gel.
  • the deletion fragment is then ligated with the vector pK19 mobsacB over the inserted and hydrolyzed restriction sites. Chemically competent E.
  • coli DH5 cells are then transformed with the entire ligation approach.
  • the grown transformants are checked for the correct ligation product by colony PCR; positive deletion plasmids are isolated and sequenced.
  • the DNA sequence to be inserted is cloned between the flanking regions of the target locus. The following steps are identical for both deletions and insertions. For the sake of simplicity, we only speak of deletion plasmids.
  • the Levan sucrase encoded by sacB is formed in addition to the kanamycin resistance.
  • This enzyme catalyzes the polymerization of sacchar rose to the toxic levan, so that there is an induced lethality when growing on sucrose (Bramucci & Nagarajan, 1996 ;, PMID 8899981). Accordingly, colonies that have integrated the deletion plasmid into their genome via homologous recombination are resistant to kanamycin and sensitive to sucrose.
  • a total of 50 of the clones grown on the BHI 10% sucrose (w / v) plate are selected and streaked out to check the successful excision of pK19 mobsacB on BHI-Kan 25 and BHI 10% sucrose (w / v) and overnight at 30 ° C incubated. If the plasmid has been completely removed, this is shown by a sensitivity to kanamycin and a resistance to sucrose of the respective clone.
  • the second recombination event (excision) can, in addition to the desired gene deletion, also lead to the restoration of the wild-type situation.
  • the successful deletion in the clones obtained after excision is checked via the expected fragment size upon deletion of the gene or gene cluster by means of colony PCR of the clones obtained.
  • the primers used are chosen so that they bind in the chromosome outside the deleted DNA area and also outside the amplified flanking gene areas.
  • strains are constructed starting from the strain C. glutamicum ATCC 13032, which in the coding region of the homologous fatty acid synthase gene fasB nucleotide substitutions (Cg130232-fasB-E622K, Cg130232-fasB-G1361 D, Cg 130232-fasB-G2153E, Cg130232-fasB-G2668S) or deleted areas (Cg 13032-AfasB), changes in the homologous fasO binding site in front of the gene cluster accBCDI (Cg130232-mufasO), and a homologous promoter region with reduced activity in front of the gene coding for the citrate synthase gtIA (Cg 13032-C7).
  • These strains are characterized by the fact that they are non-recombinantly modified and are thus characterized as non-GMOs.
  • the C. glutamicum MB001 (DE3) strain is chosen as the starting strain for the construction of C. glutamicum DelAro -4cl PcCg .
  • This is a prophage-free C. glutamicum ATCC13032 wild-type strain (strain C. glutamicum MB001; Baumgart et al, 2013b, https://doi.org/10.1 128 / AEM.01634-13), which is described below has a chromosomally integrated T7 polymerase, which allows the use of the strong and inducible T7 promoter (strain C.
  • glutamicum MB001 (DE3); (Kortmann et al., 2015; https://doi.org/10.1111/1751- 7915.12236) This promoter is also located on the pMK-Ex2 plasmids which are used for the expression of genes of plant origin involved in the synthesis of the respective product.
  • strain C. glutamicum DelAro 3 is constructed by deleting the gene (clusters) cg0344-47, cg2625-40 and cg1226 (Kallscheuer et al., 2016, https: // doi .Org / 10.1016 / j.ymben.2016.06.003).
  • Cg0344-47 is the phdBCDE operon, which codes for genes that are involved in the catabolism of phenylpropanoids, such as. B. p-cumaric acid is involved.
  • Dehydroshikimate Dehydratase QsuB catalyzes the thermodynamically irreversible conversion of the shikimate-path intermediate 3-dehydroshikimate to protocatechuate and thus leads to an undesired loss of intermediates in the synthetic route of aromatic amino acids.
  • the deletion of qsuB reduced the accumulation of protocatechuate.
  • the gene cg0502 (qsuB) is additionally deleted in the constructed strain C. glutamicum DelAro 3 , resulting in the strain C. glutamicum DelAro 4 .
  • the primer pair cgXXXX-XX-up-s / cgXXXX-XX-up-as was used to generate the upstream fragment, the downstream flank was used with the primer pair cgXXXX-XX-down-s / cgXXXX-XX-down-as amplified.
  • the coding XXXX-XX stands for the cg numbers of the genes to be deleted.
  • the primer pair cg0344-47-up-s / cg0344- 47-up-as is used for the deletion of the gene clusters cg0344-47 and analogously for the deletion of the gene clusters cg2625-40 the primer pair cg2625-40-up-s / cg2625 -40-up-as.
  • the generated DNA fragments were checked for the expected base pair size using gel electrophoretic analysis on a 1% agarose gel.
  • nucleotide sequences of the inner primers (facing the gene to be deleted) (cgXXXX-XX-up-as / cgXXXX-XX-down-s) were chosen so that the two amplified fragments up and down complementary to each other slopes included.
  • cg0344-47 this is the primer pair cg0344-47-up-as / cg0344-47-down-s and analogously for the gene cluster cg2625-40 the primer pair cg2625-40-up-as / cg2625-40-down-s .
  • the purified fragments In a second PCR (without the addition of DNA primers), the purified fragments accumulate via the complementary sequences and serve both as primers and as templates (overlap-extension PCR).
  • the deletion fragment generated in this way was amplified in a final PCR with the two outer primers (facing away from the gene) from the first PCR (cgXXXX-XX-up-s / cgXXXX-XX-down-as).
  • the gene cluster cg0344-47 this is the primer pair cg0344-47-up-s / cg0344-47-down-as and analogously for the gene cluster cg2625-40 the primer pair cg2625-40-up-s / cg2625-40-down-as .
  • the final deletion fragment was isolated from the gel using the NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) according to the attached protocol.
  • both the deletion fragments and the pK19-mobsacB empty vector were linearized with the FastDigest - ⁇ / a variants (Thermo Fisher Scientific) of the restriction enzymes Xba ⁇ and EcoRI.
  • the restriction mixtures of the fragments mentioned were cleaned using the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren).
  • a Rapid DNA Ligation Kit Thermo Fisher Scientific
  • one of the two deletion fragments was used in a three-fold molar excess compared to the linearized vector backbone pK19mobsacB.
  • the entire batch volume was used for the transformation of chemically competent E. coli DH5a cells by means of heat shock at 42 ° C. for 90 seconds. Following the heat shock, the cells were regenerated on ice for 90 seconds before they were provided with 800 pL LB medium and regenerated at 37 ° C. in a thermomixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes. Subsequently, 100 pL of the cell suspension were spread on LB agar plates with kanamycin (50 pg / ml) and incubated at 37 ° C. overnight. The correct assembly of the deletion plasmids in the grown transformants was checked by means of colony PCR.
  • the 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this.
  • the DNA template was added to the PCR approach by adding cells from the grown colonies. The cells were lysed by the initial denaturation step of the PCR protocol at 95 ° C. for 3 minutes, so that the DNA template was released and was accessible to the DNA polymerase.
  • the primer pair univ / rsp was used as the DNA primer for the colony PCR, which binds specifically to the pK19mobsacB vector backbone and, in the event of a correct ligation of the fragments used, forms a PCR product of a specific size, which was checked by gel electrophoresis.
  • NoLid NucleoSpin Plasmid
  • the Levan sucrase encoded by sacB is formed in addition to the kanamycin resistance.
  • This enzyme catalyzes the polymerization of saccharose into toxic levan, so that there is an induced lethality when sucrose grows (Bramucci & Nagarajan, 1996). Accordingly, colonies that have integrated the deletion plasmid into their genome via homologous recombination are resistant to kanamycin and sensitive to sucrose.
  • a total of 50 clones grown on the BHI 10% sucrose (w / v) plate were selected and% sucrose (w / v) streaked and incubated overnight at 30 ° C. If the plasmid has been completely removed, this is shown by a sensitivity to kanamycin and a resistance to saccha rose of the respective clone.
  • the second recombination event (excision) can, in addition to the desired gene deletion, also lead to the restoration of the wild-type situation.
  • the successful deletion in the clones obtained after excision was checked via the expected fragment size upon deletion of the gene or gene cluster by means of colony PCR of the clones obtained.
  • the primers del-cgXXXX-XX-s / del-cgXXXX-as were used so that they bind in the chromosome outside of the deleted DNA area and also outside of the amplified flanking gene areas.
  • this is the primer pair del-cg0344-47-s / del-cg0344-47-as and analogously for the gene cluster cg2625-40 the primer pair del-cg2625-40-s / del-cg2625-40-as.
  • CTCTCT AG AG CG GT G G CG AT GAT G ATCTTC GAG
  • cg0344-47-up-as AAGCATATGAGCCAAGTACTATCAACGCGTCAGGGCGACT
  • cg2625-40-down-s TTGAGCACGCGTTGCATATGT G AACT CGAGACGGTC
  • both the amplified 4cl Pc gene and the plasmid pK19mobsacB-cg0344-47 ⁇ del were linearized with the FastDigest variants (Thermo Fisher Scientific) of the restriction enzymes Mlu ⁇ and Nde I.
  • the restriction mixtures of the fragments mentioned were cleaned using the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren).
  • the 4c / Pc fragment in a triple molar excess was shot against the linearized vector backbone pK19mobsacB-cg0344-47-del.
  • the entire batch volume was used for the transformation of chemically competent E. coli DH5a cells by means of heat shock at 42 ° C. for 90 seconds. Following the heat shock, the cells were regenerated on ice for 90 seconds before they were provided with 800 ⁇ l LB medium and regenerated at 37 ° C. in a thermomixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes.
  • the primer pair univ / rsp was used as the DNA primer for the colony PCR, which binds specifically to the pK19mobsacB vector backbone and, in the event of a correct ligation of the fragments used, forms a PCR product of a specific size, which was checked by gel electrophoresis.
  • Clones whose PCR product indicated a correct assembly of the insertion plasmid pK19mobsacB-Acg0344-47 :: P T7 -4d Pc were grown overnight in LB medium with kanamycin (50 pg / mL) for the isolation of the plasmids.
  • the plasmids were then isolated using the NucleoSpin Plasmid (NoLid) kit (Macherey-Nagel, Düren) and sequenced using the amplification and colony PCR primers mentioned.
  • the levan sucrase encoded by sacB is formed in addition to the kanamycin resistance.
  • This enzyme catalyzes the polymerization of sucrose into toxic levan, so that there is an induced lethality when sucrose grows (Bramucci & Nagarajan, 1996). Accordingly, are colonies that Insertion plasmid integrated into their genome via homologous recombination, resistant to kanamycin and sensitive to sucrose.
  • a total of 50 of the clones grown on the BHI 10% sucrose (w / v) plate were selected and streaked to check the successful excision of pK19 mobsacB on BHI-Kan 25 and BHI 10% sucrose (w / v) and overnight at 30 ° C incubated. If the plasmid has been completely removed, this is shown by a sensitivity to kanamycin and a resistance to sucrose of the respective clone.
  • the second recombination event (excision) can, in addition to the desired P T7 -4c / Pc insertion, also lead to the restoration of the wild-type situation.
  • the successful insertion in the clones obtained after excision was checked via the expected fragment size when the gene or gene cluster was inserted by means of colony PCR of the clones obtained.
  • the primers del-cg0344-47-s / del-cg0344-47-as were used in such a way that they bind in the chromosome outside the insertion locus and also outside the amplified flanking gene regions.
  • PCR fragments which indicate an insertion of the PT7-4C / PC construct were purified using the Nucleo-Spin Gel and PCR clean-up kit (Macherey-Nagel, Düren) and, to check the insertion, using the primers del-cg0344- 47-s, cg0344-47-up-s, Mlul-PT7-4CLPcCg-s, Ndel- 4CLPcCg-as, cg0344-47-down-as and del-cg0344-47-as sequenced.
  • Mlul-PT7-4CLPcCg-s TC CT AC G CGTT AAT ACG ACT C ACT AT AGGG AG AT C AAG
  • Ndel-4CLPcCg-as GGACGTT CAT ATGTTACTTT GGCAGAT CACCGG ATGCG
  • ATC del-cg0344-47-s AG AGATT CACCCT CGGCGAT GAG cg0344-47-up-s: CTCTCTAGAGCGGTGGCGATGATGATCTTCGAG cg 0344-47-down-as: GACGAATT CGT GT GGCCACCACCT CAAT CT GT G del-cg0344-47-as: GACCCGCAATGGTGTCGCCAG
  • flanking fragments required for the homologous recombination event were amplified by PCR starting from isolated genomic C. glutami cum DNA.
  • the primer pair cg0502-up-s / cg0502-up-as was used to generate the upstream fragment, the downstream flank was amplified with the primer pair cg0502-down-s / cg0502-down-as.
  • the DNA fragments generated were checked for the expected base pair size by means of gel electrophoretic analysis on a 1% agarose gel.
  • the nucleotide sequences of the inner primers (facing the gene to be deleted) (cg0502-up-as / cg0502-down-s) were chosen so that the two amplified fragments up and down contain complementary overhangs.
  • the purified fragments In a second PCR (without the addition of DNA primers), the purified fragments accumulate via the complementary sequences and serve both as primers and as templates (overlap-extension PCR).
  • the deletion fragment generated in this way was amplified in a final PCR with the two outer primers (facing away from the gene) from the first PCR (cg0502-up-s / cg0502-down-as). After electrophoretic separation on a 1% TAE agarose gel, the final deletion fragment was isolated from the gel using the NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) according to the enclosed protocol.
  • both the deletion fragment and the pK19-mobsacB empty vector were linearized with the Fast Digest variants (Thermo Fisher Scientific) of the restriction enzymes Hind ⁇ and ßamHI.
  • the restriction mixtures of the fragments mentioned were cleaned with the NucleoSpin Gel and PCR Clean-up-K ⁇ t (Macherey-Nagel, Düren).
  • the deletion fragment was used in a three-fold molar excess compared to the linearized vector backbone pK19mobsacB.
  • the entire batch volume was used for the transformation of chemically competent E. coli DH5a cells by means of heat shock at 42 ° C. for 90 seconds. Following the heat shock, the cells were regenerated on ice for 90 seconds before they were provided with 800 pL LB medium and regenerated at 37 ° C. in a thermomixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes. Subsequently, 100 pL of the cell suspension were spread on LB agar plates with kanamycin (50 pg / ml) and incubated at 37 ° C. overnight. The correct assembly of the deletion plasmids in the grown transformants was checked by colony PCR.
  • the 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this.
  • the DNA template was added to the PCR approach by adding cells from the grown colonies. The cells are lysed by the initial denaturation step of the PCR protocol at 95 ° C. for 3 minutes, so that the DNA template was released and was accessible to the DNA polymerase.
  • the primer pair univ / rsp was used as the DNA primer for the colony PCR, which binds specifically to the pK19mobsacB vector backbone and, in the event of correct ligation of the fragments used, forms a PCR product of a specific size, which was checked by gel electrophoresis.
  • Clones whose PCR product indicated a correct assembly of the deletion plasmid pK19mobsacB-cg0502-del were grown overnight in LB medium with kanamycin (50 pg / mL) for the isolation of the plasmids.
  • the plasmids were then cut with the NucleoSpin Plasmid (NoLid) -KW. (Macherey-Nagel, Düren) isolated and sequenced with the aforementioned amplification and colony PCR primers.
  • the levan sucrase encoded by sacB is formed in addition to the kanamycin resistance.
  • This enzyme catalyzes the polymerization of sucrose into toxic levan, so that there is an induced lethality when growing on sucrose (Bramucci & Nagarajan, 1996). Accordingly, colonies that have integrated the deletion plasmid into their genome via homologous recombination are resistant to kanamycin and sensitive to sucrose.
  • a total of 50 of the clones grown on the BHI 10% sucrose (w / v) plate were selected and streaked to check the successful excision of pK19 mobsacB on BHI-Kan 25 and BHI 10% sucrose (w / v) and overnight at 30 ° C incubated. If the plasmid has been completely removed, this is shown by a sensitivity to kanamycin and a resistance to sucrose of the respective clone.
  • the second recombination event (excision) can, in addition to the desired gene deletion, also lead to the restoration of the wild-type situation.
  • the successful deletion in the clones obtained after excision was checked via the expected fragment size upon deletion of the gene or gene cluster by means of colony PCR of the clones obtained.
  • the primers del-cg0502-s / del-cg0502-as used were chosen so that they bind in the chromosome outside the deleted DNA area and also outside the amplified flanking gene areas.
  • del-cg0502-s GT GAACATT GT GTTT ACT GT GTGGGCACT GT C del-cg0502-as: T GAT GTT CAGGCCGTT GAAGCCAAGGT AGAG univ: CGCCAGGGTTTTCCCAGTCACGAC rsp: CACAGGAAACAGCTAT GACCAT G
  • flanking fragments required for the homologous recombination event were amplified by PCR on the basis of isolated genomic C. glutami cum DNA.
  • the primer pair cg1226-up-s / cg1226-up-as was used to generate the upstream fragment, the downstream flank was matched with the Primer pair cg1226-down-s / cg1226-down-as amplified.
  • the DNA fragments generated were checked for the expected base pair size by means of gel electrophoretic analysis on a 1% agarose gel.
  • the nucleotide sequences of the inner primers (facing the gene to be deleted) (cg1226-up-as / cg1226-down-s) were chosen such that the two amplified fragments up and down contain complementary overhangs.
  • the purified fragments In a second PCR (without the addition of DNA primers), the purified fragments accumulate via the complementary sequences and serve both as primers and as templates (overlap-extension PCR).
  • the deletion fragment thus generated was amplified in a final PCR with the two outer primers (facing away from the gene) from the first PCR (cg1226-up-s / cg1226-down-as). After electrophoretic separation on a 1% TAE agarose gel, the final deletion fragment was isolated from the gel using the NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) according to the enclosed protocol.
  • both the deletion fragment and the pK19-mobsacB empty vector were linearized with the Fast Digest variants (Thermo Fisher Scientific) of the restriction enzymes Hind ⁇ and SamHI.
  • the restriction mixtures of the fragments mentioned were cleaned with the NucleoSpin Gel and PCR Clean-up-Kti (Macherey-Nagel, Düren).
  • the deletion fragment was used in a three-fold molar excess compared to the linearized vector backbone pK19mobsacB.
  • the entire batch volume was used for the transformation of chemically competent E. coli DH5a cells by means of heat shock at 42 ° C. for 90 seconds. Following the heat shock, the cells were regenerated on ice for 90 seconds before they were provided with 800 pL LB medium and regenerated at 37 ° C. in a thermomixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes. Subsequently, 100 pL of the cell suspension were spread on LB agar plates with kanamycin (50 pg / ml) and incubated at 37 ° C. overnight. The correct assembly of the deletion plasmids in the grown transformants was checked by colony PCR.
  • the 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this.
  • the DNA template was added to the PCR approach by adding cells from the grown colonies. The cells were lysed by the initial denaturation step of the PCR protocol at 95 ° C. for 3 minutes, so that the DNA template was released and was accessible to the DNA polymerase.
  • the primer pair univ / rsp was used as the DNA primer for the colony PCR, which binds specifically to the pK19mobsacB vector backbone and, in the case of correct ligation of the fragments used, forms a PCR product of a specific size, which was checked by gel electrophoresis.
  • the Levan-Sucrase encoded by sacB is formed. This enzyme catalyzes the polymerization of sucrose into toxic levan, so that there is an induced lethality when growing on sucrose (Bramucci & Nagarajan, 1996). Accordingly, colonies that have integrated the deletion plasmid into their genome via homologous recombination are resistant to kanamycin and sensitive to sucrose.
  • a total of 50 of the clones grown on the BHI 10% sucrose (w / v) plate were selected and streaked to check the successful excision of pK19 mobsacB on BHI-Kan 25 and BHI 10% sucrose (w / v) and overnight at 30 ° C incubated. If the plasmid has been completely removed, this is shown by a sensitivity to kanamycin and a resistance to sucrose of the respective clone.
  • the second recombination event (excision) can also lead to the restoration of the wild-type situation.
  • the successful deletion in the clones obtained after excision was checked via the expected fragment size upon deletion of the gene or gene cluster by means of colony PCR of the clones obtained.
  • the primers del-cg1226-s / del-cg1226-as used were selected so that they bind in the chromosome outside the deleted DNA area and also outside the amplified flanking gene areas.
  • CTACCACGCTTCGAGGTATAAACGCTC down-cg1226-as: AGT GAATT CCAAGGAAGGCGGTTGCTACTGC del-cg01226-s: T AAAT G GTG G AG AT AC C AAACT GT G AAG C del-cg1226-as: CG AGTT CTT CTTCGTGGTTACTCCGCCCTCGCACCG AG G AAAC AG CTAT G AC CAT G
  • glutamicum is chemically synthesized by GeneArt Gene Synthesis (Thermo Fisher Scientific) as a string DNA fragment and used as a DNA template for the amplification of tal FJCg with the primer pair talFj-s / talFj-as .
  • the generated DNA fragments are checked for the expected base pair size using gel electrophoretic analysis on a 1% agarose gel.
  • the plasmid pEKEx3 is linearized with the FastDigest variants (Thermo Fisher Scientific) of the restriction enzymes BamH ⁇ and EcoRI.
  • the genes aroH Ec or tal FjCg amplified with the given primer pairs are hydrolyzed with the restriction enzymes ⁇ a / nHI and Sapl or Sapl and EcoRI.
  • the restriction mixtures of the fragments mentioned are cleaned using the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren).
  • the two inserts aroH Ec and tal FjCg are used in a three-fold molar excess compared to the linearized vector backbone pEKEx3. After the fragments have been ligated, the entire batch volume is used for the transformation of chemically competent E.
  • coli DH5a cells by means of heat shock at 42 ° C. for 90 seconds. Following the heat shock, the cells are regenerated on ice for 90 seconds before they are provided with 800 pL LB medium and regenerated at 37 ° C in a thermomixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes. Subsequently, 100 pL of the cell suspension were spread on LB agar plates with spectonomycin (100 pg / ml) and incubated at 37 ° C. overnight. The correct assembly of the fragments used in the grown transformants is checked by colony PCR. The 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) is used for this.
  • the DNA template was the PCR approach buried here by adding cells of the grown colonies.
  • the cells are lysed by the initial denaturation step of the PCR protocol at 95 ° C. for 3 minutes, so that the DNA template is released and is accessible to the DNA polymerase.
  • the primer pair chk_pEKEx3_s / chk_pEKEx3_as is used as the DNA primer for the colony PCR. It binds specifically to the pEKEx3 vector backbone and, if the fragments used are correctly ligated, forms a PCR product of a specific size, which is checked by gel electrophoresis.
  • aroHEc-s CT CGGATCCAAGGAGGT CATAT CAT GAACAGAACGACGAA
  • aroHEc-as TACGCTCTTCTGATTTAGAAGCGGGTATCTACCGCAGAGGCGAG talFj-s: TTCGCT CTT CAAT CT GGCAAGG AGGG AT CCGTAT G AACACCAT CA
  • talFj-as AT CG AATT CTTAGTTGTTG AT C AG GTG ATC CTT C ACCTT CTG C
  • AC chk_pEKEx3_s GC AAAT ATT CT G AAAT G AG CTGTT G AC AATT AAT CAT C
  • chk_pEKEx3_as C GTTCT G ATTT AAT CTGTAT C AG G CT G AAAAT CTTCTC
  • heterologous genes for the synthesis of polyphenols or polyketides in coryne-shaped bacterial cells
  • the genes sts Ah and 4cl Pc were amplified by PCR with the primer pair stsAh-s / stsAh-as and 4clPc-s / 4clPc-as, which is specific for the respective gene.
  • the generated DNA fragments were checked for the expected base pair size using gel electrophoretic analysis on a 1% agarose gel.
  • the plasmid pMKEx2 _sts Ah _4cl Pc was linearized with the FastDigestA / variants (Thermo Fisher Scientific) of the restriction enzymes Nco ⁇ and ßamHI.
  • the sts Ah and 4cl Pc genes amplified with the given primer pairs were hydrolyzed with the restriction enzymes L / col and Kpn ⁇ or Kpn ⁇ and ßamHI.
  • the restriction approaches of the fragments mentioned were cleoSpin Gel and PCR Clean-up-Kit (Macherey-Nagel, Düren) cleaned.
  • the two inserts sts Ah and 4cl Pc were used in a three-fold molar excess compared to the linearized vector backbone pMKEx2. After ligation of the fragments, the entire batch volume was used for the transformation of chemically competent E.
  • coli DH5a cells by means of heat shock at 42 ° C. for 90 seconds. Following the heat shock, the cells were regenerated on ice for 90 seconds before they were provided with 800 pL LB medium and regenerated at 37 ° C. in a thermomixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes. Subsequently, 100 pL of the cell suspension were spread on LB agar plates with kanamycin (50 pg / ml) and incubated at 37 ° C. overnight. The correct assembly of the fragments used in the grown transformants was checked by colony PCR. The 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this.
  • the DNA template was added to the PCR approach by adding cells from the grown colonies.
  • the cells were lysed by the initial denaturation step of the PCR protocol at 95 ° C. for 3 minutes, so that the DNA template was released and was accessible to the DNA polymerase.
  • the primer pair chk_pMKEx2_s / chk_pMKEx2_as was used as the DNA primer for the colony PCR. rese was checked. Clones whose PCR product indicated correct assembly of the plasmid pMKEx2 _sts Ah _4cl Pc were grown overnight in LB medium with kanamycin (50 gg / mL) for the isolation of the plasmids. The plasmids were then isolated with the NucleoSpin Plasmid (NoLid) -K ⁇ t (Macherey-Nagel, Düren) and sequenced with the amplification and colony PCR primers mentioned.
  • 4clPc-s AGCGGTACCT AAG GAG GT GG AC AAT G G G CG ATT G C GT GG C AC
  • 4clPc-as CT GGGATCCAGGACTAGTTT CCAGAGT ACT ATT ACTTT GGCA
  • GATCACCGGATGCGATC chk_pMKEx2-s CCCTCAAGACCCGTTTAGAGGC chk_pMKEx2-as: TTAAT ACGACT CACT AT AGGGG AATT GT G AGC
  • the generated DNA fragments were checked for the expected base pair size by means of gel electrophoretic analysis on a 1% agarose gel.
  • the plasmid pMKEX2-chs Ph -chi Ph the plasmid pMKEx2 was linearized with the FastDigest variants (Thermo Fisher Scientific) of the restriction enzymes Xba ⁇ and Bam-Hl.
  • the genes chs Ph and chi Ph amplified with the given primer pairs were hydrolyzed with the restriction enzymes Xba ⁇ and L / col or Nco ⁇ and ßamHI.
  • the restriction mixtures of the fragments mentioned were cleaned using the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren).
  • the two inserts chs Ph and chi Ph were used in a three-fold molar excess compared to the linearized vector backbone pMKEx2.
  • the entire batch volume was used for the transformation of chemically competent E. coli DH5a cells by means of heat shock at 42 ° C. for 90 seconds.
  • the cells were regenerated on ice for 90 seconds before they were provided with 800 pL LB medium and regenerated at 37 ° C. in a thermomixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes. Subsequently, 100 pL of the cell suspension were spread on LB agar plates with kanamycin (50 pg / ml) and incubated at 37 ° C. overnight. The correct assembly of the fragments used in the grown transformants was checked by colony PCR. The 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this. The DNA template was added to the PCR approach by adding cells from the grown colonies.
  • the cells are lysed by the initial denaturation step of the PCR protocol at 95 ° C. for 3 minutes, so that the DNA template was released and was accessible to the DNA polymerase.
  • the primer pair chk_pMKEx2_s / chk_pMKEx2_as was used as DNA primer for the colony PCR, which binds specifically to the pMKEx2 vector backbone and, if the fragments used are correctly ligated, is included PCR product of specific size, which was checked by gel electrophoresis.
  • Clones whose PCR product indicated a correct assembly of the plasmid pMKEx2_ chs Ph and chip h were grown overnight in LB medium with kanamycin (50 pg / mL) for the isolation of the plasmids.
  • the plasmids were then isolated with the NucleoSpin Plasmid (NoLid) -K ⁇ t (Macherey-Nagel, Düren) and sequenced with the amplification and colony PCR primers mentioned.
  • CGCAAG chsPh-as CTCCCATGGTTAGGTTGCCACGGAGTGCAGCAC chiPh-s: CT CCCATGGTGCT AAAGGAGGT CGAAGAT GTCCCCACCAGT G
  • TCCGTGACCAAG chiPh-as CT GGGAT CCTTACACGCCGAT CACT GGGATGGT G chk_pMKEx2-s: CCCTCAAGACCCGTTTAGAGGC chk_pMKEx2-as: TT AAT ACG ACT CACT AT AGGGG AATT GT G AGC
  • the pcs Aa gene was amplified by PCR with the primer pair Gibson-PCS-s / Gibson-PCS-as or Gibson-PCS-short-s / Gibson-PCS-as in order to determine the native and the shortened pcs Aa - Generate sequence.
  • the DNA fragments were checked for the expected base pair size using gel electrophoretic analysis on a 1% agarose gel and then cleaned using the NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) according to the enclosed protocol.
  • the plasmid pMKEx2 -sts Ah -4d Pc with the FastDigestA / ariante (Thermo Fisher Scientific) was used Restriction enzymes Nco ⁇ and Seal linearized. The restriction mixture was separated on a 1% agarose gel.
  • the expected fragment of the vector backbone was cleaned from the gel using the Nucleo Spin Gel and PCR clean-up kit (Macherey-Nagel, Düren).
  • Gibson assembly Gibson assembly (Gibson et al., 2009a)
  • one amplified fragment cs Aa or pcs Aa - short
  • the DNA fragments were provided with a prepared Gibson Assembly Master Mix, which contains an isothermal reaction buffer and the enzymes required for assembly (T5 exonuclease, phusion DNA polymerase and Taq DNA ligase).
  • the fragments are assembled at 50 ° C.
  • the entire batch volume was used for the transformation of chemically competent E. coli DH5oc cells by means of heat shock at 42 ° C. for 90 seconds. Following the heat shock, the cells were regenerated on ice for 90 seconds before they were provided with 800 ml of LB medium and regenerated at 37 ° C. in a thermomixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes. Subsequently, 100 ml of the cell suspension were spread on LB agar plates with kanamycin (50 pg / ml) and incubated at 37 ° C. overnight.
  • kanamycin 50 pg / ml
  • the correct assembly of the expression plasmids in the grown transformants was checked by colony PCR.
  • the 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this.
  • the DNA template was added to the PCR approach by adding cells from the grown colonies. The cells are lysed by the initial denaturation step of the PCR protocol at 95 ° C. for 3 minutes, so that the DNA template was released and was accessible to the DNA polymerase.
  • the primer pair chk_pMKEx2_s / chk_pMKEx2_as was used as the DNA primer for the colony PCR, which binds specifically to the pMKEx2 vector backbone and, if the fragments used are correctly assembled, forms a PCR product of a specific size, which was checked by gel electrophoresis.
  • Clones whose PCR product indicated a correct assembly of the expression plasmids construction rMKEc2-ro5 L3 and pMKEx2-pcs Aa - short were grown overnight in LB medium with kanamycin (50 pg / mL) for the isolation of the plasmids. The plasmids were then isolated using the NucleoSpin Plasmid (NoLid) KW (Macherey-Nagel, Düren) and sequenced using the amplification and colony PCR primers mentioned.
  • chk_pMKEx2-s CCCTCAAGACCCGTTTAGAGGC
  • chk_pMKEx2-as TT AAT ACG ACT CACT AT AGGGG AATT GT G
  • the strains are first incubated for 6-8 hours in 5 ml BHI medium (Brain heart infusion, Difco Laboratories, Detroit, USA) in test tubes at 170 RPM (first preculture) and then used for 50 Inoculate ml of CGXII medium in a 500 ml baffle flask (with two opposite baffles). This second preculture is incubated at 30 ° C and 130 RPM overnight.
  • BHI medium Brain heart infusion, Difco Laboratories, Detroit, USA
  • the CGXII main culture (50 ml in a 500 ml baffle flask) is grown with the overgrown second preculture to an OD 600 nm of 1.0 (malonyl-CoA measurement) or 5.0 (production of naringenin, resveratrol or noreugenin ) inoculated.
  • 1.0 malonyl-CoA measurement
  • 5.0 production of naringenin, resveratrol or noreugenin
  • 5 mM p-cumaric acid (previously dissolved in 80 ml DMSO) is optionally supplemented.
  • heterologous genes which are either chromosomally integrated or introduced plasmid-based, is increased by adding 1 mM isopropyl- ⁇ -D- thiogalactopyranoside (IPTG) induced 90 minutes after inoculum. At the times indicated, 1 ml of culture is removed and stored at -20 ° C until use.
  • IPTG isopropyl- ⁇ -D- thiogalactopyranoside
  • 1 ml of culture is removed and stored at -20 ° C until use.
  • the product determination (malonyl-CoA or polyphenols or polyketides) is carried out as described below.
  • resveratrol, or naringenin or noreugenin from the cultivation solution can optionally be further processed, ie separated, purified and / or concentrated.
  • the determination of the biomass during cultivation for the measurement of malonyl-CoA provision or the production of polyphenols or polyketides is carried out by measuring the optical density at a wavelength of 600 nm (OD 6 oonm) with the Ultrospec 3300 per UVA / isible spectrophotometer (Amersham Biosciences, Freiburg). For this purpose, 100 pL sample volume of the respective cultivation are removed and so comparable thinned that the measured OD 60 o n m in the linear measuring range of the photometer of 0, was from 2 to 0.6. By adjusting for the dilution factor, the actual OD 60 o n m of the culture is calculated. If a stronger dilution factor of> 1:10 (e.g. 1: 100) is pipetted, this is carried out sequentially (example: for a 1: 100 dilution, 1:10 was diluted twice).
  • a stronger dilution factor of> 1:10 e.g. 1: 100
  • the sample preparation for the quantification of the intracellular malonyl-CoA level was carried out as previously described (Kallscheuer et al., 2016). 5 mL of the culture is quenched in 15 ml ice-cold 60% MeOH in H 2 0 in a triplicate and then centrifuged. The malonyl-CoA concentration is determined in the cell extract and in the culture supernatant. In addition, the analysis is carried out in the supernatants obtained after quenching. For the supernatant samples of the culture and after quenching, filtration is carried out through 0.2 pm cellulose acetate filter. 250 pL of the culture supernatant are diluted with 750 pL 60% MeOH, the quenching supernatant was used undiluted.
  • the malonyl-CoA concentration in the samples obtained is quantified by means of LC-MS / MS analysis using an Agilent 1260 Infinity HPLC system (Agilent Technologies, Waldbronn, Germany) at 40 ° C with a 150 * 2.1 mm Sequant ZIC-pHILIC column with 5 pm particle size and a 20 * 2.1 mm guard column (Merck, Darmstadt, Germany).
  • the separation is carried out with 10 mM ammonium acetate (pH 9.2) (buffer A) and acetonitrile (buffer B). Before each injection, the column was equilibrated with 90% buffer B for 15 min.
  • the following gradient is used for the separation (injection volume 5 pL): 0 min: 90% B, 1 min: 90% B, 10 min: 70% B, 25 min: 65% B, 35 min: 10% B, 45 min: 10% B, 55 min: 10% B.
  • the measurement is carried out with an ESI-QqTOF-MS (TripleTOF 6600, AB Sciex, Darmstadt, Germany) with an lonDrive ion source.
  • the software analyst TF 1.7 (AB Sciex, Concord, ON, Canada) is used for data analysis.
  • the optimal collision energies for the strongest transitions of malonyl-CoA (852.1> 79) and malonate (103> 59) are -130 eV and -1 1 eV, respectively. These are determined using the metabolite standards. During the elution, the transitions mentioned and those of the internal standards (855.1> 79 and 106> 61) were used for the measurement in the MS / MS High Sensitivity Mode with the optimal collision energies.
  • the 12 C- 13 C isotope ratio was used to quantify both metabolites.
  • the standard line was determined by linear regression of the isotope ratios and the standard concentrations. To determine the dynamic range, the measurement signals for the highest concentrations were removed so that R 2 was greater than 0.99.
  • the reduced data set was then log 10 transformed to evenly weight lower concentrations. In the log 10 transformed values, measurement signals of the lowest concentrations are rejected, so that R 2 was greater than 0.99.
  • malonate (malonyl-CoA) titers are determined using coryneform bacterial cells according to the invention (FIG. 24).
  • the wild type C. glutamicum ATCC 13032 or its descendant the original type C. glutamicum DelAro 4 -4c / PcCg has a malonate titer of 0.508 pM under standard conditions.
  • DelAro 4 -4clp cCg fasB- E622K, DelAro 4 -4c / PcCg asß-G1361 D, DelAro 4 -4c / PcCg asß-G2153E and DelAro 4 -4cl PcCg fasB- G2668S have malonate titer of 1. 148 pM, 0.658 pM, 0.694 and 0.484 pM, respectively.
  • the fasB deletion strain DelAro 4 -4cl Pc c g AfasB even reaches 1.909 pM malonate. With the strain C.
  • glutamicum DelAro 4 -4clp cC8 -C7 0.741 pM malonate are achieved.
  • the strains C. glutamicum DelAro 4 -4cl PcC8 -C7 mufasO or C. glutamicum DelAro 4 -4cl PcC8 -C7 mufasO AfasB have a titer of 2.261 pM malonate or 3.645 pM malonate.
  • the LC-MS analysis of the respective products in the extracts was carried out as described using an ultra-high performance liquid chromatography 1290 Infinity System coupled to a 6130 quadrupole LC-MS system (Agilent, Waldbronn, Germany) (Kallscheuer et al., 2016).
  • a Kinetex 1.7 pm C18 column with 100 A pore size (50 mm ⁇ 2.1 mm [internal diameter]; Phenomenex, Torrance, CA, USA) at 50 ° C. was used for the chromatographic separation.
  • 0.1% acetic acid (phase A) and acetonitrile + 0.1% acetic acid (phase B) were used as mobile phases at a flow rate of 0.5 ml / min.
  • the mass spectrometer was operated in negative electrospray ionization mode (ESI); data was recorded in selected ion monitoring mode (SIM). Pure product standards of various concentrations in acetonitrile were used for the quantification.
  • the measured areas for the [M-H] mass signals (m / z 271 for naringenin, m / z 191 for noreugenin, m / z 227 for resveratroi) were linear for concentrations up to 250 mg / l.
  • Benzoate served as the internal standard (final concentration 100 mg / l, m / z 121 for benzoate).
  • a calibration curve was calculated based on the ratio of the measured areas of the analyte to the internal standard.
  • the following polyphenol or polyketide titers are determined with the coryneform bacterial cells according to the invention, in each case under standard conditions with growth to glucose or glucose supplemented with p-cumaric acid.
  • the wild type C. glutamicum ATCC 13032 or its descendant the original type C. glutamicum DelAro 4 -4c / PcCg pMKEx2-stsAh-4clPc has a resveratrol titer of 8 mg / L or 12 mg / L under standard conditions.
  • the fasB deletion strain DelAro 4 -4cl PcCg AfasB pMKEx2- stsAh-4clPc even reaches 9.49 mg / L or 37 mg / L resveratrol.
  • the strain C. glutamicum DelAro 4 -4cl PcC8 -C7 pMKEx2-stsAh-4clPc 14 mg / L or 1 13 mg / L Resveratrol are achieved.
  • glutamicum DelAro 4 -4cl Pc c g -C7-mufasO-AfasB pMKEx2-stsAh-4clPc have a titer of 22. 85 mg / L or 262 mg / L resveratrol and 22.73 mg / L and 260 mg / L resveratrol.
  • the coryneform bacterial cells according to the invention have the following titers, in each case under standard conditions with growth to glucose or glucose supplemented with p-cumaric acid.
  • the wild type C. glutamicum ATCC 13032 or its descendant the original type C. glutamicum DelAro 4 -4c / p cCg pMKEx2-chsPh-chiPh has a naringenin titer of 1 mg / L or 2.1 mg / L under standard conditions.
  • the fasB deletion strain DelAro 4 -4cl PcCg AfasB pMKEx2-chsPh-chiPh even reaches 2, 15 mg / L and 9.61 mg / L naringenin.
  • the strain C. glutamicum DelAro 4 -4cl PcC8 -C7 pMKEx2-chsPh-chiPh 3.5 mg / L and 18.5 mg / L naringeninin are achieved.
  • glutamicum DelAro 4 -4cl PcC8 -C7-mufasO-AfasB pMKEx2-chsPh-chiPh have a titer of 10.59 mg / L or 65 mg / L naringenin and 9.83 mg / L and 60 mg / L naringenin.
  • the coryneform bacterial cells according to the invention have the following noreugenin titer under standard conditions when growing on glucose. No noreugenin (0.002 mg / L) could be detected for the wild type C. glutamicum ATCC 13032 pMKEx2-pcs Aa c g -s h ort or its descendant of the original type C. glutamicum DelAro 4 -4clp cCg pMKEx2-pcs AaC8-short will. The strains C.
  • DelAro 4 -4c / p cCg asß-E622K pMKEx2-pcs AaCg-Sh ort
  • DelAro 4 -4c / p cCg fasB- G2668S pMKEx2-pcs AaCg-Sh or t have noreugenin titers of 0.004 mg / L, 0.003 mg / L, 0.003 mg / L and 0.003 mg / L Noreugenin on.
  • strain C glutamicum DelAro 4 -4cl Pc c g -C7 pMKEx2-pcs AaCg-Sh or t 0.86 mg / L noreugenin is determined.
  • the strain C. glutamicum DelAro 4 -4cl PcC8 -C7-mufasO pMKEx2-pcs AaCg.Sho r t has a titer of 4.4 mg / L noreugenin.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Plant Pathology (AREA)
  • Virology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The invention relates to a coryneform bacteria cell having an increased provision of malonyl CoA with respect to its type, a protein for a fatty acid synthase FasB with reduced functionality and nucleic acid sequence coding therefor. The invention also relates to a method for the increased provision of Malonyl-CoA and to a method for producing polyketides or polyohenoles with coryneforme bacteria cells and to the uses thereof.

Description

Beschreibung  description
Bereitstellung von Malonyl-CoA in coryneformen Bakterien sowie Verfahren zur Herstellung von Polyphenolen und Polyketiden mit coryneformen Bakterien Provision of malonyl-CoA in coryneform bacteria as well as processes for the production of polyphenols and polyketides with coryneform bacteria
Die vorliegende Erfindung betrifft ein System für die Bereitstellung von Malonyl-CoA in coryneformen Bakterien. Die vorliegende Erfindung betrifft auch ein Verfahren zur Herstellung von Sekundärmetaboliten, wie z. B. Polyphenolen und Polyketiden mit coryneformen Bakterien. The present invention relates to a system for the provision of malonyl-CoA in coryneform bacteria. The present invention also relates to a method for producing secondary metabolites, such as. B. polyphenols and polyketides with coryneform bacteria.
Eine große Zahl verschiedenster Moleküle aus den Gruppen der Polyphenole (Stilbene, Flavonoide) und der Polyketide stellen wirtschaftlich interessante Sekundärmetabolite mit großem Potential für die pharmakologische Anwendung dar. Dem Stilben Resveratrol beispielsweise wird anti-Tumor, anti-bakterielle, anti-inflammatorische und anti-aging Wirkung vorausgesagt (Pangeni et al. 2014; https://doi.org/10.1517/17425247.2014.919253). Ebenfalls diskutiert wird die Wirkung in der Prävention von kardiovaskulären Erkrankungen. Ähnliche Effekte einschließlich anti-mutagene, anti-oxidative, anti-proliferative und anti atherogene Wirkung sind für Flavonoide, wie z.B. Naringenin oder dessen Derivate beschrieben (Erlund, 2004; https://doi.Org/10.1016/i. nutres.2004.07.005, Harbone, 2013; https://doi.Org/10.1007/978-1-4899-2915-0). A large number of different molecules from the groups of polyphenols (stilbenes, flavonoids) and polyketides represent economically interesting secondary metabolites with great potential for pharmacological use. The stilbene resveratrol, for example, is anti-tumor, anti-bacterial, anti-inflammatory and anti aging effect predicted (Pangeni et al. 2014; https://doi.org/10.1517/17425247.2014.919253). The effect in the prevention of cardiovascular diseases is also discussed. Similar effects including anti-mutagenic, anti-oxidative, anti-proliferative and anti-atherogenic effects are for flavonoids, e.g. Naringenin or its derivatives are described (Erlund, 2004; https://doi.Org/10.1016/i. Nutres.2004.07.005, Harbone, 2013; https://doi.Org/10.1007/978-1-4899-2915- 0).
Allerdings bilden und akkumulieren die natürlichen Produzenten dieser Substanzen (Pflanze, Pilze, Bakterien) entweder nur sehr geringe Produktmengen, oder lassen sich schwer oder gar nicht kultivieren. Insbesondere die Extraktion aus Pflanzen ist wirtschaftlich uninteressant. Eine mikrobielle Produktion pharmakologisch und/oder biotechnologisch interessanter Polyphenole und/oder Polyketide im großtechnischen Maßstab ist daher wünschenswert. However, the natural producers of these substances (plants, fungi, bacteria) either form and accumulate only very small amounts of product, or are difficult or impossible to cultivate. Extraction from plants in particular is economically uninteresting. Microbial production of pharmacologically and / or biotechnologically interesting polyphenols and / or polyketides on an industrial scale is therefore desirable.
Die Herstellung von Sekundärmetaboliten mit dem Bakterium E. coli und der Hefe Saccharomyces cerevisiae ist beschrieben (Xu et al; 2011 , https://doi.Org/10.1016/i.vmben.2011.06.008; Li et al; 2016, https://doi.org/ 10.1038/srep36827). Allerdings sind große Bedenken zur Sicherheit beim Einsatz von E. coli für die Produktion solcher komplexen Sekundärmetoabolite und insbesondere deren Einsatz in der Medizin bekannt. Daher ist der Einsatz eines GRAS-Mikroorganismus (Generally Recognized As Safe), der zudem bereits eine industriell bewährte Zellfabrik darstellt, sehr wünschenswert. Eine Aufgabe der vorliegenden Erfindung ist daher ein System und Verfahren zur mikrobiellen, großtechnischen Herstellung von Molekülen aus den Gruppen der Polyphenole (Stilbene, Flavonoide) und der Polyketide mit coryneformen Bakterien, die als GRAS eingestuft sind, zur Verfügung zu stellen. Eine weitere Aufgabe der vorliegenden Erfindung ist es durch gezielte Stammkonstruktion einen genau charakterisierten Bakterienstamm zur Verfügung zu stellen, der die bekannten Nachteile übenwindet. The production of secondary metabolites with the bacterium E. coli and the yeast Saccharomyces cerevisiae has been described (Xu et al; 2011, https://doi.Org/10.1016/i.vmben.2011.06.008; Li et al; 2016, https: //doi.org/ 10.1038 / srep36827). However, there are great concerns about the safety of using E. coli for the production of such complex secondary metabolites and in particular their use in medicine. Therefore, the use of a GRAS microorganism (Generally Recognized As Safe), which is also an industrially proven cell factory, is very desirable. An object of the present invention is therefore a system and To provide methods for the microbial, large-scale production of molecules from the groups of the polyphenols (stilbenes, flavonoids) and the polyketides with coryneform bacteria, which are classified as GRAS. Another object of the present invention is to provide a precisely characterized bacterial strain by means of targeted strain construction, which overcomes the known disadvantages.
Ein entscheidender Baustein für die Synthese der Polyphenole oder Polyketide ist Malonyl- CoA. Während für Vertreter der Gruppe der Flavonoide und Stilbene 3 Mol Malonyl-CoA / mol Produkt benötigt werden, werden Polyketide fast ausschließlich auf Basis von Malonyl- CoA Einheiten aufgebaut. Malonyl-CoA ist ein zentrales Intermediat im Stoffwechsel von Bakterien, der nicht durch die Zellmembran transportiert werden kann, sodass eine extrazelluläre Zufütterung in einem mikrobiellen Herstellprozess nicht möglich ist. Zwar wird Malonyl-CoA durch Carboxylierung von Acetyl-CoA, dem Endprodukt der Glykolyse, in Bakterienzellen gebildet, allerdings setzen Mikroorganismen Malonyl-CoA fast ausschließlich zur Fettsäuresynthese um, was einer erhöhten Bereitstellung entgegensteht. Außerdem stellt die Fettsäuresynthese eine sehr kostenintensive Synthese für die Zelle dar, so dass folglich die Synthese von Malonyl-CoA streng reguliert ist. A key building block for the synthesis of polyphenols or polyketides is malonyl-CoA. While representatives of the group of flavonoids and stilbenes require 3 moles of malonyl-CoA / mole of product, polyketides are built almost exclusively on the basis of malonyl-CoA units. Malonyl-CoA is a central intermediate in the metabolism of bacteria that cannot be transported through the cell membrane, so that extracellular feeding in a microbial manufacturing process is not possible. Malonyl-CoA is formed by carboxylation of acetyl-CoA, the end product of glycolysis, in bacterial cells, but microorganisms use malonyl-CoA almost exclusively for the synthesis of fatty acids, which prevents increased availability. In addition, fatty acid synthesis is a very costly synthesis for the cell, so that consequently the synthesis of malonyl-CoA is strictly regulated.
Ein indirektes Mittel zur Erhöhung der intrazellulären Konzentration von Malonyl-CoA in Mikroorganismen ist beispielsweise die Zugabe von Inhibitoren der Fettsäuresynthese, wie z. B. Cerulenin. Die Herstellung von Resveratrol mit Corynebacterium glutamicum ist auch bei Kallscheuer et al. (2016, https://doi.Org/10.1016/j.ymben.2016.06.003) beschreiben. Auch hier wird Cerulenin zu Hemmung der Fettsäuresynthese eingesetzt, um die Bildung von Resveratrol zu erreichen. Ein wesentlicher Nachteil der Cerulenin-Zugabe ist allerdings, dass die Zellen nach der Zugabe von Cerulenin ihr Wachstum komplett einstellen. Dies wiederum ist negativ für die Malonyl-CoA-Bereitstellung in der Zelle, die nur bei Wachstum stattfindet. An indirect means of increasing the intracellular concentration of malonyl-CoA in microorganisms is, for example, the addition of inhibitors of fatty acid synthesis, such as. B. Cerulenin. The production of resveratrol with Corynebacterium glutamicum is also in Kallscheuer et al. (2016, https://doi.Org/10.1016/j.ymben.2016.06.003). Here, too, cerulenin is used to inhibit fatty acid synthesis in order to achieve the formation of resveratrol. A major disadvantage of adding cerulenin, however, is that the cells stop growing completely after the addition of cerulenin. This in turn is negative for the malonyl-CoA supply in the cell, which only takes place when it is growing.
Cerulenin ist ein Antibiotikum, das selektiv die Fettsäuresynthese irreversibel inhibiert (Omura et al; 1976; PMID 791237). Durch diese Hemmung wird Malonyl-CoA nicht mehr für die endogene Synthese von Fettsäuren verbraucht und könnte für eine anderweitige Umsetzung, wie z.B. zur Synthese von Sekundärmetaboliten zur Verfügung stehen. Allerdings ist Cerulenin sehr teuer und wäre daher für den Einsatz in einem großtechnisch bzw. industriell interessanten mikrobiellen Herstellungsverfahren wenig geeignet. Ein viel wesentlicher Nachteil von Cerulenin ist ferner, dass die Zellen durch die Hemmung der Fettsäuresynthese extrem in ihrem Wachstum gehemmt werden und in der Regel nach kurzer Zeit (eine Zellteilung) schließlich gar nicht mehr wachsen können. Der Einsatz von Cerulenin in einem mikrobiellen bzw. biotechnologischen Herstellungsverfahren stellt daher mit Blick auf die hohen Kosten und nicht weiter optimierbaren Ausbeuten bedingt durch Zelltod keine sinnvolle wirtschaftliche Alternative dar. Eine weitere Aufgabe der vorliegenden Erfindung besteht somit in der Bereitstellung eines Systems und Verfahrens zur Steigerung der Konzentration des zentralen Metaboliten Malonyl-CoA in corynformen Bakterien, welche von der Zugabe von Cerulenin unabhängig ist. Cerulenin is an antibiotic that selectively irreversibly inhibits fatty acid synthesis (Omura et al; 1976; PMID 791237). As a result of this inhibition, malonyl-CoA is no longer used for the endogenous synthesis of fatty acids and could be available for other uses, such as for the synthesis of secondary metabolites. However, cerulenin is very expensive and would therefore not be very suitable for use in a large-scale or industrially interesting microbial production process. Another major disadvantage of cerulenin is that the cells are extremely inhibited in their growth due to the inhibition of fatty acid synthesis and, as a rule, after a short time (one cell division) they can no longer grow. The use of cerulenin in a microbial or biotechnological manufacturing process therefore represents in view of the high costs and yields which cannot be further optimized due to cell death, this is not a sensible economic alternative. Another object of the present invention is therefore to provide a system and method for increasing the concentration of the central metabolite malonyl-CoA in corynform bacteria which is independent of the addition of cerulenin.
Eine weitere Aufgabe der vorliegenden Erfindung ist es, ein wirtschaftlich interessantes System bereitzustellen, welches für die biotechnologische Bereitstellung von Malonyl-CoA in coryneformen Bakterien geeignet ist und bei dem das Wachstum der Zellen unbeeinflusst bleibt bzw. nicht negativ beeinflusst wird oder gar zum Erliegen kommt. Another object of the present invention is to provide an economically interesting system which is suitable for the biotechnological provision of malonyl-CoA in coryneform bacteria and in which the growth of the cells remains unaffected or is not negatively influenced or even comes to a standstill.
Ferner ist es eine Aufgabe der vorliegenden Erfindung, Eingriffe in den Stoffwechsel des Zellsystems coryneformer Bakterien zu vermeiden, die weitreichend Undefinierte physiologische Auswirkungen haben können, wie es zum Beispiel der Fall ist, wenn ein oder mehrere zentral agierende Regulatoren (wie z. B. das Regulatorprotein FasR) ausgeschaltet sind, die Einfluss auf eine Vielzahl von Genen oder Proteinen in einer Zelle ausüben. Somit ist eine weitere Aufgabe der vorliegenden Erfindung die Bereitstellung eines gezielt erstellten und genau definierten Zellsystems und eines oder mehrerer definierter, homologer Strukturelemente, die eine mikrobielle Herstellung von Malonyl-CoA mit nicht-rekombinanten coryneformen Bakterien (non-GVO) ermöglichen und gleichzeitig bekannte Nachteile überwinden. It is also an object of the present invention to avoid interfering with the metabolism of the cell system of coryneform bacteria, which can have far-reaching undefined physiological effects, as is the case, for example, when one or more centrally acting regulators (such as that Regulatory protein FasR) are switched off, which influence a large number of genes or proteins in a cell. It is therefore a further object of the present invention to provide a specifically created and precisely defined cell system and one or more defined, homologous structural elements which enable microbial production of malonyl-CoA with non-recombinant coryneform bacteria (non-GMO) and at the same time known disadvantages overcome.
Eine weitere Aufgabe der vorliegenden Erfindung ist es, ein Verfahren zur mikrobiellen Herstellung von wirtschaftlich interessanten Sekundärmetaboliten, wie z. B. Molekülen aus den Gruppen der Polyphenole (Stilbene, Flavonoide) und der Polyketide, in coryneformen Bakterien bereitzustellen, bei dem die bekannten Nachteile überwunden werden. Another object of the present invention is to provide a method for the microbial production of economically interesting secondary metabolites, such as. B. to provide molecules from the groups of polyphenols (stilbenes, flavonoids) and polyketides in coryneform bacteria, in which the known disadvantages are overcome.
Diese Aufgaben werden durch die vorliegende Erfindung, wie nachfolgend ausgeführt, in vorteilhafter Weise gelöst. These objects are achieved in an advantageous manner by the present invention, as explained below.
Es folgt zunächst die kurze Beschreibung der vorliegenden Erfindung, ohne dass der Ge genstand der Erfindung dadurch limitiert wird. The following is a brief description of the present invention without restricting the subject matter of the invention.
Gegenstand der vorliegenden Erfindung ist eine coryneforme Bakterienzelle mit einer gegenüber ihrem Urtyp erhöhten Bereitstellung von Malonyl-CoA bei die die Regulation und/oder Expression der Gene, ausgewählt aus der Gruppe enthaltend fasB, gltA, accBC und accD1 , und/oder die Funktionalität der durch sie kodierten Enzyme gezielt modifiziert ist. Ein weiterer Gegenstand der Erfindung umfasst eine coryneforme Bakterienzelle, die eine oder mehrere gezielte Modifikationen aufweist, ausgewählt aus der Gruppe enthaltend a) Verminderte oder ausgeschaltete Funktionalität der Fettsäuresynthase FasB; b) Mutation oder teilweise oder komplette Deletion des für die Fettsäuresynthase kodierende Gen fasB; c) Verminderte Funktionalität des mit dem Citratsynthase-Gen gtIA operativ- verknüpften Promotors; d) Verminderte Expression des für die Citratsynthase CS kodierende Gens gltA; e) Verminderte oder ausgeschaltete Funktionalität der Operator-Bindestellen (fasO) für den Regulator FasR in den Promotorbereichen der Gene accBC und accD1 kodierend für die Acetyl-CoA-Carboxylase-Untereinheiten; f) Dereprimierte Expression der für die Acetyl-CoA-Carboxylase-Untereinheiten kodierenden Gene accBC und accD1 ; g) eine oder mehrere Kombinationen aus a) - f). The present invention relates to a coryneform bacterial cell with an increased supply of malonyl-CoA compared to its original type in which the regulation and / or expression of the genes selected from the group comprising fasB, gltA, accBC and accD1, and / or the functionality of the enzymes encoded by them is specifically modified. The invention further relates to a coryneform bacterial cell which has one or more targeted modifications, selected from the group comprising a) reduced or deactivated functionality of the fatty acid synthase FasB; b) mutation or partial or complete deletion of the gene fasB coding for the fatty acid synthase; c) reduced functionality of the promoter operatively linked to the citrate synthase gene gtIA; d) reduced expression of the gene coding for the citrate synthase CS gltA; e) Reduced or deactivated functionality of the operator binding sites (fasO) for the regulator FasR in the promoter regions of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits; f) Depressed expression of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits; g) one or more combinations of a) - f).
Erfindungsgemäß umfasst ist somit auch eine coryneforme Bakterienzelle, bei der die Funktionalität der Fettsäuresynthase FasB vermindert oder ausgeschaltet ist und/oder das für die Fettsäuresynthase kodierende Gen fasB gezielt mutiert, bevorzugt durch eine oder mehrere Nukleotidsubstitutionen, oder teilweise oder komplett deletiert ist. The invention thus also includes a coryneform bacterial cell in which the functionality of the fatty acid synthase FasB is reduced or switched off and / or the gene fasB coding for the fatty acid synthase is specifically mutated, preferably by one or more nucleotide substitutions, or is partially or completely deleted.
Erfindungsgemäß auch umfasst ist eine coryneforme Bakterienzelle, bei der die Expression des für die Citratsynthase kodierende Gens gltA durch Mutation, bevorzugt mehrere Nukleotidsubstitutionen, des operativ-verknüpften Promotors vermindert ist. Also included according to the invention is a coryneform bacterial cell in which the expression of the gene coding for citrate synthase gltA is reduced by mutation, preferably several nucleotide substitutions, of the operatively linked promoter.
Gegenstand der vorliegenden Erfindung ist auch eine coryneforme Bakterienzelle, bei der die Funktionalität der Operator-Bindestellen (fasO) für den Regulator FasR in den Promotorbereichen der Gene accBC und accD1 kodierend für die Acetyl-CoA-Carboxylase- Untereinheiten, bevorzugt durch eine oder mehrere Nukleotidsubstitutionen, vermindert oder ausgeschaltet ist und die Expression der für die Acetyl-CoA-Carboxylase-Untereinheiten kodierenden Gene accBC und accD1 dereprimiert, bevorzugt gesteigert, ist. The present invention also relates to a coryneform bacterial cell in which the functionality of the operator binding sites (fasO) for the regulator FasR in the promoter regions of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits, preferably by one or more nucleotide substitutions is reduced or switched off and the expression of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits is derepressed, preferably increased.
Ein weiterer Gegenstand der vorliegenden Erfindung ist auch eine coryneforme Bakterienzelle, die eine Kombination aus verminderter Expression und/oder Aktivität der Citratsynthase (CS) und deregulierter, gesteigerter, Expression und/oder Aktivität der Acetyl- CoA-Carboxylase-Untereinheiten (AccBC und AccD1) aufweist. Another object of the present invention is also a coryneform bacterial cell which is a combination of reduced expression and / or activity of citrate synthase (CS) and deregulated, increased expression and / or activity of acetyl- Has CoA carboxylase subunits (AccBC and AccD1).
Erfindungsgemäß umfasst ist auch eine coryneforme Bakterienzelle, die eine Kombination aus verminderter Expression und/oder Aktivität der Citratsynthase (CS) und deregulierter, gesteigerter, Expression und/oder Aktivität der Acetyl-CoA-Carboxylase-Untereinheiten (AccBC und AccD1) und verminderter oder ausgeschalteter Funktionalität der Fettsäuresynthase FasB aufweist. The invention also includes a coryneform bacterial cell which is a combination of reduced expression and / or activity of citrate synthase (CS) and deregulated, increased, expression and / or activity of acetyl-CoA carboxylase subunits (AccBC and AccD1) and reduced or switched off Has functionality of the fatty acid synthase FasB.
Gegenstand der vorliegenden Erfindung ist auch eine coryneforme Bakterienzelle zur Herstellung von Polyphenolen oder Polyketiden, die Modifikationen der vorgenannten Art aufweist und bei der zusätzlich der katabole Stoffwechselweg von aromatischen Komponenten, bevorzugt ausgewählt aus der Gruppe enthaltend Phenylpropanoide und Benzoesäure-Derivate, ausgeschaltet ist. The present invention also relates to a coryneform bacterial cell for the production of polyphenols or polyketides, which has modifications of the aforementioned type and in which the catabolic pathway of aromatic components, preferably selected from the group comprising phenylpropanoids and benzoic acid derivatives, is additionally switched off.
Erfindungsgemäß umfasst ist auch eine coryneforme Bakterienzelle, die zusätzlich Gene kodierend für eine feedback-resistente 3-Deoxy-D-Arabinoheptulosonat-7-Phosphat- Synthase (aroH), bevorzugt aus E. coli, und für eine Tyrosinammonium-Lyase (tal), bevorzugt aus Flavobacterium johnsoniae, aufweist. The invention also encompasses a coryneform bacterial cell which additionally encodes genes for a feedback-resistant 3-deoxy-D-arabinoheptulosonate 7-phosphate synthase (aroH), preferably from E. coli, and for a tyrosine ammonium lyase (tal), preferably from Flavobacterium johnsoniae.
Gegenstand der vorliegenden Erfindung ist auch eine coryneforme Bakterienzelle der zuvor genannten Art, die zusätzlich aus Pflanzen abgeleiteten Enzyme oder die sie kodierenden Gene für die Polyphenol- oder Polyketid-Synthese aufweist. The present invention also relates to a coryneform bacterial cell of the aforementioned type which additionally has enzymes derived from plants or the genes encoding them for polyphenol or polyketide synthesis.
Erfindungsgemäß handelt es sich bei der coryneformen Bakterienzelle um die Gattung ausgewählt aus der Gruppe enthaltend Corynebacterium und Brevibacterium, bevorzugt Corynebacterium glutamicum, besonders bevorzugt Corynebacterium glutamicum ATCC13032 oder deren gezielt gentechnisch veränderten Varianten. According to the invention, the coryneform bacterial cell is the genus selected from the group comprising Corynebacterium and Brevibacterium, preferably Corynebacterium glutamicum, particularly preferably Corynebacterium glutamicum ATCC13032 or their specifically genetically modified variants.
Gegenstand der vorliegenden Erfindung ist auch ein Verfahren zur erhöhten Bereitstellung von Malonyl-CoA in coryneformen Bakterien mit den zuvor genannten coryneformen Bakterien sowie ein Verfahren zur mikrobiellen Herstellung von Polyphenolen oder Polyketiden in coryneformen Bakterien. Erfindungsgemäß sind die Verfahren unabhängig von der Zugabe von Cerulenin. The present invention also relates to a method for the increased provision of malonyl-CoA in coryneform bacteria with the aforementioned coryneform bacteria and a method for the microbial production of polyphenols or polyketides in coryneform bacteria. According to the invention, the processes are independent of the addition of cerulenin.
Gegenstand der vorliegenden Erfindung ist auch die Verwendung einer erfindungsgemäßen coryneformen Bakterienzelle zur erhöhten Bereitstellung von Malonyl-CoA in coryneformen Bakterien, sowie die Verwendung einer erfindungsgemäßen coryneformen Bakterienzelle zur Herstellung von Polyphenolen oder Polyketiden mit coryneformen Bakterien. The present invention also relates to the use of a coryneform bacterial cell according to the invention for increased provision of malonyl-CoA in coryneform bacteria, and the use of a coryneform bacterial cell according to the invention for the production of polyphenols or polyketides with coryneform bacteria.
Erfindungsgemäß umfasst ist auch eine Zusammensetzung enthaltend Sekundärmetabolite ausgewählt aus der Gruppe der Polyphenole und Polyketide, bevorzugt der Stilbene, Flavonoide und Polyketide, besonders bevorzugt Resveratrol, Naringenin und Noreugenin, hergestellt mit einer erfindungsgemäßen coryneformen oder einem erfindungsgemäßen Verfahren. Gegenstand der vorliegenden Erfindung ist auch die Verwendung einer zuvor genannten erfindungsgemäßen Zusammensetzung zur Herstellung von Pharmazeutika, Lebensmitteln, Futtermitteln, und/oder zum Einsatz in der Pflanzenphysiologie. The invention also includes a composition containing secondary metabolites selected from the group of polyphenols and polyketides, preferably the stilbenes, flavonoids and polyketides, particularly preferably resveratrol, naringenin and noreugenin, produced using a coryneform according to the invention or a method according to the invention. The present invention also relates to the use of a composition according to the invention mentioned above for the production of pharmaceuticals, foods, animal feeds and / or for use in plant physiology.
Nachfolgend wird der Gegenstand der Erfindung durch Beispiele und anhand von Figuren näher erläutert, ohne dass der Gegenstand der Erfindung dadurch limitiert wird. Der Beschreibung der Ausführungsbeispiele sind einige Definitionen vorangestellt, die für das Verständnis der vorliegenden Erfindung wichtig sind. The subject matter of the invention is explained in more detail below by means of examples and with reference to figures, without the subject matter of the invention being limited thereby. The description of the exemplary embodiments is preceded by some definitions which are important for understanding the present invention.
Gegenstand der vorliegenden Erfindung ist eine coryneforme Bakterienzelle mit einer gegenüber ihrem Urtyp erhöhten Bereitstellung von Malonyl-CoA bei die die Regulation und/oder Expression der Gene, ausgewählt aus der Gruppe enthaltend fasB, gltA, accBC und accD1 , und/oder die Funktionalität der durch sie kodierten Enzyme gezielt modifiziert ist. The present invention relates to a coryneform bacterial cell with an increased supply of malonyl-CoA compared to its original type in which the regulation and / or expression of the genes selected from the group comprising fasB, gltA, accBC and accD1, and / or the functionality of the they specifically encoded enzymes.
Erfindungsgemäß umfasst ist somit eine coryneforme Bakterienzelle, die eine oder mehrere gezielte Modifikationen aufweist, ausgewählt aus der Gruppe enthaltend a) Verminderte oder ausgeschaltete Funktionalität der Fettsäuresynthase FasB; b) Mutation oder teilweise oder komplette Deletion des für die Fettsäuresynthase kodierende Gen fasB; c) Verminderte Funktionalität des mit dem Citratsynthase-Gen gtIA operativ- verknüpften Promotors; d) Verminderte Expression des für die Citratsynthase CS kodierende Gens gltA; e) Verminderte oder ausgeschaltete Funktionalität der Operator-Bindestellen (fasO) für den Regulator FasR in den Promotorbereichen der Gene accBC und accD1 kodierend für die Acetyl-CoA-Carboxylase-Untereinheiten; f) Dereprimierte Expression der für die Acetyl-CoA-Carboxylase-Untereinheiten kodierenden Gene accBC und accD1 ; g) eine oder mehrere Kombinationen aus a) - f). The invention thus encompasses a coryneform bacterial cell which has one or more targeted modifications selected from the group comprising a) reduced or deactivated functionality of the fatty acid synthase FasB; b) mutation or partial or complete deletion of the gene fasB coding for the fatty acid synthase; c) reduced functionality of the promoter operatively linked to the citrate synthase gene gtIA; d) reduced expression of the gene coding for the citrate synthase CS gltA; e) Reduced or deactivated functionality of the operator binding sites (fasO) for the regulator FasR in the promoter regions of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits; f) Depressed expression of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits; g) one or more combinations of a) - f).
Erfindungsgemäß umfasst ist auch eine coryneforme Bakterienzelle, bei der die Funktionalität der Fettsäuresynthase FasB vermindert oder ausgeschaltet ist und/oder das für die Fettsäuresynthase kodierende Gen fasB gezielt mutiert, bevorzugt durch eine oder mehrere Nukleotidsubstitutionen, oder teilweise oder komplett deletiert ist. The invention also encompasses a coryneform bacterial cell in which the functionality of the fatty acid synthase FasB is reduced or switched off and / or the gene fasB coding for the fatty acid synthase is specifically mutated, preferably by one or more nucleotide substitutions, or is partially or completely deleted.
Erfindungsgemäß ebenfalls umfasst ist eine coryneforme Bakterienzelle, bei der die Expression des für die Citratsynthase kodierende Gens gltA durch Mutation, bevorzugt mehrere Nukleotidsubstitutionen, des operativ-verknüpften Promotors vermindert ist. Also included according to the invention is a coryneform bacterial cell in which the expression of the gene coding for citrate synthase gltA is reduced by mutation, preferably several nucleotide substitutions, of the operatively linked promoter.
Gegenstand der vorliegenden Erfindung ist auch eine coryneforme Bakterienzelle, bei der die Funktionalität der Operator-Bindestellen (fasO) für den Regulator FasR in den Promotorbereichen der Gene accBC und accD1 kodierend für die Acetyl-CoA-Carboxylase- Untereinheiten, bevorzugt durch eine oder mehrere Nukleotidsubstitutionen, vermindert oder ausgeschaltet ist und die Expression der für die Acetyl-CoA-Carboxylase-Untereinheiten kodierenden Gene accBC und accD1 dereprimiert, bevorzugt gesteigert, ist. The present invention also relates to a coryneform bacterial cell in which the functionality of the operator binding sites (fasO) for the regulator FasR in the promoter regions of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits, preferably by one or more nucleotide substitutions is reduced or switched off and the expression of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits is derepressed, preferably increased.
Mutationen der /äsO-Bindestelle vor accBC und accD1 sind bekannt (Nickel et al., 2010; https://doi.Org/10.1111/j.1365-2958.2010.07337.x). Hier sind Mutationen der fasO- Bindestelle beschrieben, die zu einem Verlust der Bindung des Fettsäuresynthese- Regulators FasR führen. Im Falle von accBC liegt die /asO-Bindestelle upstream des accBC- Gens, sodass die Mutation von (Nickel et al., 2010) übernommen werden konnte. Im Fall von accD1 überlappen der Leserahmen und die /asO-Bindestelle (Figur 23; ATG in der linken, grau-hinterlegten Box ist das Startcodon von accD1). Eine Mutation in diesem Bereich ist daher nicht möglich, da hier sonst das Startcodon mutiert werden würde. Da durch die Mutation auch kein alternatives Startcodon (GTG oder TTG) gebildet wird, ist eine Translation nicht möglich mit der Folge, dass keine AccD1 -Untereinheit und somit keine funktionsfähige Acetyl-CoA Carboxylase-Aktivität vorliegt. Dies hat weiter zur Folge, dass kein Malonyl-CoA gebildet werden kann und die Zellen vermutlich letal oder stark verkrüppelt sind. Somit sind die Mutationen nach Nickel et al. für die vorliegende Erfindung nicht geeignet. Mutations of the / aO binding site before accBC and accD1 are known (Nickel et al., 2010; https://doi.Org/10.1111/j.1365-2958.2010.07337.x). Mutations of the fasO binding site are described here, which lead to a loss of binding of the fatty acid synthesis regulator FasR. In the case of accBC, the / asO binding site is upstream of the accBC gene, so that the mutation could be taken over from (Nickel et al., 2010). In the case of accD1, the reading frame and the / asO binding point overlap (FIG. 23; ATG in the left, gray box is the start codon of accD1). A mutation in this area is therefore not possible, since otherwise the start codon would be mutated here. Since the mutation also does not produce an alternative start codon (GTG or TTG), translation is not possible, with the result that there is no AccD1 subunit and therefore no functional acetyl-CoA carboxylase activity. This has the further consequence that malonyl-CoA cannot be formed and the cells are presumably lethal or severely crippled. The mutations according to Nickel et al. not suitable for the present invention.
Erfindungsgemäß wird eine neue fasO-Bindestelle 5‘- operativ-verknüpft vor dem accD1-Gen coryneformer Bakterien zur Verfügung gestellt. Diese zeichnet sich in vorteilhafter Weise dadurch aus, dass sie unter Berücksichtigung der Aminosäuresequenz und der bestmöglichen Codonverwendung in coryneformen Bakterien eine maximale Abweichung von der nativen fasO Sequenz: MTISSPX aufweist (Figur 23). Dabei liegen in der fasO- Bindestelle vor accBC an den Positionen 1 1-13 (tga -> gtc) und 20-22 (cct -> aag) Nukleotidsubstitutionen vor. In der fasO-Bindestelle vor accD1 liegen an den Positionen 20- 24 (cctca -> gtacg) Nukleotidsubstitutionen vor. In einer Variante der vorliegenden Erfindung weisen die erfindungsgemäßen fasO-Bindestellen vor den Genen accBD bzw. accD1 eine Nukleinsäuresequenz gemäß SEQ ID NO: 13 bzw. 15 auf. According to the invention, a new fasO binding site 5 'is operatively linked in front of the accD1 gene of coryneform bacteria. This is advantageously characterized in that, taking into account the amino acid sequence and the best possible codon use in coryneform bacteria, it exhibits a maximum deviation from the native fasO sequence: MTISSPX (FIG. 23). The fasO Binding site in front of accBC at positions 1 1-13 (tga -> gtc) and 20-22 (cct -> aag) before nucleotide substitutions. In the fasO binding site in front of accD1 there are nucleotide substitutions at positions 20-24 (cctca -> gtacg). In a variant of the present invention, the fasO binding sites according to the invention have a nucleic acid sequence according to SEQ ID NO: 13 or 15 in front of the accBD or accD1 genes.
Ein weiterer Gegenstand der vorliegenden Erfindung ist auch eine coryneforme Bakterienzelle, die eine Kombination aus verminderter Expression und/oder Aktivität der Citratsynthase (CS) und deregulierter, gesteigerter, Expression und/oder Aktivität der Acetyl- CoA-Carboxylase-Untereinheiten (AccBC und AccDI) aufweist. Another object of the present invention is also a coryneform bacterial cell which is a combination of reduced expression and / or activity of citrate synthase (CS) and deregulated, increased expression and / or activity of the acetyl-CoA carboxylase subunits (AccBC and AccDI) having.
Erfindungsgemäß umfasst ist auch eine coryneforme Bakterienzelle, die eine Kombination aus verminderter Expression und/oder Aktivität der Citratsynthase (CS) und deregulierter, gesteigerter, Expression und/oder Aktivität der Acetyl-CoA-Carboxylase-Untereinheiten (AccBC und AccD1) und verminderter oder ausgeschalteter Funktionalität der Fettsäuresynthase FasB aufweist. The invention also includes a coryneform bacterial cell which is a combination of reduced expression and / or activity of citrate synthase (CS) and deregulated, increased, expression and / or activity of acetyl-CoA carboxylase subunits (AccBC and AccD1) and reduced or switched off Has functionality of the fatty acid synthase FasB.
Dabei zeichnet sich eine erfindungsgemäße coryneforme Bakterienzelle insbesondere dadurch aus, dass gezielt der Anabolismus von Malonyl-CoA gesteigert ist und gleichzeitig das Wachstum der Zelle unbeeinflusst ist. Eine solche coryneforme Bakterienzelle ist bislang nicht beschrieben. Herkömmlicherweise wird zur Steigerung der Malonyl-CoA-Konzentration in der Zelle der katabolen Stoffwechsels von Malonyl-CoA ausgeschaltet, was jedoch den negativen Effekt mit sich bringt, dass die Zellen nicht mehr wachsen können. Beschrieben ist dies in vielfältiger Weise z. B. durch die Zugabe von Cerulenin. Mangelndes Wachstum beeinflusst jedoch die streng kontrollierte Malonyl-CoA-Bereitstellung negativ, d.h. es wird weniger Malonyl-CoA bereitgestellt, was sich somit als kontrapoduktiv erweist. Die vorliegende Erfindung überwindet solche Nachteile in vorteilhafter Weise. A coryneform bacterial cell according to the invention is characterized in particular by the fact that the anabolism of malonyl-CoA is specifically increased and at the same time the growth of the cell is unaffected. Such a coryneform bacterial cell has not yet been described. Conventionally, in order to increase the malonyl-CoA concentration in the cell, the catabolic metabolism of malonyl-CoA is switched off, but this has the negative effect that the cells can no longer grow. This is described in a variety of ways. B. by the addition of cerulenin. However, lack of growth negatively affects the tightly controlled malonyl CoA supply, i.e. less malonyl-CoA is provided, which proves to be counterproductive. The present invention advantageously overcomes such disadvantages.
Der Begriff „Urtyp“ ist im Sinne der vorliegenden Erfindung sowohl der„Wildtyp“ einer coryneformen Bakterienzelle zu verstehen, der z. B. ein genetisch nicht verändertes Ausgangsgen oder Ausgangsenzym bereitstellt, als auch direkte Abkömmlinge davon. Bevorzugt sind coryneforme Wildtypzellen der Gattung Corynbacterium oder Brevibacterium; besonders bevorzugt sind coryneforme Bakterienzellen des Wildtyps Corynebacterium glutamicum; ganz besonders bevorzugt sind coryneforme Bakterienzellen des Wildtyps Corynebacterium glutamicum ATCC 13032. Unter dem Begriff „Urtyp“ fallen erfindungsgemäß somit neben dem„Wildtyp“ auch gezielt abgeleitete, exakt definierte und genau charakterisierte „Abkömmlinge“ des Wildtyps. Die „Abkömmlinge“ weisen dabei Veränderungen auf, die mittels molekularbiologischer Methoden gezielt, gerichtet und kontrolliert erfolgt sind und bei denen es sich um homologe, nicht-rekombinante Veränderungen handelt, wie z. B. Nukleotidsubstitutionen oder Deletionen oder die Anpassung Heterologe Nukleinsäure Sequenzen an die Codonverwendung (codon-usage) des Wildtyps. Der resultierende Abkömmling ist physiologisch genau charakterisiert und trägt keine heterologen Nukleinsäure Sequenzen; weder chromosomal-kodiert noch plasmid- kodiert. Als Beispiel für einen „Urtyp“ im Sinne der vorliegenden Erfindung ist eine coryneforme Bakterienzelle des Wildtyps genannt, bei der die Gene verantwortlich für den Abbau aromatischer Komponenten aus dem Genom deletiert sind. Neben Deletionen sind auch gezielte Nukleotidsubstitutionen im Genom denkbar, durch die der Wildtyp genetisch ein homologer, nicht-rekombinanter Organismus bleibt. Dieses Beispiel ist nicht limitierend für die vorliegende Erfindung auszulegen. Da es sich erfindungsgemäß um gezielte Nukleotidaustausche des gleichen, homologen Wirtsorganismus handelt, ist der resultierende Organismus erfindungsgemäß nicht-rekombinant verändert. Unter„homolog“ im Sinne der Erfindung ist zu verstehen, dass die erfindungsgemäßen Enzyme und die sie kodierenden erfindungsgemäßen Nukleinsäure Sequenzen und die erfindungsgemäßen mit diesen regulatorisch-verknüpften nicht-kodierenden Nukleinsäure Sequenzen verwandtschaftlich von einem gemeinsamen Ausgangsstamm coryneformer Bakterienzellen abstammen. „Homolog“ wird erfindungsgemäß synonym benutzt mit dem Begriff „nicht heterolog“. Ein erfindungsgemäßer „Urtyp“ ist genetisch und physiologisch exakt charakterisiert, homolog, nicht-rekombinant und kann mit dem „Wildtyp“ gleichgesetzt werden. Die Begriffe „Wildtyp“, „Abkömmlinge“ und „Urtyp“ werden erfindungsgemäß synonym verwendet. For the purposes of the present invention, the term “original type” is to be understood both as the “wild type” of a coryneform bacterial cell, which z. B. provides a genetically unmodified parent gene or parent enzyme, as well as direct descendants thereof. Coryneform wild-type cells of the genus Corynbacterium or Brevibacterium are preferred; coryneform bacterial cells of the wild type Corynebacterium glutamicum are particularly preferred; coryneform bacterial cells of the wild type Corynebacterium glutamicum ATCC 13032 are very particularly preferred. According to the invention, the term “original type” thus includes, in addition to the “wild type”, also specifically derived, precisely defined and well-characterized "descendants" of the wild type. The “descendants” show changes that are targeted, directed and controlled by means of molecular biological methods and which are homologous, non-recombinant changes, such as: B. nucleotide substitutions or deletions or the adaptation of heterologous nucleic acid sequences to the codon usage (codon usage) of the wild type. The resulting descendant is characterized physiologically precisely and does not carry heterologous nucleic acid sequences; neither chromosomally coded nor plasmid coded. An example of a “primary type” in the sense of the present invention is a coryneform bacterial cell of the wild type in which the genes responsible for the breakdown of aromatic components are deleted from the genome. In addition to deletions, targeted nucleotide substitutions in the genome are also conceivable, by means of which the wild type remains genetically a homologous, non-recombinant organism. This example is not to be interpreted as limiting the present invention. Since, according to the invention, it is a matter of targeted nucleotide exchanges of the same, homologous host organism, the resulting organism is modified according to the invention in a non-recombinant manner. “Homologous” in the sense of the invention is to be understood to mean that the enzymes according to the invention and the nucleic acid sequences according to the invention coding for them and the non-coding nucleic acid sequences according to the invention linked to these in a regulatory manner are derived from a common starting strain of coryneform bacterial cells. According to the invention, “homolog” is used synonymously with the term “not heterologous”. An “original type” according to the invention is genetically and physiologically exactly characterized, homologous, non-recombinant and can be equated with the “wild type”. The terms “wild type”, “descendants” and “original type” are used synonymously according to the invention.
Im Sinne der vorliegenden Erfindung bezieht sich eine„verminderte oder ausgeschaltete Funktionalität“ beispielsweise sowohl auf die Funktionalität der erfindungsgemäßen Fettsäuresynthase FasB auf Proteinebene als auch auf die sie kodierende erfindungsgemäße Nukleinsäuresequenz. „Funktionalität“ umfasst somit allgemein die Funktion eines Proteins oder einer dafür kodierenden Nukleinsäuresequenz, die beispielsweise durch Nukleotidsubstitution oder Deletion vermindert oder ausgeschaltet sein kann. Die„Funktionalität“ umfasst somit auch die Aktivität eines Proteins, die verändert sein kann, wie beispielsweise vermindert oder ausgeschaltet. Die veränderte Aktivität eines Proteins kann dabei erfindungsgemäß sowohl Veränderungen im aktiven, katalytischen Zentrum als auch regulatorischen Zentrum umfassen. Diese Varianten sind erfindungsgemäß ebenfalls umfasst. In the sense of the present invention, a “reduced or deactivated functionality” relates, for example, both to the functionality of the fatty acid synthase FasB according to the invention at the protein level and to the nucleic acid sequence according to the invention encoding it. "Functionality" thus generally comprises the function of a protein or a nucleic acid sequence coding therefor, which can be reduced or switched off, for example, by nucleotide substitution or deletion. The "functionality" thus also includes the activity of a protein, which can be changed, such as reduced or switched off. According to the invention, the changed activity of a protein can include changes in the active, catalytic center as well as regulatory center. These variants are also included according to the invention.
In einer Variante der vorliegenden Erfindung ist eine coryneforme Bakterienzelle umfasst, die sich dadurch auszeichnet, dass sie eine modifizierte Funktionalität eines Enzyms und/oder der kodierenden Nukleinsäuresequenz und/oder einer operativ-verknüpften, regulatorischen, nicht-kodierenden Nukleinsäuresequenz aufweist. Eine weitere Variante einer erfindungsgemäßen coryneformen Bakterienzelle zeichnet sich dadurch aus, dass die Modifikation auf Veränderungen beruht, ausgewählt aus der Gruppe enthaltend a) Veränderung der Regulation oder von Signalstrukturen zur Genexpression, b) Veränderung der Transkriptionsaktivität der kodierenden Nukleinsäuresequenz, oder c) Veränderung der kodierenden Nukleinsäuresequenz. Erfindungsgemäß umfasst sind dabei beispielsweise Veränderung der Signalstrukturen der Genexpression, wie beispielsweise durch Veränderung der Repressorgene, Aktivatorgene, Operatoren, Promotoren; Attenuatoren, Ribosomenbindungsstellen, des Startkodons, Terminatoren. Ebenso umfasst sind das Einfuhren eines stärkeren oder schwächeren Promoters oder eines induzierbaren Promotors in das Genom der erfindungsgemäßen coryneformen Bakterienzelle oder Deletionen oder Nukleotidsubstitutionen in kodierenden oder nicht-kodierenden Bereichen, wobei die molekularbiologischen Methoden dem Fachmann bekannt sind. Gegenstand der vorliegenden Erfindung ist eine coryneforme Bakterienzelle bei der die Veränderungen chromosomal-kodiert im Genom vorliegen oder extrachromosomal, d.h. Vektor-kodiert oder Plasmid-kodiert, vorliegen. Erfindungsgemäß eignen sich als Plasmide solche, die in coryneformen Bakterien repliziert werden. Zahlreiche bekannte Plasmidvektoren wie z. B. pZ1 (Menkel et al. , Applied and Environmental Microbiology (1989) 64: 549-554), pEKExI (Eikmanns et al., Gene 102:93-98 (1991)) oder pHS2-1 (Sonnen et al., Gene 107:69-74 (1991)) beruhen auf den kryptischen Plasmiden pHM1519, pBL1 oder pGA1. Andere Plasmidvektoren wie z. B. solche, die auf pCG4 (US-A 4,489,160), oder pNG2 (Serwold- Davis et al., FEMS Microbiology Letters 66, 119-124 (1990)), oder pAG1 (US-A 5,158,891 ) beruhen, können in gleicher Weise verwendet werden (O. Kirchner 2003, J. Biotechnol. 104:287-99). Ebenso können Vektoren mit regulierbarer Expression benutzt werden, wie zum Beispiel pEKEx2 (B. Eikmanns, 1991 Gene 102:93-8; O. Kirchner 2003, J. Biotechnol. 104:287-99) oder pEKEx3 (Gande, R. ; Dover, L.G. ; Krumbach, K. ; Besra, G.S. ; Sahm, H. ; Oikawa, T. ; Eggeling, L, 2007. “The two carboxylases of Corynebacterium glutamicum essential for fatty acid and mycolic acid synthesis.” Journal of Bacteriology, 189 (14), 5257- 5264. https://doi.Org/10.1128/JB 00254-07). Auch kann das Gen durch Integration in das Chromosom in einfacher Kopie (P. Vasicova 1999, J. Bacteriol. 181 :6188-91), oder mehrfacher Kopie (D. Reinscheid 1994 Appl. Environ Microbiol 60:126-132) exprimiert werden. Die Transformation des gewünschten Stammes mit einem Vektor erfolgt durch Konjugation oder Elektroporation des gewünschten Stammes von beispielsweise C. glutamicum. Die Methode der Konjugation ist beispielsweise bei Schäfer et al. (Applied and Environmental Microbiology (1994) 60:756-759) beschrieben. Methoden zur Transformation sind beispielsweise bei Tauch et al. (FEMS Microbiological Leiters (1994)123:343-347) beschrieben. In a variant of the present invention, a coryneform bacterial cell is included which is characterized in that it has a modified functionality of an enzyme and / or the coding nucleic acid sequence and / or an operatively linked, regulatory, non-coding nucleic acid sequence. Another variant of a coryneform bacterial cell according to the invention is characterized in that the modification is based on changes selected from the group comprising a) change in the regulation or signal structures for gene expression, b) change in the transcription activity of the coding nucleic acid sequence, or c) change in the coding Nucleic acid sequence. The invention includes, for example, changes in the signal structures of gene expression, such as, for example, by changing the repressor genes, activator genes, operators, promoters; Attenuators, ribosome binding sites, the start codon, terminators. Also included are the introduction of a stronger or weaker promoter or an inducible promoter into the genome of the coryneform bacterial cell according to the invention or deletions or nucleotide substitutions in coding or non-coding areas, the molecular biological methods being known to the person skilled in the art. The present invention relates to a coryneform bacterial cell in which the changes are chromosomally-encoded in the genome or extrachromosomally, ie vector-encoded or plasmid-encoded. According to the invention, suitable plasmids are those which are replicated in coryneform bacteria. Numerous known plasmid vectors such as e.g. B. pZ1 (Menkel et al., Applied and Environmental Microbiology (1989) 64: 549-554), pEKExI (Eikmanns et al., Gene 102: 93-98 (1991)) or pHS2-1 (Sonnen et al., Gene 107: 69-74 (1991)) are based on the cryptic plasmids pHM1519, pBL1 or pGA1. Other plasmid vectors such as e.g. B. those based on pCG4 (US-A 4,489,160), or pNG2 (Serwold-Davis et al., FEMS Microbiology Letters 66, 119-124 (1990)), or pAG1 (US-A 5,158,891) can be the same Way are used (O. Kirchner 2003, J. Biotechnol. 104: 287-99). Vectors with controllable expression can also be used, such as, for example, pEKEx2 (B. Eikmanns, 1991 Gene 102: 93-8; O. Kirchner 2003, J. Biotechnol. 104: 287-99) or pEKEx3 (Gande, R.; Dover , LG; Krumbach, K.; Besra, GS; Sahm, H.; Oikawa, T.; Eggeling, L, 2007. “The two carboxylases of Corynebacterium glutamicum essential for fatty acid and mycolic acid synthesis.” Journal of Bacteriology, 189 (14), 5257- 5264. https://doi.Org/10.1128/JB 00254-07). The gene can also be expressed by integration into the chromosome in a single copy (P. Vasicova 1999, J. Bacteriol. 181: 6188-91) or in a multiple copy (D. Reinscheid 1994 Appl. Environ Microbiol 60: 126-132). The desired strain is transformed with a vector by conjugation or electroporation of the desired strain, for example C. glutamicum. The conjugation method is described, for example, by Schäfer et al. (Applied and Environmental Microbiology (1994) 60: 756-759). Methods of transformation are, for example, in Tauch et al. (FEMS Microbiological Leiters (1994) 123: 343-347).
Neben erfindungsgemäß bevorzugten partiellen oder kompletten Deletionen kodierender Nukleinsäure Sequenzen und/oder regulatorischer Strukturen sind erfindungsgemäß auch Veränderungen, wie z. B. Transitionen, Transversionen oder Insertionen umfasst, sowie Methoden der gerichteten Evolution. Anleitungen zur Erzeugung derartiger Veränderungen können bekannten Lehrbüchern (R. Knippers„Molekulare Genetik“, 8. Auflage, 2001 , Georg Thieme Verlag, Stuttgart, Deutschland) entnommen werden. Bevorzugt sind erfindungsgemäß Nukleinsäuresubstitutionen oder Deletionen. In addition to partial or complete deletions coding nucleic acid sequences and / or regulatory structures preferred according to the invention, changes such as e.g. B. includes transitions, transversions or insertions, as well as methods of directed evolution. Instructions for generating such changes can be found in well-known textbooks (R. Knippers "Molecular Genetics", 8th edition, 2001, Georg Thieme Verlag, Stuttgart, Germany). According to the invention, nucleic acid substitutions or deletions are preferred.
Im Sinne der vorliegenden Erfindung bezieht sich eine„verminderte oder ausgeschaltete Funktionalität“ nicht nur auf die Funktionalität eines Gens oder Proteins, sondern auch auf eine veränderte Funktionalität von Regulator-Bindungsstellen, wie z. B. die Operatorbindestelle fasO, an die normalerweise ein zentral-agierendes Regulator-Protein, wie z. B. fasR bindet, und wodurch die Expression der kodierenden Nukleinsäuresequenz reprimiert wird.„Vermindert“ oder„ausgeschaltet“ im Sinne der vorliegenden Erfindung meint somit auch, dass die Expression der kodierenden Nukleinsäuresequenz im Vergleich zur Situation in einer Wildtyp- oder Urtyp-Wirtszelle im Sinne der Erfindung schlechter erfolgt oder nicht mehr unter der Expressionskontrolle des Regulators steht. Im Sinne der vorliegenden Erfindung ist „vermindert“ oder „ausgeschaltet“, gleichbedeutend für „dereguliert“ oder „dereprimiert“ zu versehen. Eine „dereprimierte Funktionalität“ einer Regulator-Bindestelle kann somit im Sinne der Erfindung auch zu einer erhöhten Expression des betreffenden, nachfolgenden Gens führen. In the sense of the present invention, a “reduced or deactivated functionality” refers not only to the functionality of a gene or protein, but also to a changed functionality of regulator binding sites, such as, for example, B. the operator binding site fasO, to which normally a centrally acting regulatory protein, such as. B. fasR binds, and thereby the expression of the coding nucleic acid sequence is repressed. “Decreased” or “switched off” in the sense of the present invention also means that the expression of the coding nucleic acid sequence in comparison to the situation in a wild-type or primary-type host cell in the For the purposes of the invention, this has been done poorly or is no longer under the expression control of the regulator. For the purposes of the present invention, “reduced” or “switched off”, equivalent to “deregulated” or “derepressed”, is to be provided. A "derepressed functionality" of a regulator binding site can therefore also lead to an increased expression of the relevant subsequent gene in the sense of the invention.
Im Sinne der vorliegenden Erfindung bezieht sich eine„verminderte oder ausgeschaltete Funktionalität“ auch auf eine veränderte Funktionalität von Promotorbereichen in der 5‘- regulatorischen Region vor einem kodierenden Gen. Veränderungen der„Funktionalität“ können die Aktivität des Promotors verstärkten oder aber auch vermindern. In einer erfindungsgemäßen Variante wird ein Promotor, wie z. B. vor dem Gen gtIA kodierend für die Citratsynthase in seiner Funktion und damit Aktivität vermindert. Dies hat zur Folge, dass das durch diesen Promotor kodierte Gen schwächer exprimiert wird. Die Regulationsmechanismen und ihre Auswirkungen bei Veränderung sind dem Fachmann in allen Varianten vertraut. In the sense of the present invention, a “reduced or deactivated functionality” also refers to a changed functionality of promoter regions in the 5 ′ regulatory region in front of a coding gene. Changes in "functionality" can increase or decrease the activity of the promoter. In a variant according to the invention, a promoter, such as. B. before the gene gtIA coding for citrate synthase in its function and thus activity reduced. As a result, the gene encoded by this promoter is expressed more weakly. The regulation mechanisms and their effects in the event of changes are familiar to the skilled worker in all variants.
Die vorliegende Erfindung meint mit dem Begriff „Modifikation“ eine „Veränderung“ beispielsweise auch„genetische Veränderung“, wobei erfindungsgemäß gemeint ist, dass zwar eine gentechnische Methode angewandt wird, aber keine Insertionen von Nukleinsäuremolekülen erzeugt werden. Im Sinne der Erfindung sind mit„Modifikationen“ oder „Veränderungen“ Substitutionen und/oder Deletionen gemeint, bevorzugt Substitutionen.„Modifikation“„.Veränderung“ oder„genetische Veränderung“ im Sinne der vorliegenden Erfindung werden auch in einem regulatorischen, nicht-kodierenden Bereich der erfindungsgemäßen Nukleinsäuren erzeugt. Es sind alle denkbaren Positionen in einem regulatorischen Bereich kodierender Gene oder Gen-Cluster im Sinne der Erfindung gemeint und umfasst, deren Veränderungen eine messbare Auswirkung auf die Funktionalität der fasO-Bindungsstellen und fasR-Bindung, im Sinne von„vermindert“ oder„ausgeschaltet“, hat. With the term “modification”, the present invention means “change”, for example also “genetic change”, whereby according to the invention it is meant that although a genetic engineering method is used, no insertions of nucleic acid molecules are generated. For the purposes of the invention, “modifications” or “changes” mean substitutions and / or deletions, preferably substitutions “modification” “. change” or “genetic change” in the sense of the present invention are also generated in a regulatory, non-coding region of the nucleic acids according to the invention. All conceivable positions in a regulatory area of coding genes or gene clusters are meant and encompassed in the sense of the invention, the changes of which have a measurable effect on the functionality of the fasO binding sites and fasR binding, in the sense of “reduced” or “switched off” , Has.
Gegenstand der vorliegenden Erfindung ist auch ein Protein kodierend für eine Fettsäuresynthase FasB isoliert aus coryneformen Bakterien, deren Funktionalität vermindert oder ausgeschaltet ist und mit der eine erhöhte Bereitstellung von Malonyl-CoA in coryneformen Bakterien ermöglicht wird, die Aminosäuresequenz wenigstens 70% Identität zu der Aminosäuresequenz ausgewählt aus der Gruppe enthaltend SEQ ID NO. 2, 4, 6, 8 und 10 oder Fragmenten oder Allelen davon aufweist. Erfindungsgemäß umfasst ist auch eine Fettsäuresynthase FasB mit einer Aminosäuresequenz ausgewählt aus der Gruppe enthaltend SEQ ID NO. 2, 4, 6, 8 und 10 oder Fragmenten oder Allelen davon. Ferner ist eine Fettsäuresynthase kodiert durch eine Nukleinsäuresequenz enthaltend wenigstens 70% Identität zu der Nukleinsäuresequenz ausgewählt aus der Gruppe SEQ ID NO. 1 , 3, 5, 7 und 9 oder Fragmente davon erfindungsgemäß umfasst. Die vorliegende Erfindung umfasst auch eine Fettsäuresynthase kodiert durch eine Nukleinsäuresequenz ausgewählt aus der Gruppe SEQ ID NO. 1 , 3, 5, 7 und 9 oder Fragmente davon. The present invention also relates to a protein coding for a fatty acid synthase FasB isolated from coryneform bacteria, the functionality of which is reduced or switched off and with which an increased provision of malonyl-CoA in coryneform bacteria is made possible, the amino acid sequence selected at least 70% identity to the amino acid sequence from the group containing SEQ ID NO. 2, 4, 6, 8 and 10 or fragments or alleles thereof. The invention also includes a fatty acid synthase FasB with an amino acid sequence selected from the group comprising SEQ ID NO. 2, 4, 6, 8 and 10 or fragments or alleles thereof. Furthermore, a fatty acid synthase is encoded by a nucleic acid sequence containing at least 70% identity to the nucleic acid sequence selected from the group SEQ ID NO. 1, 3, 5, 7 and 9 or fragments thereof according to the invention. The present invention also comprises a fatty acid synthase encoded by a nucleic acid sequence selected from the group SEQ ID NO. 1, 3, 5, 7 and 9 or fragments thereof.
Erfindungsgemäß umfasst sind auch Proteine kodierend für eine Aminosäuresequenz mit wenigstens 75 oder 80%, bevorzugt wenigstens 81 , 82, 83, 84, 85 oder 86% Identität, be- sonders bevorzugt 87, 88, 89, 90 % Identität, ganz besonders bevorzugt wenigstens 91 , 92, 93, 94, 95 % Identität oder höchst bevorzugt 96, 97, 98, 99 oder 100% Identität zu der Ami- nosäuresequenz gemäß SEQ ID NO. 2, 4, 6, 8 und 10 oder Fragmenten oder Allelen davon. Im Weiteren betrifft die vorliegende Erfindung eine Fettsäuresynthase FasB enthaltend eine Aminosäuresequenz gemäß SEQ ID NO. 2, 4, 6, 8 und 10 oder Fragmente oder Allele da- von. Proteins coding for an amino acid sequence with at least 75 or 80%, preferably at least 81, 82, 83, 84, 85 or 86% identity, particularly preferably 87, 88, 89, 90% identity, very particularly preferably at least, are also encompassed according to the invention 91, 92, 93, 94, 95% identity or most preferably 96, 97, 98, 99 or 100% identity to the amino acid sequence according to SEQ ID NO. 2, 4, 6, 8 and 10 or fragments or alleles thereof. Furthermore, the present invention relates to a fatty acid synthase FasB containing an amino acid sequence according to SEQ ID NO. 2, 4, 6, 8 and 10 or fragments or alleles thereof.
Gegenstand der vorliegenden Erfindung ist auch eine Nukleinsäuresequenz kodierend für eine Fettsäure-Synthase FasB aus coryneformen Bakterien, deren Funktionalität vermindert oder ausgeschaltet ist, ausgewählt aus der Gruppe enthaltend: a) eine Nukleinsäuresequenz enthaltend wenigstens 70% Identität zu der Nukleinsäuresequenz ausgewählt aus der Gruppe SEQ ID NO. 1 , 3, 5, 7 und 9 oder Fragmente davon, b) eine Nukleinsäuresequenz, die unter stringenten Bedingungen mit einer komplementären Sequenz einer Nukleinsäuresequenz ausgewählt aus der Gruppe SEQ ID NO. 1 , 3, 5, 7 und 9 oder Fragmenten davon hybridisiert, c) eine Nukleinsäuresequenz ausgewählt aus der Gruppe SEQ ID NO. 1 , 3, 5, 7 und 9 oder Fragmente davon, oder d) eine Nukleinsäuresequenz kodierend für eine Fettsäure-Synthase FasB entsprechend jeder der Nukleinsäuren gemäß a) - c) , die sich jedoch von diesen Nukleinsäure Sequenzen gemäß a) - c) durch die Degeneriertheit des genetischen Codes oder funktionsneutrale Mutationen unterscheidet, zur erhöhten Bereitstellung von Malonyl-CoA in coryneformen Bakterien. The present invention also relates to a nucleic acid sequence coding for a fatty acid synthase FasB from coryneform bacteria, the functionality of which is reduced or switched off, selected from the group comprising: a) a nucleic acid sequence containing at least 70% identity to the nucleic acid sequence selected from the group SEQ ID NO. 1, 3, 5, 7 and 9 or fragments thereof, b) a nucleic acid sequence which, under stringent conditions, with a complementary sequence of a nucleic acid sequence selected from the group SEQ ID NO. 1, 3, 5, 7 and 9 or fragments thereof hybridized, c) a nucleic acid sequence selected from the group SEQ ID NO. 1, 3, 5, 7 and 9 or fragments thereof, or d) a nucleic acid sequence coding for a fatty acid synthase FasB corresponding to each of the nucleic acids according to a) - c), but which differs from these nucleic acid sequences according to a) - c) distinguishes the degeneracy of the genetic code or functionally neutral mutations, for the increased provision of malonyl-CoA in coryneform bacteria.
Gegenstand der Erfindung ist auch eine Fettsäuresynthase FasB kodiert durch eine Nukleinsäuresequenz enthaltend wenigstens 70% Identität zu der Nukleinsäuresequenz gemäß SEQ ID NO. 1 , 3, 5, 7 und 9 oder Fragmente davon. Erfindungsgemäß umfasst sind auch Nukleinsäure Sequenzen, welche wenigstens eine 75% oder 80%, bevorzugt wenigstens 81 , 82, 83, 84, 85 oder 86% Identität, besonders bevorzugt 87, 88, 89, 90 % Identität, ganz besonders bevorzugt wenigstens 91 , 92, 93, 94, 95 % Identität oder höchst bevorzugt 96, 97, 98, 99 oder 100% Identität zu der Nukleinsäuresequenz gemäß SEQ ID NO. 1 , 3, 5, 7 und 9 oder Fragmenten davon aufweist. Im Weiteren betrifft die vorliegende Erfindung eine Fettsäuresynthase FasB kodiert durch eine Nukleinsäuresequenz gemäß SEQ ID NO. 1 , 3, 5, 7 und 9 oder Fragmente davon. The invention also relates to a fatty acid synthase FasB encoded by a nucleic acid sequence containing at least 70% identity to the nucleic acid sequence according to SEQ ID NO. 1, 3, 5, 7 and 9 or fragments thereof. The invention also includes nucleic acid sequences which have at least one 75% or 80%, preferably at least 81, 82, 83, 84, 85 or 86% identity, particularly preferably 87, 88, 89, 90% identity, very particularly preferably at least 91, 92, 93, 94, 95% identity or most preferably 96, 97, 98, 99 or 100% identity to the nucleic acid sequence according to SEQ ID NO. 1, 3, 5, 7 and 9 or fragments thereof. Furthermore, the present invention relates to a fatty acid synthase FasB encoded by a nucleic acid sequence according to SEQ ID NO. 1, 3, 5, 7 and 9 or fragments thereof.
Erfindungsgemäß umfasst ist auch eine coryneforme Bakterienzelle, die ein Protein kodierend für eine Fettsäuresynthase FasB mit verminderter oder ausgeschalteter Funktionalität aufweist bzw. eine Nukleinsäuresequenz kodierend für eine Fettsäuresynthase FasB mit der zuvor benannten veränderten Funktionalität. The invention also encompasses a coryneform bacterial cell which has a protein coding for a fatty acid synthase FasB with reduced or deactivated functionality or a nucleic acid sequence coding for a fatty acid synthase FasB with the previously mentioned changed functionality.
In einer Variante der vorliegenden Erfindung ist auch eine coryneforme Bakterienzelle umfasst, die eine oder mehrere gezielte Modifikationen aufweist, ausgewählt aus der Gruppe enthaltend a) Verminderte oder ausgeschaltete Funktionalität der Fettsäuresynthase FasB mit wenigstens 70% Identität zu der Aminosäuresequenz ausgewählt aus der Gruppe enthaltend SEQ ID NO. 2, 4, 6, 8 und 10 oder Fragmenten oder Allelen davon; b) Mutation oder teilweise oder komplette Deletion des für die Fettsäuresynthase kodierende Gen fasB mit einer Nukleinsäuresequenz enthaltend wenigstens 70% Identität zu der Nukleinsäuresequenz ausgewählt aus der Gruppe SEQ ID NO. 1 , 3, 5, 7 und 9 oder Fragmente davon; c) Verminderte Funktionalität des mit dem Citratsynthase-Gen gltA operativverknüpften Promotors gemäß SEQ ID NO. 11 ; d) Verminderte Expression des für die Citratsynthase (CS) kodierende Gens gltA; e) Verminderte oder ausgeschaltete Funktionalität der Operator-Bindestellen (fasO) für den Regulator FasR in den Promotorbereichen der Gene accBC und accD1 kodierend für die Acetyl-CoA-Carboxylase-Untereinheiten gemäß SEQ ID NO. 13 und 15; f) Dereprimierte Expression der für die Acetyl-CoA-Carboxylase-Untereinheiten kodierenden Gene accBC und accD1 ; g) eine oder mehrere Kombinationen aus a) - f). In a variant of the present invention, a coryneform bacterial cell is also included, which has one or more targeted modifications, selected from the group comprising a) Reduced or deactivated functionality of the fatty acid synthase FasB with at least 70% identity to the amino acid sequence selected from the group containing SEQ ID NO. 2, 4, 6, 8 and 10 or fragments or alleles thereof; b) mutation or partial or complete deletion of the gene fasB coding for the fatty acid synthase with a nucleic acid sequence containing at least 70% identity to the nucleic acid sequence selected from the group SEQ ID NO. 1, 3, 5, 7 and 9 or fragments thereof; c) Reduced functionality of the promoter operatively linked to the citrate synthase gene gltA according to SEQ ID NO. 11; d) reduced expression of the gene coding for citrate synthase (CS) gltA; e) Reduced or deactivated functionality of the operator binding sites (fasO) for the regulator FasR in the promoter regions of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits according to SEQ ID NO. 13 and 15; f) Depressed expression of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits; g) one or more combinations of a) - f).
In Varianten der vorliegenden Erfindung sind auch Proteine der Fettsäuresynthase FasB aus coryneformen Bakterien und/oder Nukleinsäure Sequenzen kodierend eine Fettsäuresynthase FasB aus coryneformen Bakterien umfasst, bei denen Nukleotidsubstitutionen und entsprechend korrespondierende Aminsäureaustausche vorliegen. Solche Varianten sind in den Ausführungsbeispielen erläutert, die sich aber nicht limitierend auf die vorliegende Erfindung auswirken. In variants of the present invention, proteins of the fatty acid synthase FasB from coryneform bacteria and / or nucleic acid sequences encoding a fatty acid synthase FasB from coryneform bacteria are also encoded, in which nucleotide substitutions and corresponding amino acid exchanges are present. Such variants are explained in the exemplary embodiments, which, however, do not have a limiting effect on the present invention.
In Varianten der vorliegenden Erfindung ist auch der mit dem Citratsynthase-Gen gltA operativ-verknüpfte Promotor in seiner Funktionalität vermindert. Dazu können erfindungsgemäß Nukelotidsubstitutionen in den für die Bindung der Polymerase verantwortlichen Bindestellen erfolgen, oder ein Austausch einer gesamten Promotorsequenz eines schwächeren Promotors gegen die natürlicherweise vorkommende Promotorsequenz erfolgen, oder eine Kombination aus beiden, wobei ein schwächerer Promotor zusätzlich durch Nukleotidsubstitution weiter abgeschwächt wird. Da es sich erfindungsgemäß um gezielte Nukleotidaustausche des gleichen, homologen Wirtsorganismus handelt, ist der resultierende Organismus erfindungsgemäß nicht- rekombinant verändert. In variants of the present invention, the functionality of the promoter operatively linked to the citrate synthase gene gltA is also reduced. For this purpose, according to the invention, nucleotide substitutions can take place in the binding sites responsible for the binding of the polymerase, or an entire promoter sequence of a weaker promoter can be exchanged for the naturally occurring promoter sequence, or a combination of both, a weaker promoter being additionally weakened by nucleotide substitution. Since, according to the invention, targeted nucleotide exchanges of the same, homologous host organism are involved, the resulting organism is non-recombinantly changed according to the invention.
Unter„homolog“ im Sinne der Erfindung ist zu verstehen, dass die erfindungsgemäßen En- zyme und die sie kodierenden erfindungsgemäßen Nukleinsäure Sequenzen und die erfin- dungsgemäßen mit diesen regulatorisch-verknüpften nicht-kodierenden Nukleinsäure Se quenzen verwandtschaftlich von einem gemeinsamen Ausgangsstamm coryneformer Bakte rienzellen abstammen.„Homolog“ wird erfindungsgemäß synonym benutzt mit dem Begriff „nicht heterolog“. “Homologous” in the sense of the invention means that the enzymes according to the invention and the nucleic acid sequences according to the invention coding for them and the invented According to the invention, these regulatory-linked non-coding nucleic acid sequences are related to a common starting strain of coryneform bacterial cells. According to the invention, "homolog" is used synonymously with the term "non-heterologous".
Der Begriff „Nukleinsäuresequenz“ im Sinne der vorliegenden Erfindung meint jede homologe molekulare Einheit, die genetische Information transportiert. Dies betrifft entsprechend ein homologes Gen, bevorzugt ein natürlicherweise vorkommendes und/oder nicht-rekombinantes homologes Gen, ein homologes Transgen oder Codon-optimierte homologe Gene. Der Begriff„Nukleinsäuresequenz“ bezieht sich erfindungsgemäß auf eine Nukleinsäuresequenz oder Fragmente oder Allele davon, die ein spezifisches Protein kodiert bzw. exprimiert. Bevorzugt bezieht sich der Begriff „Nukleinsäuresequenz“ auf eine Nukleinsäuresequenz enthaltend regulatorische Sequenzen, die der kodierenden Sequenz vorangehen (upstream, stromaufwärts, 5’-nicht-kodierende Sequenz) und nachfolgen (downstream, stromabwärts, 3'-nicht-kodierende Sequenz). Der Begriff „natürlicherweise vorkommendes“ Gen betrifft ein in der Natur gefundenes Gen, z.B. aus einem Wildtyp- Stamm einer coryneformen Bakterienzelle, mit seinen eigenen regulatorischen Sequenzen. The term “nucleic acid sequence” in the sense of the present invention means any homologous molecular unit that transports genetic information. This applies accordingly to a homologous gene, preferably a naturally occurring and / or non-recombinant homologous gene, a homologous transgene or codon-optimized homologous genes. According to the invention, the term “nucleic acid sequence” refers to a nucleic acid sequence or fragments or alleles thereof which encode or express a specific protein. The term “nucleic acid sequence” preferably refers to a nucleic acid sequence containing regulatory sequences which precede the coding sequence (upstream, upstream, 5 ' non-coding sequence) and follow it (downstream, downstream, 3 ' non-coding sequence). The term “naturally occurring” gene refers to a gene found in nature, for example from a wild-type strain of a coryneform bacterial cell, with its own regulatory sequences.
Der Begriff „operativ-verknüpfter Bereich“ betrifft im Sinne der vorliegenden Erfindung eine Assoziation von Nukleinsäure Sequenzen auf einem einzelnen Nukleinsäure-Fragment, so dass die Funktion der einen Nukleinsäuresequenz durch die Funktion der anderen Nukleinsäuresequenz beeinflusst ist. Im Kontext eines Promotors oder einer Bindungsstelle für ein Regulator-Protein meint der Begriff„operativ-verknüpft“ im Sinne der Erfindung, dass die kodierende Sequenz unter der Kontrolle der regulatorischen Region (insbesondere des Promotors oder der Regulator-Bindestelle) steht, die die Expression der kodierenden Sequenz reguliert. For the purposes of the present invention, the term “operatively linked region” relates to an association of nucleic acid sequences on a single nucleic acid fragment, so that the function of one nucleic acid sequence is influenced by the function of the other nucleic acid sequence. In the context of a promoter or a binding site for a regulatory protein, the term “operatively linked” in the sense of the invention means that the coding sequence is under the control of the regulatory region (in particular the promoter or the regulatory binding site) that controls the expression the coding sequence regulated.
Erfindungsgemäß wird auch eine neue fasO-Bindestelle 5‘- operativ-verknüpft vor dem accD1~Gen coryneformer Bakterien zur Verfügung gestellt. In Varianten der vorliegenden Erfindung ist auch eine verminderte oder ausgeschaltete Funktionalität der Operator- Bindestellen (fasO) für den Regulator FasR in den Promotorbereichen der Gene accBC und accD1 kodierend für die Acetyl-CoA-Carboxylase-Untereinheiten umfasst. Diese zeichnet sich in vorteilhafter Weise dadurch aus, dass sie unter Berücksichtigung der Aminosäuresequenz und der bestmöglichen Codonverwendung in coryneformen Bakterien eine maximale Abweichung von der nativen fasO Sequenz: MTISSPX aufweist (Figur 23). Dabei liegen in der fasO-Bindestelle vor accBC an den Positionen 1 1-13 (tga -> gtc) und 20- 22 (cct -> aag) Nukleotidsubstitutionen vor. In der fasO-Bindestelle vor accD1 liegen an den Positionen 20-24 (cctca -> gtacg) Nukleotidsubstitutionen vor. Gegenstand der vorliegenden Erfindung ist somit auch eine Nukleinsäuresequenz für eine operativ-verknüpfte fasO-Bindestelle im regulatorischen, nicht-kodierenden Bereich 5' vor dem accD1-Gen aus coryneformen Bakterien, die Nukleotidsubstitutionen gemäß SEQ ID NO. 15 aufweist. Aufgrund der in ihrer Funktionalität veränderten fasO-Bindestelle ist eine Bindung des FasR-Regulatorproteins nicht mehr möglich und führt zu einer Deregulation der Expression des accD1-Gens, resultierend in einer gesteigerten Expression der Untereinheit accD1. In Kombination mit einer erfindungsgemäßen deregulierten, d.h. gesteigerten, Expression der Untereinheit accBC führt dies erfindungsgemäß zu einer erhöhten Bereitstellung von Malonyl-CoA in coryneformen Bakterien. According to the invention, a new fasO binding site 5 'operatively linked is provided in front of the accD1 ~ gene of coryneform bacteria. Variants of the present invention also include a reduced or deactivated functionality of the operator binding sites (fasO) for the regulator FasR in the promoter regions of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits. This is advantageously characterized in that, taking into account the amino acid sequence and the best possible codon use in coryneform bacteria, it exhibits a maximum deviation from the native fasO sequence: MTISSPX (FIG. 23). There are nucleotide substitutions in positions 1 1-13 (tga -> gtc) and 20-22 (cct -> aag) in the fasO binding site in front of accBC. In the fasO binding site in front of accD1 there are nucleotide substitutions at positions 20-24 (cctca -> gtacg). The present invention thus also relates to a nucleic acid sequence for an operatively linked fasO binding site in the regulatory, non-coding region 5 'in front of the accD1 gene from coryneform bacteria, the nucleotide substitutions according to SEQ ID NO. 15 has. Due to the functionality of the fasO binding site, binding of the FasR regulator protein is no longer possible and leads to a deregulation of the expression of the accD1 gene, resulting in an increased expression of the subunit accD1. In combination with a deregulated, ie increased, expression of the accBC subunit according to the invention, this leads according to the invention to an increased provision of malonyl-CoA in coryneform bacteria.
Gegenstand der vorliegenden Erfindung ist auch eine coryneforme Bakterienzelle, bei der die erfindungsgemäßen Modifikationen in vorteilhafter Weise chromosomal-kodiert vorliegen. Erfindungsgemäß umfasst ist auch eine coryneforme Bakterienzelle, die nicht-rekombinant (non-GVO) ist. The present invention also relates to a coryneform bacterial cell in which the modifications according to the invention are advantageously chromosomally encoded. The invention also includes a coryneform bacterial cell that is non-recombinant (non-GMO).
Unter dem Begriff„nicht-rekombinant“ ist im Sinne der vorliegenden Erfindung zu verstehen, dass das genetische Material der erfindungsgemäßen coryneformen Bakterienzellen lediglich so verändert ist, wie es auf natürliche Weise, z.B. durch natürliche Rekombination oder natürliche Mutation, entstehen könnte. Die erfindungsgemäßen coryneformen Bakterienzellen zeichnen sich somit als nicht-gentechnisch veränderter Organismus (non- GVO) aus. In the context of the present invention, the term “non-recombinant” is to be understood to mean that the genetic material of the coryneform bacterial cells according to the invention is only changed in the way that it occurs naturally, e.g. through natural recombination or natural mutation. The coryneform bacterial cells according to the invention are thus distinguished as a non-genetically modified organism (non-GMO).
Dies eröffnet auch die Möglichkeit, industriell interessante Produktionsstämme coryneformer Bakterien weiter zu optimieren, ohne rekombinantes oder heterologes Genmaterial in die Zelle einbringen zu müssen. Die vorliegende Erfindung stellt somit ein System bereit, mit dem die mikrobielle Produktion von Malonyl-CoA deutlich einfacher, stabiler, preiswerter und wirtschaftlicher durchgeführt werden kann. Denn alle bislang bekannten Bakterienstämme mit einer Malonyl-CoA-Synthesekapazität benötigen komplexe Medien für ihr Wachstum, wodurch die Kultivierung deutlich aufwendiger, teurer und damit unwirtschaftlicher wird. Hier sei vor allem der Zusatz von Inhibitoren der Fettsäuresynthese, wie z. B. Cerulenin, genannt, das sehr teuer ist und somit für den Einsatz in einem großtechnischen Herstellungsverfahren nicht geeignet ist. Außerdem sind alle bisher beschriebenen Malonyl-CoA-Produzenten keine GRAS-Organismen. Dadurch entsteht ein Nachteil für die Verwendung in bestimmten industriellen Bereichen (z. B. Lebensmittel- und Pharmaindustrie) infolge aufwändiger Genehmigungsverfahren. This also opens up the possibility of further optimizing industrially interesting production strains of coryneform bacteria without having to introduce recombinant or heterologous genetic material into the cell. The present invention thus provides a system with which the microbial production of malonyl-CoA can be carried out in a significantly simpler, more stable, cheaper and more economical manner. Because all previously known bacterial strains with a malonyl-CoA synthesis capacity require complex media for their growth, which makes cultivation significantly more complex, expensive and therefore uneconomical. Here is especially the addition of inhibitors of fatty acid synthesis, such as. B. Cerulenin called, which is very expensive and is therefore not suitable for use in an industrial manufacturing process. In addition, all malonyl-CoA producers described so far are not GRAS organisms. This creates a disadvantage for use in certain industrial areas (e.g. food and pharmaceutical industries) due to complex approval procedures.
Die erfindungsgemäße coryneforme Bakterienzelle bietet eine Vielzahl von Vorteilen, von denen eine Auswahl nachfolgend beschrieben wird. Bei coryneformen Bakterien, bevorzugt der Gattung Corynebacterium, handelt es sich um einen„Generally Recognized As Safe“ (GRAS)-Organismus, welcher in allen industriellen Bereichen eingesetzt werden kann. Coryneforme Bakterien erreichen auf definierten Medien hohe Wachstumsraten und Biomasseerträge (Grünberger et al. , 2012) und es existiert umfangreiche Erfahrung im industriellen Einsatz coryneformer Bakterien (Becker et al., 2012). The coryneform bacterial cell according to the invention offers a multitude of advantages, a selection of which is described below. Coryneform bacteria, preferably of the genus Corynebacterium, are generally recognized as safe (GRAS) organism that can be used in all industrial areas. Coryneform bacteria achieve high growth rates and biomass yields on defined media (Grünberger et al., 2012) and there is extensive experience in the industrial use of coryneform bacteria (Becker et al., 2012).
Erfindungsgemäß sind coryneforme Bakterien der Gattung Corynebacterium oder Brevibacterium umfasst. Erfindungsgemäße Variante coryneformer Bakterien sind ausgewählt aus der Gruppe enthaltend Corynebacterium und Brevibacterium, bevorzugt Corynebacterium glutamicum, besonders bevorzugt Corynebacterium glutamicum ATCC 13032, Corynebacterium acetoglutamicum, Corynebacterium thermoaminogenes, Brevibacterium flavum, Brevibacterium lactofermentum oder Brevibacterium divaricatum. Erfindungsgemäß umfasst ist auch eine coryneforme Bakterienzelle ausgewählt aus der Gruppe enthaltend Corynebacterium glutamicum ATCC13032 oder gezielt veränderten Abkömmlingen oder Urtypen, Corynebacterium acetoglutamicum ATCC15806, Corynebacterium acetoacidophilum ATCC 13870, Corynebacterium thermoaminogenes FERM BP-1539, Brevibacterium flavum ATCC14067, Brevibacterium lactofermentum ATCC13869, Brevibacterium divaricatum ATCC14020. According to the invention, coryneform bacteria of the genus Corynebacterium or Brevibacterium are included. Variants of coryneform bacteria according to the invention are selected from the group comprising Corynebacterium and Brevibacterium, preferably Corynebacterium glutamicum, particularly preferably Corynebacterium glutamicum ATCC 13032, Corynebacterium acetoglutamicum, Corynebacterium thermoaminogenes, Brevibacterium flavumacterium or Brevibacterium lactofer. According to the invention, a coryneform bacterial cell is also selected from the group comprising Corynebacterium glutamicum ATCC13032 or specifically modified descendants or primary types, Corynebacterium acetoglutamicum ATCC15806, Corynebacterium acetoacidophilum ATCC 13870, Corynebacterium thermoaminogenium flavib150 Breib1, Brex1, Brex, Brex, Brex, Bacterium, Brex, Brex, Bacterium, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Bre, 15, Brex, Brex, Brex, Brex, Brex, Brex, Brex, Breq
Erfindungsgemäß umfasst ist auch eine coryneforme Bakterienzelle mit einer oder mehrerer der zuvor genannten erfindungsgemäßen Modifikationen ausgehend von Corynebacterium glutamicum, bevorzugt Corynebacterium glutamicum ATCC13032, bei der außerdem zusätzlich der katabole Stoffwechselweg von aromatischen Komponenten, bevorzugt ausgewählt aus der Gruppe enthaltend Phenylpropanoide und Benzoesäure-Derivate, ausgeschaltet ist. The invention also includes a coryneform bacterial cell with one or more of the above-mentioned modifications according to the invention, starting from Corynebacterium glutamicum, preferably Corynebacterium glutamicum ATCC13032, in which the catabolic pathway of aromatic components, preferably selected from the group comprising phenylpropanoids and benzoic acid derivatives, is additionally switched off is.
Weitere erfindungsgemäße Varianten einer coryneformen Bakterienzelle zeichnet sich dadurch aus, dass die Funktionalität und/oder Aktivität der Enzyme oder die Expression der sie kodierenden Gene beteiligt am katabolen Stoffwechselweg von aromatischen Komponenten durch Deletionen der Gencluster cg0344-47 (phdBCDE-Operon ), cg2625-40 (cat, ben und pca), cg1226 ( pobA ) und cg0502 ( qsuB ) ausgeschaltet sind. Diese erfindungsgemäßen Zellen sind zielgerichtet verändert und nicht durch ungezielte Mutagenese entstanden. Sie zeichnen sich in vorteilhafter Weise dadurch aus, dass sie genetisch genau charakterisiert sind und die genannten Modifikationen durch Deletionen erzielt werden. Diese Deletionen liegen erfindungsgemäß chromosomal-kodiert vor. Somit weisen diese Zellen ausschließlich homologe DNA auf und sie sind nicht-rekombinant verändert. Dies zeichnet sie, zusätzlich zu der Eigenschaft zu den GRAS-Organismus zu zählen, in vorteilhafter Weise für eine mikrobielle Herstellung von Produkten, wie z. B. sekundären Pflanzenmetaboliten, aus. Denn die erfindungsgemäße coryneforme Bakterienzelle ist in vorteilhafter Weise auch dadurch charakterisiert, dass sie zur erhöhten Bereitstellung von Malonyl-CoA keine extrachromosomale DNA, wie z. B. Plasmide oder Vekoren, benötigt. Erstens sind Bakterien-Stämme mit mehr als 2 Plasmiden oder mehr als 2 Genen pro Plasmid in der Regel nicht stabil, zweitens muss bedacht werden, dass die erfindungsgemäß umfasste mikrobielle Herstellung von komplexen Sekundärmetaboliten in Bakterien eine heterologe Expression der entsprechenden pflanzlichen Gene zur Polyphenol- und/oder Polyketid-Herstellung erfordert und drittens sollten diese gewünschten Produkte oder ihre Vorstufen nicht durch zelleigene Aktivitäten, wie z.B. den enzymatischen Abbau aromatischer Komponenten, wieder zersetzt werden. Daher ist eine weitere, sehr komplexe Aufgabe der vorliegenden Erfindung, nämlich ein System für die erhöhte Bereitstellung von Malonyl-CoA in coryneformen Bakterien bereitzustellen, ohne plasmid- kodierte Veränderungen vornehmen zu müssen und dabei gleichzeitig den Abbau der gewünschten Aromaten-enthaltende Produkte und deren Vorstufen in coryneformen Bakterien zu unterbinden, in sehr vorteilhafter Weise durch die erfindungsgemäßen corynformen Bakterienzellen gelöst. Dieses erfindungsgemäß sehr vorteilhafte System einer coryneformen Bakterienzelle erlaubt so große Freiheitsgrade, welche pflanzlichen oder anderen heterologen Gene extrachromosomal in das System eingebracht werden können, um so eine stabile, mikrobielle Herstellung von pflanzlichen Sekundärmetaboliten zu ermöglichen. Further variants of a coryneform bacterial cell according to the invention are characterized in that the functionality and / or activity of the enzymes or the expression of the genes encoding them participates in the catabolic pathway of aromatic components by deletions of the gene clusters cg0344-47 (phdBCDE operon), cg2625-40 (cat, ben and pca), cg1226 (pobA) and cg0502 (qsuB) are switched off. These cells according to the invention have been changed in a targeted manner and have not arisen through untargeted mutagenesis. They are characterized in an advantageous manner in that they are genetically precisely characterized and the modifications mentioned are achieved by deletions. According to the invention, these deletions are chromosomally encoded. Thus, these cells only have homologous DNA and they are non-recombinantly modified. This distinguishes them, in addition to being a GRAS organism, advantageously for microbial production of products such as B. secondary plant metabolites. This is because the coryneform bacterial cell according to the invention is also advantageously characterized in that it does not contain any extrachromosomal DNA, such as, for example, for increased provision of malonyl CoA. B. plasmids or vectors needed. First, bacterial strains with more than 2 plasmids or more than 2 genes per plasmid are generally not stable; second, it must be borne in mind that the microbial production of complex secondary metabolites in bacteria, which is the subject of the invention, is a heterologous expression of the corresponding plant genes for polyphenol and / or polyketide production and thirdly, these desired products or their precursors should not be decomposed again by cell-specific activities, such as, for example, the enzymatic degradation of aromatic components. A further, very complex object of the present invention is therefore to provide a system for the increased provision of malonyl-CoA in coryneform bacteria without having to make plasmid-coded changes and at the same time to break down the desired aromatics-containing products and their precursors to prevent in coryneform bacteria, solved in a very advantageous manner by the corynform bacterial cells according to the invention. This system of a coryneform bacterial cell, which is very advantageous according to the invention, permits great degrees of freedom which plant or other heterologous genes can be introduced into the system extrachromosomally in order to enable stable, microbial production of plant secondary metabolites.
Gegenstand der vorliegenden ist auch eine coryneforme Bakterienzelle, die sich dadurch auszeichnet, dass sie unabhängig von der Zugabe von Fettsäuresynthese-Inhibitoren eine erhöhte intrazelluläre Konzentration an Malonyl-CoA bereitstellt. Diese erhöhte Bereitstellung von Malonyl-CoA als zentralem Intermediat kann erfindungsgemäß zur Herstellung von Produkten genutzt werden, für deren Synthese eine erhöhte Konzentration an Malonyl-CoA erforderliche ist, wie z. B. die Fettsäure-Synthese oder die Synthese von Sekundärmetaboliten aus Pflanzen, wie Polyphenole oder Polyketide. The present invention also relates to a coryneform bacterial cell which is distinguished by the fact that it provides an increased intracellular concentration of malonyl-CoA regardless of the addition of fatty acid synthesis inhibitors. This increased provision of malonyl-CoA as a central intermediate can be used according to the invention for the production of products for the synthesis of which an increased concentration of malonyl-CoA is required, such as, for. B. the fatty acid synthesis or the synthesis of secondary metabolites from plants, such as polyphenols or polyketides.
Gegenstand der vorliegenden ist auch coryneforme Bakterienzelle zur Herstellung von Polyphenolen oder Polyketiden, die erfindungsgemäße Modifikationen der zuvor genannten Art aufweist und bei der zusätzlich der katabole Stoffwechselweg von aromatischen Komponenten, bevorzugt ausgewählt aus der Gruppe enthaltend Phenylpropanoide und Benzoesäure-Derivate, ausgeschaltet ist. Coryneforme Bakterien weisen einen eigenen Stoffwechselweg zum Abbau von Phenylpropanoide oder Benzoesäure-Derivaten auf (Kallscheuer et al. , 2016; https://doi.org/10.1007/s00253-015-7165-1). Für die Herstellung von Polyketiden oder Polyphenolen mit coryneformen Bakterien wäre dies kontraproduktiv. Erfindungsgemäß wird dazu eine coryneforme Bakterienzelle bereitgestellt, die eine erhöhte Bereitstellung von Malonyl-CoA ermöglicht und die sich zusätzlich dadurch auszeichnet, dass die Funktionalität und/oder Aktivität der Enzyme oder die Expression der sie kodierenden Gene, beteiligt am katabolen Stoffwechselweg von aromatischen Komponenten, durch Deletionen der Gencluster cg0344-47 (phdBCDE- Operon), cg2625-40 (' cat , ben und pca), cg 1226 ( pobA ) und cg0502 ( qsuB ) ausgeschaltet sind. Diese erfindungsgemäßen Zellen sind zielgerichtet verändert und nicht durch ungezielte Mutagenese entstanden. Sie zeichnen sich in vorteilhafter Weise dadurch aus, dass sie genetisch genau charakterisiert sind und die genannten Modifikationen durch Deletionen erzielt werden. Diese Deletionen liegen erfindungsgemäß chromosomal-kodiert vor. Somit weisen diese Zellen ausschließlich homologe DNA auf und sie sind nicht-rekombinant verändert. Dies zeichnet sie, zusätzlich zu der Eigenschaft zu den GRAS-Organismus zu zählen, in vorteilhafter Weise für eine mikrobielle Herstellung von Produkten, wie z. B. sekundären Pflanzenmetaboliten, aus. Denn die erfindungsgemäße coryneforme Bakterienzelle ist in vorteilhafter Weise auch dadurch charakterisiert, dass sie zur erhöhten Bereitstellung von Malonyl-CoA und zur Vermeidung des Abbaus aromatischer Komponenten keine extrachromosomale DNA, wie z. B. Plasmide oder Vekoren, benötigt. The present invention also relates to coryneform bacterial cells for the production of polyphenols or polyketides, which have modifications of the aforementioned type according to the invention and in which the catabolic pathway of aromatic components, preferably selected from the group comprising phenylpropanoids and benzoic acid derivatives, is additionally switched off. Coryneform bacteria have their own metabolic pathway to break down phenylpropanoids or benzoic acid derivatives (Kallscheuer et al., 2016; https://doi.org/10.1007/s00253-015-7165-1). This would be counterproductive for the production of polyketides or polyphenols with coryneform bacteria. According to the invention, a coryneform bacterial cell is provided which increases Provision of malonyl-CoA is made possible and which is additionally characterized in that the functionality and / or activity of the enzymes or the expression of the genes encoding them, involved in the catabolic pathway of aromatic components, by deletions of the gene clusters cg0344-47 (phdBCDE operon) , cg2625-40 ('cat, ben and pca), cg 1226 (pobA) and cg0502 (qsuB) are switched off. These cells according to the invention have been changed in a targeted manner and have not arisen through untargeted mutagenesis. They are characterized in an advantageous manner in that they are genetically precisely characterized and the modifications mentioned are achieved by deletions. According to the invention, these deletions are chromosomally encoded. Thus, these cells only have homologous DNA and they are non-recombinantly modified. This distinguishes them, in addition to being a GRAS organism, advantageously for microbial production of products such as B. secondary plant metabolites. This is because the coryneform bacterial cell according to the invention is also advantageously characterized in that it does not contain any extrachromosomal DNA, such as eg. B. plasmids or vectors needed.
Gegenstand der vorliegenden Erfindung ist auch eine coryneforme Bakterienzelle, die, zusätzlich zu den erfindungsgemäßen Modifikationen der zuvor genannten Art, die aus Pflanzen abgeleiteten Enzyme oder die sie kodierenden Gene für die Polyphenol- oder Polyketid-Synthese aufweist. In einer Varianten der vorliegenden Erfindung ist auch eine coryneforme Bakterienzelle umfasst, die die aus Pflanzen abgeleiteten Gene zur Polyphenol- oder Polyketid-Produktion, ausgewählt aus der Gruppe enthaltend die Gene 4cl, sts, chs, chi und pcs, aufweist. The present invention also relates to a coryneform bacterial cell which, in addition to the modifications of the aforementioned type according to the invention, has the enzymes derived from plants or the genes encoding them for polyphenol or polyketide synthesis. A variant of the present invention also includes a coryneform bacterial cell which has the genes derived from plants for polyphenol or polyketide production, selected from the group comprising the genes 4cl, sts, chs, chi and pcs.
Die erfindungsgemäße coryneforme Bakterienzelle mit den auf zuvor beschriebene Art erfindungsgemäß ausgewiesenen Eigenschaften zeichnet sich in vorteilhafter weise dadurch aus, dass sie die Synthese von Polyketiden aus 5 Malonyl-CoA-Einheiten durchführen kann. Die Synthese von Polyphenolen kann ebenfalls mit der erfindungsgemäßen coryneformen Bakterienzelle der zuvor beschriebenen Art erfolgen, wobei eine Supplementation des entsprechenden Kulturmediums mit einer Polyphenol-Vorstufe, wie z. B. p-Cumarsäure, die Umsetzung von Malonyl-CoA zu Stilbenen oder Flavonoiden begünstigt. Ausgehend von Glukose als Kohlenstoffquelle benötigt die erfindungsgemäße coryneforme Baktienzelle die Enzyme 3-Deoxy-D-Arabinoheptulosonat-7-Phosphat-Synthase und Tyrosinammonium- Lyase kodiert durch die Gene aroH bzw. tal. The coryneform bacterial cell according to the invention with the properties according to the invention described in the manner described above is advantageously characterized in that it can carry out the synthesis of polyketides from 5 malonyl-CoA units. The synthesis of polyphenols can also be carried out with the coryneform bacterial cell according to the invention of the type described above, with a supplementation of the corresponding culture medium with a polyphenol precursor, such as. B. p-cumaric acid, the implementation of malonyl-CoA to stilbenes or flavonoids favored. Starting from glucose as the carbon source, the coryneform bacterial cell according to the invention requires the enzymes 3-deoxy-D-arabinoheptulosonate-7-phosphate synthase and tyrosine ammonium lyase encoded by the genes aroH and tal.
In einer Variante der vorliegenden Erfindung ist auch eine coryneforme Bakterienzelle umfasst, die Gene kodierend für eine feedback-resistente 3-Deoxy-D-Arabinoheptulosonat-7- Phosphat-Synthase (aroH), bevorzugt aus E. coli, und für eine Tyrosinammonium-Lyase (tal), bevorzugt aus Flavobacertium johnsoniae, aufweist. In a variant of the present invention, a coryneform bacterial cell is also encoded which encodes genes for a feedback-resistant 3-deoxy-D-arabinoheptulosonate-7-phosphate synthase (aroH), preferably from E. coli, and for a tyrosine ammonium lyase (valley), preferably from Flavobacertium johnsoniae.
Bei dem Enzym 5,7-Dihdroxy-2-Methylchromon-Synthase Aktivität (PCS) handelt es sich um eine Typ III Polyketidsynthase (EC 2.3.1.216, UniProt Q58VP7, (Abe et al. , 2005; https://doi.org/10.1021/ja0431206). Die PCS aus Aloe arborescens ist durch das pcs-Gen kodiert und als EC 2.3.1.216, UniProt Q58VP7 annotiert. Als vermeintliche Funktion ist die katalytische Aktivität zur Synthese von Noreugenin aus fünf Molekülen Malonyl-CoA be- schrieben. Erfindungsgemäß wurde das pcs-Gen aus Aloe arborescens mittels C. glutami- cum Codonverwendung synthetisiert und für die Klonierung und Transformation von erfindungsgemäßen coryneformen Bakterienzellen verwendet. Allerdings konnten mit der resul- tierenden coryneformen Bakterienzelle lediglich kleinste Spuren von Noreugenin detektiert werden. Das heißt, das etablierte Enzym PCS aus Aloe arborescens und das sie kodierende psc-Gen kann in seiner annotierten Funktion in coryneformen Bakterienzellen nicht bestätigt werden. Somit ist die annotierte 5,7-Dihdroxy-2-Methylchromon-Synthase Aktivität (PCS) (EC 2.3.1.216, UniProt Q58VP7) für den erfindungsgemäßen Einsatz in coryneformen Bakte rienzellen nicht geeignet. The enzyme 5,7-dihydroxy-2-methylchromone synthase activity (PCS) is a type III polyketide synthase (EC 2.3.1.216, UniProt Q58VP7, (Abe et al., 2005; https://doi.org /10.1021/ja0431206) The PCS from Aloe arborescens is encoded by the pcs gene and annotated as EC 2.3.1.216, UniProt Q58VP7 The catalytic activity for the synthesis of noreugenin from five molecules of malonyl-CoA is described as a supposed function. According to the invention, the pcs gene from Aloe arborescens was synthesized using C. glutamicum codon and used for the cloning and transformation of coryneform bacterial cells according to the invention. However, only the smallest traces of noreugenin could be detected with the resulting coryneform bacterial cell established enzyme PCS from Aloe arborescens and the psc gene encoding it cannot be confirmed in its annotated function in coryneform bacterial cells erte 5,7-Dihdroxy-2-methylchromone synthase activity (PCS) (EC 2.3.1.216, UniProt Q58VP7) not suitable for use according to the invention in coryneform bacterial cells.
Durch die Isolierung und Bereitstellung einer erfindungsgemäßen Nukleinsäuresequenz, kodierend für eine 5,7-Dihdroxy-2-Methylchromon-Synthase (PCSSh0rt), mit gesteigerter Aktivität in coryneformen Bakterien wird ein weiteres Strukturelement verfügbar gemacht, mit dessen Hilfe in vorteilhafter Weise pflanzliche Sekundärmetabolite in coryneformen Bakterien hergestellt werden können. Dabei weist die erfindungsgemäße 5,7-Dihdroxy-2- Methylchromon-Synthase (PCSSh0rt) eine um 10 N-terminale Aminosäuren verkürzte Amino säuresequenz auf. Das resultierende Plasmid pMKEx2-pcs \aC8-short kann in jeden der zuvor beschriebenen C. glutamicum Stämme transformiert werden, wobei nach entsprechender Kultivierung und Probennahmen die Produktbildung analysiert wird. Beispielhaft wird das Plasmid in den C. glutamicum Stamm DelAro4-4c/PcCg-C7-mu/asO transformiert. Der resul tierende Stamm C. glutamicum DelAro4-4c/PcCg-C7-mu/asO pMKEx2-pcs iacg-short wird unter Standardbedingungen (CGXII + 4 % Glucose, 1 mM IPTG, 30 °C, 130 RPM, 72 h) kultiviert und die entnommenen Proben werden mittels LC-MS (siehe oben) auf Produktbildung analysiert. Mit dem Plasmid pMKEx2 -pcsshortAaCg kann unter Standardbedingungen eine deut lich gesteigerte Funktionalität sowie eine deutliche Produktbildung von Noreugenin gezeigt werden. Eine erfindungsgemäße 5,7-Dihdroxy-2-Methylchromon-Synthase-Variante (PCSshon) und die sie kodierende Nukleinsäuresequenz pcsShort sind bislang nicht bekannt. Gegenstand der vorliegenden Erfindung ist auch ein Protein mit einer gesteigerten 5,7- Dihdroxy-2-Methylchromon-Synthase-Aktivität (PCSshort) in einer der zuvor beschriebenen erfindungsgemäßen coryneformen Bakterienzellen zur Synthese von Polyketiden in coryne- formen Bakterien, wobei die Aminosäuresequenz wenigstens 70% Identität zu der Aminosäuresequenz gemäß SEQ ID NO. 20 oder Fragmenten oder Allelen davon aufweist. In einer Variante der vorliegenden Erfindung ist eine 5,7-Dihdroxy-2-Methylchromon-Synthase um fasst, enthaltend eine Aminosäuresequenz gemäß SEQ ID NO. 20 oder Fragmenten oder Allelen davon. Erfindungsgemäß umfasst ist auch eine 5,7-Dihdroxy-2-Methylchromon- Synthase kodiert durch eine Nukleinsäuresequenz enthaltend wenigstens 70% Identität zu der Nukleinsäuresequenz gemäß SEQ ID NO. 19 oder Fragmente davon. In einer Variante der vorliegenden Erfindung ist eine 5,7-Dihdroxy-2-Methylchromon-Synthase umfasst, ko diert durch eine Nukleinsäuresequenz gemäß SEQ ID NO. 19 oder Fragmente davon. By isolating and providing a nucleic acid sequence according to the invention, coding for a 5,7-dihydroxy-2-methylchromone synthase (PCS Sh0 r t ), with increased activity in coryneform bacteria, a further structural element is made available, with the help of which plant-based plants are advantageously used Secondary metabolites can be produced in coryneform bacteria. The 5,7-dihydroxy-2-methylchromone synthase (PCS Sh0 r t ) according to the invention has an amino acid sequence shortened by 10 N-terminal amino acids. The resulting plasmid pMKEx2-pcs \ aC8 -short can be transformed into any of the C. glutamicum strains described above, the product formation being analyzed after appropriate cultivation and sampling. As an example, the plasmid is transformed into the C. glutamicum strain DelAro 4 -4c / PcCg-C7-mu / asO. The resulting strain C. glutamicum DelAro 4 -4c / PcCg-C7-mu / asO pMKEx2-pcs ia c g -short is grown under standard conditions (CGXII + 4% glucose, 1 mM IPTG, 30 ° C, 130 RPM, 72 h ) and the samples taken are analyzed for product formation using LC-MS (see above). With the plasmid pMKEx2 -pcs shortAaCg , a significantly increased functionality and a clear product formation of noreugenin can be demonstrated under standard conditions. A 5,7-dihydroxy-2-methylchromone synthase variant (PCS sho n) according to the invention and the nucleic acid sequence pcs Short encoding it are not yet known. The present invention also relates to a protein with an increased 5,7-dihydroxy-2-methylchromone synthase activity (PCS short ) in one of the previously described coryneform bacterial cells according to the invention for the synthesis of polyketides in coryne-shaped bacteria, the amino acid sequence being at least 70% identical to the amino acid sequence according to SEQ ID NO. 20 or fragments or alleles thereof. In a variant of the present invention, a 5,7-dihydroxy-2-methylchromone synthase is included, containing an amino acid sequence as shown in SEQ ID NO. 20 or fragments or alleles thereof. A 5,7-dihydroxy-2-methylchromone synthase encoded by a nucleic acid sequence containing at least 70% identity to the nucleic acid sequence according to SEQ ID NO is also included according to the invention. 19 or fragments thereof. In a variant of the present invention, a 5,7-dihydroxy-2-methylchromone synthase is encoded, encoded by a nucleic acid sequence according to SEQ ID NO. 19 or fragments thereof.
In einer weiteren Variante der vorliegenden Erfindung ist eine Nukleinsäuresequenz (pcsshort) umfasst, kodierend für eine 5,7-Dihydroxy-2-Methylchromon-Synthase mit gesteigerter Aktivität zur Polyketid-Herstellung in coryneformen Bakterien ausgewählt aus der Gruppe enthaltend: a) eine Nukleinsäuresequenz enthaltend wenigstens 70% Identität zu der Nukleinsäuresequenz gemäß SEQ ID NO. 19 oder Fragmente davon, b) eine Nukleinsäuresequenz, die unter stringenten Bedingungen mit einer komplementären Sequenz einer Nukleinsäuresequenz gemäß SEQ ID NO. 19 oder Fragmenten davon hybridisiert, c) eine Nukleinsäuresequenz gemäß SEQ ID NO. 19 oder Fragmenten davon, oder d) eine Nukleinsäuresequenz kodierend für eine 5,7-Dihydroxy-2- Methylchromon-Synthase (PCSShort) entsprechend jeder der Nukleinsäuren gemäß a) - c), die an die Codonverwendung coryneformer Bakterien angepasst ist, oder e) die sich von diesen Nukleinsäure Sequenzen gemäß a) - d) durch die Degeneriertheit des genetischen Codes oder funktionsneutrale Mutationen unterscheidet. In a further variant of the present invention, a nucleic acid sequence (pcs short ) is encoded, coding for a 5,7-dihydroxy-2-methylchromone synthase with increased activity for polyketide production in coryneform bacteria selected from the group comprising: a) a nucleic acid sequence containing at least 70% identity to the nucleic acid sequence according to SEQ ID NO. 19 or fragments thereof, b) a nucleic acid sequence which under stringent conditions with a complementary sequence of a nucleic acid sequence according to SEQ ID NO. 19 or fragments thereof hybridized, c) a nucleic acid sequence according to SEQ ID NO. 19 or fragments thereof, or d) a nucleic acid sequence coding for a 5,7-dihydroxy-2-methylchromone synthase (PCS Short ) corresponding to each of the nucleic acids according to a) - c) which is adapted to the codon use of coryneform bacteria, or e ) which differs from these nucleic acid sequences according to a) - d) by the degeneracy of the genetic code or function-neutral mutations.
Gegenstand der vorliegenden Erfindung ist auch eine coryneforme Bakterienzelle der zuvor beschriebenen Art, die ein Protein mit einer gesteigerten 5,7-Dihdroxy-2-Methylchromon- Synthase-Aktivität (PCSsh0rt) und/oder eine Nukleinsäuresequenz kodierend für eine 5,7- Dihdroxy-2-Methylchromon-Synthase (PCSsh0rt) mit gesteigerter Aktivität in coryneformen Bakterien aufweist. In einer Variante der vorliegenden Erfindung ist auch ein Protein mit einer gesteigerten 5,7-Dihdroxy-2-Methylchromon-Synthase-Aktivität (PCSshort) mit wenigstens 70% Identität zu der Aminosäuresequenz gemäß SEQ ID NO. 20 oder Fragmente oder Allele davon umfasst. Eine weitere Variante der vorliegenden Erfindung umfasst auch ein Protein mit einer gesteigerten 5,7-Dihdroxy-2-Methylchromon-Synthase-Aktivität (PCSsh0rt) gemäß SEQ ID NO. 20. The present invention also relates to a coryneform bacterial cell of the type described above, which encodes a protein with an increased 5,7-dihydroxy-2-methylchromone synthase activity (PCS sh0 r t ) and / or a nucleic acid sequence for a 5,7 - Dihdroxy-2-methylchromone synthase (PCS sh0 r t ) with increased activity in coryneform bacteria. In a variant of the present invention, there is also a protein with an increased 5,7-dihydroxy-2-methylchromone synthase activity (PCS short ) with at least 70% identity to the amino acid sequence according to SEQ ID NO. 20 or fragments or alleles thereof. Another variant of the present invention also comprises a protein with an increased 5,7-dihydroxy-2-methylchromone synthase activity (PCS sh0rt ) according to SEQ ID NO. 20th
Alle aus Pflanzen oder anderen heterologen Systemen abgeleiteten Gene, wie z.B. aroH, tal und/oder die Gene für die Polyphenol-Synthese, bevorzugt die Stilben- und/oder Flavonoid- Synthese, besonders zu nennen die Gene sts, chs, chi oder die Gene für die Polyketid- Synthese, bevorzugt pcsSh0rt, wurden für die Expression in coryneformen Bakterien an die bakterielle Codonverwendung (codon-usage) dieser coryneformen Bakterien, bevorzugt der von Corynebacterium glutamicum, angepasst und optimiert. Der Anteil Heterologe Nukleinsäure Sequenzen wird dadurch erfindungsgemäß reduziert und die Expression in coryneformen Bakterienzellen in vorteilhafter Weise unterstützt. All genes derived from plants or other heterologous systems, such as, for example, aroH, tal and / or the genes for polyphenol synthesis, preferably stilbene and / or flavonoid synthesis, particularly mentioning the genes sts, chs, chi or the genes for polyketide synthesis, preferably pcs Sh0rt , were adapted and optimized for expression in coryneform bacteria to the bacterial codon usage (codon usage) of these coryneform bacteria, preferably that of Corynebacterium glutamicum. The proportion of heterologous nucleic acid sequences is thereby reduced according to the invention and the expression in coryneform bacterial cells is advantageously supported.
In einer Variante der vorliegenden Erfindung ist auch eine coryneforme Bakterienzelle der zuvor genannten Art umfasst, bei der die pflanzlichen Gene unter der Expressionskontrolle eines induzierbaren Promotors vorliegen. In einer weiteren Variante liegt erfindungsgemäß ein mit IPTG-induzierbaren Promotor, bevorzugt der Promotor T7, vor. In a variant of the present invention, a coryneform bacterial cell of the aforementioned type is also included, in which the plant genes are present under the expression control of an inducible promoter. In a further variant, according to the invention, there is an IPTG-inducible promoter, preferably the T7 promoter.
In einer Variante der vorliegenden Erfindung ist eine erfindungsgemäße coryneforme Bakterienzelle umfasst, bei der das Gen 4cl kodierend für die 4-Cumarat-CoA-Ligase (4CL) unter der Expressionskontrolle eines induzierbaren Promotors vorliegt, wobei der induzierbare Promotor und das damit regulativ-verknüpfte Gen in das Genom der coryneformen Bakterienzelle integriert wurde, d.h. chromosomal-kodiert vorliegt. In einer weiteren Variante der vorliegenden Erfindung wird ein mit IPTG-induzierbaren Promotor, bevorzugt der Promotor T7, eingesetzt. In a variant of the present invention, a coryneform bacterial cell according to the invention is included, in which the gene 4cl coding for 4-cumarat-CoA ligase (4CL) is present under the expression control of an inducible promoter, the inducible promoter and the gene linked to it regulatively was integrated into the genome of the coryneform bacterial cell, ie chromosomally encoded. In a further variant of the present invention, an IPTG-inducible promoter, preferably the T7 promoter, is used.
Gegenstand der vorliegenden Erfindung sind auch extrachromosomale Systeme, wie Vektoren oder Plasmide, mit den erforderlichen Eigenschaften für die Expression der benötigten Gene zur Synthese von Polyphenolen oder Polyketiden. In Varianten der vorliegenden Erfindung unterliegen die plasmid- bzw. vektor-kodierten Gene einem induzierbaren Promotor, bevorzugt einem mit IPTG-induzierbaren Promotor, bevorzugt dem Promotor T7. Der Einsatz eines induzierbaren Promotors hat erfindungsgemäß den Vorteil, dass die Expression der für die Sekundärmetabolite erforderlichen Gene gezielt gesteuert, d.h. angeschaltet werden können, in Abhängigkeit von den Wachstums- bzw. Kultivierungsbedingungen der erfindungsgemäßen coryneformen Bakterienzellen. Die erfindungsgemäßen corynformen Bakterienzellen der zuvor beschriebenen Art können so zunächst zur erhöhten Bereitstellung von Malonyl-CoA kultiviert werden, welches dann nach gezielter Induktion der Expression der erforderlichen Gene weiter zu den gewünschten Produkten umgesetzt wird. The present invention also relates to extrachromosomal systems, such as vectors or plasmids, with the properties required for the expression of the genes required for the synthesis of polyphenols or polyketides. In variants of the present invention, the plasmid or vector-encoded genes are subject to an inducible promoter, preferably an IPTG-inducible promoter, preferably the T7 promoter. The use of an inducible promoter has the advantage according to the invention that the expression of the genes required for the secondary metabolites can be controlled in a targeted manner, ie switched on, depending on the growth or cultivation conditions of the coryneform bacterial cells according to the invention. The corynform bacterial cells according to the invention of the type described above can thus first be cultured for the increased provision of malonyl-CoA, which then, after specific induction of the expression of the required genes, continues to the desired ones Products.
Gegenstand der vorliegenden Erfindung ist auch eine coryneforme Bakterienzelle, die Gene aufweist, ausgewählt aus der Gruppe enthaltend a) 4cl und sts für die Synthese von Polyphenolen, bevorzugt Stilbene, besonders bevorzugt Resveratrol, oder b) chs und chi für die Synthese von Polyphenolen, bevorzugt Flavonoide, besonders bevorzugt Naringenin, oder c) pcsshort für die Synthese von Polyketiden, bevorzugt Noreugenin, unter der Kontrolle eines induzierbaren Promotors, bevorzugt eines mit IPTG-induzierbaren Promotors, besonders bevorzugt des T7-Promotors. The present invention also relates to a coryneform bacterial cell which has genes selected from the group comprising a) 4cl and sts for the synthesis of polyphenols, preferably stilbenes, particularly preferably resveratrol, or b) chs and chi for the synthesis of polyphenols Flavonoids, particularly preferably naringenin, or c) pcs short for the synthesis of polyketides, preferably noreugenin, under the control of an inducible promoter, preferably one with an IPTG-inducible promoter, particularly preferably the T7 promoter.
Wie zuvor erwähnt, zeichnet sich die vorliegende Erfindung in vorteilhafter Weise dadurch aus, dass die Gene oder mit ihnen regulatorisch-verknüpfte Bereiche zur erhöhten Bereitstellung von Malonyl-CoA in das Genom der erfindungsgemäßen Zellen integriert ist, also chromosomal-kodiert vorliegen. Dies schafft Freiheitsgrade, um weitere heterologe Gene plasmid-kodiert in die Zellen einzubringen, ohne die Zelle zu überfordern. Die bekannten Nachteile, dass bakterielle Zellen mit mehr als 2 Plasmiden nicht stabil vermehrt werden können oder der große Nachteil, dass Plasmide mit mehr als 2 heterologen Genen in der Regel kein zufriedenstellendes Ergebnis hinsichtlich der Stabilität oder Expression hervorbringen, wird durch das erfindungsgemäß sehr vorteilhafte System einer coryneformen Bakterienzelle überwunden. Durch seinen Aufbau bietet es große Freiheitsgrade, welche pflanzlichen oder anderen heterologen Gene extrachromosomal in das System eingebracht werden können, um so eine stabile, mikrobielle Herstellung von pflanzlichen Sekundärmetaboliten ausgehend von Malonyl-CoA zu ermöglichen. As mentioned above, the present invention is advantageously characterized in that the genes or regions linked to them in a regulatory manner for the increased provision of malonyl-CoA are integrated into the genome of the cells according to the invention, that is to say are chromosomally encoded. This creates degrees of freedom to insert further heterologous genes into the cells in a plasmid-encoded manner without overwhelming the cell. The known disadvantages that bacterial cells cannot be stably propagated with more than 2 plasmids or the major disadvantage that plasmids with more than 2 heterologous genes generally do not produce a satisfactory result in terms of stability or expression is due to the system which is very advantageous according to the invention of a coryneform bacterial cell. Due to its structure, it offers great degrees of freedom, which plant or other heterologous genes can be introduced extrachromosomally into the system, in order to enable a stable, microbial production of plant secondary metabolites based on malonyl-CoA.
In einer Variante der vorliegenden Erfindung liegt eine coryneforme Bakterienzelle vor, die Gene aufweist, ausgewählt aus der Gruppe enthaltend a) fasB und/oder gltA und/oder accBCDI , deren Funktionalität und/oder Expression für eine erhöhte Bereitstellung von Malonyl-CoA gezielt modifiziert ist, und b) cg0344-47 (phdBCDE- Operon), cg2625-40 ( cat , ben und pca), cg 1226 ( pobA ) und cg0502 ( qsuB ) deren Funktionalität für den Abbau aromatischer Komponenten, bevorzugt aus der Gruppe enthaltend Phenylpropanoide oder Benzoesäure-Derivate, ausgeschaltet ist, und c) pcSshort kodierend für ein Protein mit einer gesteigerten 5,7-Dihdroxy-2-Methylchromon- Synthase-Aktivität (PCSsh0rt) für die Synthese von Polyketiden, bevorzugt Noreugenin, oder d) optional aroH und tal für die Vorstufen-Synthese von Polyphenolen ausgehend von Glukose, und e) 4cl und sts für die Synthese von Polyphenolen, bevorzugt Stilbene, besonders bevorzugt Resveratrol, oder f) chs und chi für die Synthese von Polyphenolen, bevorzugt Flavonoide, besonders bevorzugt Naringenin. In Varianten einer erfindungsgemäßen Bakterienzelle liegen die erfindungsgemäßen Gene bzw. die mit ihnen operativ-verknüpften regulatorischen Bereiche aus a) und b) im Genom kodiert vor. Die Gene bzw. die mit ihnen operativ-verknüpften regulatorischen Bereiche aus c) - f) liegen plasmid-kodiert vor. Erfindungsgemäß sind hierbei zur Herstellung von Polyketiden, bevorzugt Noreugenin, Kombinationen denkbar, wie z. B. mit Varianten von fasB (Substitutionsmutanten oder Deletionsmutanten) und Acg0344-47 {phdBCDE- Operon) und Acg2625-40 {cat, ben und pca) und Acg1226 {pobA) und Acg0502 {qsuB) und pcsshort; mit gtIA und Acg0344-47 {phdBCDE-Opero ) und Acg2625-40 {cat, ben und pca) und Acg1226 {pobA) und Acg0502 {qsuB) und pcssh0rt; mit gtIA und accBCDI und Acg0344-47 {phdBCDE- Operon) und Acg2625-40 {cat, ben und pca) und Acg1226 {pobA) und Acg0502 {qsuB) und pcsShort; mit Varianten von fasB (Substitutionsmutanten oder Deletionsmutanten) und gtIA und accBCDI und Acg0344-47 {phdBCDE- Operon) und Acg2625-40 {cat, ben und pca) und Acg1226 {pobA) und Acg0502 {qsuB) und pcsshort- In a variant of the present invention, there is a coryneform bacterial cell which has genes selected from the group comprising a) fasB and / or gltA and / or accBCDI, the functionality and / or expression of which has been specifically modified for increased provision of malonyl-CoA , and b) cg0344-47 (phdBCDE operon), cg2625-40 (cat, ben and pca), cg 1226 (pobA) and cg0502 (qsuB) their functionality for the degradation of aromatic components, preferably from the group containing phenylpropanoids or benzoic acid - Derivatives, is turned off, and c) pcS short coding for a protein with an increased 5,7-dihydroxy-2-methylchromone synthase activity (PCS sh0rt ) for the synthesis of polyketides, preferably noreugenin, or d) optionally aroH and tal for the precursor synthesis of Polyphenols starting from glucose, and e) 4cl and sts for the synthesis of polyphenols, preferably stilbenes, particularly preferably resveratrol, or f) chs and chi for the synthesis of polyphenols, preferably flavonoids, particularly preferably naringenin. In variants of a bacterial cell according to the invention, the genes according to the invention or the regulatory regions from a) and b) operatively linked to them are present encoded in the genome. The genes or the regulatory regions from c) - f) operatively linked to them are plasmid-encoded. According to the invention, combinations of these are conceivable for the production of polyketides, preferably noreugenin, such as, for. B. with variants of fasB (substitution or deletion mutants) and Acg0344-47 {phdBCDE operon) and Acg2625-40 {cat, ben and pca) and Acg1226 {pobA) and Acg0502 {qsuB) and pcs short ; with gtIA and Acg0344-47 {phdBCDE-Opero) and Acg2625-40 {cat, ben and pca) and Acg1226 {pobA) and Acg0502 {qsuB) and pcs sh0rt ; with gtIA and accBCDI and Acg0344-47 {phdBCDE operon) and Acg2625-40 {cat, ben and pca) and Acg1226 {pobA) and Acg0502 {qsuB) and pcs Sho r t ; with variants of fasB (substitution mutations or deletion mutants) and gtIA and accBCDI and Acg0344-47 {phdBCDE operon) and Acg2625-40 {cat, ben and pca) and Acg1226 {pobA) and Acg0502 {qsuB) and pcs short -
Zur Herstellung von Polyphenolen, bevorzugt Stilbene, weiter bevorzugt Resveratrol, sind Kombinationen denkbar, wie z. B. mit Varianten von fasB (Substitutionsmutanten oder Deletionsmutanten) und Acg0344-47 (phdBCDE- Operon) und Acg2625-40 ( cat , ben und pca) und Acg1226 (poM) und Acg0502 ( qsuB ) und aroH und tal und 4cl und sts; mit gtIA und Acg0344-47 {phdBCDE- Operon) und Acg2625-40 {cat, ben und pca) und Acg1226 {pobA) und Acg0502 {qsuB) und aroH und tal und 4cl und sts; mit gtIA und accBCDI und Acg0344- 47 {phdBCDE-Operon ) und Acg2625-40 {cat, ben und pca) und Acg1226 {pobA) und Acg0502 {qsuB) und aroH und tal und 4cl und sts; mit Varianten von fasBCombinations are conceivable for the production of polyphenols, preferably stilbenes, more preferably resveratrol, such as. B. with variants of fasB (substitution mutants or deletion mutants) and Acg0344-47 (phdBCDE operon) and Acg2625-40 (cat, ben and pca) and Acg1226 (poM) and Acg0502 (qsuB) and aroH and tal and 4cl and sts; with gtIA and Acg0344-47 {phdBCDE operon) and Acg2625-40 {cat, ben and pca) and Acg1226 {pobA) and Acg0502 {qsuB) and aroH and tal and 4cl and sts; with gtIA and accBCDI and Acg0344-47 {phdBCDE operon) and Acg2625-40 {cat, ben and pca) and Acg1226 {pobA) and Acg0502 {qsuB) and aroH and tal and 4cl and sts; with variants from fasB
(Substitutionsmutanten oder Deletionsmutanten) und gtIA und accBCDI und Acg0344-47 {phdBCDE-Operon) und Acg2625-40 {cat, ben und pca) und Acg1226 {pobA) und Acg0502 {qsuB) und aroH und tal und 4cl und sts. Diese zuvor genannten Variante erlauben die Herstellung der Polyphenole ausgehend von Glukose aufgrund der Expression der Gene aroH und tal. Die Gene aroH und tal sind allerdings nicht erforderlich für eine mit der Vorstufe p-Cumarsäure supplementierte Kultivierung der erfindungsgemäßen coryneformen Bakterienzelle. Erfindungsgemäße Varianten der zuvor genannten coryneformen Bakterienzelle weisen dann die Gene aroH und tal nicht auf. (Substitution mutants or deletion mutants) and gtIA and accBCDI and Acg0344-47 {phdBCDE operon) and Acg2625-40 {cat, ben and pca) and Acg1226 {pobA) and Acg0502 {qsuB) and aroH and tal and 4cl and sts. These previously mentioned variants allow the production of the polyphenols based on glucose based on the expression of the genes aroH and valley. However, the genes aroH and tal are not required for a cultivation of the coryneform bacterial cell according to the invention supplemented with the precursor p-cumaric acid. Variants according to the invention of the aforementioned coryneform bacterial cell then do not have the genes aroH and tal.
Zur Herstellung von Polyphenolen, bevorzugt Flavonoide, weiter bevorzugt Naringenin, sind Kombinationen denkbar, wie z. B. mit Varianten von fasB (Substitutionsmutanten oder Deletionsmutanten) und Acg0344-47 ( phdBCDE-Operon ) und Acg2625-40 ( cat , ben und pca) und Acg1226 (pobA) und Acg0502 ( qsuB ) und aroH und tal und chs und chi; mit gtIA und Acg0344-47 {phdBCDE- Operon) und Acg2625-40 (cat, ben und pca) und Acg1226 (pobA) und Acg0502 ( qsuB ) und aroH und tal und chs und chi; mit gtIA und accBCDI und Acg0344-47 (phdBCDE- Operon) und Acg2625-40 (cat, ben und pca) und Acg1226 (pobA) und Acg0502 (qsuB) und aroH und tal und chs und chi; mit Varianten von fasB (Substitutionsmutanten oder Deletionsmutanten) und gtIA und accBCDI und Acg0344-47 (phdBCDE-Operon) und Acg2625-40 (cat, ben und pca) und Acg1226 (pobA) und Acg0502 (qsuB) und aroH und tal und chs und chi. Diese zuvor genannten Variante erlauben die Herstellung der Polyphenole ausgehend von Glukose aufgrund der Expression der Gene aroH und tal. Die Gene aroH und tal sind allerdings nicht erforderlich für eine mit der Vorstufe p-Cumarsäure supplementierte Kultivierung der erfindungsgemäßen coryneformen Bakterienzelle. Erfindungsgemäße Varianten der zuvor genannten coryneformen Bakterienzelle weisen dann die Gene aroH und tal gegebenenfalls nicht auf. Combinations are conceivable for the production of polyphenols, preferably flavonoids, more preferably naringenin, such as. B. with variants of fasB (substitution or deletion mutants) and Acg0344-47 (phdBCDE operon) and Acg2625-40 (cat, ben and pca) and Acg1226 (pobA) and Acg0502 (qsuB) and aroH and tal and chs and chi; with gtIA and Acg0344-47 {phdBCDE operon) and Acg2625-40 (cat, ben and pca) and Acg1226 (pobA) and Acg0502 (qsuB) and aroH and tal and chs and chi; with gtIA and accBCDI and Acg0344-47 (phdBCDE operon) and Acg2625-40 (cat, ben and pca) and Acg1226 (pobA) and Acg0502 (qsuB) and aroH and tal and chs and chi; with variants of fasB (substitution mutants or deletion mutants) and gtIA and accBCDI and Acg0344-47 (phdBCDE operon) and Acg2625-40 (cat, ben and pca) and Acg1226 (pobA) and Acg0502 (qsuB) and aroH and tal and chs and chi. These previously mentioned variants allow the production of the polyphenols starting from glucose on the basis of the expression of the aroH and tal genes. However, the genes aroH and tal are not required for a cultivation of the coryneform bacterial cell according to the invention supplemented with the precursor p-cumaric acid. Variants of the aforementioned coryneform bacterial cell according to the invention may then not have the genes aroH and tal.
In weiteren Varianten der vorliegenden Erfindung liegt eine coryneforme Bakterienzelle der zuvor genannten Art mit den zuvor genannten Variationen an Genkombinationen vor, die Gene aufweist, ausgewählt aus der Gruppe enthaltend a) fasB-Gen gemäß einer Nukleinsäuresequenz ausgewählt aus der Gruppe enthaltend SEQ ID NO. 1 , 3, 5, 7, und 9 oder Fragmenten davon, kodierend für Fettsäuresynthasen FasB ausgewählt aus der Gruppe enthaltend SEQ ID NO. 2, 4, 6, 8, und 10 oder Fragmenten oder Allelen davon und/oder gltA-Gen mit operativ-verknüpfter Promotorregion gemäß SEQ ID NO. 11 und/oder accBCDI -Gencluster mit operativ-verknüpften fasO- Bindestellen ausgewählt aus der Gruppe enthaltend SEQ ID NO. 13 und 15, deren Funktionalität und/oder Expression für eine erhöhte Bereitstellung von Malonyl-CoA gezielt modifiziert ist, und b) cg0344-47 (phdBCDE- Operon), cg2625-40 (cat, ben und pca), cg 1226 (pobA) und cg0502 (qsuB) deren Funktionalität für den Abbau aromatischer Komponenten, bevorzugt aus der Gruppe enthaltend Phenylpropanoide oder Benzoesäure-Derivate, ausgeschaltet ist, und c) pcSshort gemäß SEQ ID NO. 19 kodierend für ein Protein mit einer gesteigerten 5,7- Dihdroxy-2-Methylchromon-Synthase-Aktivität (PCSshort) gemäß SEQ ID NO: 20 oder Fragmente oder Allele davon für die Synthese von Polyketiden, bevorzugt Noreugenin, oder d) optional aroH gemäß SEQ ID NO. 30 oder Fragmente oder Allele davon, und tal gemäß SEQ ID NO: 32 oder Fragmente oder Allele davon, für die Vorstufen-Synthese von Polyphenolen ausgehend von Glukose, und e) 4cl gemäß SEQ ID NO. 22 oder Fragmente oder Allele davon, und sts gemäß SEQ ID 24 oder Fragmente oder Allele davon, für die Synthese von Polyphenolen, bevorzugt Stilbene, besonders bevorzugt Resveratrol, oder f) chs gemäß SEQ ID NO. 26 oder Fragmente oder Allele davon, und chi gemäß SEQ ID NO. 28 oder Fragmente oder Allele davon, für die Synthese von Polyphenolen, bevorzugt Flavonoide, besonders bevorzugt Naringenin. In further variants of the present invention, there is a coryneform bacterial cell of the aforementioned type with the aforementioned variations in gene combinations, which has genes selected from the group containing a) fasB gene according to a nucleic acid sequence selected from the group containing SEQ ID NO. 1, 3, 5, 7, and 9 or fragments thereof, coding for fatty acid synthases FasB selected from the group comprising SEQ ID NO. 2, 4, 6, 8, and 10 or fragments or alleles thereof and / or gltA gene with an operatively linked promoter region according to SEQ ID NO. 11 and / or accBCDI gene clusters with operatively linked fasO binding sites selected from the group containing SEQ ID NO. 13 and 15, whose functionality and / or expression has been specifically modified for increased provision of malonyl-CoA, and b) cg0344-47 (phdBCDE operon), cg2625-40 (cat, ben and pca), cg 1226 (pobA) and cg0502 (qsuB) whose functionality for the degradation of aromatic components, preferably from the group comprising phenylpropanoids or benzoic acid derivatives, is switched off, and c) pcS short according to SEQ ID NO. 19 coding for a protein with an increased 5,7-dihydroxy-2-methylchromone synthase activity (PCS short ) according to SEQ ID NO: 20 or fragments or alleles thereof for the synthesis of polyketides, preferably noreugenin, or d) optionally aroH according to SEQ ID NO. 30 or fragments or alleles thereof, and tal according to SEQ ID NO: 32 or fragments or alleles thereof, for the precursor synthesis of polyphenols starting from glucose, and e) 4cl according to SEQ ID NO. 22 or fragments or alleles thereof, and sts according to SEQ ID 24 or fragments or alleles thereof, for the synthesis of polyphenols, preferably stilbenes, particularly preferably resveratrol, or f) chs according to SEQ ID NO. 26 or fragments or alleles thereof, and chi according to SEQ ID NO. 28 or fragments or alleles thereof, for the synthesis of polyphenols, preferably flavonoids, particularly preferably naringenin.
Diese genannten Varianten sind Gegenstand der Erfindung ohne dass die Erfindung dadurch limitiert wird. Diese Beschreibung dient dem besseren Verständnis der vorliegenden Erfindung. These variants mentioned are the subject of the invention without the invention being limited thereby. This description is provided for a better understanding of the present invention.
Gegenstand der vorliegenden Erfindung ist auch ein Verfahren zur erhöhten Bereitstellung von Malonyl-CoA in coryneformen Bakterien enthaltend die Schritte: a) Bereitstellen einer Lösung enthaltend Wasser und eine C6-Kohlenstoff-Quelle; b) mikrobielle Umsetzung der C6-Kohlenstoffquelle in einer Lösung gemäß Schritt a) zu Malonyl-CoA in Anwesenheit einer erfindungsgemäßen coryneformen Bakterienzelle bei der die Regulation und/oder Expression der Gene ausgewählt aus der Gruppe enthaltend fasB, gtIA, accBC und accD1 und/oder die Funktionalität der durch sie kodierten Enzyme gezielt modifiziert ist. The present invention also relates to a method for the increased provision of malonyl-CoA in coryneform bacteria comprising the steps: a) providing a solution containing water and a C6-carbon source; b) microbial conversion of the C6 carbon source in a solution according to step a) to malonyl-CoA in the presence of a coryneform bacterial cell according to the invention in which the regulation and / or expression of the genes selected from the group comprising fasB, gtIA, accBC and accD1 and / or the functionality of the enzymes encoded by it is specifically modified.
Unter „Lösung“ ist erfindungsgemäß gleichbedeutend zu verstehen „Medium“, „Kulturmedium“,„Kulturbrühe“ oder„Kulturlösung“. Im Sinne der vorliegenden Erfindung ist „mikrobiell“ gleichbedeutend zu verstehen mit„biotechnologisch“ oder„fermentative“. Unter „Umsetzung“ ist erfindungsgemäß gleichbedeutend zu verstehen „Verstoffwechslung“, „Metabolisierung“ oder „Kultivierung“. Unter „Aufbereitung“ ist erfindungsgemäß gleichbedeutend zu verstehen„Abtrennung“,„Aufkonzentrierung“ oder„Aufreinigung“. According to the invention, “solution” is to be understood as meaning “medium”, “culture medium”, “culture broth” or “culture solution”. In the sense of the present invention, “microbial” is to be understood as synonymous with “biotechnological” or “fermentative”. According to the invention, “implementation” is to be understood as synonymous with “metabolism”, “metabolism” or “cultivation”. Under "preparation" is according to the invention synonymous to understand "separation", "concentration" or "purification".
Das zu verwendende Kulturmedium sollte in geeigneter Weise den Ansprüchen der jeweiligen Mikroorganismen genügen. Beschreibungen von Kulturmedien verschiedener Mikroorganismen sind im Handbuch “Manual of Methods for General Bacteriology” der American Society for Bacteriology (Washington D.C., USA, 1981) enthalten. Neben Glukose als Ausgangssubstrat der Malonyl-CoA-Bereitstellung können als Kohlenstoffquelle Zucker und Kohlehydrate wie z.B. Glucose, Saccharose, Lactose, Fructose, Maltose, Melasse, Stärke und Cellulose, Öle und Fette wie z. B. Sojaöl, Sonnenblumenöl, Erdnussöl und Kokosfett, Fettsäuren wie z. B. Palmitinsäure, Stearinsäure und Linolsäure, Alkohole wie z. B. Glycerin und Ethanol und organische Säuren wie z. B. Essigsäure verwendet werden. Diese Stoffe können einzeln oder als Mischung verwendet werden. Als Stickstoffquelle können organische, Stickstoff-haltige Verbindungen wie Peptone, Hefeextrakt, Fleischextrakt, Malzextrakt, Maisquellwasser, Sojabohnenmehl und Harnstoff oder anorganische Verbindungen wie Ammoniumsulfat, Ammoniumchlorid, Ammoniumphosphat, Ammoniumcarbonat und Ammoniumnitrat verwendet werden. Die Stickstoffquellen können einzeln oder als Mischung verwendet werden. Als Phosphorquelle können Kaliumdihydrogenphosphat oder Dikaliumhydrogenphosphat oder die entsprechenden Natrium-haltigen Salze verwendet werden. Das Kulturmedium sollte weiterhin Salze von Metallen enthalten wie z.B. Magnesiumsulfat oder Eisensulfat, die für das Wachstum notwendig sind. Schließlich können essentielle Wuchsstoffe, wie Aminosäuren und Vitamine zusätzlich zu den oben genannten Stoffen eingesetzt werden. Die genannten Einsatzstoffe können zur Kultur in Form eines einmaligen Ansatzes hinzugegeben oder in geeigneter Weise während der Kultivierung zugefüttert werden. Zur pH - Kontrolle der Kultur werden basische Verbindungen wie Natriumhydroxid, Kaliumhydroxid, Ammoniak oder saure Verbindungen wie Salzsäure, Phosphorsäure oder Schwefelsäure in geeigneter Weise eingesetzt. Zur Kontrolle der Schaumentwicklung können Antischaummittel wie z.B. Fettsäurepolyglykolester eingesetzt werden. Zur Aufrechterhaltung der Stabilität von Plasmiden können dem Medium geeignete selektiv wirkende Stoffe, z.B. Antibiotika, hinzugefügt werden. Um aerobe Bedingungen aufrechtzuerhalten werden Sauerstoff oder Sauerstoff-haltige Gasmischungen wie z.B. Luft in die Kultur eingetragen. Die Temperatur der Kultur liegt normalerweise bei 20°C bis 45°C und vorzugsweise bei 25°C bis 40°C. The culture medium to be used should suitably meet the requirements of the respective microorganisms. Descriptions of culture media of various microorganisms are contained in the manual “Manual of Methods for General Bacteriology” of the American Society for Bacteriology (Washington D.C., USA, 1981). In addition to glucose as the starting substrate for the provision of malonyl CoA, sugar and carbohydrates such as e.g. Glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose, oils and fats such as B. soybean oil, sunflower oil, peanut oil and coconut oil, fatty acids such as. As palmitic acid, stearic acid and linoleic acid, alcohols such as. B. glycerol and ethanol and organic acids such as. B. acetic acid can be used. These substances can be used individually or as a mixture. Organic nitrogen-containing compounds such as peptones, yeast extract, meat extract, malt extract, corn steep liquor, soybean meal and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate can be used as the nitrogen source. The nitrogen sources can be used individually or as a mixture. Potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts can be used as the source of phosphorus. The culture medium should also contain salts of metals such as e.g. Magnesium sulfate or iron sulfate, which are necessary for growth. Finally, essential growth substances such as amino acids and vitamins can be used in addition to the substances mentioned above. The feedstocks mentioned can be added to the culture in the form of a single batch or can be added in a suitable manner during the cultivation. Basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or acidic compounds such as hydrochloric acid, phosphoric acid or sulfuric acid are used in a suitable manner to control the pH of the culture. Anti-foam agents such as e.g. Fatty acid polyglycol esters are used. To maintain the stability of plasmids, suitable selectively acting substances, e.g. Antibiotics. In order to maintain aerobic conditions, oxygen or gas mixtures containing oxygen, e.g. Air entered the culture. The temperature of the culture is usually 20 ° C to 45 ° C and preferably 25 ° C to 40 ° C.
Die vorliegende Erfindung betrifft Verfahren bei dem die Kultivierung diskontinuierlich oder kontinuierlich, bevorzugt im batch-, fed-batch-, repeated-fed-batch- oder kontinuierlichen Modus erfolgt. In einer Variante des erfindungsgemäßen Verfahrens zur erhöhten Bereitstellung von Malonyl-CoA erfolgt die mikrobielle Umsetzung der C6-Kohlenstoffquelle in einer erfindungsgemäßen coryneformen Bakterien enthaltend eine der erfindungsgemäß beschriebenen Varianten von fasB, bei der die Fettsäuresynthase FasB vermindert oder ausgeschaltet ist und/oder das für die Fettsäuresynthase kodierende Gen fasB gezielt mutiert, bevorzugt durch eine oder mehrere Nukleotidsubstitutionen, oder teilweise oder komplett deletiert ist. The present invention relates to methods in which the cultivation is carried out discontinuously or continuously, preferably in batch, fed-batch, repeated fed-batch or continuous mode. In a variant of the method according to the invention for increased provision of malonyl-CoA, the microbial conversion of the C6 carbon source takes place in a coryneform bacteria according to the invention containing one of the variants of fasB described according to the invention, in which the fatty acid synthase FasB is reduced or switched off and / or for the Gene encoding fatty acid synthase is specifically mutated, preferably by one or more nucleotide substitutions, or is partially or completely deleted.
In einer Variante des erfindungsgemäßen Verfahrens zur erhöhten Bereitstellung von Malonyl-CoA erfolgt die mikrobielle Umsetzung der C6-Kohlenstoffquelle in einer erfindungsgemäßen coryneformen Bakterienzelle enthaltend ein erfindungsgemäß für die Citratsynthase kodierendes Gens gltA, das durch Mutation, bevorzugt mehrere Nukleotidsubstitutionen, des operativ-verknüpften Promotors in seiner Expression vermindert ist. In a variant of the method according to the invention for increased provision of malonyl-CoA, the microbial conversion of the C6 carbon source takes place in a coryneform bacterial cell according to the invention containing a gene gltA coding for citrate synthase according to the invention, which by mutation, preferably several nucleotide substitutions, of the operatively linked promoter its expression is reduced.
In einer Variante des erfindungsgemäßen Verfahrens zur erhöhten Bereitstellung von Malonyl-CoA erfolgt die mikrobielle Umsetzung der C6-Kohlenstoffquelle in einer erfindungsgemäßen coryneformen Bakterienzelle enthaltend die erfindungsgemäßen Gene accBC und accD1 , bei der die Funktionalität der Operator-Bindestellen (fasO) für den Regulator FasR in den Promotorbereichen der Gene accBC und accD1 kodierend für die Acetyl-CoA-Carboxylase-Untereinheiten, bevorzugt durch eine oder mehrere Nukleotidsubstitutionen, vermindert oder ausgeschaltet ist und die Expression der für die Acetyl-CoA-Carboxylase-Untereinheiten kodierenden Gene accBC und accD1 dereprimiert, bevorzugt gesteigert, ist. In a variant of the method according to the invention for the increased provision of malonyl-CoA, the microbial conversion of the C6 carbon source takes place in a coryneform bacterial cell according to the invention containing the genes accBC and accD1 according to the invention, in which the functionality of the operator binding sites (fasO) for the regulator FasR in the promoter regions of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits, preferably by one or more nucleotide substitutions, is reduced or switched off and the expression of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits is de-expressed, preferred is increased.
In einer weiteren Variante des erfindungsgemäßen Verfahrens zur erhöhten Bereitstellung von Malonyl-CoA erfolgt die mikrobielle Umsetzung der C6-Kohlenstoffquelle in einer erfindungsgemäßen coryneformen Bakterienzelle, die eine Kombination aus verminderter Expression und/oder Aktivität der Citratsynthase (CS) und deregulierter, gesteigerter,In a further variant of the method according to the invention for increased provision of malonyl-CoA, the microbial conversion of the C6 carbon source takes place in a coryneform bacterial cell according to the invention, which is a combination of reduced expression and / or activity of citrate synthase (CS) and deregulated, increased,
Expression und/oder Aktivität der Acetyl-CoA-Carboxylase-Untereinheiten (AccBC undExpression and / or activity of the acetyl-CoA carboxylase subunits (AccBC and
AccD1 ) aufweist. AccD1).
In einer weiteren Variante des erfindungsgemäßen Verfahrens zur erhöhten Bereitstellung von Malonyl-CoA erfolgt die mikrobielle Umsetzung der C6-Kohlenstoffquelle in einer erfindungsgemäßen coryneformen Bakterienzelle, die eine Kombination aus verminderter Expression und/oder Aktivität der Citratsynthase (CS) und deregulierter, gesteigerter,In a further variant of the method according to the invention for increased provision of malonyl-CoA, the microbial conversion of the C6 carbon source takes place in a coryneform bacterial cell according to the invention, which is a combination of reduced expression and / or activity of citrate synthase (CS) and deregulated, increased,
Expression und/oder Aktivität der Acetyl-CoA-Carboxylase-Untereinheiten (AccBC undExpression and / or activity of the acetyl-CoA carboxylase subunits (AccBC and
AccD1) und verminderter oder ausgeschalteter Funktionalität der Fettsäuresynthase FasB aufweist. In einer weiteren Variante des erfindungsgemäßen Verfahrens zur erhöhten Bereitstellung von Malonyl-CoA erfolgt die mikrobielle Umsetzung der C6-Kohlenstoffquelle in einer erfindungsgemäßen coryneformen Bakterienzelle der Gattung Corynebacterium oder Brevibacterium. In einer weiteren Variante des erfindungsgemäßen Verfahrens zur erhöhten Bereitstellung von Malonyl-CoA erfolgt die mikrobielle Umsetzung der C6-Kohlenstoffquelle in einer erfindungsgemäßen coryneformen Bakterienzelle ausgewählt aus der Gruppe enthaltend Corynebacterium glutamicum, besonders bevorzugt Corynebacterium glutamicum ATCC 13032, Corynebacterium acetoglutamicum, Corynebacterium thermoaminogenes, Brevibacterium flavum, Brevibacterium lactofermentum oder Brevibacterium divaricatum. Erfindungsgemäß umfasst ist auch eine Variante des erfindungsgemäßen Verfahrens zur erhöhten Bereitstellung von Malonyl-CoA erfolgt die mikrobielle Umsetzung der C6- Kohlenstoffquelle in einer erfindungsgemäßen coryneformen Bakterienzelle wie z. B. Corynebacterium glutamicum ATCC13032 oder gezielt veränderten Abkömmlingen oder Urtypen davon, wie z. B. Corynebacterium glutamicum ATCC13032 bei der außerdem zusätzlich der katabole Stoffwechselweg von aromatischen Komponenten, bevorzugt ausgewählt aus der Gruppe enthaltend Phenylpropanoide und Benzoesäure-Derivate, ausgeschaltet ist. AccD1) and reduced or deactivated functionality of the fatty acid synthase FasB. In a further variant of the method according to the invention for the increased provision of malonyl-CoA, the microbial conversion of the C6 carbon source takes place in a coryneform bacterial cell according to the invention of the genus Corynebacterium or Brevibacterium. In a further variant of the method according to the invention for the increased provision of malonyl-CoA, the microbial conversion of the C6 carbon source takes place in a coryneform bacterial cell according to the invention selected from the group containing Corynebacterium glutamicum, particularly preferably Corynebacterium glutamicum ATCC 13032, Corynebacterium acetoglutamicum, Corynebacterium thermoaminogenes, Breum , Brevibacterium lactofermentum or Brevibacterium divaricatum. The invention also includes a variant of the method according to the invention for increased provision of malonyl-CoA. The microbial conversion of the C6 carbon source takes place in a coryneform bacterial cell according to the invention, such as, for example, B. Corynebacterium glutamicum ATCC13032 or specifically modified derivatives or primary types thereof, such as. B. Corynebacterium glutamicum ATCC13032 in which the catabolic pathway of aromatic components, preferably selected from the group comprising phenylpropanoids and benzoic acid derivatives, is also switched off.
Gegenstand der vorliegenden Erfindung ist auch ein Verfahren zur mikrobiellen Herstellung von Polyphenolen oder Polyketiden in coryneformen Bakterien enthaltend die Schritte: a) Bereitstellen einer Lösung enthaltend Wasser und eine C6-Kohlenstoff-Quelle, b) mikrobielle Umsetzung der C6-Kohlenstoffquelle in einer Lösung gemäß Schritt a) zu Polyphenolen oder Polyketiden, in Anwesenheit einer erfindungsgemäßen coryneformen Bakterienzelle, wobei zunächst Malonyl-CoA in erhöhter Konzentration als Intermediat bereitgestellt und zur mikrobiellen Synthese von Polyphenolen oder Polyketiden weiter umgesetzt wird; c) Induktion der Expression Heterologe oder pflanzlicher Gene unter der Kontrolle eines induzierbaren Promotors durch Zugabe eines geeigneten Induktors in Schritt b), d) optional die Aufbereitung des gewünschten Produkts. The present invention also relates to a process for the microbial production of polyphenols or polyketides in coryneform bacteria, comprising the steps: a) providing a solution comprising water and a C6 carbon source, b) microbial conversion of the C6 carbon source in a solution according to step a) to polyphenols or polyketides, in the presence of a coryneform bacterial cell according to the invention, malonyl-CoA first being provided in an increased concentration as an intermediate and being further reacted for the microbial synthesis of polyphenols or polyketides; c) induction of the expression of heterologous or plant genes under the control of an inducible promoter by adding a suitable inductor in step b), d) optionally the preparation of the desired product.
In einer Variante des erfindungsgemäßen Verfahrens wird eine coryneforme Bakterienzelle eingesetzt, die Gene aufweist, ausgewählt aus der Gruppe enthaltend: a) fasB und/oder gltA und/oder accBCDI , deren Funktionalität und/oder Expression für eine erhöhte Bereitstellung von Malonyl-CoA gezielt modifiziert ist, und b) cg0344-47 {phdBCDE- Operon), cg2625-40 ( cat , ben und pca), cg 1226 ( pobA ) und cg0502 ( qsuB ) deren Funktionalität für den Abbau aromatischer Komponenten, bevorzugt aus der Gruppe enthaltend Phenylpropanoide oder Benzoesäure-Derivate, ausgeschaltet ist, und c) pcsShort kodierend für ein Protein mit einer gesteigerten 5,7-Dihdroxy-2- Methylchromon-Synthase-Aktivität (PCSShort) für die Synthese von Polyketiden, bevorzugt Noreugenin oder d) aroH und tal für die Vorstufen-Synthese von Polyphenolen ausgehend von Glukose, und e) 4cl und sts für die Synthese von Polyphenolen, bevorzugt Stilbene, besonders bevorzugt Resveratrol, oder f) chs und chi für die Synthese von Polyphenolen, bevorzugt Flavonoide, besonders bevorzugt Naringenin. In a variant of the method according to the invention, a coryneform bacterial cell is used which has genes selected from the group comprising: a) fasB and / or gltA and / or accBCDI, their functionality and / or expression for an increased supply of malonyl-CoA is specifically modified, and b) cg0344-47 {phdBCDE operon), cg2625-40 (cat, ben and pca), cg 1226 (pobA) and cg0502 (qsuB) their functionality for the degradation of aromatic Components, preferably from the group containing phenylpropanoids or benzoic acid derivatives, are switched off, and c) pcs short coding for a protein with an increased 5,7-dihydroxy-2-methylchromone synthase activity (PCS short ) for the synthesis of polyketides , preferably Noreugenin or d) aroH and tal for the precursor synthesis of polyphenols starting from glucose, and e) 4cl and sts for the synthesis of polyphenols, preferably stilbenes, particularly preferably resveratrol, or f) chs and chi for the synthesis of polyphenols , preferably flavonoids, particularly preferably naringenin.
Erfindungsgemäß sind hierbei zur Herstellung von Polyketiden, bevorzugt Noreugenin, Kombinationen denkbar, wie z. B. mit Varianten von fasB (Substitutionsmutanten oder Deletionsmutanten) und Acg0344-47 {phdBCDE- Operon) und Acg2625-40 {cat, ben und pca) und Acg1226 {pobA) und Acg0502 {qsuB) und pcsshor1; oder mit gtIA und Acg0344-47 {phdBCDE-Operon) und Acg2625-40 {cat, ben und pca) und Acg1226 {pobA) und Acg0502 {qsuB) und pcsshort; oder mit gtIA und accBCDI und Acg0344-47 {phdBCDE-Operon ) und Acg2625-40 {cat, ben und pca) und Acg1226 {pobA) und Acg0502 {qsuB) und pcsSh0rt; oder mit Varianten von fasB (Substitutionsmutanten oder Deletionsmutanten) und gtIA und accBCDI und Acg0344-47 {phdBCDE- Operon) und Acg2625-40 {cat, ben und pca) und Acg1226 {pobA) und Acg0502 {qsuB) und pcsshort. According to the invention, for the preparation of polyketides, preferably noreugenin, combinations are conceivable, such as, for. B. with variants of fasB (substitution mutants or deletion mutants) and Acg0344-47 {phdBCDE operon) and Acg2625-40 {cat, ben and pca) and Acg1226 {pobA) and Acg0502 {qsuB) and pcs shor1 ; or with gtIA and Acg0344-47 {phdBCDE operon) and Acg2625-40 {cat, ben and pca) and Acg1226 {pobA) and Acg0502 {qsuB) and pcs short ; or with gtIA and accBCDI and Acg0344-47 {phdBCDE-Operon) and Acg2625-40 {cat, ben and pca) and Acg1226 {pobA) and Acg0502 {qsuB) and pcs Sh0rt ; or with variants of fasB (substitution mutations or deletion mutants) and gtIA and accBCDI and Acg0344-47 {phdBCDE operon) and Acg2625-40 {cat, ben and pca) and Acg1226 {pobA) and Acg0502 {qsuB) and pcs short .
Erfindungsgemäß sind zur Herstellung von Polyphenolen, bevorzugt Stilbene, weiter bevorzugt Resveratrol, sind Kombinationen denkbar, wie z. B. mit Varianten von fasB (Substitutionsmutanten oder Deletionsmutanten) und Acg0344-47 {phdBCDE-Opero ) und Acg2625-40 {cat, ben und pca) und Acg1226 {pobA) und Acg0502 {qsuB) und aroH und tal und 4cl und sts; mit gtIA und Acg0344-47 {phdBCDE- Operon) und Acg2625-40 {cat, ben und pca) und Acg1226 {pobA) und Acg0502 {qsuB) und aroH und tal und 4cl und sts; mit gtIA und accBCDI und Acg0344-47 {phdBCDE-Operon ) und Acg2625-40 {cat, ben und pca) und Acg1226 {pobA) und Acg0502 {qsuB) und aroH und tal und 4cl und sts; mit Varianten von fasB (Substitutionsmutanten oder Deletionsmutanten) und gtIA und accBCDI und Acg0344- 47 (phdBCDE-Operon ) und Acg2625-40 ( cat , ben und pca) und Acg1226 ( pobA ) und Acg0502 ( qsuB ) und aroH und tal und 4cl und sts. Diese zuvor genannten Variante erlauben die Herstellung der Polyphenole ausgehend von Glukose aufgrund der Expression der Gene aroH und tal. Die Gene aroH und tal sind allerdings nicht erforderlich für eine mit der Vorstufe p-Cumarsäure supplementierte Kultivierung der erfindungsgemäßen coryneformen Bakterienzelle. Erfindungsgemäße Varianten der zuvor genannten coryneformen Bakterienzelle weisen dann die Gene aroH und tal nicht auf oder die Expression dieser Gene wird nicht induziert. According to the invention for the preparation of polyphenols, preferably stilbenes, more preferably resveratrol, combinations are conceivable, such as. B. with variants of fasB (substitution or deletion mutants) and Acg0344-47 {phdBCDE opero) and Acg2625-40 {cat, ben and pca) and Acg1226 {pobA) and Acg0502 {qsuB) and aroH and tal and 4cl and sts; with gtIA and Acg0344-47 {phdBCDE operon) and Acg2625-40 {cat, ben and pca) and Acg1226 {pobA) and Acg0502 {qsuB) and aroH and tal and 4cl and sts; with gtIA and accBCDI and Acg0344-47 {phdBCDE operon) and Acg2625-40 {cat, ben and pca) and Acg1226 {pobA) and Acg0502 {qsuB) and aroH and tal and 4cl and sts; with variants of fasB (substitution mutants or deletion mutants) and gtIA and accBCDI and Acg0344- 47 (phdBCDE operon) and Acg2625-40 (cat, ben and pca) and Acg1226 (pobA) and Acg0502 (qsuB) and aroH and tal and 4cl and sts. These previously mentioned variants allow the production of the polyphenols starting from glucose on the basis of the expression of the aroH and tal genes. However, the genes aroH and tal are not required for a cultivation of the coryneform bacterial cell according to the invention supplemented with the precursor p-cumaric acid. Variants of the aforementioned coryneform bacterial cell according to the invention then do not have the genes aroH and tal or the expression of these genes is not induced.
Erfindungsgemäß sind zur Herstellung von Polyphenolen, bevorzugt Flavonoide, weiter bevorzugt Naringenin, Kombinationen denkbar, wie z. B. mit Varianten von fasB (Substitutionsmutanten oder Deletionsmutanten) und Acg0344-47 (phdBCDE- Operon) und Acg2625-40 (cat, ben und pca) und Acg1226 ( pobA ) und Acg0502 ( qsuB ) und aroH und tal und chs und chi; mit gtIA und Acg0344-47 (phdBCDE-Operon) und Acg2625-40 (cat, ben und pca) und Acg1226 (pobA) und Acg0502 (qsuB) und aroH und tal und chs und chi; mit gtIA und accBCDI und Acg0344-47 (phdBCDE- Operon) und Acg2625-40 (cat, ben und pca) und Acg1226 (pobA) und Acg0502 (qsuB) und aroH und tal und chs und chi; mit Varianten von fasB (Substitutionsmutanten oder Deletionsmutanten) und gtIA und accBCDI und Acg0344- 47 (phdBCDE- Operon) und Acg2625-40 (cat, ben und pca) und Acg1226 (pobA) und Acg0502 (qsuB) und aroH und tal und chs und chi. Diese zuvor genannten Variante erlauben die Herstellung der Polyphenole ausgehend von Glukose aufgrund der Expression der Gene aroH und tal. Die Gene aroH und tal sind allerdings nicht erforderlich für eine mit der Vorstufe p-Cumarsäure supplementierte Kultivierung der erfindungsgemäßen coryneformen Bakterienzelle. Erfindungsgemäße Varianten der zuvor genannten coryneformen Bakterienzelle weisen dann die Gene aroH und tal gegebenenfalls nicht auf. According to the invention, combinations are conceivable for the production of polyphenols, preferably flavonoids, more preferably naringenin, such as, for. B. with variants of fasB (substitution mutants or deletion mutants) and Acg0344-47 (phdBCDE operon) and Acg2625-40 (cat, ben and pca) and Acg1226 (pobA) and Acg0502 (qsuB) and aroH and tal and chs and chi; with gtIA and Acg0344-47 (phdBCDE operon) and Acg2625-40 (cat, ben and pca) and Acg1226 (pobA) and Acg0502 (qsuB) and aroH and tal and chs and chi; with gtIA and accBCDI and Acg0344-47 (phdBCDE operon) and Acg2625-40 (cat, ben and pca) and Acg1226 (pobA) and Acg0502 (qsuB) and aroH and tal and chs and chi; with variants of fasB (substitution mutations or deletion mutants) and gtIA and accBCDI and Acg0344-47 (phdBCDE operon) and Acg2625-40 (cat, ben and pca) and Acg1226 (pobA) and Acg0502 (qsuB) and aroH and tal and chs and chi. These previously mentioned variants allow the production of the polyphenols starting from glucose on the basis of the expression of the aroH and tal genes. However, the genes aroH and tal are not required for a cultivation of the coryneform bacterial cell according to the invention supplemented with the precursor p-cumaric acid. Variants of the aforementioned coryneform bacterial cell according to the invention may then not have the genes aroH and tal.
In einer Variante des erfindungsgemäßen Verfahrens zur Polyphenol-Herstellung wird die Lösung in Schritt b) mit der Polyphenol-Vorstufe, bevorzugt p-Cumarsäure, supplementiert. In a variant of the process for the production of polyphenol according to the invention, the solution in step b) is supplemented with the polyphenol precursor, preferably p-cumaric acid.
Hierbei ist die Supplementation mit p-Cumarsäure in einer Konzentration von 1 - 10 mIVI, bevorzugt 2 - 8 mM, besonders bevorzugt 3 - 7 mM, ganz besonders bevorzugt 5 - 6 mM und insbesondere 5 mM sowie alle denkbaren Zwischenstufen geeignet. Supplementation with p-cumaric acid in a concentration of 1-10 mIVI, preferably 2-8 mM, particularly preferably 3-7 mM, very particularly preferably 5-6 mM and in particular 5 mM and all conceivable intermediates is suitable.
Unter „Aufbereitung“ ist erfindungsgemäß gleichbedeutend zu verstehen „Abtrennung“, „Extraktion“, „Aufkonzentrierung“ oder„Aufreinigung“. Die Produktaufbereitung ist in dem erfindungsgemäßen Verfahren zur Herstellung von Polyketiden und Polyphenolen optional, da durch die vorteilhafte, gezielte Stammkonstruktion erfindungsgemäßer coryneformer Bakterien die Produktion nur eines Sekundärmetaboliten erzielt wird, wie z. B. Resveratrol oder Naringenin oder Noreugenin. Dadurch ist in vorteilhafter Weise die Trennung mehrerer, verschiedener Produkte, wie z. B. Resveratrol und Naringenin, aus der Kulturlösung nicht erforderlich. Die ist ein weiterer Vorteil der vorliegenden Erfindung. Außerdem zeichnet sich das erfindungsgemäße Verfahren in vorteilhafter Weise dadurch aus, dass es unabhängig von der Zugabe von Inhibitoren der Fettsäuresynthese, beispielsweise Cerulenin, ist. Eine weitere Extraktion, Aufbereitung der Zellen, Zellextrakte oder Zellüberstände sind dem Fachmann bekannt und können in bekannter Weise erfolgen. According to the invention, “preparation” is to be understood as meaning “separation”, “extraction”, “concentration” or “purification”. The product preparation is optional in the process according to the invention for the production of polyketides and polyphenols, since the coryneformer according to the invention is advantageous due to the advantageous, targeted parent construction Bacteria the production of only one secondary metabolite is achieved, such as. B. resveratrol or naringenin or noreugenin. As a result, the separation of several different products, such as. B. resveratrol and naringenin, not required from the culture solution. This is another advantage of the present invention. In addition, the process according to the invention is advantageously characterized in that it is independent of the addition of inhibitors of fatty acid synthesis, for example cerulenin. A further extraction, processing of the cells, cell extracts or cell supernatants are known to the person skilled in the art and can be carried out in a known manner.
In Varianten des erfindungsgemäßen Verfahrens erfolgt die Kultivierung in einem diskontinuierlichen oder kontinuierlichen, bevorzugt batch-, fed-batch-, repeated-fed-batch- oder kontinuierlichen Modus. Die erforderlichen Vorgehensweisen zur Durchführung solcher Kultivierungsverfahren sind dem Fachmann bekannt. In variants of the method according to the invention, cultivation takes place in a discontinuous or continuous, preferably batch, fed-batch, repeated fed-batch or continuous mode. The necessary procedures for carrying out such cultivation methods are known to the person skilled in the art.
Gegenstand der vorliegenden Erfindung ist auch die Verwendung einer erfindungsgemäßen coryneformen Bakterienzelle der zuvor beschriebenen Art und/oder eines oder mehrerer erfindungsgemäßer Proteine und/oder einer oder mehrerer erfindungsgemäßer Nukleotidsequenzen zur erhöhten Bereitstellung von Malonyl-CoA in coryneformen Bakterien. The present invention also relates to the use of a coryneform bacterial cell according to the invention of the type described above and / or one or more proteins according to the invention and / or one or more nucleotide sequences according to the invention for the increased provision of malonyl-CoA in coryneform bacteria.
Ebenso ist Gegenstand der vorliegenden Erfindung die Verwendung einer erfindungsgemäßen coryneformen Bakterienzelle und/oder eines oder mehrerer erfindungsgemäßer Proteine und/oder einer oder mehrerer erfindungsgemäßer Nukleotidsequenzen zur Polyketid- oder Polyphenol-Herstellung, bevorzugt zur Herstellung von Noreugenin oder zur Herstellung von Stilbenen, besonders bevorzugt Resveratrol, oder zur Herstellung von Flavonoiden, besonders bevorzugt Naringenin. The present invention also relates to the use of a coryneform bacterial cell according to the invention and / or one or more proteins and / or one or more nucleotide sequences according to the invention for the production of polyketide or polyphenol, preferably for the production of noreugenin or for the production of stilbenes, particularly preferably resveratrol , or for the production of flavonoids, particularly preferably naringenin.
Gegenstand der vorliegenden Erfindung ist auch eine Zusammensetzung enthaltend Sekundärmetabolite ausgewählt aus der Gruppe der Polyphenole und Polyketide, bevorzugt der Stilbene, Flavonoide oder Polyketide, besonders bevorzugt Resveratrol, Naringenin und/oder Noreugenin, hergestellt mit einer erfindungsgemäßen coryneformen Bakterienzelle und/oder einem oder mehreren erfindungsgemäßen Proteinen und/oder einer oder mehrerer erfindungsgemäßer Nukleotidsequenzen und/oder einem erfindungsgemäßen Verfahren der zuvor beschriebenen Art. Gegenstand der vorliegenden Erfindung ist weiter die Verwendung von Resveratrol, Naringenin und/oder Noreugenin hergestellt mit einer erfindungsgemäßen coryneformen Bakterienzelle und/oder nach einem erfindungsgemäß Verfahren und/oder die Verwendung einer Zusammensetzung der zuvor beschriebenen Art zur Herstellung von Pharmazeutika, Lebensmitteln, Futtermitteln, und/oder zum Einsatz in der Pflanzenphysiologie. Die erfindungsgemäße Zusammensetzung kann weitere Stoffe aufweisen, die bei der Herstellung der gewünschten Produkte vorteilhaft sind. Eine Auswahl ist dem Fachmann aus dem Stand der Technik bekannt. The present invention also relates to a composition containing secondary metabolites selected from the group of polyphenols and polyketides, preferably the stilbenes, flavonoids or polyketides, particularly preferably resveratrol, naringenin and / or noreugenin, produced with a coryneform bacterial cell according to the invention and / or one or more according to the invention Proteins and / or one or more nucleotide sequences according to the invention and / or a method according to the invention of the type described above. The present invention furthermore relates to the use of resveratrol, naringenin and / or noreugenin produced with a coryneform bacterial cell according to the invention and / or according to a method according to the invention and / or the use of a composition of the type described above for the production of pharmaceuticals, foods, animal feeds, and / or for use in plant physiology. The composition according to the invention can contain further substances which are advantageous in the production of the desired products. A selection is known to the person skilled in the art from the prior art.
Tabellen und Figuren: Tables and figures:
Tabelle 1 zeigt eine Übersicht an Bakterienstämmen der vorliegenden Erfindung. Table 1 shows an overview of bacterial strains of the present invention.
Tabelle 2 zeigt eine Übersicht an Plasmiden der vorliegenden Erfindung Tabelle 3 zeigt eine Übersicht der SEQ ID NO‘s der vorliegenden Erfindung. Table 2 shows an overview of plasmids of the present invention. Table 3 shows an overview of the SEQ ID NOs of the present invention.
Figur 1 zeigt Plasmid pK19mobsacB-fasß-E622 für die Aminosäuresubstitution E622K im fasß-Gen (cg2743), kodierend für eine Fettsäuresynthase FasB mit verminderter Funktionali- tät. FIG. 1 shows plasmid pK19mobsacB-fasß-E622 for the amino acid substitution E622K in the fasß gene (cg2743), coding for a fatty acid synthase FasB with reduced functionality.
Figur 2 zeigt Plasmid pK19mobsacB-fasß-G1361 D für die Aminosäuresubstitution G1361 D im fasß-Gen (cg2743), kodierend für eine Fettsäuresynthase FasB mit verminderter Funktionalität.  FIG. 2 shows plasmid pK19mobsacB-fasß-G1361 D for the amino acid substitution G1361 D in the fasß gene (cg2743), coding for a fatty acid synthase FasB with reduced functionality.
Figur 3 zeigt Plasmid pK19mobsacB-fasß-G2153D, für die Aminosäuresubstitution G2153D im fasß-Gen (cg2743), kodierend für eine Fettsäuresynthase FasB mit verminderter Funktio nalität.  Figure 3 shows plasmid pK19mobsacB-fasß-G2153D, for the amino acid substitution G2153D in the fasß gene (cg2743), coding for a fatty acid synthase FasB with reduced functionality.
Figur 4 zeigt Plasmid pK19mobsacB-fasß-G2668S für die Aminosäuresubstitution G2668S im fasß-Gen (cg2743), kodierend für eine Fettsäuresynthase FasB mit verminderter Funktio- nalität.  FIG. 4 shows plasmid pK19mobsacB-fasß-G2668S for the amino acid substitution G2668S in the fasß gene (cg2743), coding for a fatty acid synthase FasB with reduced functionality.
Figur 5 zeigt Plasmid pK19mobsacB -AfasB für die in-frame Deletion von fasB (cg2743), für eine Fettsäuresynthase FasB deren Funktionalität ausgeschaltet ist.  FIG. 5 shows plasmid pK19mobsacB -AfasB for the in-frame deletion of fasB (cg2743), for a fatty acid synthase FasB whose functionality is switched off.
Figur 6 zeigt Plasmid pK19mobsacB-P5/M::Ptiap/l-C7 für die chromosomale Integration des für C. glutamicum codon-optimierten Genes 4cl aus Petroselinum crispum unter Kontrolle des IPTG-induzierbaren T7-Promotors an den Deletionslocus Acg0344-47 (Acg 0344-47 ::P 7- 4clpcCg)· FIG. 6 shows plasmid pK19mobsacB-P 5 / M :: P tiap / l- C7 for the chromosomal integration of the gene 4cl from Petroselinum crispum codon-optimized for C. glutamicum under control of the IPTG-inducible T7 promoter at the deletion locus Acg0344-47 (Acg 0344-47 :: P 7- 4clp cCg )
Figur 7 zeigt Plasmid pK19mobsacB-mufasO-accßC zur Mutation der fasO-Bindestelle vor denen Genen accBC (cg0802), kodierend für eine AcetylCoA-Carboxylase-Untereinheit. Figur 8 zeigt Plasmid pK19mobsacB-mufasO-accD7 zur Mutation der fasO-Bindestelle vor dem Gen accD1 (cg0812), kodierend für eine AcetylCoA-Carboxylase-Untereinheit, unter Berücksichtigung des ATG-Startcodons und der Aminosäuresequenz von accD1.  FIG. 7 shows plasmid pK19mobsacB-mufasO-accßC for mutating the fasO binding site in front of the genes accBC (cg0802), coding for an acetylCoA carboxylase subunit. FIG. 8 shows plasmid pK19mobsacB-mufasO-accD7 for mutating the fasO binding site in front of the accD1 gene (cg0812), coding for an acetylCoA carboxylase subunit, taking into account the ATG start codon and the amino acid sequence of accD1.
Figur 9 zeigt Plasmid pMKEx2-stsAh-4dPc zur Expression der für C. glutamicum codon- optimierten Gene für eine Stilben Synthase ( sts ) aus Arachis hypogea und eine 4 Cumarat CoA Ligase {4c!) aus Petroselinum crispum unter Kontrolle des IPTG-induzierbaren T7- Promotors FIG. 9 shows plasmid pMKEx2-sts Ah- 4d Pc for expression of the genes codon-optimized for C. glutamicum for a stilbene synthase (sts) from Arachis hypogea and a 4 Cumarat CoA ligase {4c!) From Petroselinum crispum under the control of the IPTG- inducible T7 promoter
Figur 10 zeigt Plasmid pMKEx2-chsPh-chiPhzur Expression der für C. glutamicum codon- optimierten Gene für eine Chalkon Synthase (chs) aus Petunia x hybrida und eine Chalkon Isomerase (chi) aus Petunia x hybrida unter Kontrolle des IPTG-induzierbaren T7-Promotors Figur 11 zeigt Plasmid pMKEx2-pcsA3-short zur Expression einer verkürzten Variante des für C. glutamicum codon-optimierten Gens für eine Pentaketide Chromone Synthase (pcs) aus Aloe arborescens FIG. 10 shows plasmid pMKEx2-chs Ph -chi Ph for expressing the genes codon-optimized for C. glutamicum for a chalcone synthase (chs) from Petunia x hybrida and a chalcone isomerase (chi) from Petunia x hybrida under the control of the IPTG-inducible T7 promoter FIG. 11 shows plasmid pMKEx2-pcs A3 -short for expressing a shortened variant of the gene optimized for C. glutamicum codon-optimized for a pentaketide chromone synthase (pcs) from aloe arborescens
Figur 12 zeigt Plasmid pK19mobsacB-cg0344-47-del mit dem das phdBCDE- Operon (cg0344-47), welches für Gene codiert, die am Katabolismus von Phenylpropanoiden betei- ligt sind, wie z. B. p-Cumarsäure, aus dem Genom deletiert wird.  FIG. 12 shows plasmid pK19mobsacB-cg0344-47-del with which the phdBCDE operon (cg0344-47), which codes for genes which are involved in the catabolism of phenylpropanoids, such as, for. B. p-cumaric acid, is deleted from the genome.
Figur 13 zeigt Plasmid pK19mobsacB-cg2625-40-del mit dem die Gene cat, ben und pca (cg2625-40), die essentiell für den Abbau von 4-Hydroxybenzoat, Catechol, Benzoat und Protocatechuat sind, aus dem Genom deletiert werden. FIG. 13 shows plasmid pK19mobsacB-cg2625-40-del with which the genes cat, ben and pca (cg2625-40), which are essential for the breakdown of 4-hydroxybenzoate, catechol, benzoate and protocatechuate, are deleted from the genome.
Figur 14 zeigt Plasmid pK19mobsacB-Acg0344-47::PT7-4c/Pcfür die chromosomale Integrati on einer für C. glutamicum codon-optimierten Variante des 4cl- Gens aus Petroselinum cris- pum, unter Kontrolle des T7-Promotors (PT7-4C/Pc), an den Deletionslocus Dcg0344-47. FIG. 14 shows plasmid pK19mobsacB-Acg0344-47 :: P T7 -4c / Pc for the chromosomal integration of a variant of the 4cl gene from Petroselinum crispum codon-optimized for C. glutamicum, under the control of the T7 promoter (PT7- 4C / Pc ), to the deletion locus Dcg0344-47.
Figur 15 zeigt Plasmid pK19mobsacB-cg0502-del mit dem das Gen qsuB (cg0502), essenti- ell für die Akkumulation von Protocatechuat, aus dem Genom deletiert wird. FIG. 15 shows plasmid pK19mobsacB-cg0502-del with which the gene qsuB (cg0502), essential for the accumulation of protocatechuate, is deleted from the genome.
Figur 16 zeigt Plasmid pK19mobsacB-cg1226-del mit dem das Gen phobA (cg1226), kodie rend für 4-Hydroxybenzoate-3-Hydroxylase und essentiell für den Abbau von 4-Hydroxybenzoat, Catechol, Benzoat und Protocatechuat, aus dem Genom deletiert wird. Figure 16 shows plasmid pK19mobsacB-cg1226-del with which the gene phobA (cg1226), coding for 4-hydroxybenzoate-3-hydroxylase and essential for the breakdown of 4-hydroxybenzoate, catechol, benzoate and protocatechuate, is deleted from the genome.
Figur 17 zeigt Plasmid pEKEx3-aro/-/£c-fa/Pcg mit denen Genen kodierend für eine feedbackresistente 3-Deoxy-D-Arabinoheptulosonat-7-Phosphat-Synthase (aroH), bevorzugt aus E. coli ( aroHEc ), sowie für eine and die Codonverwendung von C. glutamicum angepasste Tyro- sinammonium-Lyase (tal), bevorzugt aus Flavobacertium johnsoniae (talFj)· Diese Plasmid findet Einsatz bei der Synthese von Polyphenolen oder Polyketiden bei Wachstum ausge hend von Glukose. FIG. 17 shows plasmid pEKEx3-aro / - / £ c -fa / P c g with the genes coding for a feedback-resistant 3-deoxy-D-arabinoheptulosonate-7-phosphate synthase (aroH), preferably from E. coli (aroH Ec ), as well as for a tyrosine ammonium lyase (tal) adapted to the codon use of C. glutamicum, preferably from Flavobacertium johnsoniae (tal Fj ) · This plasmid is used in the synthesis of polyphenols or polyketides during growth starting from glucose.
Figur 18 zeigt Plasmid pMKEx2_sfS/u,_4c/Pc für die Expression der Gene sfs aus Arachis hypogea ( stsAh ) und 4c/ aus Petroselinum crispum (4c/Pc) in coryneformen Bakterienzellen. FIG. 18 shows plasmid pMKEx2_sfS / u, _4c / Pc for the expression of the genes sfs from Arachis hypogea (sts Ah ) and 4c / from Petroselinum crispum (4c / Pc ) in coryneform bacterial cells.
Figur 19 zeigt Plasmid pMKEX2-cf/sP/,-c/i/' P/, für die Expression der Gene chs und chi aus Petunia x hybrida ( chsPh und chiph) in coryneformen Bakterienzellen. FIG. 19 shows plasmid pMKEX2-cf / s P / , -c / i / ' P / , for the expression of the genes chs and chi from Petunia x hybrida (chs Ph and chip h ) in coryneform bacterial cells.
Figur 20 zeigt Plasmid pMKEx2 _pcsAa für die Expression von pcs aus Aloe arborescens ( pcsAa ) mit Anpassung an die Codonverwendung von coryneformen Bakterienzellen. FIG. 20 shows plasmid pMKEx2 _pcs Aa for the expression of pcs from Aloe arborescens (pcs Aa ) with adaptation to the codon use of coryneform bacterial cells.
Figur 21 zeigt Plasmid pMKEx2 _pcsAa- short für die Expression der Genvariante von pcs aus Aloe arborescens ( pcsAa ) in coryneformen Bakterienzellen. FIG. 21 shows plasmid pMKEx2 _pcs Aa - short for the expression of the gene variant of pcs from Aloe arborescens (pcs Aa ) in coryneform bacterial cells.
Figur 22 zeigt einen Sequenz-Vergleich der nativen Promotor-Region PdaPA des C. glutami- cum Wildtyp Gens mit dem erfindungsgemäßen PdapA-C7-Promotor, der den nativen gtlA- Promotor vor dem gtlA-Gen aus Corynebacterium glutamicum erfindungsgemäß ersetzt. Die erfindungsgemäße Promotorregion PgltA::PdapA-C7 weist neben dem Austausch der Pro- motorregion von gtIA (PgtIA) gegen den Promotor von dapA (PdapA) zusätzlich Nukleo- tidsubstitutionen an Position 95 (a->t) und 96 (g->a) vor dem Startcodon ATG von gtIA auf. FIG. 22 shows a sequence comparison of the native promoter region P daP A of C. glutami- cum wild-type gene with the P dapA- C7 promoter according to the invention, which replaces the native gtlA promoter before the gtlA gene from Corynebacterium glutamicum according to the invention. The promoter region PgltA :: PdapA-C7 according to the invention has, in addition to the exchange of the promoter region of gtIA (PgtIA) for the promoter of dapA (PdapA), also nucleotide substitutions at positions 95 (a-> t) and 96 (g-> a ) in front of the start codon ATG from gtIA.
Figur 23 zeigt eine Übersicht über die fasO-Bindestellen 5'-operativ-verknüpft vor den Ge- nen accBC und accD1 mit erfindungsgemäßen Nukleotidsubstitutionen resultierend in einem Verlust der Bindung des fasR-Regulators und einer gesteigerten Funktionalität bzw. Expres- sion der accBCD1-Gene. Ferner ist eine Übersicht gezeigt über fasO-accD1 Sequenzen. Das accD1- Startcodon: unterstrichen (AS-Sequenz entsprechend ab hier translatiert), grau hinterlegt: konservierte Bereiche des fasO-Bindemotivs, die mutiert werden müssen, um eine FasR-Bindung zu verhindern rot: Unterschiede zur nativen Sequenz. FIG. 23 shows an overview of the fasO binding sites 5 'operatively linked before the genes accBC and accD1 with nucleotide substitutions according to the invention, resulting in a loss of binding of the fasR regulator and an increased functionality or expression of the accBCD1 genes . An overview of fasO-accD1 sequences is also shown. The accD1 start codon: underlined (AS sequence translated accordingly from here), highlighted in gray: conserved areas of the fasO binding motif that have to be mutated to prevent FasR binding red: differences to the native sequence.
Figur 24 zeigt ein Diagramm mit Malonyl-CoA-Konzentrationen (gemessen in Form von mM Malonat) in erfindungsgemäßen coryneformen Bakterienzellen. FIG. 24 shows a diagram with malonyl-CoA concentrations (measured in the form of mM malonate) in coryneform bacterial cells according to the invention.
Die vorliegende Erfindung wird durch die folgenden Beispiele näher erläutert, die jedoch nicht limitierend sind: The present invention is illustrated by the following examples, which, however, are not limiting:
Veränderung der regulatorischen Bindestelle im Promotorbereich der Citratsvnthase CS durch Nukleotidsubstitutionen zur Integration in das Genom coryneformer BakterienzellenChange of the regulatory binding site in the promoter area of the citrate protein CS by nucleotide substitutions for integration into the genome of coryneform bacterial cells
Klonierung pK19mobsacB-PgltA::PdapA-C7 Cloning pK19mobsacB-PgltA :: PdapA-C7
Zur Konstruktion des Plasmids pK19mobsacB-PgltA::PdapA-C7 (Figur 6) wurde zunächst das Plasmid pK19mobsacB-A540 konstruiert. Hier wurden die flankierenden Bereiche so gewählt, dass ein 540 Basenpaar großes chromosomales Fragment, welches die native gltA Promotorregion mit den zwei Transkriptionsstart- und Operatorsequenzen trägt, deletiert werden kann. Zwischen die beiden Flanken up und down wurde ein 20 Basenpaar großer Linker eingefügt, der über die Schnittstellen Nsi\ und Xho\ verfügt. Über diese Schnittstellen wurde anschließend die C7-Variante des dapA-Promotors subkloniert. To construct the plasmid pK19mobsacB-PgltA :: PdapA-C7 (FIG. 6), the plasmid pK19mobsacB-A540 was first constructed. Here the flanking areas were chosen so that a 540 base pair chromosomal fragment, which carries the native gltA promoter region with the two transcription start and operator sequences, can be deleted. A 20 base pair large linker was inserted between the two edges up and down, which has the interfaces Nsi \ and Xho \. The C7 variant of the dapA promoter was then subcloned via these interfaces.
Für die Klonierung von pK19mobsacB-A540 wurde das stromaufwärts gelegenen Fragment up mit dem Primerpaar PgltA-up-s / PgltA-up-as amplifiziert, die stromabwärts gelegene Flanke wurde mit dem Primerpaar PgltA-down-s / PgltA-down-as amplifiziert. Die Überprü- fung der generierten DNA-Fragmente auf die erwartete Basenpaargröße wurde mittels gel- elektrophoretischer Analyse auf einem 1 % Agarosegel durchgeführt. Die Nukleotidsequen zen der inneren Primer (PgltA-up-as / PgltA-down-s) wurden dabei so gewählt, dass die bei- den amplifizierten Fragmente up und down zueinander komplementäre Überhänge enthalten (inklusive des beschriebenen A/s/l/X/jol-Linkers. In einer zweiten PCR (ohne Zugabe von DNA-Primern) lagern sich die gereinigten Fragmente über die komplementären Sequenzen an und dienen sich gegenseitig sowohl als Primer als auch als Matrize (overlap-extension PCR). Das so generierte A540-fragment wurde in einer finalen PCR mit den beiden äußeren (dem Gen abgewandten) Primern aus der ersten PCR amplifiziert (PgltA-up-s / PgltA-down- as). Nach elektrophoretischer Trennung auf einem 1 % TAE-Agarosegel wurde das finale Mutationsfragment mit dem NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) nach dem beiliegenden Protokoll aus dem Gel isoliert. Für die Konstruktion von pk19mobsacB-A540 wurden sowohl das generierte A540-Fragment als auch der pK19- mobsacB-Leervektor mit den FastDigest-V arianten (Thermo Fisher Scientific) der Restrikti onsenzyme Xba\ und Sma\ verdaut. Die Restriktionsansätze der genannten Fragmente wur- den mit dem NucleoSpin Gel and PCR Clean-up-KL (Macherey-Nagel, Düren) gereinigt. Für die Ligation der hydrolysierten DNA-Fragmente mittels Rapid DNA Ligation- Kit (Thermo Fis- her Scientific) wurde das Deletionsfragment in einem dreifachen molaren Überschuss ge- genüber dem linearisierten Vektorrückgrat pK19mobsacB eingesetzt. Nach erfolgter Ligation der Fragmente wurden das gesamte Ansatzvolumen für die Transformation chemisch kom- petenter E. coli DH5a-Zellen mittels Hitzeschock bei 42 °C für 90 Sekunden verwendet. Im Anschluss an den Hitzeschock wurden die Zellen 90 Sekunden auf Eis regeneriert bevor diese mit 800 pL LB-Medium versehen worden und bei 37 °C in einem Thermomixer (Ep- pendorf, Hamburg) bei 900 RPM für 60 Minuten regeneriert worden sind. Im Anschluss wur- den 100 pl_ der Zellsuspension auf LB-Agarplatten mit Kanamycin (50 pg/ml) ausgestrichen und über Nacht bei 37 °C inkubiert. Die korrekte Assemblierung von pk19mobsacB-A540 in den gewachsenen Transformanden wurde mittels Kolonie-PCR überprüft. Hierfür wurde der 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc. , Waltham, MA, USA) verwendet. Die DNA-Matrize wurde dem PCR-Ansatz hierbei durch das Hinzufügen von Zel- len der gewachsenen Kolonien beigesetzt. Durch den initialen Denaturierungsschritt des PCR-Protokolls bei 95 °C für 3 Minuten werden die Zellen lysiert, sodass die DNA-Matrize freigesetzt wurde und für die DNA-Polymerase zugänglich war. Als DNA-Primer für die Kolo- nie-PCR wurde das Primerpaar univ / rsp verwendet, welches spezifisch an das pK19mobsacB-Vektorrückgrat bindet und im Falle einer korrekten Ligation der eingesetzten Fragmente ein PCR-Produkt spezifischer Größe bildet, welches per Gelelektrophorese über- prüft wurde. Klone, deren PCR-Produkt auf eine korrekte Assemblierung von pK19mobsacB- D540 hindeutet, wurden über Nacht in LB-Medium mit Kanamycin (50 pg/mL) für die Isolie rung der Plasmide angezogen. Die Plasmide wurden anschließend mit dem NucleoSpin Plasmid (NoLid)-KA (Macherey-Nagel, Düren) isoliert und mit den genannten Amplifizie- rungs-und Kolonie-PCR-Primern sequenziert. For the cloning of pK19mobsacB-A540, the upstream fragment up was amplified with the primer pair PgltA-up-s / PgltA-up-as, the downstream flank was amplified with the primer pair PgltA-down-s / PgltA-down-as. The generated DNA fragments were checked for the expected base pair size using gel electrophoretic analysis on a 1% agarose gel. The nucleotide sequences of the inner primers (PgltA-up-as / PgltA-down-s) were chosen so that the two amplified fragments up and down contain mutually complementary overhangs (including the described A / s / l / X / In a second PCR (without the addition of DNA primers), the purified fragments accumulate via the complementary sequences and serve each other both as primers and as templates (overlap-extension PCR). The A540 fragment generated in this way was amplified in a final PCR with the two outer primers (facing away from the gene) from the first PCR (PgltA-up-s / PgltA-down-as). After electrophoretic separation on a 1% TAE agarose gel, the final mutation fragment with the The NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) was isolated from the gel according to the attached protocol .. For the construction of pk19mobsacB-A540, both the generated A540 fragment and the pK19-mobsacB empty vector with d FastDigest variants (Thermo Fisher Scientific) of the restriction enzymes Xba \ and Sma \ digested. The restriction mixtures of the fragments mentioned were cleaned with the NucleoSpin Gel and PCR Clean-up-KL (Macherey-Nagel, Düren). For the ligation of the hydrolyzed DNA fragments using a Rapid DNA Ligation Kit (Thermo Scientific Scientific), the deletion fragment was used in a triple molar excess. compared to the linearized vector backbone pK19mobsacB. After ligation of the fragments, the entire batch volume was used for the transformation of chemically competent E. coli DH5a cells by means of heat shock at 42 ° C. for 90 seconds. Following the heat shock, the cells were regenerated on ice for 90 seconds before they were provided with 800 pL LB medium and regenerated at 37 ° C. in a thermomixer (Ependorf, Hamburg) at 900 RPM for 60 minutes. Subsequently, 100 μl of the cell suspension were spread on LB agar plates with kanamycin (50 pg / ml) and incubated at 37 ° C. overnight. The correct assembly of pk19mobsacB-A540 in the grown transformants was checked by colony PCR. The 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this. The DNA template was added to the PCR approach by adding cells from the grown colonies. The cells are lysed by the initial denaturation step of the PCR protocol at 95 ° C. for 3 minutes, so that the DNA template was released and was accessible to the DNA polymerase. The primer pair univ / rsp was used as the DNA primer for the colony PCR, which binds specifically to the pK19mobsacB vector backbone and, if the fragments used are correctly ligated, forms a PCR product of a specific size, which is checked by gel electrophoresis has been. Clones whose PCR product indicated a correct assembly of pK19mobsacB-D540 were grown overnight in LB medium with kanamycin (50 pg / mL) for the isolation of the plasmids. The plasmids were then isolated with the NucleoSpin Plasmid (NoLid) -KA (Macherey-Nagel, Düren) and sequenced with the above-mentioned amplification and colony PCR primers.
Für die Konstruktion von pk19mobsacB-PgltA::PdapA-C7 wurde die C7-Variante des dapA- Promotors mit dem Primerpaar PdapA-s / PdapA-as amplifiziert und auf die erwartete Ba- senpaargröße mittels gelelektrophoretischer Analyse auf einem 1 % Agarosegel überprüft. Das generierte Fragment wurde mit dem NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) nach dem beiliegenden Protokoll gereinigt. Für die Konstruktion von pk19mobsacB-PgltA::PdapA-C7 wurden sowohl das generierte PdapA-Fragment als auch der Zielvektor pk19mobsacB-A540 mit den FastDigest-V arianten (Thermo Fisher Scientific) der Restriktionsenzyme Xho\ und Nsi\ verdaut. Die Restriktionsansätze der genannten Fragmente wurden mit dem NucleoSpin Gel and PCR Clean-up- Kit (Macherey-Nagel, Düren) gereinigt. Für die Ligation der hydrolysierten DNA-Fragmente mittels Rapid DNA Ligation- Kit (Thermo Fisher Scientific) wurde das PdapA-Fragment in einem dreifachen molaren Über- schuss gegenüber dem linearisierten Vektorrückgrat pk19mobsacB-A540 eingesetzt. Nach erfolgter Ligation der Fragmente wurden das gesamte Ansatzvolumen für die Transformation chemisch kompetenter E. coli DH5a-Zellen mittels Hitzeschock bei 42 °C für 90 Sekunden verwendet. Im Anschluss an den Hitzeschock wurden die Zellen 90 Sekunden auf Eis rege- neriert bevor diese mit 800 mI_ LB-Medium versehen worden und bei 37 °C in einem Ther- momixer (Eppendorf, Hamburg) bei 900 RPM für 60 Minuten regeneriert worden sind. Im Anschluss wurden 100 pl_ der Zellsuspension auf LB-Agarplatten mit Kanamycin (50 pg/ml) ausgestrichen und über Nacht bei 37 °C inkubiert. Die korrekte Assemblierung von pk19mobsacB-PgltA::PdapA-C7 in den gewachsenen Transformanden wurde mittels Kolo- nie-PCR überprüft. Hierfür wurde der 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) verwendet. Die DNA-Matrize wurde dem PCR-Ansatz hierbei durch das Hinzufügen von Zellen der gewachsenen Kolonien beigesetzt. Durch den initialen Denaturierungsschritt des PCR-Protokolls bei 95 °C für 3 Minuten werden die Zellen lysiert, sodass die DNA-Matrize freigesetzt wurde und für die DNA-Polymerase zugänglich war. Als DNA-Primer für die Kolonie-PCR wurde das Primerpaar univ / rsp verwendet, wel- ches spezifisch an das pK19mobsacB-Vektorrückgrat bindet und im Falle einer korrekten Ligation der eingesetzten Fragmente ein PCR-Produkt spezifischer Größe bildet, welches per Gelelektrophorese überprüft wurde. Klone, deren PCR-Produkt auf eine korrekte As- semblierung von pk19mobsacB-PgltA::PdapA-C7 hindeutet, wurden über Nacht in LB- Medium mit Kanamycin (50 pg/mL) für die Isolierung der Plasmide angezogen. Die Plasmide wurden anschließend mit dem NudeoSpin Plasmid (NoLid)-KW (Macherey-Nagel, Düren) isoliert und mit den genannten Amplifizierungs-und Kolonie-PCR-Primern sequenziert. For the construction of pk19mobsacB-PgltA :: PdapA-C7, the C7 variant of the dapA promoter was amplified with the primer pair PdapA-s / PdapA-as and checked for the expected base pair size by means of gel electrophoretic analysis on a 1% agarose gel. The generated fragment was cleaned with the NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) according to the attached protocol. For the construction of pk19mobsacB-PgltA :: PdapA-C7, both the generated PdapA fragment and the target vector pk19mobsacB-A540 were digested with the FastDigest variants (Thermo Fisher Scientific) of the restriction enzymes Xho \ and Nsi \. The restriction mixtures of the fragments mentioned were cleaned using the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren). For the ligation of the hydrolyzed DNA fragments using a Rapid DNA Ligation Kit (Thermo Fisher Scientific), the PdapA fragment was used in a triple molar excess compared to the linearized vector backbone pk19mobsacB-A540. After ligation of the fragments, the entire batch volume for the transformation of chemically competent E. coli DH5a cells was determined by heat shock at 42 ° C. for 90 seconds used. Following the heat shock, the cells were regenerated on ice for 90 seconds before they were provided with 800 ml of LB medium and regenerated at 37 ° C. in a thermal mixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes. Then 100 μl of the cell suspension were spread on LB agar plates with kanamycin (50 pg / ml) and incubated at 37 ° C. overnight. The correct assembly of pk19mobsacB-PgltA :: PdapA-C7 in the grown transformants was checked by colony PCR. The 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this. The DNA template was added to the PCR approach by adding cells from the grown colonies. The cells are lysed by the initial denaturation step of the PCR protocol at 95 ° C. for 3 minutes, so that the DNA template was released and was accessible to the DNA polymerase. The primer pair univ / rsp was used as the DNA primer for the colony PCR. It binds specifically to the pK19mobsacB vector backbone and, if the fragments used are correctly ligated, forms a PCR product of a specific size, which was checked by gel electrophoresis. Clones whose PCR product indicated correct assembly of pk19mobsacB-PgltA :: PdapA-C7 were grown overnight in LB medium with kanamycin (50 pg / mL) for the isolation of the plasmids. The plasmids were then isolated with the NudeoSpin plasmid (NoLid) KW (Macherey-Nagel, Düren) and sequenced with the amplification and colony PCR primers mentioned.
Ein Aliquot elektrokompetenter C. glutamicum- Zellen wurde mit dem beschriebenen Protokoll mit pk19mobsacB-PgltA::PdapA-C7 transformiert und auf BHIS-Kan15-Platten ausgestrichen. Da das pK19mobsacß-Plasmid in C. glutamicum nicht replizieren kann, konnte bei der an schließenden Selektion der vermittelten Kanamycin-Resistenz davon ausgegangen werden, dass diese nur ausgebildet wird, falls das Mutationsplasmid erfolgreich über die homologen Sequenzen in das Genom von C. glutamicum integriert werden konnte. Die erhaltenen In- tegranten wurden in einer ersten Selektionsrunde auf BHI-Kan25-Platten sowie BHI 10 % Saccharose (w/v)-Platten ausplattiert und über Nacht bei 30 °C inkubiert. Bei er folgreicher Genomintegration des Mutationsplasmides wird neben der Kanamycin-Resistenz die von sacB codierte Levan-Sucrase gebildet. Dieses Enzym katalysiert die Polymerisierung von Saccharose zum toxischen Levan, sodass es zu einer induzierten Letalität bei Wachs tum auf Saccharose kommt (Bramucci & Nagarajan, 1996). Demnach sind Kolonien, die das Mutationsplasmid über homologe Rekombination in ihr Genom integriert haben, resistent gegenüber Kanamycin und sensitiv gegenüber Saccharose. An aliquot of electrocompetent C. glutamicum cells was transformed with the described protocol with pk19mobsacB-PgltA :: PdapA-C7 and streaked on BHIS-Kan 15 plates. Since the pK19mobsacß plasmid cannot replicate in C. glutamicum, it could be assumed in the subsequent selection of the mediated kanamycin resistance that this would only be formed if the mutation plasmid was successfully integrated into the genome of C. glutamicum via the homologous sequences could be. In a first selection round, the integrants obtained were plated on BHI-Kan 25 plates and BHI 10% sucrose (w / v) plates and incubated at 30 ° C. overnight. If genomic integration of the mutation plasmid is successful, the Levan sucrase encoded by sacB is formed in addition to the kanamycin resistance. This enzyme catalyzes the polymerization of sucrose into toxic levan, so that there is an induced lethality when sucrose grows (Bramucci & Nagarajan, 1996). Accordingly, colonies that have integrated the mutation plasmid into their genome via homologous recombination are resistant to kanamycin and sensitive to sucrose.
Die Exzision von pK19 mobsacB fand in einem zweiten Rekombinationsereignis über die nun doppelt vorliegenden DNA-Bereiche statt, bei dem das zu mutierende Codon aus dem Chromosom letztendlich gegen das eingebrachte Mutationsfragment ausgetauscht wurde. Dazu wurden Zellen, die den beschriebenen Phänotyp (kanamycinresistent, saccharosesen- sitiv) zeigten, in einem Reagenzglas mit 3 ml BHI-Medium (ohne Zugabe von Kanamycin) für 3 Stunden bei 30 °C und 170 RPM inkubiert. Im Anschluss wurden je 100 mI einer 1 :10- Verdünnung auf BHI-Kan25-Platten sowie BHI-10 % Saccharose (w/v)-Platten ausgestrichen und über Nacht bei 30 °C inkubiert. Insgesamt wurden 50 der auf der BHI 10 % Saccharose (w/v)-Platte gewachsenen Klone ausgewählt und zur Überprüfung der erfolgreichen Exzision von pK19 mobsacB auf BHI-Kan25 sowie BHI 10 % Saccharose (w/v) ausgestrichen und über Nacht bei 30 °C inkubiert. Sollte das Plasmid vollständig entfernt worden sein, so zeigt sich dies in einer Sensitivität gegenüber Kanamycin und einer Resistenz gegenüber Saccharose des jeweiligen Klons. Das zweite Rekombinationsereignis (Exzision) kann neben der gewünschten Mutation auch zur Wiederherstellung der Wildtyp- Situation führen. Für den Nachweis des erfolgreichen Austausches in den erhaltenen Klonen nach Exzision wurde der entsprechende genomische Bereich per Kolonie-PCR amplifiziert (Primerpaar chk-PgltA-s / chk-PgltA-as) und auf die erwartete Fragmentgröße mittels Gel elektrophorese überprüft. PCR-Produkte, die einen Promotor-Austausch anzeigen, wurden mit dem NucleoSpin Gel and PCR Clean-up- Kit (Macherey-Nagel, Düren) gereinigt und zur Verifikation des Austausches mit den Primern chk-PgltA-s und chk-PgltA-as sequenziert.The excision of pK19 mobsacB took place in a second recombination event over the now duplicate DNA areas, in which the codon to be mutated from the chromosome was ultimately exchanged for the introduced mutation fragment. For this purpose, cells that have the described phenotype (kanamycin-resistant, sucrose- sitiv), incubated in a test tube with 3 ml BHI medium (without addition of kanamycin) for 3 hours at 30 ° C and 170 RPM. Subsequently, 100 ml of a 1:10 dilution were spread on BHI-Kan 25 plates and BHI-10% sucrose (w / v) plates and incubated overnight at 30 ° C. A total of 50 of the clones grown on the BHI 10% sucrose (w / v) plate were selected and streaked to check the successful excision of pK19 mobsacB on BHI-Kan 25 and BHI 10% sucrose (w / v) and overnight at 30 ° C incubated. If the plasmid has been completely removed, this is shown by a sensitivity to kanamycin and a resistance to sucrose of the respective clone. In addition to the desired mutation, the second recombination event (excision) can also restore the wild-type situation. For the detection of the successful exchange in the clones obtained after excision, the corresponding genomic region was amplified by colony PCR (primer pair chk-PgltA-s / chk-PgltA-as) and checked for the expected fragment size using gel electrophoresis. PCR products that indicate a promoter exchange were cleaned with the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) and used to verify the exchange with the primers chk-PgltA-s and chk-PgltA-as sequenced.
Die erfindungsgemäße Promotorregion PgltA::PdapA-C7 weist neben dem Austausch der Promotorregion von gtIA gegen dapA zusätzlich Nukleotidsubstitutionen an Position 95 (a->t) und 96 (g->a) vor dem Startcodon ATG auf (Figur 22). The promoter region PgltA :: PdapA-C7 according to the invention has, in addition to the exchange of the promoter region of gtIA for dapA, also nucleotide substitutions at positions 95 (a-> t) and 96 (g-> a) before the start codon ATG (FIG. 22).
Verwendete Primer Primers used
PgltA-up-s: TGCTCT AGAGCAT GAACTGGGACTT GAAG PgltA-up-s: TGCTCT AGAGCAT GAACTGGGACTT GAAG
PgltA-up-as: TATG C AT GTTT CT C G AGT GG G CC G AAC AAAT AT GTTT GAAAG G PgltA-up-as: TATG C AT GTTT CT C G AGT GG G CC G AAC AAAT AT GTTT GAAAG G
PgltA-down-s: CCCACTCGAGAAACATGCATAGCGTTTTCAATAGTTCGGTGTCPgltA-down-s: CCCACTCGAGAAACATGCATAGCGTTTTCAATAGTTCGGTGTC
PgltA-down-as: CCCCCCGGGGGGCCTAGGGAAAGGATGATCTCGTAGCC PgltA-down-as: CCCCCCGGGGGGCCTAGGGAAAGGATGATCTCGTAGCC
PdapA-s: CCAATGCATTGGTTCTGCAGTTATCACACCCAAGAGCTAAAAAT  PdapA-s: CCAATGCATTGGTTCTGCAGTTATCACACCCAAGAGCTAAAAAT
TCA  TCA
PdapA-as: CCGCTCGAGCGGCTCCGGTCTTAGCTGTTAAACCT  PdapA-as: CCGCTCGAGCGGCTCCGGTCTTAGCTGTTAAACCT
chk-PgltA-s: ATGAGTCCGAAGGTTGCTGCAT chk-PgltA-s: ATGAGTCCGAAGGTTGCTGCAT
chk-PgltA-as: TCGAGTGGGTTCAGCTGGTCC chk-PgltA-as: TCGAGTGGGTTCAGCTGGTCC
univ: CGCCAGGGTTTTCCCAGTCACGAC univ: CGCCAGGGTTTTCCCAGTCACGAC
rsp: C AC AG G AAAC AG CTAT G AC CAT G rsp: C AC AG G AAAC AG CTAT G AC CAT G
Veränderung der requlatorischen Bindestelle (Operator: fasO) für das FasR-Regulatorprotein im Promotorbereich der Acetyl-Carboxylasen AccBCDI durch Nukleotidsubstitutionen zurChange in the regulatory binding site (operator: fasO) for the FasR regulator protein in the promoter region of the acetyl carboxylases AccBCDI by nucleotide substitutions
Integration in das Genom corvneformer Bakterienzellen Integration into the genome of corvneform bacterial cells
Konstruktion pK19mobsacB-mufasO-accBC und pK19mobsacB-mufasO-accD1 Zur Konstruktion der Plasmide pK19mobsacB-mufasO-accBC (Figur 7) und pK19mobsacB- mufasO-accD1 (Figur 8) für die Mutation der jeweiligen /asO-Bindestelle der Gene accBC und accD1 in C. glutamicum, wurden die für das homologe Rekombinationsereignis benötig- ten flankierenden Fragmente per PCR ausgehend von isolierter genomischer C. glutamicum DNA amplifiziert. Construction pK19mobsacB-mufasO-accBC and pK19mobsacB-mufasO-accD1 To construct the plasmids pK19mobsacB-mufasO-accBC (FIG. 7) and pK19mobsacB-mufasO-accD1 (FIG. 8) for the mutation of the respective / asO binding site of the genes accBC and accD1 in C. glutamicum, the homologous recombination event was required. The flanking fragments were amplified by PCR based on isolated genomic C. glutamicum DNA.
Für die Generierung des stromaufwärts gelegenen Fragments wurde das Primerpaar mu- accXX-up-s / mu-accXX-up-as verwendet, die stromabwärts gelegene Flanke wurde mit dem Primerpaar mu-accXX-down-s / mu-accXX-down-as amplifiziert. Die Codierung XX steht hierbei jeweils für eine der beiden acc-Genvarianten ( accBC oder accD1). Die Nukleotidse- quenzen der inneren (dem zu deletierenden Gen zugewandten) Primer (fasB-(cg2743)-up-as / fasB-(cg2743)-down-s) wurden dabei so gewählt, dass die beiden amplifizierten Fragmente up und down zueinander komplementäre Überhänge enthalten, die für Voraussetzung für die spätere Gibson Assemblierung sind. Weiterhin werden über diese Primer die geplanten Mu- tationen innerhalb der jeweiligen fasO-Bindestelle eingeführt. Die Überprüfung der generier- ten DNA-Fragmente auf die erwartete Basenpaargröße wurde mittels gelelektrophoretischer Analyse auf einem 1 % Agarosegel durchgeführt und anschließend mit dem NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) nach dem beiliegenden Protokoll gerei- nigt. Für die Konstruktion der Mutationsplasmide wurde der pK19-mobsacB-Leervektor mit der FastDigestA/ ariante (Thermo Fisher Scientific) des Restriktionsenzyms EcoRI lineari- siert. Der Restriktionsansatz wurde mit dem NucleoSpin Gel and PCR Clean-up- Kit (Mache rey-Nagel, Düren) gereinigt. Für die Assemblierung der DNA-Fragmente mittels Gibson As- sembly (Gibson et al., 2009a) wurden die amplifzierten Fragmente in einem dreifachen mola- ren Überschuss gegenüber dem linearisierten Vektorrückgrat pK19mobsacB eingesetzt. Die DNA-Fragmente wurde mit einem vorbereiten Gibson Assembly Master Mix versehen, der neben einem isothermalen Reaktionspuffer die für die Assemblierung benötigten Enzyme (T5-Exonuklease, Phusion DNA Polymerase und Taq DNA Ligase) beinhaltet. Die Assemb- lierung der Fragmente wird bei 50 °C für 60 Minuten in einem Thermocycler durchgeführt. Nach erfolgter Assemblierung der Fragmente wurden das gesamte Ansatzvolumen für die Transformation chemisch kompetenter E. coli DH5a-Zellen mittels Hitzeschock bei 42 °C für 90 Sekunden verwendet. Im Anschluss an den Hitzeschock wurden die Zellen 90 Sekunden auf Eis regeneriert bevor diese mit 800 pl_ LB-Medium versehen worden und bei 37 °C in einem Thermomixer (Eppendorf, Hamburg) bei 900 RPM für 60 Minuten regeneriert worden sind. Im Anschluss wurden 100 pl_ der Zellsuspension auf LB-Agarplatten mit Kanamycin (50 pg/ml) ausgestrichen und über Nacht bei 37 °C inkubiert. Die korrekte Assemblierung der Mutationsplasmide in den gewachsenen Transformanden wurde mittels Kolonie-PCR über- prüft. Hierfür wurde der 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) verwendet. Die DNA-Matrize wurde dem PCR-Ansatz hierbei durch das Hinzufügen von Zellen der gewachsenen Kolonien beigesetzt. Durch den initialen Denaturierungsschritt des PCR-Protokolls bei 95 °C für 3 Minuten werden die Zellen lysiert, sodass die DNA-Matrize freigesetzt wurde und für die DNA-Polymerase zugänglich war. Als DNA-Primer für die Kolonie-PCR wurde das Primerpaar univ / rsp verwendet, welches spezifisch an das pK19mobsacB-Vektorrückgrat bindet und im Falle einer korrekten Assemblierung der einge- setzten Fragmente ein PCR-Produkt spezifischer Größe bildet, welches per Gelelektropho- rese überprüft wurde. Klone, deren PCR-Produkt auf eine korrekte Assemblierung der Muta tionsplasmide pK19mobsacB-mufasO-accBC bzw. pK19mobsacB-mufasO-accD1 hindeutet, wurden über Nacht in LB-Medium mit Kanamycin (50 pg/mL) für die Isolierung der Plasmide angezogen. Die Plasmide wurden anschließend mit dem NucleoSpin Plasmid (NoLid)-K\t (Macherey-Nagel, Düren) isoliert und mit den genannten Amplifizierungs-und Kolonie-PCR- Primern sequenziert. The primer pair mu-accXX-up-s / mu-accXX-up-as was used to generate the upstream fragment, the downstream flank was primed with the primer pair mu-accXX-down-s / mu-accXX-down-as amplified. Coding XX stands for one of the two acc gene variants (accBC or accD1). The nucleotide sequences of the inner primers (facing the gene to be deleted) (fasB- (cg2743) -up-as / fasB- (cg2743) -down-s) were chosen so that the two amplified fragments up and down complement each other Overhangs are included, which are prerequisites for the subsequent Gibson assembly. Furthermore, the planned mutations within the respective fasO binding site are introduced via these primers. The generated DNA fragments were checked for the expected base pair size by gel electrophoretic analysis on a 1% agarose gel and then cleaned with the NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) according to the enclosed protocol . For the construction of the mutation plasmids, the pK19-mobsacB empty vector was linearized with the FastDigestA / ariante (Thermo Fisher Scientific) of the restriction enzyme EcoRI. The restriction mixture was cleaned using the NucleoSpin Gel and PCR Clean-up Kit (Mache rey-Nagel, Düren). For the assembly of the DNA fragments using Gibson assembly (Gibson et al., 2009a), the amplified fragments were used in a three-fold molar excess compared to the linearized vector backbone pK19mobsacB. The DNA fragments were provided with a prepared Gibson Assembly Master Mix, which contains an isothermal reaction buffer and the enzymes required for assembly (T5 exonuclease, phusion DNA polymerase and Taq DNA ligase). The fragments are assembled at 50 ° C. for 60 minutes in a thermal cycler. After the fragments had been assembled, the entire batch volume was used for the transformation of chemically competent E. coli DH5a cells by means of heat shock at 42 ° C. for 90 seconds. Following the heat shock, the cells were regenerated on ice for 90 seconds before they were provided with 800 μl LB medium and regenerated at 37 ° C. in a thermomixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes. Then 100 μl of the cell suspension were spread on LB agar plates with kanamycin (50 pg / ml) and incubated at 37 ° C. overnight. The correct assembly of the mutation plasmids in the grown transformants was checked by means of colony PCR. The 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this. The DNA template was the PCR approach by the Add cells to the grown colonies buried. The cells are lysed by the initial denaturation step of the PCR protocol at 95 ° C. for 3 minutes, so that the DNA template was released and was accessible to the DNA polymerase. The primer pair univ / rsp was used as the DNA primer for the colony PCR. It binds specifically to the pK19mobsacB vector backbone and, if the fragments used are correctly assembled, forms a PCR product of a specific size, which is checked by gel electrophoresis has been. Clones whose PCR product indicates a correct assembly of the mutation plasmids pK19mobsacB-mufasO-accBC or pK19mobsacB-mufasO-accD1 were grown overnight in LB medium with kanamycin (50 pg / mL) for the isolation of the plasmids. The plasmids were then isolated with the NucleoSpin Plasmid (NoLid) -K \ t (Macherey-Nagel, Düren) and sequenced with the amplification and colony PCR primers mentioned.
Ein Aliquot elektrokompetenter C. glutamicum- Zellen wurde mit dem beschriebenen Protokoll mit dem jeweiligen Mutationsplasmid transformiert und auf BHIS-Kan15-Platten ausgestrichen. Da das pK19mobsacß-Plasmid in C. glutamicum nicht replizieren kann, konnte bei der anschließenden Selektion der vermittelten Kanamycin-Resistenz davon ausgegangen wer den, dass diese nur ausgebildet wird, falls das Mutationsplasmid erfolgreich über die homo logen Sequenzen in das Genom von C. glutamicum integriert werden konnte. Die erhaltenen Integranten wurden in einer ersten Selektionsrunde auf BHI-Kan25-Platten sowie BHI 10 % Saccharose (w/v)-Platten ausplattiert und über Nacht bei 30 °C inkubiert. Bei erfolgreicher Genomintegration des Mutationsplasmides wird neben der Kanamycin-Resistenz die von sacB codierte Levan-Sucrase gebildet. Dieses Enzym katalysiert die Polymerisierung von Saccharose zum toxischen Levan, sodass es zu einer induzierten Letalität bei Wachstum auf Saccharose kommt (Bramucci & Nagarajan, 1996). Demnach sind Kolonien, die das Mutationsplasmid über homologe Rekombination in ihr Genom integriert haben, resistent gegenüber Kanamycin und sensitiv gegenüber Saccharose. An aliquot of electrocompetent C. glutamicum cells was transformed using the described protocol with the respective mutation plasmid and streaked on BHIS-Kan 15 plates. Since the pK19mobsacß plasmid cannot replicate in C. glutamicum, it could be assumed in the subsequent selection of the mediated kanamycin resistance that this would only be formed if the mutation plasmid was successfully introduced into the genome of C. glutamicum via the homologous sequences could be integrated. The integrants obtained were plated in a first round of selection on BHI-Kan 25 plates and BHI 10% sucrose (w / v) plates and incubated at 30 ° C. overnight. If genomic integration of the mutation plasmid is successful, the Levan sucrase encoded by sacB is formed in addition to the kanamycin resistance. This enzyme catalyzes the polymerization of sucrose into toxic levan, so that there is an induced lethality when sucrose grows (Bramucci & Nagarajan, 1996). Accordingly, colonies that have integrated the mutation plasmid into their genome via homologous recombination are resistant to kanamycin and sensitive to sucrose.
Die Exzision von pK19 mobsacB fand in einem zweiten Rekombinationsereignis über die nun doppelt vorliegenden DNA-Bereiche statt, bei dem das zu mutierende Codon aus dem Chromosom letztendlich gegen das eingebrachte Mutationsfragment ausgetauscht wurde. Dazu wurden Zellen, die den beschriebenen Phänotyp (kanamycinresistent, saccharosesen sitiv) zeigten, in einem Reagenzglas mit 3 ml BHI-Medium (ohne Zugabe von Kanamycin) für 3 Stunden bei 30 °C und 170 RPM inkubiert. Im Anschluss wurden je 100 pl einer 1 :10- Verdünnung auf BHI-Kan25-Platten sowie BHI-10 % Saccharose (w/v)-Platten ausgestrichen und über Nacht bei 30 °C inkubiert. Insgesamt wurden 50 der auf der BHI 10 % Saccharose (w/v)-Platte gewachsenen Klone ausgewählt und zur Überprüfung der erfolgreichen Exzision von pK19mobsacß auf BHI-Kan25 sowie BHI 10 % Saccharose (w/v) ausgestrichen und über Nacht bei 30 °C inkubiert. Sollte das Plasmid vollständig entfernt worden sein, so zeigt sich dies in einer Sensitivität gegenüber Kanamycin und einer Resis- tenz gegenüber Saccharose des jeweiligen Klons. Das zweite Rekombinationsereignis (Exzision) kann neben der gewünschten Mutation auch zur Wiederherstellung der Wildtyp- Situation führen. Für den Nachweis der erfolgreichen Mutation in den erhaltenen Klonen nach Exzision wurde der entsprechende genomische Bereich per Kolonie-PCR amplifiziert (Primerpaar chk_accXX_s / chk_accXX_as). Die PCR-Produkte wurden mit dem NucleoSpin Gel and PCR Clean-up- Kit (Macherey-Nagel, Düren) gereinigt und zur Verifikation der Muta tion mit den Primern chk_accXX_s / chk_accXX_as sequenziert. The excision of pK19 mobsacB took place in a second recombination event over the now duplicate DNA areas, in which the codon to be mutated from the chromosome was ultimately exchanged for the introduced mutation fragment. For this purpose, cells which showed the phenotype described (kanamycin-resistant, sucrose-sitiv) were incubated in a test tube with 3 ml of BHI medium (without addition of kanamycin) for 3 hours at 30 ° C. and 170 RPM. Subsequently, 100 μl of a 1:10 dilution were spread on BHI-Kan 25 plates and BHI-10% sucrose (w / v) plates and incubated at 30 ° C. overnight. A total of 50 of the clones grown on the BHI 10% sucrose (w / v) plate were selected and streaked out to check the successful excision of pK19mobsacß on BHI-Kan 25 and BHI 10% sucrose (w / v) and overnight at 30 ° C incubated. The plasmid should be removed completely this is shown by a sensitivity to kanamycin and a resistance to sucrose of the respective clone. In addition to the desired mutation, the second recombination event (excision) can also restore the wild-type situation. For the detection of the successful mutation in the clones obtained after excision, the corresponding genomic region was amplified by colony PCR (primer pair chk_accXX_s / chk_accXX_as). The PCR products were cleaned with the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) and sequenced with the primers chk_accXX_s / chk_accXX_as to verify the mutation.
Erfindungsgemäß liegen somit in der fasO-Bindestelle vor accBC an den Positionen 1 1 -13 (tga -> gtc) und 20-22 (cct -> aag) Nukleotidsubstitutionen vor. In der fasO-Bindestelle vor accD1 liegen an den Positionen 20-24 (cctca -> gtacg) Nukleotidsubstitutionen vor. In einer Variante der vorliegenden Erfindung weisen die erfindungsgemäßen fasO-Bindestellen vor den Genen accBD bzw. accD1 eine Nukleinsäuresequenz gemäß SEQ ID NO: 13 bzw. 15 auf.  According to the invention, nucleotide substitutions are thus present in the fasO binding site in front of accBC at positions 1 1 -13 (tga -> gtc) and 20-22 (cct -> aag). In the fasO binding site in front of accD1 there are nucleotide substitutions at positions 20-24 (cctca -> gtacg). In a variant of the present invention, the fasO binding sites according to the invention have a nucleic acid sequence according to SEQ ID NO: 13 or 15 in front of the accBD or accD1 genes.
Verwendete Primer Primers used
univ: CGCCAGGGTTTTCCCAGTCACGAC univ: CGCCAGGGTTTTCCCAGTCACGAC
rsp: CACAGGAAACAGCTAT GACCAT G rsp: CACAGGAAACAGCTAT GACCAT G
mufasO-accBC mufasO-accBC
mu-accBC-up-s: ATCCCCGGGTACCGAGCTCGAACCAGCGCGCGTTCGTG mu-accBC-up-as: TT ACG ACT ATT CTGG G G G AATT CTTCT GTTTT AGG C AG GA mu-accBC-up-s: ATCCCCGGGTACCGAGCTCGAACCAGCGCGCGTTCGTG mu-accBC-up-as: TT ACG ACT ATT CTGG G G G AATT CTTCT GTTTT AGG C AG GA
AATATGGCTTATG  AATATGGCTTATG
mu-accBC-down-s: AG AAGAATT CCCCC AGAAT AGT CGTAAGT AAGCAT AT CT G mu-accBC-down-s: AG AAGAATT CCCCC AGAAT AGT CGTAAGT AAGCAT AT CT G
GTT GAGTT CTT CGGGGTTG  GTT GAGTT CTT CGGGGTTG
mu-accBC-down-as: TTGTAAAACGACGGCCAGTGGCCTTGGCGGTATCTGCG chk-accBC-s: GTTCGGCCACTCCGATGTCCGCCTG mu-accBC-down-as: TTGTAAAACGACGGCCAGTGGCCTTGGCGGTATCTGCG chk-accBC-s: GTTCGGCCACTCCGATGTCCGCCTG
chk-accBC-as: GCCTTGATGGCGATTGGGAGACC chk-accBC-as: GCCTTGATGGCGATTGGGAGACC
mufasO-accD1 mufasO-accD1
mu-accD1 -up-s: ATCCCCGGGTACCGAGCTCGTCATTCAACGCATCCATGA mu-accD1 -up-s: ATCCCCGGGTACCGAGCTCGTCATTCAACGCATCCATGA
CAGC  CAGC
mu-accD1-up-as: CTAATGGTCATGTTTTGAAATCGTAGCGGTAGGCGGGG mu-accD1-down-s: ACCGCTACGATTT CAAAACAT GACCATTAGT AGCCCTTT G mu-accD1-up-as: CTAATGGTCATGTTTTGAAATCGTAGCGGTAGGCGGGG mu-accD1-down-s: ACCGCTACGATTT CAAAACAT GACCATTAGT AGCCCTTT G
ATT G ACGT CGCCAACCTT C  ATT G ACGT CGCCAACCTT C
mu-accD1-down-as: TTGTAAAACGACGGCCAGTGCGCCAGAAGCCTGAATGTT mu-accD1-down-as: TTGTAAAACGACGGCCAGTGCGCCAGAAGCCTGAATGTT
TTG  TTG
chk-accD1 -s: G G CTG AT ATT AGT G C CCC AACC G AT G AC chk-accD1 -s: G G CTG AT ATT AGT G C CCC AACC G AT G AC
chk-accD1 -as: GATCACGTCTGGGCCGGTAACGAAC Deletion des Gens fasB zur Ausschaltung der Funktionalität der Fettsäuresvnthase FasB zur Integration in das Genom coryneformer Bakterienzellen chk-accD1 -as: GATCACGTCTGGGCCGGTAACGAAC Deletion of the gene fasB to switch off the functionality of the fatty acid protein FasB for integration into the genome of coryneform bacterial cells
Konstruktion pK19mobsacB-AfasB  Construction pK19mobsacB-AfasB
Zur Konstruktion des Plasmids pK19mobsacB-AfasB (Figur 5) für die Deletion des Gens fasB in C. glutamicum, wurden die für das homologe Rekombinationsereignis benötigten flankie renden Fragmente per PCR ausgehend von isolierter genomischer C. glutamicum DNA amplifiziert. To construct the plasmid pK19mobsacB-AfasB (FIG. 5) for the deletion of the fasB gene in C. glutamicum, the flanking fragments required for the homologous recombination event were amplified by PCR starting from isolated genomic C. glutamicum DNA.
Für die Generierung des stromaufwärts gelegenen Fragments wurde das Primerpaar fasB- (cg2743)-up-s / fasB-(cg2743)-up-as verwendet, die stromabwärts gelegene Flanke wurde mit dem Primerpaar fasB-(cg2743)-down-s / fasB-(cg2743)-down-as amplifiziert. Die Nukleo tidsequenzen der inneren (dem zu deletierenden Gen zugewandten) Primer (fasB-(cg2743)- up-as / fasB-(cg2743)-down-s) wurden dabei so gewählt, dass die beiden amplifizierten Fragmente up und down zueinander komplementäre Überhänge enthalten, die für Voraus setzung für die spätere Gibson Assemblierung sind. Die Überprüfung der generierten DNA- Fragmente auf die erwartete Basenpaargröße wurde mittels gelelektrophoretischer Analyse auf einem 1 % Agarosegel durchgeführt und anschließend mit dem NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) nach dem beiliegenden Protokoll gereinigt. Für die Konstruktion des Deletionsplasmids wurde der pK19-mobsacB-Leervektor mit der Fast- Digest-V ariante (Thermo Fisher Scientific) des Restriktionsenzyms EcoRI linearisiert. Der Restriktionsansatz wurde mit dem NucleoSpin Gel and PCR Clean-up- Kit (Macherey-Nagel, Düren) gereinigt. Für die Assemblierung der DNA-Fragmente mittels Gibson Assembly (Gibson et al., 2009a) wurden die amplifzierten Fragmente in einem dreifachen molaren Überschuss gegenüber dem linearisierten Vektorrückgrat pK19mobsacB eingesetzt. Die DNA-Fragmente wurde mit einem vorbereiten Gibson Assembly Master Mix versehen, der neben einem isothermalen Reaktionspuffer die für die Assemblierung benötigten Enzyme (T5-Exonuklease, Phusion DNA Polymerase und Taq DNA Ligase) beinhaltet. Die Assemb lierung der Fragmente wird bei 50 °C für 60 Minuten in einem Thermocycler durchgeführt. Nach erfolgter Assemblierung der Fragmente wurden das gesamte Ansatzvolumen für die Transformation chemisch kompetenter E. coli DH5a-Zellen mittels Hitzeschock bei 42 °C für 90 Sekunden verwendet. Im Anschluss an den Hitzeschock wurden die Zellen 90 Sekunden auf Eis regeneriert bevor diese mit 800 mI_ LB-Medium versehen worden und bei 37 °C in einem Thermomixer (Eppendorf, Hamburg) bei 900 RPM für 60 Minuten regeneriert worden sind. Im Anschluss wurden 100 mI_ der Zellsuspension auf LB-Agarplatten mit Kanamycin (50 pg/ml) ausgestrichen und über Nacht bei 37 °C inkubiert. Die korrekte Assemblierung der Mutationsplasmide in den gewachsenen Transformanden wurde mittels Kolonie-PCR überprüft. Hierfür wurde der 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) verwendet. Die DNA-Matrize wurde dem PCR-Ansatz hierbei durch das Hinzufügen von Zellen der gewachsenen Kolonien beigesetzt. Durch den initialen Denaturierungsschritt des PCR-Protokolls bei 95 °C für 3 Minuten werden die Zellen lysiert, sodass die DNA-Matrize freigesetzt wurde und für die DNA-Polymerase zugänglich war. Als DNA-Primer für die Kolonie-PCR wurde das Primerpaar univ / rsp verwendet, welches spezifisch an das pK19mobsacB-Vektorrückgrat bindet und im Falle einer korrekten Assemblierung der einge setzten Fragmente ein PCR-Produkt spezifischer Größe bildet, welches per Gelelektropho rese überprüft wurde. Klone, deren PCR-Produkt auf eine korrekte Assemblierung des Deletionsplasmids pK19mobsacB-AfasB hindeutet, wurden über Nacht in LB-Medium mit Ka- namycin (50 pg/mL) für die Isolierung der Plasmide angezogen. Die Plasmide wurden an schließend mit dem NucleoSpin Plasmid (NoLid)-K\t (Macherey-Nagel, Düren) isoliert und mit den genannten Amplifizierungs-und Kolonie-PCR-Primern sequenziert. The primer pair fasB- (cg2743) -up-s / fasB- (cg2743) -up-as was used to generate the upstream fragment, the downstream flank was primed with the primer pair fasB- (cg2743) -down-s / fasB - (cg2743) -down-as amplified. The nucleotide sequences of the inner primers (facing the gene to be deleted) (fasB- (cg2743) - up-as / fasB- (cg2743) -down-s) were chosen so that the two amplified fragments up and down complementary overhangs included, which are prerequisites for the subsequent Gibson assembly. The DNA fragments were checked for the expected base pair size using gel electrophoretic analysis on a 1% agarose gel and then cleaned using the NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) according to the enclosed protocol. For the construction of the deletion plasmid, the pK19-mobsacB empty vector was linearized with the Fast Digest variant (Thermo Fisher Scientific) of the restriction enzyme EcoRI. The restriction mixture was cleaned with the NucleoSpin Gel and PCR clean-up kit (Macherey-Nagel, Düren). For the assembly of the DNA fragments by means of Gibson assembly (Gibson et al., 2009a), the amplified fragments were used in a three-fold molar excess compared to the linearized vector backbone pK19mobsacB. The DNA fragments were provided with a prepared Gibson Assembly Master Mix, which contains an isothermal reaction buffer and the enzymes required for assembly (T5 exonuclease, phusion DNA polymerase and Taq DNA ligase). The fragments are assembled at 50 ° C. for 60 minutes in a thermal cycler. After the fragments had been assembled, the entire batch volume was used for the transformation of chemically competent E. coli DH5a cells by means of heat shock at 42 ° C. for 90 seconds. Following the heat shock, the cells were regenerated on ice for 90 seconds before they were provided with 800 ml of LB medium and regenerated at 37 ° C. in a thermomixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes. Subsequently, 100 ml of the cell suspension were spread on LB agar plates with kanamycin (50 pg / ml) and incubated at 37 ° C. overnight. The correct assembly of the Mutation plasmids in the grown transformants were checked by colony PCR. The 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this. The DNA template was added to the PCR approach by adding cells from the grown colonies. The cells are lysed by the initial denaturation step of the PCR protocol at 95 ° C. for 3 minutes, so that the DNA template was released and was accessible to the DNA polymerase. The primer pair univ / rsp was used as the DNA primer for the colony PCR, which binds specifically to the pK19mobsacB vector backbone and, if the fragments used are correctly assembled, forms a PCR product of a specific size, which was checked by gel electrophoresis. Clones whose PCR product indicated a correct assembly of the deletion plasmid pK19mobsacB-AfasB were grown overnight in LB medium with kamanycin (50 pg / mL) for the isolation of the plasmids. The plasmids were then isolated with the NucleoSpin plasmid (NoLid) -K \ t (Macherey-Nagel, Düren) and sequenced with the amplification and colony PCR primers mentioned.
Ein Aliquot elektrokompetenter C. glutamicum- Zellen wurde mit dem beschriebenen Protokoll mit dem jeweiligen Deletionsplasmid transformiert und auf BHIS-Kan15-Platten ausgestri chen. Da das pK19mobsacB-Plasmid in C. glutamicum nicht replizieren kann, konnte bei der anschließenden Selektion der vermittelten Kanamycin-Resistenz davon ausgegangen wer den, dass diese nur ausgebildet wird, falls das Deletionsplasmid erfolgreich über die homo logen Sequenzen in das Genom von C. glutamicum integriert werden konnte. Die erhaltenen Integranten wurden in einer ersten Selektionsrunde auf BHI-Kan25-Platten sowie BHI 10 % Saccharose (w/v)-Platten ausplattiert und über Nacht bei 30 °C inkubiert. Bei er folgreicher Genomintegration des Deletionsplasmid wird neben der Kanamycin-Resistenz die von sacB codierte Levan-Sucrase gebildet. Dieses Enzym katalysiert die Polymerisierung von Saccharose zum toxischen Levan, sodass es zu einer induzierten Letalität bei Wachs tum auf Saccharose kommt (Bramucci & Nagarajan, 1996). Demnach sind Kolonien, die das Deletionsplasmid über homologe Rekombination in ihr Genom integriert haben, resistent gegenüber Kanamycin und sensitiv gegenüber Saccharose. An aliquot of electrocompetent C. glutamicum cells was transformed using the described protocol with the respective deletion plasmid and streaked on BHIS-Kan 15 plates. Since the pK19mobsacB plasmid cannot replicate in C. glutamicum, it could be assumed in the subsequent selection of the mediated kanamycin resistance that this would only develop if the deletion plasmid was successfully introduced into the genome of C. glutamicum via the homologous sequences could be integrated. The integrants obtained were plated in a first round of selection on BHI-Kan 25 plates and BHI 10% sucrose (w / v) plates and incubated at 30 ° C. overnight. If the deletion plasmid is successfully integrated, the levan-sucrase encoded by sacB is formed in addition to the kanamycin resistance. This enzyme catalyzes the polymerization of sucrose into toxic levan, so that there is an induced lethality when sucrose grows (Bramucci & Nagarajan, 1996). Accordingly, colonies that have integrated the deletion plasmid into their genome via homologous recombination are resistant to kanamycin and sensitive to sucrose.
Die Exzision von pK19 mobsacB fand in einem zweiten Rekombinationsereignis über die nun doppelt vorliegenden DNA-Bereiche statt, bei dem das zu mutierende Codon aus dem Chromosom letztendlich gegen das eingebrachte Mutationsfragment ausgetauscht wurde. Dazu wurden Zellen, die den beschriebenen Phänotyp (kanamycinresistent, saccharosesensitiv) zeigten, in einem Reagenzglas mit 3 ml BHI-Medium (ohne Zugabe von Kanamycin) für 3 Stunden bei 30 °C und 170 RPM inkubiert. Im Anschluss wurden je 100 pl einer 1 :10- Verdünnung auf BHI-Kan25-Platten sowie BHI-10 % Saccharose (w/v)-Platten ausgestrichen und über Nacht bei 30 °C inkubiert. Insgesamt wurden 50 der auf der BHI 10 % Saccharose (w/v)-Platte gewachsenen Klone ausgewählt und zur Überprüfung der erfolgreichen Exzision von pK19 mobsacB auf BHI-Kan25 sowie BHI 10 % Saccharose (w/v) ausgestrichen und über Nacht bei 30 °C inkubiert. Sollte das Plasmid vollständig entfernt worden sein, so zeigt sich dies in einer Sensitivität gegenüber Kanamycin und einer Resistenz gegenüber Saccharose des jeweiligen Klons. Das zweite Rekombinationsereignis (Exzision) kann neben der gewünschten Deletion auch zur Wiederherstellung der Wildtyp- Situation führen. Die erfolgreiche Deletion in den erhaltenen Klonen nach Exzision wurde über die erwartete Fragmentgröße bei Deletion des mittels Kolonie-PCR der erhaltenen Klone überprüft. Die verwendeten Primer chk-fasB-s / chk-fasB-as wurden hierbei so gewählt, dass sie im Chromosom außerhalb des deletierten DNA-Bereiches und auch außerhalb der amplifizierten flankierenden Genbereiche binden. The excision of pK19 mobsacB took place in a second recombination event over the now duplicate DNA areas, in which the codon to be mutated from the chromosome was ultimately exchanged for the introduced mutation fragment. For this purpose, cells which showed the phenotype described (kanamycin-resistant, sucrose-sensitive) were incubated in a test tube with 3 ml of BHI medium (without addition of kanamycin) for 3 hours at 30 ° C. and 170 RPM. Subsequently, 100 μl of a 1:10 dilution were spread on BHI-Kan 25 plates and BHI-10% sucrose (w / v) plates and incubated at 30 ° C. overnight. A total of 50 of the clones grown on the BHI 10% sucrose (w / v) plate were selected and used to check the successful excision of pK19 mobsacB on BHI-Kan 25 and BHI 10% sucrose (w / v) and incubated overnight at 30 ° C. If the plasmid has been completely removed, this is shown by a sensitivity to kanamycin and a resistance to sucrose of the respective clone. The second recombination event (excision) can, in addition to the desired deletion, also lead to the restoration of the wild-type situation. The successful deletion in the clones obtained after excision was checked via the expected fragment size upon deletion of the clones obtained by means of colony PCR. The primers chk-fasB-s / chk-fasB-as used were chosen so that they bind in the chromosome outside the deleted DNA area and also outside the amplified flanking gene areas.
Verwendete Primer Primers used
fasB-(cg2743)-up-s: ATCCCCGGGTACCGAGCTCGAATTCGCGATTTCGATGC fasB- (cg2743) -up-s: ATCCCCGGGTACCGAGCTCGAATTCGCGATTTCGATGC
CTGGATG  CTGGATG
fasB-(cg2743)-up-as: CGCGGGAATCGAAGTTCCTGCTCAATTCGG fasB- (cg2743) -up-as: CGCGGGAATCGAAGTTCCTGCTCAATTCGG
fasB-(cg2743)-down-s: CAGGAACTTCGATTCCCGCGCCCGCCTA fasB- (cg2743) -down-s: CAGGAACTTCGATTCCCGCGCCCGCCTA
fasB-(cg2743)-down-as: TTGTAAAACGACGGCCAGTGAATTCGATACTGCAATATC fasB- (cg2743) -down-as: TTGTAAAACGACGGCCAGTGAATTCGATACTGCAATATC
AAACCAAG AT CT CCATT CTCC  AAACCAAG AT CT CCATT CTCC
chk-fasB-s: GG AGGAT ACAT CCACGGT CATT G chk-fasB-s: GG AGGAT ACAT CCACGGT CATT G
chk-fasB-as: CGCTATGAGTT C AG GAT GTT GAT CG chk-fasB-as: CGCTATGAGTT C AG GAT GTT GAT CG
Nukleotidsubstitution im Gen fasB kodierend für eine Fettsäuresvnthase mit verminderter Funktionalität zur Integration in das Genom coryneformer Bakterienzellen Nucleotide substitution in the gene encodes a fatty acid synthesis with reduced functionality for integration into the genome of coryneform bacterial cells
C. glutamicum DelAro 4-4dPc Zellen wurden in 5 ml BHI Medium (Reagenzglas, 30 °C, 170 RPM) bis zu einer OD6oonm von 5 angezogen um sicherzustellen, dass die exponentielle Wachstumsphase erreicht wurde. Die Ganzzell-Mutagenese wurde durch Zugabe von Me- thylnitronitrosoguanidine (MNNG) gelöst in DMSO (Endkonzentration 0,1 mg/mL) für 15 Minuten bei 30 °C durchgeführt. Die behandelten Zellen wurden zweimal mit 45 ml NaCI, 0,9 % (w/v), gewaschen, in 10 ml BHI-Medium resuspendiert und anschließend 3 Stunden bei 30 °C und 170 RPM regeneriert. Die mutierten Zellen wurden als Glycerolstocks bei -30 °C in BHI Medium mit 40 % (w/v) Glycerol gelagert. Für die Bestimmung der Malonyl-CoA Bereitstellung wurden Verdünnungen der Zellbibliotheken auf BHI-Agarplatten ausplattiert, sodass einzelne Kolonien gepickt werden konnten. Einzelne Klone wurden zufällig gepickt und für die Bestimmung der Malonyl-CoA Bereitstellung nach dem beschriebenen LC-MS/MS Protokoll kultiviert. Im Anschluss wurde das Genom der Klone, für die eine verbesserte Bereitstel lung von Malonyl-CoA gemessen werden konnte, sequenziert. Zur Feststellung, welche der detektierten Mutationen zu einer verbesserten Malonyl-CoA Bereitstellung beitragen, wurden ausgewählte Mutationen in den Stammhintergrund C. glutamicum DelAro 4-4dPc integriert. Anschließend wurde eine erneute Messung der Malonyl-CoA Bereitstellung mittels LC- MS/MS durchgeführt, um zu prüfen, ob die eingeführten Mutationen den vermuteten positi ven Einfluss auf die Malonyl-CoA Bereitstellung haben. C. glutamicum DelAro 4 -4d Pc cells were grown in 5 ml BHI medium (test tube, 30 ° C, 170 RPM) to an OD 6 oonm of 5 to ensure that the exponential growth phase was reached. The whole cell mutagenesis was carried out by adding methylnitronitrosoguanidine (MNNG) dissolved in DMSO (final concentration 0.1 mg / mL) for 15 minutes at 30 ° C. The treated cells were washed twice with 45 ml NaCl, 0.9% (w / v), resuspended in 10 ml BHI medium and then regenerated for 3 hours at 30 ° C. and 170 RPM. The mutated cells were stored as glycerol stocks at -30 ° C. in BHI medium with 40% (w / v) glycerol. For the determination of malonyl-CoA supply, dilutions of the cell libraries were plated on BHI agar plates so that individual colonies could be picked. Individual clones were picked at random and cultivated for the determination of malonyl-CoA provision according to the described LC-MS / MS protocol. The genome of the clones for which an improved provision of malonyl-CoA could be measured was then sequenced. To determine which of the detected mutations contribute to an improved malonyl-CoA supply, selected mutations were integrated into the background of C. glutamicum DelAro 4 -4d Pc . The malonyl-CoA provision was then measured again by means of LC-MS / MS in order to check whether the introduced mutations have the suspected positive influence on the malonyl-CoA provision.
Konstruktion der Plasmide pK19mobsacB-fasB-E622K, pK19mobsacB-fasB-G1361 D, pK19mobsacB-fasB-G2153D und pK19mobsacB-fasB-G2668S Construction of plasmids pK19mobsacB-fasB-E622K, pK19mobsacB-fasB-G1361 D, pK19mobsacB-fasB-G2153D and pK19mobsacB-fasB-G2668S
Zur Konstruktion der Plasmide pK19mobsacB-fasB-E622K (Figur 1 ), pK19mobsacB-fasB- G1361 D (Figur 2), pK19mobsacB-fasB-G2153D (Figur 3) und pK19mobsacB-fasB-G2668S (Figur 4) für die Integration der jeweiligen Aminosäure-Substitution in der Fettsäure Synthase B, welche in C. glutamicum durch das Gen fasB codiert wird, wurden die für das homologe Rekombinationsereignis benötigten flankierenden Fragmente des jeweils zu mutierenden Codons per PCR ausgehend von isolierter genomischer C. glutamicum DNA amplifiziert. For the construction of the plasmids pK19mobsacB-fasB-E622K (Figure 1), pK19mobsacB-fasB-G1361 D (Figure 2), pK19mobsacB-fasB-G2153D (Figure 3) and pK19mobsacB-fasB-G2668S (Figure 4) for the integration of the respective amino acid Substitution in the fatty acid synthase B, which is encoded in C. glutamicum by the gene fasB, the flanking fragments of the codon to be mutated required for the homologous recombination event were amplified by PCR starting from isolated genomic C. glutamicum DNA.
Für die Generierung des stromaufwärts gelegenen Fragments wurde das Primerpaar Sbfl_XXX_s / OL_XXX_as verwendet, die stromabwärts gelegene Flanke wurde mit dem Primerpaar OL_XXX_s / Xbal_XXX-as amplifiziert. Die Codierung XXX steht hierbei jeweils für die einzufügende Aminosäuresubstitution an einer spezifischen Position in der Fettsäure Synthase B. Die Überprüfung der generierten DNA-Fragmente auf die erwartete Basenpaar größe wurde mittels gelelektrophoretischer Analyse auf einem 1 % Agarosegel durchgeführt. Die Nukleotidsequenzen der inneren (dem zu mutierenden Codon zugewandten) Primer (OL_XXX_as / OL_XXX_s) wurden dabei so gewählt, dass die beiden amplifizierten Frag mente up und down zueinander komplementäre Überhänge enthalten. In einer zweiten PCR (ohne Zugabe von DNA-Primern) lagern sich die gereinigten Fragmente über die komple mentären Sequenzen an und dienen sich gegenseitig sowohl als Primer als auch als Matrize (overlap-extension PCR). Das so generierte Mutationsfragment wurde in einer finalen PCR mit den beiden äußeren (dem Gen abgewandten) Primern aus der ersten PCR amplifiziert (Sbfl_XXX_s / Xbal_XXX-as). Nach elektrophoretischer Trennung auf einem 1 % TAE- Agarosegel wurde das finale Mutationsfragment mit dem NucleoSpin® Gel and PCR Clean- up Kit (Macherey-Nagel, Düren) nach dem beiliegenden Protokoll aus dem Gel isoliert. Für die Konstruktion der Mutationsplasmide wurden sowohl die Mutationsfragmente als auch der pK19-mobsacB-Leervektor mit den FastDigest-V arianten (Thermo Fisher Scientific) der Restriktionsenzyme Sbf\ und Xba\ linearisiert. Die Restriktionsansätze der genannten Frag mente wurden mit dem NucleoSpin Gel and PCR Clean-up- Kit (Macherey-Nagel, Düren) gereinigt. Für die Ligation der hydrolysierten DNA-Fragmente mittels Rapid DNA Ligation- Kit (Thermo Fisher Scientific) wurde jeweils eines Mutationsfragmente in einem dreifachen mo laren Überschuss gegenüber dem linearisierten Vektorrückgrat pK19mobsacB eingesetzt. Nach erfolgter Ligation der Fragmente wurden das gesamte Ansatzvolumen für die Trans- formation chemisch kompetenter E. coli DFI5a-Zellen mittels Flitzeschock bei 42 °C für 90 Sekunden verwendet. Im Anschluss an den Flitzeschock wurden die Zellen 90 Sekunden auf Eis regeneriert bevor diese mit 800 pL LB-Medium versehen worden und bei 37 °C in einem Thermomixer (Eppendorf, Hamburg) bei 900 RPM für 60 Minuten regeneriert worden sind. Im Anschluss wurden 100 pL der Zellsuspension auf LB-Agarplatten mit Kanamycin (50 pg/ml) ausgestrichen und über Nacht bei 37 °C inkubiert. Die korrekte Assemblierung der Mutationsplasmide in den gewachsenen Transformanden wurde mittels Kolonie-PCR über- prüft. Hierfür wurde der 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) verwendet. Die DNA-Matrize wurde dem PCR-Ansatz hierbei durch das Hinzufügen von Zellen der gewachsenen Kolonien beigesetzt. Durch den initialen Denaturie- rungsschritt des PCR-Protokolls bei 95 °C für 3 Minuten werden die Zellen lysiert, sodass die DNA-Matrize freigesetzt wurde und für die DNA-Polymerase zugänglich war. Als DNA-Primer für die Kolonie-PCR wurde das Primerpaar univ / rsp verwendet, welches spezifisch an das pK19mobsacB-Vektorrückgrat bindet und im Falle einer korrekten Ligation der eingesetzten Fragmente ein PCR-Produkt spezifischer Größe bildet, welches per Gelelektrophorese über- prüft wurde. Klone, deren PCR-Produkt auf eine korrekte Assemblierung des jeweiligen Mu- tationsplasmides pK19mobsacB-fasB-XXX hindeutet, wurden über Nacht in LB-Medium mit Kanamycin (50 pg/mL) für die Isolierung der Plasmide angezogen. Die Plasmide wurden anschließend mit dem NucleoSpin Plasmid (NoLid)-K\t (Macherey-Nagel, Düren) isoliert und mit den genannten Amplifizierungs-und Kolonie-PCR-Primern sequenziert. The primer pair Sbfl_XXX_s / OL_XXX_as was used to generate the upstream fragment, the downstream flank was amplified with the primer pair OL_XXX_s / Xbal_XXX-as. Coding XXX stands here for the amino acid substitution to be inserted at a specific position in the fatty acid synthase B. The DNA fragments were checked for the expected base pair size using gel electrophoretic analysis on a 1% agarose gel. The nucleotide sequences of the inner primers (facing the codon to be mutated) (OL_XXX_as / OL_XXX_s) were chosen so that the two amplified fragments up and down contain mutually complementary overhangs. In a second PCR (without the addition of DNA primers), the purified fragments accumulate via the complementary sequences and serve both as a primer and as a template (overlap-extension PCR). The mutation fragment generated in this way was amplified in a final PCR with the two outer primers (facing away from the gene) from the first PCR (Sbfl_XXX_s / Xbal_XXX-as). After electrophoretic separation on a 1% TAE agarose gel, the final mutation fragment was isolated from the gel using the NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) according to the attached protocol. For the construction of the mutation plasmids, both the mutation fragments and the pK19-mobsacB empty vector were linearized with the FastDigest variants (Thermo Fisher Scientific) of the restriction enzymes Sbf \ and Xba \. The restriction approaches of the fragments mentioned were cleaned using the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren). For the ligation of the hydrolyzed DNA fragments using the Rapid DNA Ligation Kit (Thermo Fisher Scientific) a mutation fragment was used in a three-fold molar excess compared to the linearized vector backbone pK19mobsacB. After ligation of the fragments, the entire batch volume was used for the transformation of chemically competent E. coli DFI5a cells by means of flash shock at 42 ° C. for 90 seconds. Following the flash shock, the cells were regenerated on ice for 90 seconds before they were provided with 800 pL LB medium and regenerated at 37 ° C. in a thermomixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes. Subsequently, 100 pL of the cell suspension were spread on LB agar plates with kanamycin (50 pg / ml) and incubated at 37 ° C. overnight. The correct assembly of the mutation plasmids in the grown transformants was checked by means of colony PCR. The 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this. The DNA template was added to the PCR approach by adding cells from the grown colonies. The cells were lysed by the initial denaturation step of the PCR protocol at 95 ° C. for 3 minutes, so that the DNA template was released and was accessible to the DNA polymerase. The primer pair univ / rsp was used as the DNA primer for the colony PCR. It binds specifically to the pK19mobsacB vector backbone and, if the fragments used are correctly ligated, forms a PCR product of a specific size, which was checked by gel electrophoresis. Clones whose PCR product indicated that the respective mutation plasmid pK19mobsacB-fasB-XXX was correctly assembled were grown overnight in LB medium with kanamycin (50 pg / mL) for the isolation of the plasmids. The plasmids were then isolated with the NucleoSpin Plasmid (NoLid) -K \ t (Macherey-Nagel, Düren) and sequenced with the amplification and colony PCR primers mentioned.
Ein Aliquot elektrokompetenter C. glutamicum- Zellen wurde mit dem beschriebenen Protokoll mit dem jeweiligen Mutationsplasmid transformiert und auf BHIS-Kan15-Platten ausgestri- chen. Da das pK19moösacß-Plasmid in C. glutamicum nicht replizieren kann, konnte bei der anschließenden Selektion der vermittelten Kanamycin-Resistenz davon ausgegangen wer- den, dass diese nur ausgebildet wird, falls das Mutationsplasmid erfolgreich über die homo- logen Sequenzen in das Genom von C. glutamicum integriert werden konnte. Die erhaltenen Integranten wurden in einer ersten Selektionsrunde auf BHI-Kan25-Platten sowie BHI 10 % Saccharose (w/v)-Platten ausplattiert und über Nacht bei 30 °C inkubiert. Bei er- folgreicher Genomintegration des Mutationsplasmides wird neben der Kanamycin-Resistenz die von sacB codierte Levan-Sucrase gebildet. Dieses Enzym katalysiert die Polymerisierung von Saccharose zum toxischen Levan, sodass es zu einer induzierten Letalität bei Wachs- tum auf Saccharose kommt (Bramucci & Nagarajan, 1996). Demnach sind Kolonien, die das Mutationsplasmid über homologe Rekombination in ihr Genom integriert haben, resistent gegenüber Kanamycin und sensitiv gegenüber Saccharose. Die Exzision von pK19/nobsacß fand in einem zweiten Rekombinationsereignis über die nun doppelt vorliegenden DNA-Bereiche statt, bei dem das zu mutierende Codon aus dem Chromosom letztendlich gegen das eingebrachte Mutationsfragment ausgetauscht wurde. Dazu wurden Zellen, die den beschriebenen Phänotyp (kanamycinresistent, saccharosesen- sitiv) zeigten, in einem Reagenzglas mit 3 ml BHI-Medium (ohne Zugabe von Kanamycin) für 3 Stunden bei 30 °C und 170 RPM inkubiert. Im Anschluss wurden je 100 pl einer 1 :10- Verdünnung auf BHI-Kan25-Platten sowie BHI-10 % Saccharose (w/v)-Platten ausgestrichen und über Nacht bei 30 °C inkubiert. Insgesamt wurden 50 der auf der BHI 10 % Saccharose (w/v)-Platte gewachsenen Klone ausgewählt und zur Überprüfung der erfolgreichen Exzision von pK19 mobsacB auf BHI-Kan25 sowie BHI 10 % Saccharose (w/v) ausgestrichen und über Nacht bei 30 °C inkubiert. Sollte das Plasmid vollständig entfernt worden sein, so zeigt sich dies in einer Sensitivität gegenüber Kanamycin und einer Resis tenz gegenüber Saccharose des jeweiligen Klons. Das zweite Rekombinationsereignis (Exzision) kann neben der gewünschten Mutation auch zur Wiederherstellung der Wildtyp- Situation führen. Für den Nachweis der erfolgreichen Mutation in den erhaltenen Klonen nach Exzision wurde der entsprechende genomische Bereich per Kolonie-PCR amplifiziert (Primerpaar Sbfl_XXX_s / Xbal_XXX-as). Die PCR-Produkte wurden mit dem NucleoSpin Gel and PCR Clean-up- Kit (Macherey-Nagel, Düren) gereinigt und zur Verifikation der Muta- tion mit den Primern Sbfl_XXX_s, OL_XXX_as, OL_XXX_s und Xbal_XXX-as sequenziert. An aliquot of electrocompetent C. glutamicum cells was transformed using the described protocol with the respective mutation plasmid and streaked on BHIS-Kan 15 plates. Since the pK19moösacß plasmid cannot replicate in C. glutamicum, it could be assumed in the subsequent selection of the mediated kanamycin resistance that this would only develop if the mutation plasmid was successfully introduced into the genome of C glutamicum could be integrated. The integrants obtained were plated in a first round of selection on BHI-Kan 25 plates and BHI 10% sucrose (w / v) plates and incubated at 30 ° C. overnight. If genomic integration of the mutant plasmid is successful, the Levan sucrase encoded by sacB is formed in addition to the kanamycin resistance. This enzyme catalyzes the polymerization of sucrose into toxic levan, so that there is an induced lethality when growing on sucrose (Bramucci & Nagarajan, 1996). Accordingly, colonies that have integrated the mutation plasmid into their genome via homologous recombination are resistant to kanamycin and sensitive to sucrose. The excision of pK19 / nobsacß took place in a second recombination event over the now double DNA regions, in which the codon to be mutated from the chromosome was ultimately exchanged for the introduced mutation fragment. For this purpose, cells which showed the phenotype described (kanamycin-resistant, sucrose-sensitive) were incubated in a test tube with 3 ml of BHI medium (without addition of kanamycin) for 3 hours at 30 ° C. and 170 RPM. Subsequently, 100 μl of a 1:10 dilution were spread on BHI-Kan 25 plates and BHI-10% sucrose (w / v) plates and incubated at 30 ° C. overnight. A total of 50 of the clones grown on the BHI 10% sucrose (w / v) plate were selected and streaked to check the successful excision of pK19 mobsacB on BHI-Kan 25 and BHI 10% sucrose (w / v) and overnight at 30 ° C incubated. If the plasmid has been completely removed, this is shown by a sensitivity to kanamycin and a resistance to sucrose of the respective clone. In addition to the desired mutation, the second recombination event (excision) can also restore the wild-type situation. To detect the successful mutation in the clones obtained after excision, the corresponding genomic region was amplified by colony PCR (primer pair Sbfl_XXX_s / Xbal_XXX-as). The PCR products were cleaned with the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) and sequenced with the primers Sbfl_XXX_s, OL_XXX_as, OL_XXX_s and Xbal_XXX-as to verify the mutation.
Verwendete Primer: univ: CGCCAGGGTTTTCCCAGTCACGAC rsp: C AC AG G AAAC AG CTAT G ACC AT G Primers used: univ: CGCCAGGGTTTTCCCAGTCACGAC rsp: C AC AG G AAAC AG CTAT G ACC AT G
pK19mobsacB-fasB-E622K pK19mobsacB-fasB-E622K
OL_622-s: GT ACCGCT GCGAT GGCAACCAAGAAAGCAACCACCT CCCAG  OL_622-s: GT ACCGCT GCGAT GGCAACCAAGAAAGCAACCACCT CCCAG
GCCGTC GCCGTC
OL 622-as: GACGGCCTGGGAGGTGGTTGCTTTCTTGGTTGCCATCGCA OL 622-as: GACGGCCTGGGAGGTGGTTGCTTTCTTGGTTGCCATCGCA
GCGGTAC  GCGGTAC
Sbfl 622-s: AAAACCTGCAGGGGCTGAGCTCGCTGGTGGCGGACAGGTTAC  Sbfl 622-s: AAAACCTGCAGGGGCTGAGCTCGCTGGTGGCGGACAGGTTAC
CCCAG  CCCAG
Xbal 622-as: GGGGTCT AG AACGT CCTT AT CAAT GACGGGCACAAAGTT CAC  Xbal 622-as: GGGGTCT AG AACGT CCTT AT CAAT GACGGGCACAAAGTT CAC
AGGC pK19mobsacB-fasB-G1361 D  AGGC pK19mobsacB-fasB-G1361 D
OL 1361 -s: C CT CAC C C AGTT CAC C C AG GTG G AC AT G G C AACT CTGGGCGTT OL 1361 -s: C CT CAC C C AGTT CAC C C AG GTG G AC AT G G C AACT CTGGGCGTT
GCTC OL 1361-as: GAGCAACGCCCAGAGTTGCCATGTCCACCTGGGTGAACTGGGTGCTC OL 1361-as: GAGCAACGCCCAGAGTTGCCATGTCCACCTGGGTGAACTGGGT
GAGG GAGG
Sbfl 1361 -s: AAAACCTGCAGGGTT GCACCT GAAT CCAT GCGCCCATTCGCT GT  Sbfl 1361 -s: AAAACCTGCAGGGTT GCACCT GAAT CCAT GCGCCCATTCGCT GT
GATC  GATC
Xbal 1361-as: GG AAT CT AG AT CG G CG G AAG C AG CCTT G AAAT C AG C C AAG AT CTC pK19mobsacB-fasB-G2153D  Xbal 1361-as: GG AAT CT AG AT CG G CG G AAG C AG CCTT G AAAT C AG C C AAG AT CTC pK19mobsacB-fasB-G2153D
OL 2153-s: CATTCGCGGCACCTCGCGTGTCCGAATCCATGGCAGATGCAG OL 2153-s: CATTCGCGGCACCTCGCGTGTCCGAATCCATGGCAGATGCAG
GCCCAC GCCCAC
OL 2153-as: GTGGGCCTGCATCTGCCATGGATTCGGACACGCGAGGTGCCGC OL 2153-as: GTGGGCCTGCATCTGCCATGGATTCGGACACGCGAGGTGCCGC
GAATG  GAATG
Sbfl 2153-s: AAAACCTGCAGGTTGGCCACGTCAGGTTGCACCAAGCTTCGATG  Sbfl 2153-s: AAAACCTGCAGGTTGGCCACGTCAGGTTGCACCAAGCTTCGATG
AAG  AAG
Xbal 2153-as: AAAATCTAGACCGAGCTCGCCGGCGCCAACGATGACGACCATC  Xbal 2153-as: AAAATCTAGACCGAGCTCGCCGGCGCCAACGATGACGACCATC
TCG pK19mobsacB-fasB-G2668S  TCG pK19mobsacB-fasB-G2668S
OL_G2668S-s: AGTCCGACTTCGTTGTCGCATCCGGCTTCGATGCCCTGTCC OL_G2668S-as: GGACAGGGCATCGAAGCCGGATGCGACAACGAAGTCGGACT Sbfl G2668S-s: AAAACCTGCAGGCACTGACCTACGTCGACTCCGAGCCAGAACT OL_G2668S-s: AGTCCGACTTCGTTGTCGCATCCGGCTTCGATGCCCTGTCC OL_G2668S-as: GGACAGGGCATCGAAGCCGGATGCGACAACGAAGTCGGACT Sbfl G2668S-s: AAAACCTGCAGGCACTGACCTGGCCGACT
CAC  CAC
Xbal G2668S-as: GGGGTCTAGATGCGCAGCCAGACGAGGTGGGAATGCTTGGACAG  Xbal G2668S-as: GGGGTCTAGATGCGCAGCCAGACGAGGTGGGAATGCTTGGACAG
In Varianten der vorliegenden Erfindung sind auch Proteine der Fettsäuresynthase FasB aus coryneformen Bakterien und/oder Nukleinsäuresequenzen kodierend eine Fettsäuresynthase FasB aus coryneformen Bakterien umfasst, bei denen Nukleotidsubstitutionen und entsprechend korrespondierende Aminosäureaustausche vorliegen. Solche Varianten sind beispielsweise beschrieben in SEQ ID NO. 1 mit einer Nukleotidsubsitiution an Position 1864 (g -> a), in SEQ ID NO. 3 mit einer Nukleotidsubsitiution an Position 4082 (g -> a), in SEQ ID NO. 5 mit einer Nukleotidsubsitiution an Position 6458 (g -> a), in SEQ ID NO. 7 mit einer Nukleotidsubsitiution an den Positionen 8002-8004 (ggt->tcc) und in SEQ ID NO. 9 mit einer Deletion der Positionen 25-8943. In variants of the present invention, proteins of the fatty acid synthase FasB from coryneform bacteria and / or nucleic acid sequences encoding a fatty acid synthase FasB from coryneform bacteria are encoded, in which nucleotide substitutions and corresponding amino acid exchanges are present. Such variants are described, for example, in SEQ ID NO. 1 with a nucleotide substitution at position 1864 (g -> a), in SEQ ID NO. 3 with a nucleotide substitution at position 4082 (g -> a), in SEQ ID NO. 5 with a nucleotide substitution at position 6458 (g -> a), in SEQ ID NO. 7 with a nucleotide substitution at positions 8002-8004 (ggt-> tcc) and in SEQ ID NO. 9 with a deletion of positions 25-8943.
Allgemeine Methodik zur Deletion bzw. Mutation (Nukleotidsubstitution) von Genen bzwGeneral methodology for deletion or mutation (nucleotide substitution) of genes or
Integration von DNA in coryneforme Bakterienzellen Die nachfolgenden Schritte sind sowohl für Deletionen als auch für Integration/ Substitutio nen identisch. Der Einfachheit halber wird nur von Deletionsstämmen bzw. Deletionsplasmi den gesprochen. Integration of DNA in coryneform bacterial cells The following steps are identical for deletions as well as for integration / substitutions. For the sake of simplicity, only deletion strains or deletion plasmas are spoken of.
Für die Konstruktion von C. g/ufam/cum-Deletionsstämmen werden pK19/77obsacß-basierte Deletionsplasmide kloniert (Schäfer et ai, 1994; https://doi.org/10/1016/0378: For the construction of C. g / ufam / cum deletion strains, pK19 / 77obsacß-based deletion plasmids are cloned (Schäfer et ai, 1994; https://doi.org/10/1016/0378:
1119(94)90324-7). Das Zielgen wird anschließend wie beschrieben (Niebisch & Bott, 2001 ; https://doi.org/10.1007/s002030100262) deletiert. Das hierfür benötigte Deletionsfragment wird dabei mittels cross-over- PCR (Link et al., 1997; https://doi.org/10.1128/jb.179.20.6228- 6237.1997) generiert. Dazu werden im ersten Schritt in zwei getrennten Reaktionen -500 bp große flankierende Fragmente generiert, die im Chromosom stromauf- und abwärts des zu deletierenden Gens liegen. Die Nukleotidsequenzen der inneren (dem zu deletierenden Gen zugewandten) Primer werden dabei so gewählt, dass die beiden amplifizierten Fragmente zueinander komplementäre Überhänge enthalten. In einer zweiten PCR lagern sich die ge reinigten Fragmente über die komplementären Sequenzen an und dienen sich gegenseitig sowohl als Primer als auch als Matrize. Das so generierte Deletionsfragment wird in einer finalen PCR mit den beiden äußeren (dem Gen abgewandten) Primern aus der ersten PCR amplifiziert. Nach elektrophoretischer Trennung auf einem 1 % TAE-Agarosegel (Sambrook et al., 1989) wird das finale Deletionsfragment mit dem NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) nach dem beiliegenden Protokoll aus dem Gel isoliert. Das De letionsfragment wird im Anschluss mit dem Vektor pK19 mobsacB über die eingefügten und hydrolysierten Restriktionsschnittstellen ligiert. Im Anschluss werden chemisch kompetente E. coli DH5 Zellen mit dem gesamten Ligationssansatz transformiert. Die gewachsenen Transformanden werden mittels Kolonie-PCR auf das korrekte Ligationsprodukt überprüft; positive Deletionsplasmide werden isoliert und sequenziert. Im Falle von Insertionen wird die zu inserierende DNA-Sequenz zwischen die flankierenden Bereiche des Ziellocus kloniert. Die nachfolgenden Schritte sind sowohl für Deletionen als auch für Insertionen identisch. Der Einfachheit halber wird nur von Deletionsplasmiden gesprochen. 1119 (94) 90324-7). The target gene is then deleted as described (Niebisch & Bott, 2001; https://doi.org/10.1007/s002030100262). The deletion fragment required for this is generated by means of cross-over-PCR (Link et al., 1997; https://doi.org/10.1128/jb.179.20.6228- 6237.1997). For this purpose, in the first step in two separate reactions -500 bp flanking fragments are generated, which are located in the chromosome upstream and downstream of the gene to be deleted. The nucleotide sequences of the inner primers (facing the gene to be deleted) are selected such that the two amplified fragments contain overhangs which are complementary to one another. In a second PCR, the purified fragments accumulate via the complementary sequences and serve each other both as a primer and as a template. The deletion fragment generated in this way is amplified in a final PCR with the two outer primers (facing away from the gene) from the first PCR. After electrophoretic separation on a 1% TAE agarose gel (Sambrook et al., 1989), the final deletion fragment with the NucleoSpin ® Gel and PCR Clean-up Kit (Macherey-Nagel, Duren) is isolated according to the protocol attached thereto from the gel. The deletion fragment is then ligated with the vector pK19 mobsacB over the inserted and hydrolyzed restriction sites. Chemically competent E. coli DH5 cells are then transformed with the entire ligation approach. The grown transformants are checked for the correct ligation product by colony PCR; positive deletion plasmids are isolated and sequenced. In the case of insertions, the DNA sequence to be inserted is cloned between the flanking regions of the target locus. The following steps are identical for both deletions and insertions. For the sake of simplicity, we only speak of deletion plasmids.
Ein Aliquot elektrokompetenter C. glutamicum- Zellen wird mit dem beschriebenen Protokoll mit dem jeweiligen Deletionsplasmid transformiert und auf BHIS-Kan15-Platten ausgestri chen. Da das pK19moösacß-Plasmid in C. glutamicum nicht replizieren kann, konnte bei der anschließenden Selektion der vermittelten Kanamycin-Resistenz davon ausgegangen wer den, dass diese nur ausgebildet wird, falls das Deletionsplasmid erfolgreich über die homo logen Sequenzen in das Genom von C. glutamicum integriert werden konnte. Die erhaltenen Integranten werden in einer ersten Selektionsrunde auf BHI-Kan25-Platten sowie BHI 10 % Saccharose (w/v)-Platten ausplattiert und über Nacht bei 30 C inkubiert. Bei erfolgreicher Genomintegration des Deletionsplasmids wird neben der Kanamycin-Resistenz die von sacB codierte Levan-Sucrase gebildet. Dieses Enzym katalysiert die Polymerisierung von Saccha- rose zum toxischen Levan, sodass es zu einer induzierten Letalität bei Wachstum auf Sac- charose kommt (Bramucci & Nagarajan, 1996;, PMID 8899981 ). Demnach sind Kolonien, die das Deletionsplasmid über homologe Rekombination in ihr Genom integriert haben, resistent gegenüber Kanamycin und sensitiv gegenüber Saccharose. An aliquot of electrocompetent C. glutamicum cells is transformed using the described protocol with the respective deletion plasmid and streaked on BHIS-Kan 15 plates. Since the pK19moösacß plasmid cannot replicate in C. glutamicum, it could be assumed in the subsequent selection of the mediated kanamycin resistance that it would only develop if the deletion plasmid was successfully introduced into the genome of C. glutamicum via the homologous sequences could be integrated. The integrants obtained are plated in a first round of selection on BHI-Kan 25 plates and BHI 10% sucrose (w / v) plates and incubated at 30 ° C. overnight. If the deletion plasmid is successfully integrated, the Levan sucrase encoded by sacB is formed in addition to the kanamycin resistance. This enzyme catalyzes the polymerization of sacchar rose to the toxic levan, so that there is an induced lethality when growing on sucrose (Bramucci & Nagarajan, 1996 ;, PMID 8899981). Accordingly, colonies that have integrated the deletion plasmid into their genome via homologous recombination are resistant to kanamycin and sensitive to sucrose.
Die Exzision von pK19 mobsacB findet in einem zweiten Rekombinationsereignis über die nun doppelt vorliegenden DNA-Bereiche statt, bei dem das zu deletierende Gen aus dem Chromosom letztendlich gegen das eingebrachte Deletionsfragment ausgetauscht wird. Da- zu werden Zellen, die den beschriebenen Phänotyp (kanamycinresistent, saccharosesensi- tiv) zeigten, in einem Reagenzglas mit 3 ml BHI-Medium (ohne Zugabe von Kanamycin) für 3 Stunden bei 30 C und 170 RPM inkubiert. Im Anschluss werden je 100 mI einer 1 :10- Verdünnung auf BHI-Kan25-Platten sowie BHI-10 % Saccharose (w/v)-Platten ausgestrichen und über Nacht bei 30 C inkubiert. Insgesamt werden 50 der auf der BHI 10 % Saccharose (w/v)-Platte gewachsenen Klone ausgewählt und zur Überprüfung der erfolgreichen Exzision von pK19 mobsacB auf BHI-Kan25 sowie BHI 10 % Saccharose (w/v) ausgestrichen und über Nacht bei 30 °C inkubiert. Sollte das Plasmid vollständig entfernt worden sein, so zeigt sich dies in einer Sensitivität gegenüber Kanamycin und einer Resistenz gegenüber Saccharose des jeweiligen Klons. Das zweite Rekombinationsereignis (Exzision) kann neben der ge wünschten Gendeletion auch zur Wiederherstellung der Wildtyp-Situation führen. Die erfolg- reiche Deletion in den erhaltenen Klonen nach Excision wird über die erwartete Fragment größe bei Deletion des Gens oder Genclusters mittels Kolonie-PCR der erhaltenen Klone überprüft. Die verwendeten Primer werden hierbei so gewählt, dass sie im Chromosom au- ßerhalb des deletierten DNA-Bereiches und auch außerhalb der amplifizierten flankierenden Genbereiche binden. The excision of pK19 mobsacB takes place in a second recombination event over the now duplicated DNA areas, in which the gene to be deleted from the chromosome is ultimately exchanged for the inserted deletion fragment. For this purpose, cells which showed the described phenotype (kanamycin-resistant, sucrose-sensitive) are incubated in a test tube with 3 ml of BHI medium (without addition of kanamycin) for 3 hours at 30 C and 170 RPM. Subsequently, 100 ml of a 1: 10 dilution on BHI-Kan 25 plates and BHI-10% sucrose (w / v) plates are spread out and incubated at 30 C overnight. A total of 50 of the clones grown on the BHI 10% sucrose (w / v) plate are selected and streaked out to check the successful excision of pK19 mobsacB on BHI-Kan 25 and BHI 10% sucrose (w / v) and overnight at 30 ° C incubated. If the plasmid has been completely removed, this is shown by a sensitivity to kanamycin and a resistance to sucrose of the respective clone. The second recombination event (excision) can, in addition to the desired gene deletion, also lead to the restoration of the wild-type situation. The successful deletion in the clones obtained after excision is checked via the expected fragment size upon deletion of the gene or gene cluster by means of colony PCR of the clones obtained. The primers used are chosen so that they bind in the chromosome outside the deleted DNA area and also outside the amplified flanking gene areas.
Mit dieser zuvor beschrieben Vorgehensweise werden ausgehend von dem Stamm C. glu- tamicum ATCC 13032 Stämme konstruiert, die im kodierenden Bereich des homologen Fett- säuresynthase-Gens fasB Nukleotidsubstitutionen (C.g.130232-fasB-E622K, C.g.130232- fasB-G1361 D, C.g.130232-fasB-G2153E, C.g.130232-fasB-G2668S) bzw. deletierte Berei- che (C.g 13032-AfasB), Veränderungen in der homologen fasO-Bindestelle vor dem Gen- cluster accBCDI (C.g.130232-mufasO), sowie eine homologe Promotorregion mit verminder- ter Aktivität vor dem Gen kodierend für die Citratsynthase gtIA (C.g. 13032-C7) aufweisen. Diese Stämme zeichnen sich dadurch aus, dass sie nicht-rekombinant verändert sind und sich damit als non-GVO auszeichnen. Using this procedure described above, strains are constructed starting from the strain C. glutamicum ATCC 13032, which in the coding region of the homologous fatty acid synthase gene fasB nucleotide substitutions (Cg130232-fasB-E622K, Cg130232-fasB-G1361 D, Cg 130232-fasB-G2153E, Cg130232-fasB-G2668S) or deleted areas (Cg 13032-AfasB), changes in the homologous fasO binding site in front of the gene cluster accBCDI (Cg130232-mufasO), and a homologous promoter region with reduced activity in front of the gene coding for the citrate synthase gtIA (Cg 13032-C7). These strains are characterized by the fact that they are non-recombinantly modified and are thus characterized as non-GMOs.
Stammkonstruktion C. qlutamicum 13032 DelAro3/DelAro4 Die nachfolgend beschriebene Methodik wurde für die Konstruktion von C. glutamicum DelA- ro 4-4dpccg sowie alle entsprechenden Zwischenstufen, wie z.B. C. glutamicum DelAro3, DelAro4 und DelAro3-4c/PcCg verwendet. Stem construction C. qlutamicum 13032 DelAro 3 / DelAro 4 The methodology described below was used for the construction of C. glutamicum DelAro 4 -4dp c c g and all corresponding intermediates, such as C. glutamicum DelAro3, DelAro4 and DelAro 3 -4c / PcCg .
Als Ausgangsstamm für die Konstruktion von C. glutamicum DelAro -4clPcCg wird der Stamm C. glutamicum MB001 (DE3) gewählt. Hierbei handelt sich um einen Prophagen-freien C. glutamicum ATCC13032 Wildtyp-Stamm (Stamm C. glutamicum MB001 ; Baumgart et al, 2013b, https://doi.org/10.1 128/AEM.01634-13), der im Weiteren über eine chromosomal- integrierte T7-Polymerase verfügt, welche die Nutzung des starken und induzierbaren T7- Promotors erlaubt (Stamm C. glutamicum MB001 (DE3); (Kortmann et al., 2015; https://doi.org/10.1111/1751-7915.12236). Dieser Promotor befindet sich auch auf den pMK- Ex2-Plasmiden, die für die Expression an der Synthese des jeweiligen Produkts beteiligter Gene pflanzlichen Ursprungs genutzt werden. The C. glutamicum MB001 (DE3) strain is chosen as the starting strain for the construction of C. glutamicum DelAro -4cl PcCg . This is a prophage-free C. glutamicum ATCC13032 wild-type strain (strain C. glutamicum MB001; Baumgart et al, 2013b, https://doi.org/10.1 128 / AEM.01634-13), which is described below has a chromosomally integrated T7 polymerase, which allows the use of the strong and inducible T7 promoter (strain C. glutamicum MB001 (DE3); (Kortmann et al., 2015; https://doi.org/10.1111/1751- 7915.12236) This promoter is also located on the pMK-Ex2 plasmids which are used for the expression of genes of plant origin involved in the synthesis of the respective product.
Ausgehend von C. glutamicum MB001 (DE3) wird durch Deletion der Gen(-cluster) cg0344-47, cg2625-40 und cg1226 der Stamm C. glutamicum DelAro3 konstruiert (Kall- scheuer et al., 2016, https://doi.Org/10.1016/j.ymben.2016.06.003). Starting from C. glutamicum MB001 (DE3), the strain C. glutamicum DelAro 3 is constructed by deleting the gene (clusters) cg0344-47, cg2625-40 and cg1226 (Kallscheuer et al., 2016, https: // doi .Org / 10.1016 / j.ymben.2016.06.003).
Bei cg0344-47 handelt es sich um das phdBCDE- Operon, welches für Gene codiert, die am Katabolismus von Phenylpropanoiden, wie z. B. p-Cumarsäure beteiligt ist.  Cg0344-47 is the phdBCDE operon, which codes for genes that are involved in the catabolism of phenylpropanoids, such as. B. p-cumaric acid is involved.
Um die unspezifische Umwandlung von Phenylpropanoiden durch Enzym-katalysierte Ring- Hydroxylierung oder Ring-spaltende Reaktionen zu verhindern (die natürlichen Substrate der jeweiligen Enzyme 4-Hydroxybenzoate-3-Hydroxylase PobA bzw. Protocatechuat Di- oxygenase PcaGH zeigen eine hohe strukturelle Ähnlichkeit zu Phenylpropanoiden) werden die entsprechenden Gen(-cluster) cg 1226 ( pobA ) und cg2625-40 ( cat , ben und pca Gene, die essentiell für den Abbau von 4-Hydroxybenzoat, Catechol, Benzoat und Protocatechuat sind) deletiert.  In order to prevent the unspecific conversion of phenylpropanoids by enzyme-catalyzed ring hydroxylation or ring-cleaving reactions (the natural substrates of the respective enzymes 4-hydroxybenzoate-3-hydroxylase PobA or protocatechuate di-oxygenase PcaGH show a high structural similarity to phenylpropanoids) the corresponding gene (cluster) cg 1226 (pobA) and cg2625-40 (cat, ben and pca genes which are essential for the breakdown of 4-hydroxybenzoate, catechol, benzoate and protocatechuate) are deleted.
Während der Etablierung der Synthese von pflanzlichen Polyphenolen aus Glucose (zusätz- lich mit Plasmid pEKEx3_aro/-/£c_fa/P/) wird eine Akkumulation von 0,9 g/L Protocatechuat gemessen, aber es können weder L-Tyrosin noch p-Cumarsäure detektiert werden (Kallscheuer et al., 2016 https://doi.Org/10.1016/j.ymben.2016.06.003). Die 3-During the establishment of the synthesis of plant polyphenols from glucose (additionally with plasmid pEKEx3_aro / - / £ c _fa / P /), an accumulation of 0.9 g / L protocatechuate was measured, but neither L-tyrosine nor p- Cumaric acid can be detected (Kallscheuer et al., 2016 https://doi.Org/10.1016/j.ymben.2016.06.003). The 3-
Dehydroshikimat Dehydratase QsuB katalysiert die thermodynamisch irreversible Umwand- lung des Shikimat-Weg-Intermediates 3-Dehydroshikimat zu Protocatechuat und führt so zu einem ungewünschten Verlust von Intermediaten des Syntheseweges aromatischer Amino- säuren. Die Deletion von qsuB reduzierte die Akkumulation von Protocatechuat. Somit wird in dem konstruierten Stamm C. glutamicum DelAro3 zusätzlich das Gen cg0502 (qsuB) dele tiert, resultierend in dem Stamm C. glutamicum DelAro4. Dehydroshikimate Dehydratase QsuB catalyzes the thermodynamically irreversible conversion of the shikimate-path intermediate 3-dehydroshikimate to protocatechuate and thus leads to an undesired loss of intermediates in the synthetic route of aromatic amino acids. The deletion of qsuB reduced the accumulation of protocatechuate. Thus, the gene cg0502 (qsuB) is additionally deleted in the constructed strain C. glutamicum DelAro 3 , resulting in the strain C. glutamicum DelAro 4 .
Durch chromosomale Integration des 4clPcC8- Gens aus Petroselinum crispum unter Kontrolle des T7-Promotors an den Deletionlocus cg0344-47 (Acg0344-47::PT7-4c/PcCg) im Stamm C. glutamicum DelAro3 bzw. DelAro4 wurde C. glutamicum DelAro3-4c/PcCg bzw. C. glutamicum DelAro4-4c/PcCg konstruiert. Chromosomal integration of the 4cl PcC8 gene from Petroselinum crispum under the control of the T7 promoter at the deletion locus cg0344-47 (Acg0344-47 :: P T7 -4c / PcCg ) in the strain C. glutamicum DelAro 3 or DelAro 4 resulted in C. glutamicum DelAro 3 -4c / PcCg or C. glutamicum DelAro 4 -4c / PcCg constructed.
Ausgehend von C. glutamicum DelAro3-4 clPcCg bzw. C. glutamicum DelAro4-4 clPccg werden analog (siehe oben Deletion bzw. Integration von DNA in coryneforme Bakterien) durch In tegration nicht-rekombinant veränderter DNA die entsprechenden C. glutamicum Stämme konstruiert, bei denen das Gen der Fettsäuresynthase fasB mutiert bzw. deletiert wird, die fasO-Bindestelle vor dem Gencluster accBCDI mutiert wird bzw. der Promotor vor dem Ci- tratsynthase-Gen gltA mutiert wird. Beispielhaft für alle oben aufgeführten C. glutamicum Stämme (DelAro3, DelAro4, DelAro3-4c/PcCg, DelAro4-4c/PcCg) werden so die Stämme mit C. glutamicum DelAro4-4c/PcC8-fasB-E622K, DelAro4-4c/PcC8-fasB-G1361 D, DelAro4-4c/PcC8-fasB- G2153E, DelAro4-4c/PcC8-fasB-G2668S, DelAro4-4c/PcCs?-AfasB, DelAro4-4c/PcC8-C7, DelAro4- 4c/PcC8-C7-mufasO, DelAro4-4c/PcC8-C7-mufasO-fasB-E622K, DelAro4-4c/PcC8-C7-mufasO- fasB-G1361 D, DelAro4-4c/PcC8-C7-mufasO-fasB-G2153E, DelAro4-4c/PcC8-C7-mufasO-fasB- G2668S, DelAro4-4c/PcC8-C7-mufasO-AfasB konstruiert. Auch alle anderen denkbaren Bakte rienstämme mit Kombinationen an Veränderungen in Genen von coryneformen Bakterien, wie z. B. fasB, fasO und gtIA, im Genom des C. glutamicum Wildtyps ATCC 13032 oder des sen Abkömmlingen C. glutamicum DelAro3, C. glutamicum DelAro4, C. glutamicum DelAro3- 4c/PcCg, C. glutamicum DelAro4-4 clpcCg werden auf die gleiche beschriebene Weise herge stellt. Starting from C. glutamicum DelAro 3 -4 cl PcC g or C. glutamicum DelAro 4 -4 cl Pc c g , the corresponding analog (see above deletion or integration of DNA in coryneform bacteria) by integrating non-recombinantly modified DNA C. glutamicum strains are constructed in which the gene of the fatty acid synthase fasB is mutated or deleted, the fasO binding site in front of the gene cluster accBCDI is mutated or the promoter is mutated in front of the citrate synthase gene gltA. As an example for all C. glutamicum strains listed above (DelAro 3 , DelAro 4 , DelAro 3 -4c / PcCg , DelAro 4 -4c / PcCg ) the strains with C. glutamicum DelAro 4 -4c / PcC8 -fasB-E622K, DelAro 4 -4c / PcC8 -fasB-G1361 D, DelAro 4 -4c / PcC8 -fasB- G2153E, DelAro 4 -4c / PcC8 -fasB-G2668S, DelAro 4 -4c / PcCs? -AfasB, DelAro 4 -4c / PcC8 -C7, DelAro 4 - 4c / PcC8 -C7-mufasO, DelAro 4 -4c / PcC8 -C7-mufasO-fasB-E622K, DelAro 4 -4c / PcC8 -C7-mufasO- fasB -G1361 D, DelAro 4 -4c / PcC8 -C7-mufasO-fasB-G2153E, DelAro 4 -4c / PcC8 -C7-mufasO-fasB- G2668S, DelAro 4 -4c / PcC8 -C7-mufasO-AfasB. All other conceivable bacterial strains with combinations of changes in genes of coryneform bacteria, such as. B. fasB, fasO and gtIA, in the genome of the C. glutamicum wild type ATCC 13032 or its descendants C. glutamicum DelAro 3 , C. glutamicum DelAro 4 , C. glutamicum DelAro 3 - 4c / PcCg , C. glutamicum DelAro 4 -4 clp cCg are produced in the same way as described.
Konstruktion pK19mobsacB-cg0344-47-del und pK19mobsacB-cg2625-40-del Construction pK19mobsacB-cg0344-47-del and pK19mobsacB-cg2625-40-del
Zur Konstruktion des Plasmides pK19mobsacB-cg0344-47-del (Figur 12) und pK19mobsacB-cg2625-40-del (Figur 13) für die Deletion der Gencluster cg0344-47 und cg2625-40 in C. glutamicum wurden die für das homologe Rekombinationsereignis benötig ten flankierenden Fragmente des jeweils zu deletierenden Genclusters per PCR ausgehend von isolierter genomischer C. glutamicum DNA amplifiziert. The construction of the plasmid pK19mobsacB-cg0344-47-del (FIG. 12) and pK19mobsacB-cg2625-40-del (FIG. 13) for the deletion of the gene clusters cg0344-47 and cg2625-40 in C. glutamicum required those for the homologous recombination event The flanking fragments of the gene cluster to be deleted were amplified by PCR starting from isolated genomic C. glutamicum DNA.
Für die Generierung des stromaufwärts gelegenen Fragments wurde das Primerpaar cgXXXX-XX-up-s / cgXXXX-XX-up-as verwendet, die stromabwärts gelegene Flanke wurde mit dem Primerpaar cgXXXX-XX-down-s / cgXXXX-XX-down-as amplifiziert. Die Codierung XXXX-XX steht hierbei jeweils für die cg-Nummern der zu deletierenden Gene. Beispielswei se wird für die Deletion der Genclusters cg0344-47 das Primerpaar cg0344-47-up-s/ cg0344- 47-up-as benutzt und analog für die Deletion der Genclusters cg2625-40 das Primerpaar cg2625-40-up-s/ cg2625-40-up-as. Die Überprüfung der generierten DNA-Fragmente auf die erwartete Basenpaargröße wurde mittels gelelektrophoretischer Analyse auf einem 1 % Aga- rosegel durchgeführt. Die Nukleotidsequenzen der inneren (dem zu deletierenden Gen zu gewandten) Primer (cgXXXX-XX-up-as / cgXXXX-XX-down-s) wurden dabei so gewählt, dass die beiden amplifizierten Fragmente up und down zueinander komplementäre Über- hänge enthalten. Für das Gencluster cg0344-47 ist dies das Primerpaar cg0344-47-up-as/ cg0344-47-down-s und analog für das Gencluster cg2625-40 das Primerpaar cg2625-40- up-as/ cg2625-40-down-s. In einer zweiten PCR (ohne Zugabe von DNA-Primern) lagern sich die gereinigten Fragmente über die komplementären Sequenzen an und dienen sich gegenseitig sowohl als Primer als auch als Matrize (overlap-extension PCR). Das so gene- rierte Deletionsfragment wurde in einer finalen PCR mit den beiden äußeren (dem Gen ab- gewandten) Primern aus der ersten PCR amplifiziert (cgXXXX-XX-up-s / cgXXXX-XX-down- as). Für das Gencluster cg0344-47 ist dies das Primerpaar cg0344-47-up-s/ cg0344-47- down-as und analog für das Gencluster cg2625-40 das Primerpaar cg2625-40-up-s/ cg2625-40-down-as. Nach elektrophoretischer Trennung auf einem 1 % TAE-Agarosegel wurde das finale Deletionsfragment mit dem NucleoSpin® Gel and PCR Clean-up Kit (Ma- cherey-Nagel, Düren) nach dem beiliegenden Protokoll aus dem Gel isoliert. Für die Kon- struktion der Deletionsplasmide wurden sowohl die Deletionfragmente als auch der pK19- mobsacB-Leervektor mit den FastDigest-\/a rianten (Thermo Fisher Scientific) der Restrikti onsenzyme Xba\ und EcoRI linearisiert. Die Restriktionsansätze der genannten Fragmente wurden mit dem NucleoSpin Gel and PCR Clean-up- Kit (Macherey-Nagel, Düren) gereinigt. Für die Ligation der hydrolysierten DNA-Fragmente mittels Rapid DNA Ligation- Kit (Thermo Fisher Scientific) wurde jeweils eines der beiden Deletionsfragmente in einem dreifachen molaren Überschuss gegenüber dem linearisierten Vektorrückgrat pK19mobsacB eingesetzt. Nach erfolgter Ligation der Fragmente wurden das gesamte Ansatzvolumen für die Trans- formation chemisch kompetenter E. coli DH5a-Zellen mittels Hitzeschock bei 42 °C für 90 Sekunden verwendet. Im Anschluss an den Hitzeschock wurden die Zellen 90 Sekunden auf Eis regeneriert bevor diese mit 800 pL LB-Medium versehen worden und bei 37 °C in einem Thermomixer (Eppendorf, Hamburg) bei 900 RPM für 60 Minuten regeneriert worden sind. Im Anschluss wurden 100 pL der Zellsuspension auf LB-Agarplatten mit Kanamycin (50 pg/ml) ausgestrichen und über Nacht bei 37 °C inkubiert. Die korrekte Assemblierung der Deletionsplasmide in den gewachsenen Transformanden wurde mittels Kolonie-PCR über- prüft. Hierfür wurde der 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) verwendet. Die DNA-Matrize wurde dem PCR-Ansatz hierbei durch das Hinzufügen von Zellen der gewachsenen Kolonien beigesetzt. Durch den initialen Denaturie rungsschritt des PCR-Protokolls bei 95 °C für 3 Minuten werden die Zellen lysiert, sodass die DNA-Matrize freigesetzt wurde und für die DNA-Polymerase zugänglich war. Als DNA-Primer für die Kolonie-PCR wurde das Primerpaar univ / rsp verwendet, welches spezifisch an das pK19mobsacB-Vektorrückgrat bindet und im Falle einer korrekten Ligation der eingesetzten Fragmente ein PCR-Produkt spezifischer Größe bildet, welches per Gelelektrophorese über prüft wurde. Klone, deren PCR-Produkt auf eine korrekte Assemblierung des jeweiligen De letionsplasmides pK19mobsacB-cg0344-47-del bzw. pK19mobsacB-cg2625-40-del hindeu- tet, wurden über Nacht in LB-Medium mit Kanamycin (50 pg/mL) für die Isolierung der Plas mide angezogen. Die Plasmide wurden anschließend mit dem NucleoSpin Plasmid (NoLid)- Kit (Macherey-Nagel, Düren) isoliert und mit den genannten Amplifizierungs-und Kolonie- PCR-Primern sequenziert. The primer pair cgXXXX-XX-up-s / cgXXXX-XX-up-as was used to generate the upstream fragment, the downstream flank was used with the primer pair cgXXXX-XX-down-s / cgXXXX-XX-down-as amplified. The coding XXXX-XX stands for the cg numbers of the genes to be deleted. For example, the primer pair cg0344-47-up-s / cg0344- 47-up-as is used for the deletion of the gene clusters cg0344-47 and analogously for the deletion of the gene clusters cg2625-40 the primer pair cg2625-40-up-s / cg2625 -40-up-as. The generated DNA fragments were checked for the expected base pair size using gel electrophoretic analysis on a 1% agarose gel. The nucleotide sequences of the inner primers (facing the gene to be deleted) (cgXXXX-XX-up-as / cgXXXX-XX-down-s) were chosen so that the two amplified fragments up and down complementary to each other slopes included. For the gene cluster cg0344-47 this is the primer pair cg0344-47-up-as / cg0344-47-down-s and analogously for the gene cluster cg2625-40 the primer pair cg2625-40-up-as / cg2625-40-down-s . In a second PCR (without the addition of DNA primers), the purified fragments accumulate via the complementary sequences and serve both as primers and as templates (overlap-extension PCR). The deletion fragment generated in this way was amplified in a final PCR with the two outer primers (facing away from the gene) from the first PCR (cgXXXX-XX-up-s / cgXXXX-XX-down-as). For the gene cluster cg0344-47 this is the primer pair cg0344-47-up-s / cg0344-47-down-as and analogously for the gene cluster cg2625-40 the primer pair cg2625-40-up-s / cg2625-40-down-as . After electrophoretic separation on a 1% TAE agarose gel, the final deletion fragment was isolated from the gel using the NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) according to the attached protocol. For the construction of the deletion plasmids, both the deletion fragments and the pK19-mobsacB empty vector were linearized with the FastDigest - \ / a variants (Thermo Fisher Scientific) of the restriction enzymes Xba \ and EcoRI. The restriction mixtures of the fragments mentioned were cleaned using the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren). For the ligation of the hydrolyzed DNA fragments using a Rapid DNA Ligation Kit (Thermo Fisher Scientific), one of the two deletion fragments was used in a three-fold molar excess compared to the linearized vector backbone pK19mobsacB. After ligation of the fragments, the entire batch volume was used for the transformation of chemically competent E. coli DH5a cells by means of heat shock at 42 ° C. for 90 seconds. Following the heat shock, the cells were regenerated on ice for 90 seconds before they were provided with 800 pL LB medium and regenerated at 37 ° C. in a thermomixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes. Subsequently, 100 pL of the cell suspension were spread on LB agar plates with kanamycin (50 pg / ml) and incubated at 37 ° C. overnight. The correct assembly of the deletion plasmids in the grown transformants was checked by means of colony PCR. The 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this. The DNA template was added to the PCR approach by adding cells from the grown colonies. The cells were lysed by the initial denaturation step of the PCR protocol at 95 ° C. for 3 minutes, so that the DNA template was released and was accessible to the DNA polymerase. The primer pair univ / rsp was used as the DNA primer for the colony PCR, which binds specifically to the pK19mobsacB vector backbone and, in the event of a correct ligation of the fragments used, forms a PCR product of a specific size, which was checked by gel electrophoresis. Clones whose PCR product is based on a correct assembly of the respective release plasmid pK19mobsacB-cg0344-47-del or pK19mobsacB-cg2625-40-del tet, were grown overnight in LB medium with kanamycin (50 pg / mL) for the isolation of the plasmids. The plasmids were then isolated using the NucleoSpin Plasmid (NoLid) kit (Macherey-Nagel, Düren) and sequenced using the amplification and colony PCR primers mentioned.
Ein Aliquot elektrokompetenter C. glutamicum- Zellen wurde mit dem beschriebenen Protokoll mit dem jeweiligen Deletionsplasmid transformiert und auf BHIS-Kan15-Platten ausgestri- chen. Da das pK19moösacß-Plasmid in C. glutamicum nicht replizieren kann, konnte bei der anschließenden Selektion der vermittelten Kanamycin-Resistenz davon ausgegangen wer- den, dass diese nur ausgebildet wird, falls das Deletionsplasmid erfolgreich über die homo logen Sequenzen in das Genom von C. glutamicum integriert werden konnte. Die erhaltenen Integranten wurden in einer ersten Selektionsrunde auf BHI-Kan25-Platten sowie BHI 10 % Saccharose (w/v)-Platten ausplattiert und über Nacht bei 30°C inkubiert. Bei erfolgreicher Genomintegration des Deletionsplasmids wird neben der Kanamycin-Resistenz die von sacB codierte Levan-Sucrase gebildet. Dieses Enzym katalysiert die Polymerisierung von Saccha- rose zum toxischen Levan, sodass es zu einer induzierten Letalität bei Wachstum auf Saccharose kommt (Bramucci & Nagarajan, 1996). Demnach sind Kolonien, die das Deletions plasmid über homologe Rekombination in ihr Genom integriert haben, resistent gegenüber Kanamycin und sensitiv gegenüber Saccharose. An aliquot of electrocompetent C. glutamicum cells was transformed using the described protocol with the respective deletion plasmid and streaked on BHIS-Kan 15 plates. Since the pK19moösacß plasmid cannot replicate in C. glutamicum, it could be assumed during the subsequent selection of the mediated kanamycin resistance that this would only be formed if the deletion plasmid was successfully introduced into the C. genome via the homologous sequences. glutamicum could be integrated. The integrants obtained were plated in a first round of selection on BHI-Kan 25 plates and BHI 10% sucrose (w / v) plates and incubated at 30 ° C. overnight. If the deletion plasmid is successfully integrated, the Levan sucrase encoded by sacB is formed in addition to the kanamycin resistance. This enzyme catalyzes the polymerization of saccharose into toxic levan, so that there is an induced lethality when sucrose grows (Bramucci & Nagarajan, 1996). Accordingly, colonies that have integrated the deletion plasmid into their genome via homologous recombination are resistant to kanamycin and sensitive to sucrose.
Die Exzision von pK19/77obsacß fand in einem zweiten Rekombinationsereignis über die nun doppelt vorliegenden DNA-Bereiche statt, bei dem das zu deletierende Gen aus dem Chro mosom letztendlich gegen das eingebrachte Deletionsfragment ausgetauscht wurde. Dazu wurden Zellen, die den beschriebenen Phänotyp (kanamycinresistent, saccharosesensitiv) zeigten, in einem Reagenzglas mit 3 ml BHI-Medium (ohne Zugabe von Kanamycin) für 3 Stunden bei 30 °C und 170 RPM inkubiert. Im Anschluss wurden je 100 mI einer 1 :10- Verdünnung auf BHI-Kan25-Platten sowie BHI-10 % Saccharose (w/v)-Platten ausgestrichen und über Nacht bei 30 °C inkubiert. Insgesamt wurden 50 der auf der BHI 10 % Saccharose (w/v)-Platte gewachsenen Klone ausgewählt und % Saccharose (w/v) ausgestrichen und über Nacht bei 30 °C inkubiert. Sollte das Plasmid vollständig entfernt worden sein, so zeigt sich dies in einer Sensitivität gegenüber Kanamycin und einer Resistenz gegenüber Saccha rose des jeweiligen Klons. Das zweite Rekombinationsereignis (Exzision) kann neben der gewünschten Gendeletion auch zur Wiederherstellung der Wildtyp-Situation führen. Die er folgreiche Deletion in den erhaltenen Klonen nach Exzision wurde über die erwartete Frag mentgröße bei Deletion des Gens oder Genclusters mittels Kolonie-PCR der erhaltenen Klone überprüft. Die verwendeten Primer del-cgXXXX-XX-s / del-cgXXXX-XX-as wurden hierbei so gewählt, dass sie im Chromosom außerhalb des deletierten DNA-Bereiches und auch außerhalb der amplifizierten flankierenden Genbereiche binden. Für das Gencluster cg0344- 47 ist dies das Primerpaar del-cg0344-47-s/ del-cg0344-47-as und analog für das Gencluster cg2625-40 das Primerpaar del-cg2625-40-s / del-cg2625-40-as. The excision of pK19 / 77obsacß took place in a second recombination event over the now duplicate DNA regions, in which the gene to be deleted from the chromosome was ultimately exchanged for the inserted deletion fragment. For this purpose, cells which showed the phenotype described (kanamycin-resistant, sucrose-sensitive) were incubated in a test tube with 3 ml of BHI medium (without addition of kanamycin) for 3 hours at 30 ° C. and 170 RPM. Subsequently, 100 ml of a 1:10 dilution were spread on BHI-Kan 25 plates and BHI-10% sucrose (w / v) plates and incubated overnight at 30 ° C. A total of 50 clones grown on the BHI 10% sucrose (w / v) plate were selected and% sucrose (w / v) streaked and incubated overnight at 30 ° C. If the plasmid has been completely removed, this is shown by a sensitivity to kanamycin and a resistance to saccha rose of the respective clone. The second recombination event (excision) can, in addition to the desired gene deletion, also lead to the restoration of the wild-type situation. The successful deletion in the clones obtained after excision was checked via the expected fragment size upon deletion of the gene or gene cluster by means of colony PCR of the clones obtained. The primers del-cgXXXX-XX-s / del-cgXXXX-XX-as were used so that they bind in the chromosome outside of the deleted DNA area and also outside of the amplified flanking gene areas. For the gene cluster cg0344- 47 this is the primer pair del-cg0344-47-s / del-cg0344-47-as and analogously for the gene cluster cg2625-40 the primer pair del-cg2625-40-s / del-cg2625-40-as.
Verwendete Primer univ: CGCCAGGGTTTTCCCAGTCACGAC Primers used univ: CGCCAGGGTTTTCCCAGTCACGAC
rsp: CAC AG G AAAC AG CTAT G ACC AT G pK19mobsacB-cg0344-47-del rsp: CAC AG G AAAC AG CTAT G ACC AT G pK19mobsacB-cg0344-47-del
cg0344-47-up-s: CTCTCT AG AG CG GT G G CG AT GAT G ATCTTC GAG cg0344-47-up-s: CTCTCT AG AG CG GT G G CG AT GAT G ATCTTC GAG
cg0344-47-up-as: AAGCATATGAGCCAAGTACTATCAACGCGTCAGGGCGACT cg0344-47-up-as: AAGCATATGAGCCAAGTACTATCAACGCGTCAGGGCGACT
TTT CCATT GAGAGACATTT C  TTT CCATT GAGAGACATTT C
cg0344-47-down-s: CT G ACGCGTT GAT AGTACTT GGCT CAT AT GCTTTTCCT CAC cg0344-47-down-s: CT G ACGCGTT GAT AGTACTT GGCT CAT AT GCTTTTCCT CAC
CCGCTTCTACGCTTAAAAG  CCGCTTCTACGCTTAAAAG
cg0344-47-down-as: GACGAATT CGT GTGGCCACCACCT CAAT CT GT G cg0344-47-down-as: GACGAATT CGT GTGGCCACCACCT CAAT CT GT G
del-cg0344-47-s: AGAGATTCACCCTCGGCGATGAG del-cg0344-47-s: AGAGATTCACCCTCGGCGATGAG
del-cg0344-47-as: GACCCGCAATGGTGTCGCCAG pK19mobsacB-cg2625-40-del del-cg0344-47-as: GACCCGCAATGGTGTCGCCAG pK19mobsacB-cg2625-40-del
cg2625-40-up-s: ACAT CTAGAGGT CGGCGAAT CAAGCT CCAT G cg2625-40-up-s: ACAT CTAGAGGT CGGCGAAT CAAGCT CCAT G
cg2625-40-up-as: CGTCTCGAGTTCACATATGCAACGCGTGCTCAAGATGA cg2625-40-up-as: CGTCTCGAGTTCACATATGCAACGCGTGCTCAAGATGA
CAAT AT CTT GAGGGTT C ATTTTTT G ATCCTT AATTT AG  CAAT AT CTT GAGGGTT C ATTTTTT G ATCCTT AATTT AG
cg2625-40-down-s: TTGAGCACGCGTTGCATATGT G AACT CGAGACGGTC cg2625-40-down-s: TTGAGCACGCGTTGCATATGT G AACT CGAGACGGTC
GGTGGAGGCGACCAGGGATAAC  GGTGGAGGCGACCAGGGATAAC
cg2625-40-down-as: T CT GAATT CAT CAAGGCCAAT CAT GAT GAGT GCGAAAC del-cg2625-40-s: AAG AG G AGTT GAT G G GAT G GT CG AAC AAT C cg2625-40-down-as: T CT GAATT CAT CAAGGCCAAT CAT GAT GAGT GCGAAAC del-cg2625-40-s: AAG AG G AGTT GAT G G GAT G GT CG AAC AAT C
del-cg2625-40-as: GTTG G CAT G CC AG CTTT GT G GG AT G del-cg2625-40-as: GTTG G CAT G CC AG CTTT GT G GG AT G
Konstru ktion pK19mobsacB-Acg0344-47 : : PT7-4c/Pc Construction pK19mobsacB-Acg0344-47:: P T7 -4c / Pc
Zur Konstruktion des Plasmides pK19mobsacB-Acg0344-47::PT7-4c/Pc (Figur 14) für die chromosomale Integration an den Deletionslocus cg0344-47 einer für C. glutamicum codon- optimierten Variante des 4cl- Gens aus Petroselinum crispum unter Kontrolle des T7- Promotors (PT7-4C/Pc) wurde das Gen von GeneArt Gene Synthesis (Thermo Fisher Scienti- fic) chemisch als String DNA Fragment synthetisiert und als DNA-Template für die Amplifika- tion mit dem Primerpaar Mlul-PT7-4CLPcCg-s / Ndel-4CLPcCg-as verwendet. Für die Kon- struktion des Integrationsplasmides wurden sowohl das amplifizierte 4clPc- Gen als auch das Plasmid pK19mobsacB-cg0344-47~del mit den FastDigest-V arianten (Thermo Fisher Scienti fic) der Restriktionsenzyme Mlu\ und Nde I linearisiert. Die Restriktionsansätze der genannten Fragmente wurden mit dem NucleoSpin Gel and PCR Clean-up- Kit (Macherey-Nagel, Düren) gereinigt. Für die Ligation der hydrolysierten DNA-Fragmente mittels Rapid DNA Ligation- Kit (Thermo Fisher Scientific) wurde das 4c/Pc-Fragment in einem dreifachen molaren Über- schuss gegenüber dem linearisierten Vektorrückgrat pK19mobsacB-cg0344-47-del einge- setzt. Nach erfolgter Ligation der Fragmente wurden das gesamte Ansatzvolumen für die Transformation chemisch kompetenter E. coli DH5a-Zellen mittels Hitzeschock bei 42 °C für 90 Sekunden verwendet. Im Anschluss an den Hitzeschock wurden die Zellen 90 Sekunden auf Eis regeneriert bevor diese mit 800 pl_ LB-Medium versehen worden und bei 37 °C in einem Thermomixer (Eppendorf, Hamburg) bei 900 RPM für 60 Minuten regeneriert worden sind. Im Anschluss wurden 100 pl_ der Zellsuspension auf LB-Agarplatten mit Kanamycin (50 pg/ml) ausgestrichen und über Nacht bei 37 °C inkubiert. Die korrekte Assemblierung des Insertionsplasmides in den gewachsenen Transformanden wurde mittels Kolonie-PCR über- prüft. Hierfür wurde der 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc. , Waltham, MA, USA) verwendet. Die DNA-Matrize wurde dem PCR-Ansatz hierbei durch das Hinzufügen von Zellen der gewachsenen Kolonien beigesetzt. Durch den initialen Denaturie- rungsschritt des PCR-Protokolls bei 95 °C für 3 Minuten werden die Zellen lysiert, sodass die DNA-Matrize freigesetzt wurde und für die DNA-Polymerase zugänglich war. Als DNA-Primer für die Kolonie-PCR wurde das Primerpaar univ / rsp verwendet, welches spezifisch an das pK19mobsacB-Vektorrückgrat bindet und im Falle einer korrekten Ligation der eingesetzten Fragmente ein PCR-Produkt spezifischer Größe bildet, welches per Gelelektrophorese über prüft wurde. Klone, deren PCR-Produkt auf eine korrekte Assemblierung des Insertionsplas- mides pK19mobsacB-Acg0344-47::PT7 -4dPc hindeutet, wurden über Nacht in LB-Medium mit Kanamycin (50 pg/mL) für die Isolierung der Plasmide angezogen. Die Plasmide wurden anschließend mit dem NucleoSpin Plasmid (NoLid)- Kit (Macherey-Nagel, Düren) isoliert und mit den genannten Amplifizierungs-und Kolonie-PCR-Primern sequenziert. For the construction of the plasmid pK19mobsacB-Acg0344-47 :: P T7 -4c / Pc (FIG. 14) for the chromosomal integration to the deletion locus cg0344-47 a variant of the 4cl gene from Petroselinum crispum, codon-optimized for C. glutamicum, under the control of the T7 promoters (PT7-4C / Pc ), the gene from GeneArt Gene Synthesis (Thermo Fisher Scientific) was chemically synthesized as a string DNA fragment and as a DNA template for amplification with the primer pair Mlul-PT7-4CLPcCg-s / Ndel-4CLPcCg-as used. For the construction of the integration plasmid, both the amplified 4cl Pc gene and the plasmid pK19mobsacB-cg0344-47 ~ del were linearized with the FastDigest variants (Thermo Fisher Scientific) of the restriction enzymes Mlu \ and Nde I. The restriction mixtures of the fragments mentioned were cleaned using the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren). For the ligation of the hydrolyzed DNA fragments using a Rapid DNA Ligation Kit (Thermo Fisher Scientific), the 4c / Pc fragment in a triple molar excess was shot against the linearized vector backbone pK19mobsacB-cg0344-47-del. After ligation of the fragments, the entire batch volume was used for the transformation of chemically competent E. coli DH5a cells by means of heat shock at 42 ° C. for 90 seconds. Following the heat shock, the cells were regenerated on ice for 90 seconds before they were provided with 800 μl LB medium and regenerated at 37 ° C. in a thermomixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes. Then 100 μl of the cell suspension were spread on LB agar plates with kanamycin (50 pg / ml) and incubated at 37 ° C. overnight. The correct assembly of the insertion plasmid in the grown transformants was checked by colony PCR. The 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this. The DNA template was added to the PCR approach by adding cells from the grown colonies. The cells were lysed by the initial denaturation step of the PCR protocol at 95 ° C. for 3 minutes, so that the DNA template was released and was accessible to the DNA polymerase. The primer pair univ / rsp was used as the DNA primer for the colony PCR, which binds specifically to the pK19mobsacB vector backbone and, in the event of a correct ligation of the fragments used, forms a PCR product of a specific size, which was checked by gel electrophoresis. Clones whose PCR product indicated a correct assembly of the insertion plasmid pK19mobsacB-Acg0344-47 :: P T7 -4d Pc were grown overnight in LB medium with kanamycin (50 pg / mL) for the isolation of the plasmids. The plasmids were then isolated using the NucleoSpin Plasmid (NoLid) kit (Macherey-Nagel, Düren) and sequenced using the amplification and colony PCR primers mentioned.
Ein Aliquot elektrokompetenter C. glutamicum- Zellen wurde mit dem beschriebenen Protokoll mit dem Insertionsplasmid transformiert und auf BHIS-Kan15-Platten ausgestrichen. Da das pK19mobsacß-Plasmid in C. glutamicum nicht replizieren kann, konnte bei der anschließen- den Selektion der vermittelten Kanamycin-Resistenz davon ausgegangen werden, dass die- se nur ausgebildet wird, falls das Insertionsplasmid erfolgreich über die homologen Sequenzen in das Genom von C. glutamicum integriert werden konnte. Die erhaltenen Integranten wurden in einer ersten Selektionsrunde auf BHI-Kan25-Platten sowie BHI 10 % Saccharose (w/v)-Platten ausplattiert und über Nacht bei 30 °C inkubiert. Bei er folgreicher Genomintegration des Insertionsplasmides wird neben der Kanamycin-Resistenz die von sacB codierte Levan-Sucrase gebildet. Dieses Enzym katalysiert die Polymerisierung von Saccharose zum toxischen Levan, sodass es zu einer induzierten Letalität bei Wachs tum auf Saccharose kommt (Bramucci & Nagarajan, 1996). Demnach sind Kolonien, die das Insertionsplasmid über homologe Rekombination in ihr Genom integriert haben, resistent gegenüber Kanamycin und sensitiv gegenüber Saccharose. An aliquot of electrocompetent C. glutamicum cells was transformed with the insertion plasmid using the protocol described and spread on BHIS-Kan 15 plates. Since the pK19mobsacß plasmid cannot replicate in C. glutamicum, it could be assumed in the subsequent selection of the mediated kanamycin resistance that this would only be formed if the insertion plasmid was successfully introduced into the genome of C glutamicum could be integrated. The integrants obtained were plated in a first round of selection on BHI-Kan 25 plates and BHI 10% sucrose (w / v) plates and incubated at 30 ° C. overnight. If the insertion plasmid is successfully integrated, the levan sucrase encoded by sacB is formed in addition to the kanamycin resistance. This enzyme catalyzes the polymerization of sucrose into toxic levan, so that there is an induced lethality when sucrose grows (Bramucci & Nagarajan, 1996). Accordingly, are colonies that Insertion plasmid integrated into their genome via homologous recombination, resistant to kanamycin and sensitive to sucrose.
Die Exzision von pK19 mobsacB fand in einem zweiten Rekombinationsereignis über die nun doppelt vorliegenden DNA-Bereiche statt, bei dem der gewählte Integrationslocus aus dem Chromosom letztendlich gegen das eingebrachte Insertionsfragment ausgetauscht wurde. Dazu wurden Zellen, die den beschriebenen Phänotyp (kanamycinresistent, saccharosesen- sitiv) zeigten, in einem Reagenzglas mit 3 ml BHI-Medium (ohne Zugabe von Kanamycin) für 3 Stunden bei 30 °C und 170 RPM inkubiert. Im Anschluss wurden je 100 pl einer 1 :10- Verdünnung auf BHI-Kan25-Platten sowie BHI-10 % Saccharose (w/v)-Platten ausgestrichen und über Nacht bei 30 °C inkubiert. Insgesamt wurden 50 der auf der BHI 10 % Saccharose (w/v)-Platte gewachsenen Klone ausgewählt und zur Überprüfung der erfolgreichen Exzision von pK19 mobsacB auf BHI-Kan25 sowie BHI 10 % Saccharose (w/v) ausgestrichen und über Nacht bei 30 °C inkubiert. Sollte das Plasmid vollständig entfernt worden sein, so zeigt sich dies in einer Sensitivität gegenüber Kanamycin und einer Resis- tenz gegenüber Saccharose des jeweiligen Klons. Das zweite Rekombinationsereignis (Exzision) kann neben der gewünschten PT7-4c/Pc-lnsertion auch zur Wiederherstellung der Wildtyp-Situation führen. Die erfolgreiche Insertion in den erhaltenen Klonen nach Exzision wurde über die erwartete Fragmentgröße bei Insertion des Gens oder Genclusters mittels Kolonie-PCR der erhaltenen Klone überprüft. Die verwendeten Primer del-cg0344-47-s / del- cg0344-47-as wurden hierbei so gewählt, dass sie im Chromosom außerhalb des Insertions- locus und auch außerhalb der amplifizierten flankierenden Genbereiche binden. PCR- Fragmente, die eine Insertion des Kontruktes PT7-4C/PC anzeigen, wurden mit dem Nucleo- Spin Gel and PCR Clean-up- Kit (Macherey-Nagel, Düren) gereinigt und zur Kontrolle der Insertion mit den Primern del-cg0344-47-s, cg0344-47-up-s, Mlul-PT7-4CLPcCg-s, Ndel- 4CLPcCg-as, cg0344-47-down-as und del-cg0344-47-as sequenziert. The excision of pK19 mobsacB took place in a second recombination event over the now double DNA regions, in which the selected integration locus from the chromosome was ultimately exchanged for the inserted insertion fragment. For this purpose, cells which showed the phenotype described (kanamycin-resistant, sucrose-sensitive) were incubated in a test tube with 3 ml of BHI medium (without addition of kanamycin) for 3 hours at 30 ° C. and 170 RPM. Subsequently, 100 μl of a 1:10 dilution were spread on BHI-Kan 25 plates and BHI-10% sucrose (w / v) plates and incubated at 30 ° C. overnight. A total of 50 of the clones grown on the BHI 10% sucrose (w / v) plate were selected and streaked to check the successful excision of pK19 mobsacB on BHI-Kan 25 and BHI 10% sucrose (w / v) and overnight at 30 ° C incubated. If the plasmid has been completely removed, this is shown by a sensitivity to kanamycin and a resistance to sucrose of the respective clone. The second recombination event (excision) can, in addition to the desired P T7 -4c / Pc insertion, also lead to the restoration of the wild-type situation. The successful insertion in the clones obtained after excision was checked via the expected fragment size when the gene or gene cluster was inserted by means of colony PCR of the clones obtained. The primers del-cg0344-47-s / del-cg0344-47-as were used in such a way that they bind in the chromosome outside the insertion locus and also outside the amplified flanking gene regions. PCR fragments which indicate an insertion of the PT7-4C / PC construct were purified using the Nucleo-Spin Gel and PCR clean-up kit (Macherey-Nagel, Düren) and, to check the insertion, using the primers del-cg0344- 47-s, cg0344-47-up-s, Mlul-PT7-4CLPcCg-s, Ndel- 4CLPcCg-as, cg0344-47-down-as and del-cg0344-47-as sequenced.
Verwendete Primer Primers used
univ: CGCCAGGGTTTTCCCAGTCACGAC univ: CGCCAGGGTTTTCCCAGTCACGAC
rsp: C AC AG G AAAC AG CTAT G ACC AT G rsp: C AC AG G AAAC AG CTAT G ACC AT G
Mlul-PT7-4CLPcCg-s: TC CT AC G CGTT AAT ACG ACT C ACT AT AGGG AG AT C AAG Mlul-PT7-4CLPcCg-s: TC CT AC G CGTT AAT ACG ACT C ACT AT AGGG AG AT C AAG
GAGGCGGACAATGGGCGATTGCGTGGCAC  GAGGCGGACAATGGGCGATTGCGTGGCAC
Ndel-4CLPcCg-as: GGACGTT CAT ATGTTACTTT GGCAGAT CACCGG ATGCG Ndel-4CLPcCg-as: GGACGTT CAT ATGTTACTTT GGCAGAT CACCGG ATGCG
ATC del-cg0344-47-s: AG AGATT CACCCT CGGCGAT GAG cg0344-47-up-s: CTCTCTAGAGCGGTGGCGATGATGATCTTCGAG cg 0344-47-down-as : GACGAATT CGT GT GGCCACCACCT CAAT CT GT G del-cg0344-47-as: GACCCGCAATGGTGTCGCCAG ATC del-cg0344-47-s: AG AGATT CACCCT CGGCGAT GAG cg0344-47-up-s: CTCTCTAGAGCGGTGGCGATGATGATCTTCGAG cg 0344-47-down-as: GACGAATT CGT GT GGCCACCACCT CAAT CT GT G del-cg0344-47-as: GACCCGCAATGGTGTCGCCAG
Konstruktion pK19mobsacB-cg0502-del Construction pK19mobsacB-cg0502-del
Zur Konstruktion des Plasmides pK19mobsacB-cg0502-del (Figur 15) für die Deletion des Gens cg0502 in C. glutamicum wurden die für das homologe Rekombinationsereignis benö- tigten flankierenden Fragmente per PCR ausgehend von isolierter genomischer C. glutami cum DNA amplifiziert. To construct the plasmid pK19mobsacB-cg0502-del (FIG. 15) for the deletion of the gene cg0502 in C. glutamicum, the flanking fragments required for the homologous recombination event were amplified by PCR starting from isolated genomic C. glutami cum DNA.
Für die Generierung des stromaufwärts gelegenen Fragments wurde das Primerpaar cg0502-up-s / cg0502-up-as verwendet, die stromabwärts gelegene Flanke wurde mit dem Primerpaar cg0502-down-s / cg0502-down-as amplifiziert. Die Überprüfung der generierten DNA-Fragmente auf die erwartete Basenpaargröße wurde mittels gelelektrophoretischer Analyse auf einem 1 % Agarosegel durchgeführt. Die Nukleotidsequenzen der inneren (dem zu deletierenden Gen zugewandten) Primer (cg0502-up-as / cg0502-down-s) wurden dabei so gewählt, dass die beiden amplifizierten Fragmente up und down zueinander komplemen- täre Überhänge enthalten. In einer zweiten PCR (ohne Zugabe von DNA-Primern) lagern sich die gereinigten Fragmente über die komplementären Sequenzen an und dienen sich gegenseitig sowohl als Primer als auch als Matrize (overlap-extension PCR). Das so gene- rierte Deletionsfragment wurde in einer finalen PCR mit den beiden äußeren (dem Gen ab- gewandten) Primern aus der ersten PCR amplifiziert (cg0502-up-s / cg0502-down-as). Nach elektrophoretischer Trennung auf einem 1 % TAE-Agarosegel wurde das finale Deletions- fragment mit dem NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) nach dem beiliegenden Protokoll aus dem Gel isoliert. Für die Konstruktion des Deletionsplasmids wurden sowohl das Deletionfragment als auch der pK19-mobsacB-Leervektor mit den Fast- Digest-V arianten (Thermo Fisher Scientific) der Restriktionsenzyme Hind\\\ und ßamHI linea- risiert. Die Restriktionsansätze der genannten Fragmente wurden mit dem NucleoSpin Gel and PCR Clean-up-K\t (Macherey-Nagel, Düren) gereinigt. Für die Ligation der hydrolysier- ten DNA-Fragmente mittels Rapid DNA Ligation- Kit (Thermo Fisher Scientific) wurde das Deletionsfragment in einem dreifachen molaren Überschuss gegenüber dem linearisierten Vektorrückgrat pK19mobsacB eingesetzt. Nach erfolgter Ligation der Fragmente wurden das gesamte Ansatzvolumen für die Transformation chemisch kompetenter E. coli DH5a-Zellen mittels Hitzeschock bei 42 °C für 90 Sekunden verwendet. Im Anschluss an den Hitzeschock wurden die Zellen 90 Sekunden auf Eis regeneriert bevor diese mit 800 pL LB-Medium ver- sehen worden und bei 37 °C in einem Thermomixer (Eppendorf, Hamburg) bei 900 RPM für 60 Minuten regeneriert worden sind. Im Anschluss wurden 100 pL der Zellsuspension auf LB-Agarplatten mit Kanamycin (50 pg/ml) ausgestrichen und über Nacht bei 37 °C inkubiert. Die korrekte Assemblierung der Deletionsplasmide in den gewachsenen Transformanden wurde mittels Kolonie-PCR überprüft. Hierfür wurde der 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) verwendet. Die DNA-Matrize wurde dem PCR-Ansatz hierbei durch das Hinzufügen von Zellen der gewachsenen Kolonien bei gesetzt. Durch den initialen Denaturierungsschritt des PCR-Protokolls bei 95 °C für 3 Minu- ten werden die Zellen lysiert, sodass die DNA-Matrize freigesetzt wurde und für die DNA- Polymerase zugänglich war. Als DNA-Primer für die Kolonie-PCR wurde das Primerpaar univ / rsp verwendet, welches spezifisch an das pK19mobsacB-Vektorrückgrat bindet und im Fal- le einer korrekten Ligation der eingesetzten Fragmente ein PCR-Produkt spezifischer Größe bildet, welches per Gelelektrophorese überprüft wurde. Klone, deren PCR-Produkt auf eine korrekte Assemblierung des Deletionsplasmides pK19mobsacB-cg0502-del hindeutet, wur- den über Nacht in LB-Medium mit Kanamycin (50 pg/mL) für die Isolierung der Plasmide angezogen. Die Plasmide wurden anschließend mit dem NucleoSpin Plasmid (NoLid)-KW. (Macherey-Nagel, Düren) isoliert und mit den genannten Amplifizierungs-und Kolonie-PCR- Primern sequenziert. The primer pair cg0502-up-s / cg0502-up-as was used to generate the upstream fragment, the downstream flank was amplified with the primer pair cg0502-down-s / cg0502-down-as. The DNA fragments generated were checked for the expected base pair size by means of gel electrophoretic analysis on a 1% agarose gel. The nucleotide sequences of the inner primers (facing the gene to be deleted) (cg0502-up-as / cg0502-down-s) were chosen so that the two amplified fragments up and down contain complementary overhangs. In a second PCR (without the addition of DNA primers), the purified fragments accumulate via the complementary sequences and serve both as primers and as templates (overlap-extension PCR). The deletion fragment generated in this way was amplified in a final PCR with the two outer primers (facing away from the gene) from the first PCR (cg0502-up-s / cg0502-down-as). After electrophoretic separation on a 1% TAE agarose gel, the final deletion fragment was isolated from the gel using the NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) according to the enclosed protocol. For the construction of the deletion plasmid, both the deletion fragment and the pK19-mobsacB empty vector were linearized with the Fast Digest variants (Thermo Fisher Scientific) of the restriction enzymes Hind \\\ and ßamHI. The restriction mixtures of the fragments mentioned were cleaned with the NucleoSpin Gel and PCR Clean-up-K \ t (Macherey-Nagel, Düren). For the ligation of the hydrolyzed DNA fragments using a Rapid DNA Ligation Kit (Thermo Fisher Scientific), the deletion fragment was used in a three-fold molar excess compared to the linearized vector backbone pK19mobsacB. After ligation of the fragments, the entire batch volume was used for the transformation of chemically competent E. coli DH5a cells by means of heat shock at 42 ° C. for 90 seconds. Following the heat shock, the cells were regenerated on ice for 90 seconds before they were provided with 800 pL LB medium and regenerated at 37 ° C. in a thermomixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes. Subsequently, 100 pL of the cell suspension were spread on LB agar plates with kanamycin (50 pg / ml) and incubated at 37 ° C. overnight. The correct assembly of the deletion plasmids in the grown transformants was checked by colony PCR. The 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this. The DNA template was added to the PCR approach by adding cells from the grown colonies. The cells are lysed by the initial denaturation step of the PCR protocol at 95 ° C. for 3 minutes, so that the DNA template was released and was accessible to the DNA polymerase. The primer pair univ / rsp was used as the DNA primer for the colony PCR, which binds specifically to the pK19mobsacB vector backbone and, in the event of correct ligation of the fragments used, forms a PCR product of a specific size, which was checked by gel electrophoresis. Clones whose PCR product indicated a correct assembly of the deletion plasmid pK19mobsacB-cg0502-del were grown overnight in LB medium with kanamycin (50 pg / mL) for the isolation of the plasmids. The plasmids were then cut with the NucleoSpin Plasmid (NoLid) -KW. (Macherey-Nagel, Düren) isolated and sequenced with the aforementioned amplification and colony PCR primers.
Ein Aliquot elektrokompetenter C. glutamicum- Zellen wurde mit dem beschriebenen Protokoll mit dem jeweiligen Deletionsplasmid transformiert und auf BHIS-Kan15-Platten ausgestri- chen. Da das pK19rr70ösacß-Plasmid in C. glutamicum nicht replizieren kann, konnte bei der anschließenden Selektion der vermittelten Kanamycin-Resistenz davon ausgegangen wer- den, dass diese nur ausgebildet wird, falls das Deletionsplasmid erfolgreich über die homo logen Sequenzen in das Genom von C. glutamicum integriert werden konnte. Die erhaltenen Integranten wurden in einer ersten Selektionsrunde auf BHI-Kan25-Platten sowie BHI 10 % Saccharose (w/v)-Platten ausplattiert und über Nacht bei 30 °C inkubiert. Bei er- folgreicher Genomintegration des Deletionsplasmids wird neben der Kanamycin-Resistenz die von sacB codierte Levan-Sucrase gebildet. Dieses Enzym katalysiert die Polymerisierung von Saccharose zum toxischen Levan, sodass es zu einer induzierten Letalität bei Wachs- tum auf Saccharose kommt (Bramucci & Nagarajan, 1996). Demnach sind Kolonien, die das Deletionsplasmid über homologe Rekombination in ihr Genom integriert haben, resistent gegenüber Kanamycin und sensitiv gegenüber Saccharose. An aliquot of electrocompetent C. glutamicum cells was transformed using the described protocol with the respective deletion plasmid and streaked on BHIS-Kan 15 plates. Since the pK19rr70ösacß plasmid cannot replicate in C. glutamicum, it could be assumed in the subsequent selection of the mediated kanamycin resistance that this would only be formed if the deletion plasmid was successfully introduced into the C. genome via the homologous sequences. glutamicum could be integrated. The integrants obtained were plated in a first round of selection on BHI-Kan 25 plates and BHI 10% sucrose (w / v) plates and incubated at 30 ° C. overnight. If the deletion plasmid is successfully integrated, the levan sucrase encoded by sacB is formed in addition to the kanamycin resistance. This enzyme catalyzes the polymerization of sucrose into toxic levan, so that there is an induced lethality when growing on sucrose (Bramucci & Nagarajan, 1996). Accordingly, colonies that have integrated the deletion plasmid into their genome via homologous recombination are resistant to kanamycin and sensitive to sucrose.
Die Exzision von pK19 mobsacB fand in einem zweiten Rekombinationsereignis über die nun doppelt vorliegenden DNA-Bereiche statt, bei dem das zu deletierende Gen aus dem Chro mosom letztendlich gegen das eingebrachte Deletionsfragment ausgetauscht wurde. Dazu wurden Zellen, die den beschriebenen Phänotyp (kanamycinresistent, saccharosesensitiv) zeigten, in einem Reagenzglas mit 3 ml BHI-Medium (ohne Zugabe von Kanamycin) für 3 Stunden bei 30 °C und 170 RPM inkubiert. Im Anschluss wurden je 100 pl einer 1 :10- Verdünnung auf BHI-Kan25-Platten sowie BHI-10 % Saccharose (w/v)-Platten ausgestrichen und über Nacht bei 30 °C inkubiert. Insgesamt wurden 50 der auf der BHI 10 % Saccharose (w/v)-Platte gewachsenen Klone ausgewählt und zur Überprüfung der erfolgreichen Exzision von pK19 mobsacB auf BHI-Kan25 sowie BHI 10 % Saccharose (w/v) ausgestrichen und über Nacht bei 30 °C inkubiert. Sollte das Plasmid vollständig entfernt worden sein, so zeigt sich dies in einer Sensitivität gegenüber Kanamycin und einer Resistenz gegenüber Saccharose des jeweiligen Klons. Das zweite Rekombinationsereignis (Exzision) kann neben der gewünschten Gendeletion auch zur Wiederherstellung der Wildtyp-Situation führen. Die erfolgreiche Deletion in den erhaltenen Klonen nach Exzision wurde über die erwartete Fragmentgröße bei Deletion des Gens oder Genclusters mittels Kolonie- PCR der erhaltenen Klone überprüft. Die verwendeten Primer del-cg0502-s / del-cg0502-as wurden hierbei so gewählt, dass sie im Chromosom außerhalb des deletierten DNA- Bereiches und auch außerhalb der amplifizierten flankierenden Genbereiche binden. The excision of pK19 mobsacB took place in a second recombination event over the now duplicate DNA areas, in which the gene to be deleted from the chromosome was ultimately exchanged for the inserted deletion fragment. For this purpose, cells which showed the phenotype described (kanamycin-resistant, sucrose-sensitive) were incubated in a test tube with 3 ml of BHI medium (without addition of kanamycin) for 3 hours at 30 ° C. and 170 RPM. Subsequently, 100 μl of a 1:10 dilution were spread on BHI-Kan 25 plates and BHI-10% sucrose (w / v) plates and incubated overnight at 30 ° C. A total of 50 of the clones grown on the BHI 10% sucrose (w / v) plate were selected and streaked to check the successful excision of pK19 mobsacB on BHI-Kan 25 and BHI 10% sucrose (w / v) and overnight at 30 ° C incubated. If the plasmid has been completely removed, this is shown by a sensitivity to kanamycin and a resistance to sucrose of the respective clone. The second recombination event (excision) can, in addition to the desired gene deletion, also lead to the restoration of the wild-type situation. The successful deletion in the clones obtained after excision was checked via the expected fragment size upon deletion of the gene or gene cluster by means of colony PCR of the clones obtained. The primers del-cg0502-s / del-cg0502-as used were chosen so that they bind in the chromosome outside the deleted DNA area and also outside the amplified flanking gene areas.
Verwendete Primer up-cg0502-s: ACGAAGCTTTGTCCGGCATGCTGGCTGAC up-cg0502-as: TGCGCATATGTGGCCGTCTAGATACGCGTACGTCAAA Primers used up-cg0502-s: ACGAAGCTTTGTCCGGCATGCTGGCTGAC up-cg0502-as: TGCGCATATGTGGCCGTCTAGATACGCGTACGTCAAA
CAAACAGTGGCAATGGATGTACGCATG  CAAACAGTGGCAATGGATGTACGCATG
down-cg0502-s: ACGTACGCGTATCTAGACGGCCACATATGCGCAATCG down-cg0502-s: ACGTACGCGTATCTAGACGGCCACATATGCGCAATCG
AGCGGGGAATCCCAAACTAGCATC down-cg0502-as: TATGGATCCTACGCCTGTACACCGTCGCACGTC  AGCGGGGAATCCCAAACTAGCATC down-cg0502-as: TATGGATCCTACGCCTGTACACCGTCGCACGTC
del-cg0502-s: GT GAACATT GT GTTT ACT GT GTGGGCACT GT C del-cg0502-as: T GAT GTT CAGGCCGTT GAAGCCAAGGT AGAG univ: CGCCAGGGTTTTCCCAGTCACGAC rsp: CACAGGAAACAGCTAT GACCAT G del-cg0502-s: GT GAACATT GT GTTT ACT GT GTGGGCACT GT C del-cg0502-as: T GAT GTT CAGGCCGTT GAAGCCAAGGT AGAG univ: CGCCAGGGTTTTCCCAGTCACGAC rsp: CACAGGAAACAGCTAT GACCAT G
Konstruktion pK19mobsacB-cg1226-del Construction pK19mobsacB-cg1226-del
Zur Konstruktion des Plasmides pK19mobsacB-cg1226-del (Figur 16) für die Deletion des Gens cg1226 in C. glutamicum wurden die für das homologe Rekombinationsereignis benö- tigten flankierenden Fragmente per PCR ausgehend von isolierter genomischer C. glutami cum DNA amplifiziert. To construct the plasmid pK19mobsacB-cg1226-del (FIG. 16) for the deletion of the gene cg1226 in C. glutamicum, the flanking fragments required for the homologous recombination event were amplified by PCR on the basis of isolated genomic C. glutami cum DNA.
Für die Generierung des stromaufwärts gelegenen Fragments wurde das Primerpaar cg1226-up-s / cg1226-up-as verwendet, die stromabwärts gelegene Flanke wurde mit dem Primerpaar cg1226-down-s / cg1226-down-as amplifiziert. Die Überprüfung der generierten DNA-Fragmente auf die erwartete Basenpaargröße wurde mittels gelelektrophoretischer Analyse auf einem 1 % Agarosegel durchgeführt. Die Nukleotidsequenzen der inneren (dem zu deletierenden Gen zugewandten) Primer (cg1226-up-as / cg1226-down-s) wurden dabei so gewählt, dass die beiden amplifizierten Fragmente up und down zueinander komplemen- täre Überhänge enthalten. In einer zweiten PCR (ohne Zugabe von DNA-Primern) lagern sich die gereinigten Fragmente über die komplementären Sequenzen an und dienen sich gegenseitig sowohl als Primer als auch als Matrize (overlap-extension PCR). Das so gene- rierte Deletionsfragment wurde in einer finalen PCR mit den beiden äußeren (dem Gen ab gewandten) Primern aus der ersten PCR amplifiziert (cg1226-up-s / cg1226-down-as). Nach elektrophoretischer Trennung auf einem 1 % TAE-Agarosegel wurde das finale Deletions- fragment mit dem NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) nach dem beiliegenden Protokoll aus dem Gel isoliert. Für die Konstruktion des Deletionsplasmids wurden sowohl das Deletionfragment als auch der pK19-mobsacB-Leervektor mit den Fast- Digest-V arianten (Thermo Fisher Scientific) der Restriktionsenzyme Hind\\\ und SamHI linea- risiert. Die Restriktionsansätze der genannten Fragmente wurden mit dem NucleoSpin Gel and PCR Clean-up-Kti (Macherey-Nagel, Düren) gereinigt. Für die Ligation der hydrolysierten DNA-Fragmente mittels Rapid DNA Ligation- Kit (Thermo Fisher Scientific) wurde das Deletionsfragment in einem dreifachen molaren Überschuss gegenüber dem linearisierten Vektorrückgrat pK19mobsacB eingesetzt. Nach erfolgter Ligation der Fragmente wurden das gesamte Ansatzvolumen für die Transformation chemisch kompetenter E. coli DH5a-Zellen mittels Hitzeschock bei 42 °C für 90 Sekunden verwendet. Im Anschluss an den Hitzeschock wurden die Zellen 90 Sekunden auf Eis regeneriert bevor diese mit 800 pL LB-Medium ver sehen worden und bei 37 °C in einem Thermomixer (Eppendorf, Hamburg) bei 900 RPM für 60 Minuten regeneriert worden sind. Im Anschluss wurden 100 pL der Zellsuspension auf LB-Agarplatten mit Kanamycin (50 pg/ml) ausgestrichen und über Nacht bei 37 °C inkubiert. Die korrekte Assemblierung der Deletionsplasmide in den gewachsenen Transformanden wurde mittels Kolonie-PCR überprüft. Hierfür wurde der 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) verwendet. Die DNA-Matrize wurde dem PCR-Ansatz hierbei durch das Hinzufügen von Zellen der gewachsenen Kolonien bei gesetzt. Durch den initialen Denaturierungsschritt des PCR-Protokolls bei 95 °C für 3 Minu ten werden die Zellen lysiert, sodass die DNA-Matrize freigesetzt wurde und für die DNA- Polymerase zugänglich war. Als DNA-Primer für die Kolonie-PCR wurde das Primerpaar univ / rsp verwendet, welches spezifisch an das pK19mobsacB-Vektorrückgrat bindet und im Fal le einer korrekten Ligation der eingesetzten Fragmente ein PCR-Produkt spezifischer Größe bildet, welches per Gelelektrophorese überprüft wurde. Klone, deren PCR-Produkt auf eine korrekte Assemblierung des Deletionsplasmides pK19mobsacB-cg1226-del hindeutet, wur- den über Nacht in LB-Medium mit Kanamycin (50 pg/mL) für die Isolierung der Plasmide angezogen. Die Plasmide wurden anschließend mit dem NucleoSpin Plasmid (NoLid)-KH (Macherey-Nagel, Düren) isoliert und mit den genannten Amplifizierungs-und Kolonie-PCR- Primern sequenziert. The primer pair cg1226-up-s / cg1226-up-as was used to generate the upstream fragment, the downstream flank was matched with the Primer pair cg1226-down-s / cg1226-down-as amplified. The DNA fragments generated were checked for the expected base pair size by means of gel electrophoretic analysis on a 1% agarose gel. The nucleotide sequences of the inner primers (facing the gene to be deleted) (cg1226-up-as / cg1226-down-s) were chosen such that the two amplified fragments up and down contain complementary overhangs. In a second PCR (without the addition of DNA primers), the purified fragments accumulate via the complementary sequences and serve both as primers and as templates (overlap-extension PCR). The deletion fragment thus generated was amplified in a final PCR with the two outer primers (facing away from the gene) from the first PCR (cg1226-up-s / cg1226-down-as). After electrophoretic separation on a 1% TAE agarose gel, the final deletion fragment was isolated from the gel using the NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) according to the enclosed protocol. For the construction of the deletion plasmid, both the deletion fragment and the pK19-mobsacB empty vector were linearized with the Fast Digest variants (Thermo Fisher Scientific) of the restriction enzymes Hind \\\ and SamHI. The restriction mixtures of the fragments mentioned were cleaned with the NucleoSpin Gel and PCR Clean-up-Kti (Macherey-Nagel, Düren). For the ligation of the hydrolyzed DNA fragments using a Rapid DNA Ligation Kit (Thermo Fisher Scientific), the deletion fragment was used in a three-fold molar excess compared to the linearized vector backbone pK19mobsacB. After ligation of the fragments, the entire batch volume was used for the transformation of chemically competent E. coli DH5a cells by means of heat shock at 42 ° C. for 90 seconds. Following the heat shock, the cells were regenerated on ice for 90 seconds before they were provided with 800 pL LB medium and regenerated at 37 ° C. in a thermomixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes. Subsequently, 100 pL of the cell suspension were spread on LB agar plates with kanamycin (50 pg / ml) and incubated at 37 ° C. overnight. The correct assembly of the deletion plasmids in the grown transformants was checked by colony PCR. The 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this. The DNA template was added to the PCR approach by adding cells from the grown colonies. The cells were lysed by the initial denaturation step of the PCR protocol at 95 ° C. for 3 minutes, so that the DNA template was released and was accessible to the DNA polymerase. The primer pair univ / rsp was used as the DNA primer for the colony PCR, which binds specifically to the pK19mobsacB vector backbone and, in the case of correct ligation of the fragments used, forms a PCR product of a specific size, which was checked by gel electrophoresis. Clones whose PCR product indicated a correct assembly of the deletion plasmid pK19mobsacB-cg1226-del which was grown overnight in LB medium with kanamycin (50 pg / mL) for the isolation of the plasmids. The plasmids were then isolated with the NucleoSpin Plasmid (NoLid) -KH (Macherey-Nagel, Düren) and sequenced with the amplification and colony PCR primers mentioned.
Ein Aliquot elektrokompetenter C. glutamicum-ZeWen wurde mit dem beschriebenen Protokoll mit dem jeweiligen Deletionsplasmid transformiert und auf BHIS-Kan15-Platten ausgestri- chen. Da das pK19moösacß-Plasmid in C. glutamicum nicht replizieren kann, konnte bei der anschließenden Selektion der vermittelten Kanamycin-Resistenz davon ausgegangen wer- den, dass diese nur ausgebildet wird, falls das Deletionsplasmid erfolgreich über die homo- logen Sequenzen in das Genom von C. glutamicum integriert werden konnte. Die erhaltenen Integranten wurden in einer ersten Selektionsrunde auf BHI-Kan25-Platten sowie BHI 10 % Saccharose (w/v)-Platten ausplattiert und über Nacht bei 30 °C inkubiert. Bei er folgreicher Genomintegration des Deletionsplasmids wird neben der Kanamycin-Resistenz die von sacB codierte Levan-Sucrase gebildet. Dieses Enzym katalysiert die Polymerisierung von Saccharose zum toxischen Levan, sodass es zu einer induzierten Letalität bei Wachs- tum auf Saccharose kommt (Bramucci & Nagarajan, 1996). Demnach sind Kolonien, die das Deletionsplasmid über homologe Rekombination in ihr Genom integriert haben, resistent gegenüber Kanamycin und sensitiv gegenüber Saccharose. An aliquot of electrocompetent C. glutamicum ZeWen was transformed with the respective deletion plasmid using the protocol described and streaked on BHIS-Kan 15 plates. Since the pK19moösacß plasmid cannot replicate in C. glutamicum, it could be assumed in the subsequent selection of the mediated kanamycin resistance that this would only develop if the deletion plasmid was successfully introduced into the genome of C glutamicum could be integrated. The integrants obtained were plated in a first round of selection on BHI-Kan 25 plates and BHI 10% sucrose (w / v) plates and incubated at 30 ° C. overnight. Upon successful genome integration of the deletion plasmid, in addition to the kanamycin resistance, the Levan-Sucrase encoded by sacB is formed. This enzyme catalyzes the polymerization of sucrose into toxic levan, so that there is an induced lethality when growing on sucrose (Bramucci & Nagarajan, 1996). Accordingly, colonies that have integrated the deletion plasmid into their genome via homologous recombination are resistant to kanamycin and sensitive to sucrose.
Die Exzision von pK19 mobsacB fand in einem zweiten Rekombinationsereignis über die nun doppelt vorliegenden DNA-Bereiche statt, bei dem das zu deletierende Gen aus dem Chro- mosom letztendlich gegen das eingebrachte Deletionsfragment ausgetauscht wurde. Dazu wurden Zellen, die den beschriebenen Phänotyp (kanamycinresistent, saccharosesensitiv) zeigten, in einem Reagenzglas mit 3 ml BHI-Medium (ohne Zugabe von Kanamycin) für 3 Stunden bei 30 °C und 170 RPM inkubiert. Im Anschluss wurden je 100 pl einer 1 :10- Verdünnung auf BHI-Kan25-Platten sowie BHI-10 % Saccharose (w/v)-Platten ausgestrichen und über Nacht bei 30 °C inkubiert. Insgesamt wurden 50 der auf der BHI 10 % Saccharose (w/v)-Platte gewachsenen Klone ausgewählt und zur Überprüfung der erfolgreichen Exzision von pK19 mobsacB auf BHI-Kan25 sowie BHI 10 % Saccharose (w/v) ausgestrichen und über Nacht bei 30 °C inkubiert. Sollte das Plasmid vollständig entfernt worden sein, so zeigt sich dies in einer Sensitivität gegenüber Kanamycin und einer Resis- tenz gegenüber Saccharose des jeweiligen Klons. Das zweite Rekombinationsereignis (Exzision) kann neben der gewünschten Gendeletion auch zur Wiederherstellung der Wild- typ-Situation führen. Die erfolgreiche Deletion in den erhaltenen Klonen nach Exzision wurde über die erwartete Fragmentgröße bei Deletion des Gens oder Genclusters mittels Kolonie- PCR der erhaltenen Klone überprüft. Die verwendeten Primer del-cg1226-s / del-cg1226-as wurden hierbei so gewählt, dass sie im Chromosom außerhalb des deletierten DNA- Bereiches und auch außerhalb der amplifizierten flankierenden Genbereiche binden. The excision of pK19 mobsacB took place in a second recombination event over the now duplicate DNA regions, in which the gene to be deleted from the chromosome was ultimately exchanged for the inserted deletion fragment. For this purpose, cells which showed the phenotype described (kanamycin-resistant, sucrose-sensitive) were incubated in a test tube with 3 ml of BHI medium (without addition of kanamycin) for 3 hours at 30 ° C. and 170 RPM. Subsequently, 100 μl of a 1:10 dilution were spread on BHI-Kan 25 plates and BHI-10% sucrose (w / v) plates and incubated at 30 ° C. overnight. A total of 50 of the clones grown on the BHI 10% sucrose (w / v) plate were selected and streaked to check the successful excision of pK19 mobsacB on BHI-Kan 25 and BHI 10% sucrose (w / v) and overnight at 30 ° C incubated. If the plasmid has been completely removed, this is shown by a sensitivity to kanamycin and a resistance to sucrose of the respective clone. In addition to the desired gene deletion, the second recombination event (excision) can also lead to the restoration of the wild-type situation. The successful deletion in the clones obtained after excision was checked via the expected fragment size upon deletion of the gene or gene cluster by means of colony PCR of the clones obtained. The primers del-cg1226-s / del-cg1226-as used were selected so that they bind in the chromosome outside the deleted DNA area and also outside the amplified flanking gene areas.
Verwendete Primer up-cg1226-s: CACAAGCTT CCACACG AT G AAAAT CAAT CCGCAG up-cg1226-as: TG CG GT AC CCT CG CAT ATG ATATCT CG AG AG CT AATT Primers used up-cg1226-s: CACAAGCTT CCACACG AT G AAAAT CAAT CCGCAG up-cg1226-as: TG CG GT AC CCT CG CAT ATG ATATCT CG AG AG CT AATT
GCCACTGGTACGT GGTT CAT G down-cg1226-s: AGCTCTCGAGATATCATATGCGAGGGTACCGCAGAC  GCCACTGGTACGT GGTT CAT G down-cg1226-s: AGCTCTCGAGATATCATATGCGAGGGTACCGCAGAC
CTACCACGCTTCGAGGTATAAACGCTC down-cg1226-as: AGT GAATT CCAAGGAAGGCGGTTGCTACTGC del-cg01226-s: T AAAT G GTG G AG AT AC C AAACT GT G AAG C del-cg1226-as: CG AGTT CTT CTTCGT GTT CGCGAT C univ: CGCCAGGGTTTTCCCAGTCACGAC rsp: C AC AG G AAAC AG CTAT G AC CAT G  CTACCACGCTTCGAGGTATAAACGCTC down-cg1226-as: AGT GAATT CCAAGGAAGGCGGTTGCTACTGC del-cg01226-s: T AAAT G GTG G AG AT AC C AAACT GT G AAG C del-cg1226-as: CG AGTT CTT CTTCGTGGTTACTCCGCCCTCGCACCG AG G AAAC AG CTAT G AC CAT G
Codonoptimierunq heteroloqer Gene in coryneformen Bakterienzellen Codon optimization of heterologous genes in coryneform bacterial cells
Die Etablierung synthetischer Biosynthesewege, wie der Synthese von Polyphenolen oder Polyketiden, aus Pflanzen in coryneformen Bakterienzellen erfordert eine heterologe Expres sion der erforderlichen pflanzlichen Gene. Es ist bekannt, dass verschiedene Spezies Vari anten des universellen genetischen Codes mit unterschiedlicher Häufigkeit verwenden, was letztendlich auf unterschiedliche tRNA-Konzentrationen innerhalb der Zelle zurückzuführen ist. Man spricht in diesem Fall von Codonverwendung (engl. Codon Usage). Selten verwen dete Codons können die Translation ausbremsen, während häufiger genutzte Codons die Translation beschleunigen können. Dies führt dazu, dass heterologe Gene mit Codonver wendung spezifisch für den Zielorganismus synthetisiert werden. Hierzu wird die Aminosäu resequenz des heterologen Proteins von Interesse in die DNA-Sequenz mit spezifischer Co donverwendung umgeschrieben. Für C. glutamicum ist eine Datenbank über die Codonver wendung verfügbar unter http://www.kazusa.or.ip/codon/cqi- bin/showcodon.cqi?species=196627&aa=1 &style=N. Establishing synthetic biosynthetic pathways, such as the synthesis of polyphenols or polyketides, from plants in coryneform bacterial cells requires a heterologous expression of the required plant genes. It is known that different species use variants of the universal genetic code with different frequencies, which is ultimately due to different tRNA concentrations within the cell. In this case, one speaks of codon usage. Rarely used codons can slow down translation, while more frequently used codons can speed up translation. As a result, heterologous genes with codon use are synthesized specifically for the target organism. For this purpose, the amino acid sequence of the heterologous protein of interest is rewritten into the DNA sequence with specific codon usage. For C. glutamicum, a database on codon usage is available at http: //www.kazusa.or.ip/codon/cqi- bin / showcodon.cqi? Species = 196627 & aa = 1 & style = N.
Expression der Gene aroH und tal in coryneformen Bakterienzellen Expression of the aroH and tal genes in coryneform bacterial cells
Konstruktion des Plasmids pEKEx3-aroH£c-fa/F7 Um die Synthese von pflanzlichen Polyphenolen ohne Supplementation der Polyphenol- Vorstufe p-Cumarsäure in corynformen Bakterien vornehmen zu können, also für die Syn- these von pflanzlichen Polyphenolen aus Glukose, werden zwei weitere Gene benötigt (Kallscheuer et al., 2016; https://doi.Org/10.1016/j.ymben.2016.06.003). Dies sind die Gene kodierend für eine feedback-resistente 3-Deoxy-D-Arabinoheptulosonat-7-Phosphat- Synthase (aroH), bevorzugt aus E. coli ( aroHEc ), sowie für eine Tyrosinammonium-Lyase (tal), bevorzugt aus Flavobacertium johnsoniae (talFj). Construction of plasmid pEKEx3-aroH £ c -fa / F7 In order to be able to carry out the synthesis of plant polyphenols in corynform bacteria without supplementing the polyphenol precursor p-cumaric acid, i.e. for the synthesis of plant polyphenols from glucose, two additional genes are required (Kallscheuer et al., 2016; https: / /doi.Org/10.1016/j.ymben.2016.06.003). These are the genes coding for a feedback-resistant 3-deoxy-D-arabinoheptulosonate-7-phosphate synthase (aroH), preferably from E. coli (aroH Ec ), and for a tyrosine ammonium lyase (tal), preferably from flavobacertium johnsoniae (valley fj ).
Für die Konstruktion des Plasmids pEKEx3-aro/-/Ec-fa/Fy (Figur 17) wird wie folgt vorgegan- gen: The construction of the plasmid pEKEx3-aro / - / Ec -fa / Fy (FIG. 17) is carried out as follows:
Zur Konstruktion des Plasmides pEKEx3-aro/-/Ec-fa/Fycgfür die Expression der Gene aroH aus E. coli (aroHEc) und einer für C. glutamicum codon-optimierten Variante des tal- Gens aus Flavobacterium johnsoniae ( talFJCg ) werden die beiden Gene per PCR amplifiziert. Für die aro/-/Ec-Amplifikation per PCR wird genomische DNA von E. coli isoliert und mit dem Primer- paar aroHEc-s / aroHEc-as, welches spezifisch an das für das aroHEc- Gen ist, amplifiziert. Das für C. glutamicum codon-optimierte talFjC8- Gen wird von GeneArt Gene Synthesis (Thermo Fisher Scientific) chemisch als String DNA Fragment synthetisiert und als DNA- Template für die Amplifikation von talFJCg mit dem Primerpaar talFj-s / talFj-as verwendet. Die Überprüfung der generierten DNA-Fragmente auf die erwartete Basenpaargröße wird mittels gelelektrophoretischer Analyse auf einem 1 % Agarosegel durchgeführt. Für die Konstruktion des Plasmides pEKEx3-aro/-/£c-fa/fyCg wird das Plasmid pEKEx3 mit den FastDigest- Varianten (Thermo Fisher Scientific) der Restriktionsenzyme BamH\ und EcoRI linearisiert. Die mit den gegebenen Primerpaaren amplifizierten Gene aroHEc bzw. talFjCg werden mit den Restriktionsenzymen ßa/nHI und Sapl bzw. Sapl und EcoRI hydrolysiert. Die Restriktionsan- sätze der genannten Fragmente werden mit dem NucleoSpin Gel and PCR Clean-up- Kit (Macherey-Nagel, Düren) gereinigt. Für die Ligation der hydrolysierten DNA-Fragmente mit- tels Rapid DNA Ligation- Kit (Thermo Fisher Scientific) werden die beiden Inserts aroHEc und talFjCg in einem dreifachen molaren Überschuss gegenüber dem linearisierten Vektorrückgrat pEKEx3 eingesetzt. Nach erfolgter Ligation der Fragmente werden das gesamte Ansatzvo- lumen für die Transformation chemisch kompetenter E. coli DH5a-Zellen mittels Hitzeschock bei 42 °C für 90 Sekunden verwendet. Im Anschluss an den Hitzeschock werden die Zellen 90 Sekunden auf Eis regeneriert bevor diese mit 800 pL LB-Medium versehen werden und bei 37 °C in einem Thermomixer (Eppendorf, Hamburg) bei 900 RPM für 60 Minuten regene- riert werden. Im Anschluss wurden 100 pL der Zellsuspension auf LB-Agarplatten mit Specti- nomycin (100 pg/ml) ausgestrichen und über Nacht bei 37 °C inkubiert. Die korrekte As- semblierung der eingesetzten Fragmente in den gewachsenen Transformanden wird mittels Kolonie-PCR überprüft. Hierfür wird der 2x DreamTaq Green PCR Master Mix (ThermoFis- her Scientific Inc., Waltham, MA, USA) verwendet. Die DNA-Matrize wurde dem PCR-Ansatz hierbei durch das Hinzufügen von Zellen der gewachsenen Kolonien beigesetzt. Durch den initialen Denaturierungsschritt des PCR-Protokolls bei 95 °C für 3 Minuten werden die Zellen lysiert, sodass die DNA-Matrize freigesetzt wird und für die DNA-Polymerase zugänglich ist. Als DNA-Primer für die Kolonie-PCR wird das Primerpaar chk_pEKEx3_s / chk_pEKEx3_as verwendet, welches spezifisch an das pEKEx3-Vektorrückgrat bindet und im Falle einer korrekten Ligation der eingesetzten Fragmente ein PCR-Produkt spezifischer Größe bildet, wel- ches per Gelelektrophorese überprüft wird. Klone, deren PCR-Produkt auf eine korrekte Assemblierung des Plasmides pEKEx3 -aroHEc-talFjcg hindeutet, wurden über Nacht in LB- Medium mit Spectinomycin (100 pg/mL) für die Isolierung der Plasmide angezogen. Die Plasmide werden anschließend mit dem NucleoSpin Plasmid (NoLid)-Kti (Macherey-Nagel, Düren) isoliert und mit den genannten Amplifizierungs-und Kolonie-PCR-Primern sequen- ziert. Das Plasmid ist in Figur 1 dargestellt. For the construction of the plasmid pEKEx3-aro / - / Ec -fa / Fy c g for the expression of the genes aroH from E. coli (aroH Ec ) and a variant of the tal gene from Flavobacterium johnsoniae (tal FJCg ) the two genes are amplified by PCR. For aro / - / Ec amplification by PCR, genomic DNA from E. coli is isolated and amplified with the primer pair aroHEc-s / aroHEc-as, which is specific to that for the aroH Ec gene. The tal FjC8 gene, codon-optimized for C. glutamicum, is chemically synthesized by GeneArt Gene Synthesis (Thermo Fisher Scientific) as a string DNA fragment and used as a DNA template for the amplification of tal FJCg with the primer pair talFj-s / talFj-as . The generated DNA fragments are checked for the expected base pair size using gel electrophoretic analysis on a 1% agarose gel. For the construction of the plasmid pEKEx3-aro / - / £ c -fa / fyCg , the plasmid pEKEx3 is linearized with the FastDigest variants (Thermo Fisher Scientific) of the restriction enzymes BamH \ and EcoRI. The genes aroH Ec or tal FjCg amplified with the given primer pairs are hydrolyzed with the restriction enzymes βa / nHI and Sapl or Sapl and EcoRI. The restriction mixtures of the fragments mentioned are cleaned using the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren). For the ligation of the hydrolyzed DNA fragments using the Rapid DNA Ligation Kit (Thermo Fisher Scientific), the two inserts aroH Ec and tal FjCg are used in a three-fold molar excess compared to the linearized vector backbone pEKEx3. After the fragments have been ligated, the entire batch volume is used for the transformation of chemically competent E. coli DH5a cells by means of heat shock at 42 ° C. for 90 seconds. Following the heat shock, the cells are regenerated on ice for 90 seconds before they are provided with 800 pL LB medium and regenerated at 37 ° C in a thermomixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes. Subsequently, 100 pL of the cell suspension were spread on LB agar plates with spectonomycin (100 pg / ml) and incubated at 37 ° C. overnight. The correct assembly of the fragments used in the grown transformants is checked by colony PCR. The 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) is used for this. The DNA template was the PCR approach buried here by adding cells of the grown colonies. The cells are lysed by the initial denaturation step of the PCR protocol at 95 ° C. for 3 minutes, so that the DNA template is released and is accessible to the DNA polymerase. The primer pair chk_pEKEx3_s / chk_pEKEx3_as is used as the DNA primer for the colony PCR. It binds specifically to the pEKEx3 vector backbone and, if the fragments used are correctly ligated, forms a PCR product of a specific size, which is checked by gel electrophoresis. Clones whose PCR product indicated a correct assembly of the plasmid pEKEx3 -aroH Ec -tal Fj c g were grown overnight in LB medium with spectinomycin (100 pg / mL) for the isolation of the plasmids. The plasmids are then isolated with the NucleoSpin Plasmid (NoLid) -Kti (Macherey-Nagel, Düren) and sequenced with the aforementioned amplification and colony PCR primers. The plasmid is shown in Figure 1.
Verwendete Primer: Primers used:
aroHEc-s: CT CGGATCCAAGGAGGT CATAT CAT GAACAGAACGACGAA aroHEc-s: CT CGGATCCAAGGAGGT CATAT CAT GAACAGAACGACGAA
CTCCGTACTGCGCGTATTG  CTCCGTACTGCGCGTATTG
aroHEc-as: TACGCTCTTCTGATTTAGAAGCGGGTATCTACCGCAGAGGCGAG talFj-s: TTCGCT CTT CAAT CT GGCAAGG AGGG AT CCGTAT G AACACCAT CA aroHEc-as: TACGCTCTTCTGATTTAGAAGCGGGTATCTACCGCAGAGGCGAG talFj-s: TTCGCT CTT CAAT CT GGCAAGG AGGG AT CCGTAT G AACACCAT CA
ACGAATACCTGTCCCTGGAAG  ACGAATACCTGTCCCTGGAAG
talFj-as: AT CG AATT CTTAGTTGTTG AT C AG GTG ATC CTT C ACCTT CTG C AC chk_pEKEx3_s: GC AAAT ATT CT G AAAT G AG CTGTT G AC AATT AAT CAT C talFj-as: AT CG AATT CTTAGTTGTTG AT C AG GTG ATC CTT C ACCTT CTG C AC chk_pEKEx3_s: GC AAAT ATT CT G AAAT G AG CTGTT G AC AATT AAT CAT C
chk_pEKEx3_as: C GTTCT G ATTT AAT CTGTAT C AG G CT G AAAAT CTTCTC chk_pEKEx3_as: C GTTCT G ATTT AAT CTGTAT C AG G CT G AAAAT CTTCTC
Expression heteroloqer Gene für die Synthese von Polyphenolen oder Polyketiden in coryne- formen Bakterienzellen Expression of heterologous genes for the synthesis of polyphenols or polyketides in coryne-shaped bacterial cells
Konstruktion pMKEx2 _stsAh_4clPc Construction pMKEx2 _sts Ah _4cl Pc
Zur Konstruktion des Plasmides pMKEx2_sfs^_4c/Pc (Figur 18) für die Expression der Gene sfs aus Arachis hypogea ( stsAh ) und 4cl aus Petroselinum crispum ( 4dPc ) wurden die beiden Gene als für C. glutamicum codon-optimierte Genvarianten von GeneArt Gene Synthesis (Thermo Fisher Scientific) chemisch als String DNA Fragment synthetisiert und als DNA- Template für die Amplifikation per PCR verwendet. Die Gene stsAh und 4clPc wurden per PCR mit dem Primerpaar stsAh-s / stsAh-as bzw. 4clPc-s / 4clPc-as, welches spezifisch für das jeweilige Gen ist, amplifiziert. Die Überprüfung der generierten DNA-Fragmente auf die erwartete Basenpaargröße wurde mittels gelelektrophoretischer Analyse auf einem 1 % Aga- rosegel durchgeführt. Für die Konstruktion des Plasmides pMKEx2 _stsAh_4clPc wurde das Plasmid pMKEx2 mit den FastDigestA/ arianten (Thermo Fisher Scientific) der Restriktions- enzyme Nco\ und ßamHI linearisiert. Die mit den gegebenen Primerpaaren amplifizierten Gene stsAh und 4clPc wurden mit den Restriktionsenzymen L/col und Kpn\ bzw. Kpn\ und ßamHI hydrolysiert. Die Restriktionsansätze der genannten Fragmente wurden mit dem Nu- cleoSpin Gel and PCR Clean-up- Kit (Macherey-Nagel, Düren) gereinigt. Für die Ligation der hydrolysierten DNA-Fragmente mittels Rapid DNA Ligation- Kit (Thermo Fisher Scientific) wurden die beiden Inserts stsAh und 4clPc in einem dreifachen molaren Überschuss gegen- über dem linearisierten Vektorrückgrat pMKEx2 eingesetzt. Nach erfolgter Ligation der Fragmente wurden das gesamte Ansatzvolumen für die Transformation chemisch kompeten- ter E. coli DH5a-Zellen mittels Hitzeschock bei 42 °C für 90 Sekunden verwendet. Im An- schluss an den Hitzeschock wurden die Zellen 90 Sekunden auf Eis regeneriert bevor diese mit 800 pL LB-Medium versehen worden und bei 37 °C in einem Thermomixer (Eppendorf, Hamburg) bei 900 RPM für 60 Minuten regeneriert worden sind. Im Anschluss wurden 100 pL der Zellsuspension auf LB-Agarplatten mit Kanamycin (50 pg/ml) ausgestrichen und über Nacht bei 37 °C inkubiert. Die korrekte Assemblierung der eingesetzten Fragmente in den gewachsenen Transformanden wurde mittels Kolonie-PCR überprüft. Hierfür wurde der 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) ver- wendet. Die DNA-Matrize wurde dem PCR-Ansatz hierbei durch das Hinzufügen von Zellen der gewachsenen Kolonien beigesetzt. Durch den initialen Denaturierungsschritt des PCR- Protokolls bei 95 °C für 3 Minuten werden die Zellen lysiert, sodass die DNA-Matrize freige- setzt wurde und für die DNA-Polymerase zugänglich war. Als DNA-Primer für die Kolonie- PCR wurde das Primerpaar chk_pMKEx2_s / chk_pMKEx2_as verwendet, welches spezi- fisch an das pMKEx2-Vektorrückgrat bindet und im Falle einer korrekten Ligation der einge- setzten Fragmente ein PCR-Produkt spezifischer Größe bildet, welches per Gelelektropho- rese überprüft wurde. Klone, deren PCR-Produkt auf eine korrekte Assemblierung des Plas- mides pMKEx2 _stsAh_4clPc hindeutet, wurden über Nacht in LB-Medium mit Kanamycin (50 gg/mL) für die Isolierung der Plasmide angezogen. Die Plasmide wurden anschließend mit dem NucleoSpin Plasmid (NoLid)-K\t (Macherey-Nagel, Düren) isoliert und mit den genannten Amplifizierungs-und Kolonie-PCR-Primern sequenziert. To construct the plasmid pMKEx2_sfs ^ _4c / Pc (FIG. 18) for the expression of the genes sfs from Arachis hypogea (sts Ah ) and 4cl from Petroselinum crispum (4d Pc ), the two genes were used as gene variants of GeneArt codon-optimized for C. glutamicum Gene Synthesis (Thermo Fisher Scientific) chemically synthesized as a string DNA fragment and used as a DNA template for amplification by PCR. The genes sts Ah and 4cl Pc were amplified by PCR with the primer pair stsAh-s / stsAh-as and 4clPc-s / 4clPc-as, which is specific for the respective gene. The generated DNA fragments were checked for the expected base pair size using gel electrophoretic analysis on a 1% agarose gel. For the construction of the plasmid pMKEx2 _sts Ah _4cl Pc , the plasmid pMKEx2 was linearized with the FastDigestA / variants (Thermo Fisher Scientific) of the restriction enzymes Nco \ and ßamHI. The sts Ah and 4cl Pc genes amplified with the given primer pairs were hydrolyzed with the restriction enzymes L / col and Kpn \ or Kpn \ and ßamHI. The restriction approaches of the fragments mentioned were cleoSpin Gel and PCR Clean-up-Kit (Macherey-Nagel, Düren) cleaned. For the ligation of the hydrolyzed DNA fragments using a Rapid DNA Ligation Kit (Thermo Fisher Scientific), the two inserts sts Ah and 4cl Pc were used in a three-fold molar excess compared to the linearized vector backbone pMKEx2. After ligation of the fragments, the entire batch volume was used for the transformation of chemically competent E. coli DH5a cells by means of heat shock at 42 ° C. for 90 seconds. Following the heat shock, the cells were regenerated on ice for 90 seconds before they were provided with 800 pL LB medium and regenerated at 37 ° C. in a thermomixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes. Subsequently, 100 pL of the cell suspension were spread on LB agar plates with kanamycin (50 pg / ml) and incubated at 37 ° C. overnight. The correct assembly of the fragments used in the grown transformants was checked by colony PCR. The 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this. The DNA template was added to the PCR approach by adding cells from the grown colonies. The cells were lysed by the initial denaturation step of the PCR protocol at 95 ° C. for 3 minutes, so that the DNA template was released and was accessible to the DNA polymerase. The primer pair chk_pMKEx2_s / chk_pMKEx2_as was used as the DNA primer for the colony PCR. rese was checked. Clones whose PCR product indicated correct assembly of the plasmid pMKEx2 _sts Ah _4cl Pc were grown overnight in LB medium with kanamycin (50 gg / mL) for the isolation of the plasmids. The plasmids were then isolated with the NucleoSpin Plasmid (NoLid) -K \ t (Macherey-Nagel, Düren) and sequenced with the amplification and colony PCR primers mentioned.
Verwendete Primer stsAh-s: ATACCATGGTAAGGAGGACAGCTATGGTGTCCGTGTCCGGCATC stsAh-as: CTCG GT ACCTTT AG ATT G C CAT AG AG CG C AG C ACC AC Primers used stsAh-s: ATACCATGGTAAGGAGGACAGCTATGGTGTCCGTGTCCGGCATC stsAh-as: CTCG GT ACCTTT AG ATT G C CAT AG AG CG C AG C ACC AC
4clPc-s: AGCGGTACCT AAG GAG GT GG AC AAT G G G CG ATT G C GT GG C AC 4clPc-s: AGCGGTACCT AAG GAG GT GG AC AAT G G G CG ATT G C GT GG C AC
4clPc-as: CT GGGATCCAGGACTAGTTT CCAGAGT ACT ATT ACTTT GGCA 4clPc-as: CT GGGATCCAGGACTAGTTT CCAGAGT ACT ATT ACTTT GGCA
GATCACCGGATGCGATC chk_pMKEx2-s: CCCTCAAGACCCGTTTAGAGGC chk_pMKEx2-as: TTAAT ACGACT CACT AT AGGGG AATT GT G AGC GATCACCGGATGCGATC chk_pMKEx2-s: CCCTCAAGACCCGTTTAGAGGC chk_pMKEx2-as: TTAAT ACGACT CACT AT AGGGG AATT GT G AGC
Konstruktion pNlKEX2-chsPh-chiPh Construction pNlKEX2-chs Ph -chi Ph
Zur Konstruktion des Plasmides pMKEX2-chsPh-cbiPh (Figur 19) für die Expression der Gene chs und chi aus Petunia x hybrida ( chsPh und chiPh) wurden die beiden Gene als für C. glu- tamicum codon-optimierte Genvarianten von GeneArt Gene Synthesis (Thermo Fisher Scientific) chemisch als String DNA Fragment synthetisiert und als DNA-Template für die Ampli fikation per PCR verwendet. Die chsPh und chiPh wurden per PCR mit dem Primerpaar chsPh-s / chsPh-as bzw. chiPh-s / chiPh-as, welches spezifisch für das jeweilige Gen ist, amplifiziert. Die Überprüfung der generierten DNA-Fragmente auf die erwartete Basenpaar größe wurde mittels gelelektrophoretischer Analyse auf einem 1 % Agarosegel durchgeführt. Für die Konstruktion des Plasmides pMKEX2-chsPh-chiPh wurde das Plasmid pMKEx2 mit den FastDigest-V arianten (Thermo Fisher Scientific) der Restriktionsenzyme Xba\ und Bam- Hl linearisiert. Die mit den gegebenen Primerpaaren amplifizierten Gene chsPh und chiPh wurden mit den Restriktionsenzymen Xba\ und L/col bzw. Nco\ und ßamHI hydrolysiert. Die Restriktionsansätze der genannten Fragmente wurden mit dem NucleoSpin Gel and PCR Clean-up- Kit (Macherey-Nagel, Düren) gereinigt. Für die Ligation der hydrolysierten DNA- Fragmente mittels Rapid DNA Ligation- Kit (Thermo Fisher Scientific) wurden die beiden In- serts chsPh und chiPh in einem dreifachen molaren Überschuss gegenüber dem linearisierten Vektorrückgrat pMKEx2 eingesetzt. Nach erfolgter Ligation der Fragmente wurden das gesamte Ansatzvolumen für die Transformation chemisch kompetenter E. coli DH5a-Zellen mittels Hitzeschock bei 42 °C für 90 Sekunden verwendet. Im Anschluss an den Hitzeschock wurden die Zellen 90 Sekunden auf Eis regeneriert bevor diese mit 800 pL LB-Medium ver- sehen worden und bei 37 °C in einem Thermomixer (Eppendorf, Hamburg) bei 900 RPM für 60 Minuten regeneriert worden sind. Im Anschluss wurden 100 pL der Zellsuspension auf LB-Agarplatten mit Kanamycin (50 pg/ml) ausgestrichen und über Nacht bei 37 °C inkubiert. Die korrekte Assemblierung der eingesetzten Fragmente in den gewachsenen Transforman- den wurde mittels Kolonie-PCR überprüft. Hierfür wurde der 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) verwendet. Die DNA-Matrize wurde dem PCR-Ansatz hierbei durch das Hinzufügen von Zellen der gewachsenen Kolonien beigesetzt. Durch den initialen Denaturierungsschritt des PCR-Protokolls bei 95 °C für 3 Minuten werden die Zellen lysiert, sodass die DNA-Matrize freigesetzt wurde und für die DNA- Polymerase zugänglich war. Als DNA-Primer für die Kolonie-PCR wurde das Primerpaar chk_pMKEx2_s / chk_pMKEx2_as verwendet, welches spezifisch an das pMKEx2- Vektorrückgrat bindet und im Falle einer korrekten Ligation der eingesetzten Fragmente ein PCR-Produkt spezifischer Größe bildet, welches per Gelelektrophorese überprüft wurde. Klone, deren PCR-Produkt auf eine korrekte Assemblierung des Plasmides pMKEx2_ chsPh und chiph hindeutet, wurden über Nacht in LB-Medium mit Kanamycin (50 pg/mL) für die Iso- lierung der Plasmide angezogen. Die Plasmide wurden anschließend mit dem NucleoSpin Plasmid (NoLid)-K\t (Macherey-Nagel, Düren) isoliert und mit den genannten Amplifizie- rungs-und Kolonie-PCR-Primern sequenziert. To construct the plasmid pMKEX2-chs Ph -cbi Ph (FIG. 19) for the expression of the genes chs and chi from Petunia x hybrida (chs Ph and chi Ph ), the two genes were used as gene variants codon-optimized for C. glutamicum GeneArt Gene Synthesis (Thermo Fisher Scientific) chemically synthesized as a string DNA fragment and used as a DNA template for amplification by PCR. The chs Ph and chi Ph were amplified by PCR with the primer pair chsPh-s / chsPh-as and chiPh-s / chiPh-as, which is specific for the respective gene. The generated DNA fragments were checked for the expected base pair size by means of gel electrophoretic analysis on a 1% agarose gel. For the construction of the plasmid pMKEX2-chs Ph -chi Ph , the plasmid pMKEx2 was linearized with the FastDigest variants (Thermo Fisher Scientific) of the restriction enzymes Xba \ and Bam-Hl. The genes chs Ph and chi Ph amplified with the given primer pairs were hydrolyzed with the restriction enzymes Xba \ and L / col or Nco \ and ßamHI. The restriction mixtures of the fragments mentioned were cleaned using the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren). For the ligation of the hydrolyzed DNA fragments using a Rapid DNA Ligation Kit (Thermo Fisher Scientific), the two inserts chs Ph and chi Ph were used in a three-fold molar excess compared to the linearized vector backbone pMKEx2. After ligation of the fragments, the entire batch volume was used for the transformation of chemically competent E. coli DH5a cells by means of heat shock at 42 ° C. for 90 seconds. Following the heat shock, the cells were regenerated on ice for 90 seconds before they were provided with 800 pL LB medium and regenerated at 37 ° C. in a thermomixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes. Subsequently, 100 pL of the cell suspension were spread on LB agar plates with kanamycin (50 pg / ml) and incubated at 37 ° C. overnight. The correct assembly of the fragments used in the grown transformants was checked by colony PCR. The 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this. The DNA template was added to the PCR approach by adding cells from the grown colonies. The cells are lysed by the initial denaturation step of the PCR protocol at 95 ° C. for 3 minutes, so that the DNA template was released and was accessible to the DNA polymerase. The primer pair chk_pMKEx2_s / chk_pMKEx2_as was used as DNA primer for the colony PCR, which binds specifically to the pMKEx2 vector backbone and, if the fragments used are correctly ligated, is included PCR product of specific size, which was checked by gel electrophoresis. Clones whose PCR product indicated a correct assembly of the plasmid pMKEx2_ chs Ph and chip h were grown overnight in LB medium with kanamycin (50 pg / mL) for the isolation of the plasmids. The plasmids were then isolated with the NucleoSpin Plasmid (NoLid) -K \ t (Macherey-Nagel, Düren) and sequenced with the amplification and colony PCR primers mentioned.
Verwendete Primer chsPh-s: GT AT CT AGAAAGG AGGT CG AAG ATGGT GACCGT GGAAG AAT AC Primer chsPh-s used: GT AT CT AGAAAGG AGGT CG AAG ATGGT GACCGT GGAAG AAT AC
CGCAAG chsPh-as: CTCCCATGGTTAGGTTGCCACGGAGTGCAGCAC chiPh-s: CT CCCATGGTGCT AAAGGAGGT CGAAGAT GTCCCCACCAGT G  CGCAAG chsPh-as: CTCCCATGGTTAGGTTGCCACGGAGTGCAGCAC chiPh-s: CT CCCATGGTGCT AAAGGAGGT CGAAGAT GTCCCCACCAGT G
TCCGTGACCAAG chiPh-as: CT GGGAT CCTTACACGCCGAT CACT GGGATGGT G chk_pMKEx2-s: CCCTCAAGACCCGTTTAGAGGC chk_pMKEx2-as: TT AAT ACG ACT CACT AT AGGGG AATT GT G AGC  TCCGTGACCAAG chiPh-as: CT GGGAT CCTTACACGCCGAT CACT GGGATGGT G chk_pMKEx2-s: CCCTCAAGACCCGTTTAGAGGC chk_pMKEx2-as: TT AAT ACG ACT CACT AT AGGGG AATT GT G AGC
Expression der erfindunqsqemäßen Polyketidsynthase PCS in Bakterienzellen Expression of the polyketide synthase PCS in accordance with the invention Bacterial cells
Konstruktion pMKEx2-pcsAa und pMKEx2-pcsAa-short Construction pMKEx2-pcsAa and pMKEx2-pcsAa-short
Zur Konstruktion der Plasmide pMKEx2 _pcsAa (Figur 20) und pMKEx2 ^cs^-short (Figur 21 ) für die Expression der Genvarianten von pcs aus Aloe arborescens ( pcsAa ) wurde das Gen als für C. glutamicum codon-optimierte Genvariante von GeneArt Gene Synthesis (Thermo Fisher Scientific) chemisch als String DNA Fragment synthetisiert und als DNA-Template für die Amplifikation per PCR verwendet. Das pcsAa- Gen wurde per PCR mit dem Primerpaar Gibson-PCS-s / Gibson-PCS-as bzw. Gibson-PCS-short-s / Gibson-PCS-as amplifiziert, um so die native als auch die verkürzte pcsAa- Sequenz zu generieren. For the construction of the plasmids pMKEx2 _pcs Aa (FIG. 20) and pMKEx2 ^ cs ^ -short (FIG. 21) for the expression of the gene variants of pcs from Aloe arborescens (pcs Aa ), the gene was used as gene variant of C. glutamicum codon-optimized by GeneArt Gene Synthesis (Thermo Fisher Scientific) chemically synthesized as a string DNA fragment and used as a DNA template for amplification by PCR. The pcs Aa gene was amplified by PCR with the primer pair Gibson-PCS-s / Gibson-PCS-as or Gibson-PCS-short-s / Gibson-PCS-as in order to determine the native and the shortened pcs Aa - Generate sequence.
Die Überprüfung der generierten DNA-Fragmente auf die erwartete Basenpaargröße wurde mittels gelelektrophoretischer Analyse auf einem 1 % Agarosegel durchgeführt und an- schließend mit dem NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) nach dem beiliegenden Protokoll gereinigt. Für die Konstruktion der Expressionsplasmide wurde das Plasmid pMKEx2 -stsAh-4dPc mit der FastDigestA/ ariante (Thermo Fisher Scientific) der Restriktionsenzyme Nco\ und Seal linearisiert. Der Restriktionsansatz wurde auf einem 1 % Agarosegel getrennt. Das erwartete Fragment des Vektorrückgrats wurde mit dem Nucleo- Spin Gel and PCR Clean-up- Kit (Macherey-Nagel, Düren) aus dem Gel gereinigt. Für die Assemblierung der DNA-Fragmente mittels Gibson Assembly (Gibson et al., 2009a) wurde je eines amplifzierten Fragmente ( csAa bzw. pcsAa- short) in einem dreifachen molaren Über schuss gegenüber dem linearisierten Vektorrückgrat pMKEx2 eingesetzt. Die DNA- Fragmente wurde mit einem vorbereiten Gibson Assembly Master Mix versehen, der neben einem isothermalen Reaktionspuffer die für die Assemblierung benötigten Enzyme (T5- Exonuklease, Phusion DNA Polymerase und Taq DNA Ligase) beeinhaltet. Die Assemblie rung der Fragmente wird bei 50 °C für 60 Minuten in einem Thermocycler durchgeführt. Nach erfolgter Assemblierung der Fragmente wurden das gesamte Ansatzvolumen für die Trans formation chemisch kompetenter E. coli DH5oc-Zellen mittels Hitzeschock bei 42 °C für 90 Sekunden verwendet. Im Anschluss an den Hitzeschock wurden die Zellen 90 Sekunden auf Eis regeneriert bevor diese mit 800 mI_ LB-Medium versehen worden und bei 37 °C in einem Thermomixer (Eppendorf, Hamburg) bei 900 RPM für 60 Minuten regeneriert worden sind. Im Anschluss wurden 100 mI_ der Zellsuspension auf LB-Agarplatten mit Kanamycin (50 pg/ml) ausgestrichen und über Nacht bei 37 °C inkubiert. Die korrekte Assemblierung der Expressionsplasmide in den gewachsenen Transformanden wurde mittels Kolonie-PCR überprüft. Hierfür wurde der 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) verwendet. Die DNA-Matrize wurde dem PCR-Ansatz hierbei durch das Hinzufügen von Zellen der gewachsenen Kolonien beigesetzt. Durch den initialen Dena turierungsschritt des PCR-Protokolls bei 95 °C für 3 Minuten werden die Zellen lysiert, so- dass die DNA-Matrize freigesetzt wurde und für die DNA-Polymerase zugänglich war. Als DNA-Primer für die Kolonie-PCR wurde das Primerpaar chk_pMKEx2_s / chk_pMKEx2_as verwendet, welches spezifisch an das pMKEx2-Vektorrückgrat bindet und im Falle einer korrekten Assemblierung der eingesetzten Fragmente ein PCR-Produkt spezifischer Größe bil det, welches per Gelelektrophorese überprüft wurde. Klone, deren PCR-Produkt auf eine korrekte Assemblierung der Expressionsplasmide Konstruktion rMKEc2-ro5L3 und pMKEx2- pcsAa- short hindeutet, wurden über Nacht in LB-Medium mit Kanamycin (50 pg/mL) für die Isolierung der Plasmide angezogen. Die Plasmide wurden anschließend mit dem NucleoSpin Plasmid (NoLid)-KW (Macherey-Nagel, Düren) isoliert und mit den genannten Amplifizie- rungs-und Kolonie-PCR-Primern sequenziert. The DNA fragments were checked for the expected base pair size using gel electrophoretic analysis on a 1% agarose gel and then cleaned using the NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren) according to the enclosed protocol. For the construction of the expression plasmids, the plasmid pMKEx2 -sts Ah -4d Pc with the FastDigestA / ariante (Thermo Fisher Scientific) was used Restriction enzymes Nco \ and Seal linearized. The restriction mixture was separated on a 1% agarose gel. The expected fragment of the vector backbone was cleaned from the gel using the Nucleo Spin Gel and PCR clean-up kit (Macherey-Nagel, Düren). For the assembly of the DNA fragments using Gibson assembly (Gibson et al., 2009a), one amplified fragment (cs Aa or pcs Aa - short) was used in a three-fold molar excess compared to the linearized vector backbone pMKEx2. The DNA fragments were provided with a prepared Gibson Assembly Master Mix, which contains an isothermal reaction buffer and the enzymes required for assembly (T5 exonuclease, phusion DNA polymerase and Taq DNA ligase). The fragments are assembled at 50 ° C. for 60 minutes in a thermal cycler. After the fragments had been assembled, the entire batch volume was used for the transformation of chemically competent E. coli DH5oc cells by means of heat shock at 42 ° C. for 90 seconds. Following the heat shock, the cells were regenerated on ice for 90 seconds before they were provided with 800 ml of LB medium and regenerated at 37 ° C. in a thermomixer (Eppendorf, Hamburg) at 900 RPM for 60 minutes. Subsequently, 100 ml of the cell suspension were spread on LB agar plates with kanamycin (50 pg / ml) and incubated at 37 ° C. overnight. The correct assembly of the expression plasmids in the grown transformants was checked by colony PCR. The 2x DreamTaq Green PCR Master Mix (ThermoFisher Scientific Inc., Waltham, MA, USA) was used for this. The DNA template was added to the PCR approach by adding cells from the grown colonies. The cells are lysed by the initial denaturation step of the PCR protocol at 95 ° C. for 3 minutes, so that the DNA template was released and was accessible to the DNA polymerase. The primer pair chk_pMKEx2_s / chk_pMKEx2_as was used as the DNA primer for the colony PCR, which binds specifically to the pMKEx2 vector backbone and, if the fragments used are correctly assembled, forms a PCR product of a specific size, which was checked by gel electrophoresis. Clones whose PCR product indicated a correct assembly of the expression plasmids construction rMKEc2-ro5 L3 and pMKEx2-pcs Aa - short were grown overnight in LB medium with kanamycin (50 pg / mL) for the isolation of the plasmids. The plasmids were then isolated using the NucleoSpin Plasmid (NoLid) KW (Macherey-Nagel, Düren) and sequenced using the amplification and colony PCR primers mentioned.
Verwendete Primer: chk_pMKEx2-s: CCCTCAAGACCCGTTTAGAGGC chk_pMKEx2-as: TT AAT ACG ACT CACT AT AGGGG AATT GT G AGC pMKEx2-pcsAa Primers used: chk_pMKEx2-s: CCCTCAAGACCCGTTTAGAGGC chk_pMKEx2-as: TT AAT ACG ACT CACT AT AGGGG AATT GT G AGC pMKEx2-pcsAa
Gibson-PCS-s: ACTTT AAG AAGGAG AT AT ACCATGGTAAGG AGGACAGCT AT -Gibson-PCS-s: ACTTT AAG AAGGAG AT AT ACCATGGTAAGG AGGACAGCT AT -
GT CCTCCTT GT CCAAC GT CCTCCTT GT CCAAC
Gibson-PCS-as: CCAGGACT AGTTT CCAG AGT ACT ATT ACAT G AGTGGCAGGGAG pMKEx2-pcsAa-short Gibson-PCS-as: CCAGGACT AGTTT CCAG AGT ACT ATT ACAT G AGTGGCAGGGAG pMKEx2-pcsAa-short
Gibson-PCS-short-s: ACTTTAAGAAGGAGATATACCATGGTAAGGAGGACAGCTATG-Gibson-PCS-short-s: ACTTTAAGAAGGAGATATACCATGGTAAGGAGGACAGCTATG-
GAAGATGTGCAGGGC GAAGATGTGCAGGGC
Gibson-PCS-as: CCAGGACT AGTTT CCAGAGTACT ATT ACAT GAGTGGCAGGGAG Gibson-PCS-as: CCAGGACT AGTTT CCAGAGTACT ATT ACAT GAGTGGCAGGGAG
Kultivierungsbedinqunqen Cultivation conditions
Sämtliche Kultivierungen von C. glutamicum zur Messung der intrazellulären Malonyl-CoA Bereitstellung oder der Synthese von Naringenin, Noreugenin und Resveratrol werden in 50 ml definiertem CGXII-Medium (Keilhauer et al., 1993) mit 4 % Glucose (w/v) in einem JRC-1- T Schüttelinkubator (Adolf Kühner AG, Birsfelden, Schweiz) durchgeführt (500 ml Schikane- kolben, 30 °C, 130RPM). Wenn angebracht, werden Selektionsantibiotika der genanntenAll cultivations of C. glutamicum for measuring the intracellular malonyl-CoA provision or the synthesis of naringenin, noreugenin and resveratrol are in 50 ml defined CGXII medium (Keilhauer et al., 1993) with 4% glucose (w / v) in one JRC-1- T shaking incubator (Adolf Kühner AG, Birsfelden, Switzerland) carried out (500 ml baffle flask, 30 ° C, 130RPM). If appropriate, selection antibiotics of the named
Konzentrationen zugefügt: Concentrations added:
Für die Kultivierung in CGXII-Medium werden die Stämme zunächst für 6-8 Stunden in 5 ml BHI-Medium ( Brain heart infusion, Difco Laboratories, Detroit, USA) in Reagenzgläsern bei 170 RPM inkubiert (erste Vorkultur) und anschließend genutzt, um 50 ml CGXII-Medium in einem 500 ml-Schikanekolben (mit zwei gegenüberliegenden Schikanen) zu beimpfen. Diese zweite Vorkultur wird bei 30 °C und 130 RPM über Nacht inkubiert. Die CGXII-Hauptkultur (50 ml in einem 500 ml-Schikanekolben) wird mit der bewachsenen zweiten Vorkultur auf eine OD600nm von 1 ,0 (Malonyl-CoA Messung) bzw. 5,0 (Produktion von Naringenin, Res- veratrol oder Noreugenin) angeimpft. Optional wird für die Synthese von Naringenin und Resveratrol zusätzlich 5 mM p-Cumarsäure (vorher gelöst in 80 mI DMSO) supplementiert.For the cultivation in CGXII medium, the strains are first incubated for 6-8 hours in 5 ml BHI medium (Brain heart infusion, Difco Laboratories, Detroit, USA) in test tubes at 170 RPM (first preculture) and then used for 50 Inoculate ml of CGXII medium in a 500 ml baffle flask (with two opposite baffles). This second preculture is incubated at 30 ° C and 130 RPM overnight. The CGXII main culture (50 ml in a 500 ml baffle flask) is grown with the overgrown second preculture to an OD 600 nm of 1.0 (malonyl-CoA measurement) or 5.0 (production of naringenin, resveratrol or noreugenin ) inoculated. For the synthesis of naringenin and resveratrol, 5 mM p-cumaric acid (previously dissolved in 80 ml DMSO) is optionally supplemented.
Die Expression heterologer Gene, die entweder chromosomal integriert sind oder plasmid basiert eingebracht wurden, wird durch Zugabe von 1 mM Isopropyl-ß-D- thiogalactopyranosid (IPTG) 90 Minuten nach Inokulum induziert. Zu den angegebenen Zeit- punkten wird 1 ml Kultur abgenommen und bei -20 °C bis zur Verwendung gelagert. Die Produktbestimmung (Malonyl-CoA oder Polyphenole oder Polyketide) erfolgt wie unten be- schrieben. Gegen Ende der Fermentation kann Resveratrol, oder Naringenin oder Noreuge- nin aus der Kultivierungslösung optinal weiter aufbereitet, d.h. abgetrennt, aufgereinigt und/oder aufkonzentriert werden. The expression of heterologous genes, which are either chromosomally integrated or introduced plasmid-based, is increased by adding 1 mM isopropyl-β-D- thiogalactopyranoside (IPTG) induced 90 minutes after inoculum. At the times indicated, 1 ml of culture is removed and stored at -20 ° C until use. The product determination (malonyl-CoA or polyphenols or polyketides) is carried out as described below. Towards the end of the fermentation, resveratrol, or naringenin or noreugenin from the cultivation solution can optionally be further processed, ie separated, purified and / or concentrated.
Die Bestimmung der Biomasse während Kultivierungen zur Messung der Malonyl-CoA Be- reitstellung oder der Produktion von Polyphenolen bzw. Polyketiden wird über die Messung der optischen Dichte bei einer Wellenlänge von 600 nm (OD6oonm) mit dem Ultrospec 3300 pro UVA/isible Spectrophotometer (Amersham Biosciences, Freiburg) durchgeführt. Hierzu werden 100 pL Probenvolumen der entsprechenden Kultivierung entnommen und so ver- dünnt, dass die gemessene OD60onm im linearen Messbereich des Photometers von 0, 2-0,6 lag. Durch Bereinigung um den Verdünnungsfaktor wird die tatsächliche OD60onm der Kultur berechnet. Sollte ein stärkerer Verdünnungsfaktor von >1 :10 (bspw. 1 :100) pipettiert werden, so wird dies sequentiell durchgeführt (Beispiel: für eine 1 :100 Verdünnung wurde zweimal 1 :10 verdünnt). The determination of the biomass during cultivation for the measurement of malonyl-CoA provision or the production of polyphenols or polyketides is carried out by measuring the optical density at a wavelength of 600 nm (OD 6 oonm) with the Ultrospec 3300 per UVA / isible spectrophotometer (Amersham Biosciences, Freiburg). For this purpose, 100 pL sample volume of the respective cultivation are removed and so comparable thinned that the measured OD 60 o n m in the linear measuring range of the photometer of 0, was from 2 to 0.6. By adjusting for the dilution factor, the actual OD 60 o n m of the culture is calculated. If a stronger dilution factor of> 1:10 (e.g. 1: 100) is pipetted, this is carried out sequentially (example: for a 1: 100 dilution, 1:10 was diluted twice).
Malonyl-CoA-Quantifizierunq mittels LC-MS/MS Malonyl-CoA quantification using LC-MS / MS
Die Probenvorbereitung für die Quantifizierung des intrazellulären Malonyl-CoA-Levels wurde wie zuvor beschrieben durchgeführt (Kallscheuer et al., 2016). 5 mL der Kultur wird in 15 ml_ eiskaltem 60% MeOH in H20 im Triplikat gequencht und anschließend zentrifugiert. Die Bestimmung der Malonyl-CoA-Konzentration erfolgt im Zell-Extrakt und im Kulturüberstand. Zusätzlich erfolgt die Analytik in den erhaltenen Überständen nach dem Quenching. Für die Überstandsproben der Kultur und nach Quenching erfolgt eine Filtration durch 0.2 pm Celluloseacetat-Filter. Vom Kulturüberstand werden 250 pL mit 750 pL 60% MeOH verdünnt, der Quenching-Überstand wurde unverdünnt verwendet. The sample preparation for the quantification of the intracellular malonyl-CoA level was carried out as previously described (Kallscheuer et al., 2016). 5 mL of the culture is quenched in 15 ml ice-cold 60% MeOH in H 2 0 in a triplicate and then centrifuged. The malonyl-CoA concentration is determined in the cell extract and in the culture supernatant. In addition, the analysis is carried out in the supernatants obtained after quenching. For the supernatant samples of the culture and after quenching, filtration is carried out through 0.2 pm cellulose acetate filter. 250 pL of the culture supernatant are diluted with 750 pL 60% MeOH, the quenching supernatant was used undiluted.
Die Quantifizierung der Malonyl-CoA-Konzentration in den erhaltene Proben (Zellextrakt, Kulturüberstand und Quenching-Überstand) erfolgt mittels LC-MS/MS-Analytik mit einem Agilent 1260 Infinity HPLC-System (Agilent Technologies, Waldbronn, Deutschland) bei 40 °C mit einer 150 * 2.1 mm Sequant ZIC-pHILIC-Säule mit 5 pm Partikelgröße und einer 20*2.1 mm-Vorsäule (Merck, Darmstadt, Germany). Die Trennung erfolgt mit 10 mM Ammoniumacetat (pH 9,2) (Puffer A) und Acetonitril (Puffer B). Vor jeder Injektion wurde die Säule für 15 min mit 90% Puffer B äquilibriert. Der folgende Gradient wird für die Trennung verwendet (Injektionsvolumen 5 pL): 0 min: 90% B, 1 min: 90% B, 10 min: 70% B, 25 min: 65 % B, 35 min: 10 % B, 45 min: 10% B, 55 min: 10% B. Die Messung erfolgt mit einem ESI- QqTOF-MS (TripleTOF 6600, AB Sciex, Darmstadt, Germany) mit einer lonDrive lonenquelle. Zur Datenanalyse dient die Software Analyst TF 1.7 (AB Sciex, Concord, ON, Canada). The malonyl-CoA concentration in the samples obtained (cell extract, culture supernatant and quenching supernatant) is quantified by means of LC-MS / MS analysis using an Agilent 1260 Infinity HPLC system (Agilent Technologies, Waldbronn, Germany) at 40 ° C with a 150 * 2.1 mm Sequant ZIC-pHILIC column with 5 pm particle size and a 20 * 2.1 mm guard column (Merck, Darmstadt, Germany). The separation is carried out with 10 mM ammonium acetate (pH 9.2) (buffer A) and acetonitrile (buffer B). Before each injection, the column was equilibrated with 90% buffer B for 15 min. The following gradient is used for the separation (injection volume 5 pL): 0 min: 90% B, 1 min: 90% B, 10 min: 70% B, 25 min: 65% B, 35 min: 10% B, 45 min: 10% B, 55 min: 10% B. The measurement is carried out with an ESI-QqTOF-MS (TripleTOF 6600, AB Sciex, Darmstadt, Germany) with an lonDrive ion source. The software analyst TF 1.7 (AB Sciex, Concord, ON, Canada) is used for data analysis.
Als Referenz erfolgt eine Quantifizierung von komplett 13C-markiertem Zellextrakt aus Escherichia coli versetzt mit 13C3-markiertem Malonyl-CoA, um eine Konzentration von ca. 12,5 mM zu erhalten (Abschätzung basierend auf dem Molekulargewicht der freien Säure). 13C3-markiertes Malonyl-CoA enthielt [U-13C3]Malonat als Kontamination (Daten nicht gezeigt), das wahrscheinlich durch spontane Hydrolyse des Thioesters entsteht. Dieses wird als interner Standard für die Malonat-Quantifizierung genutzt und die Proben wurden mit gleichen Volumina der internen Standard-Lösung versetzt. Als externe Standardreihe dienen Malonat-Standards mit Konzentrationen von 0.01 -100 mM im 50 % Me0H/H20. Eine separate externe Standardreihe für Malonyl-CoA wurde analog angesetzt. As a reference, a complete 13 C-labeled cell extract from Escherichia coli was added with 13 C3-labeled malonyl-CoA in order to obtain a concentration of approximately 12.5 mM (estimate based on the molecular weight of the free acid). 13 C3-labeled malonyl-CoA contained [U- 13 C3] malonate as contamination (data not shown), which is probably caused by spontaneous hydrolysis of the thioester. This is used as the internal standard for malonate quantification and the samples were mixed with equal volumes of the internal standard solution. Malonate standards with concentrations of 0.01-100 mM in 50% Me0H / H 2 0 serve as the external standard series. A separate external standard series for malonyl-CoA was set up analogously.
Als optimale Kollisionsenergien für die stärksten Transitionen von Malonyl-CoA (852.1 >79) und von Malonat (103>59) werden -130 eV bzw. -1 1 eV verwendet. Diese werden mithilfe der Metabolitstandards ermittelt. Während der Elution wurden die erwähnten Transitionen und die der internen Standards (855.1 >79 bzw. 106>61 ) für die Messung im MS/MS High Sensitivity Mode mit den optimalen Kollosionsenergien verwendet.  The optimal collision energies for the strongest transitions of malonyl-CoA (852.1> 79) and malonate (103> 59) are -130 eV and -1 1 eV, respectively. These are determined using the metabolite standards. During the elution, the transitions mentioned and those of the internal standards (855.1> 79 and 106> 61) were used for the measurement in the MS / MS High Sensitivity Mode with the optimal collision energies.
Für die Quantifizierung beider Metabolite wurde des 12C-13C-lsotopenverhältnis genutzt. Die Standardgerade wurde mittels linearer Regression der Isotopen-Verhältnisse und der Standardkonzentrationen ermittelt. Um den dynamischen Bereich zu ermitteln, wurden die Messsignale für die höchsten Konzentrationen entfernt, sodass R2 größer als 0.99 war. Das reduzierte Datenset wurde dann log10-transformiert, um niedrigere Konzentrationen gleichmäßig zu gewichten. In den log10-transformierten Werten werden Messsignale der niedrigsten Konzentrationen verworfen, sodass R2 größer als 0,99 war. The 12 C- 13 C isotope ratio was used to quantify both metabolites. The standard line was determined by linear regression of the isotope ratios and the standard concentrations. To determine the dynamic range, the measurement signals for the highest concentrations were removed so that R 2 was greater than 0.99. The reduced data set was then log 10 transformed to evenly weight lower concentrations. In the log 10 transformed values, measurement signals of the lowest concentrations are rejected, so that R 2 was greater than 0.99.
Beispielshaft werden mit erfindungsgemäßen coryneformen Bakterienzellen folgende Malo- nat-(Malonyl-CoA)-Titer bestimmt (Figur 24). Der Wildtyp C. glutamicum ATCC 13032 bzw. dessen Abkömmling der Urtyp C. glutamicum DelAro4-4c/PcCg weist unter Standardbedingun gen einen Malonat-Titer von 0,508 pM auf. Die Stämme C. glutamicum DelAro 4-4clpcCg fasB- E622K, DelAro4-4c/PcCg asß-G1361 D, DelAro4-4c/PcCg asß-G2153E und DelAro 4-4clPcCg fasB- G2668S weisen Malonat-Titer von 1 , 148 pM, 0,658 pM, 0,694 bzw. 0,484 pM auf. Der fasB- Deletionsstamm DelAro4-4clPccg AfasB erreicht sogar 1 ,909 pM Malonat. Mit dem Stamm C. glutamicum DelAro4-4clpcC8-C7 werden 0,741 pM Malonat erreicht. Die Stämme C. glutami- cum DelAro4-4clPcC8-C7 mufasO bzw. C. glutamicum DelAro4-4clPcC8-C7 mufasO AfasB wei- sen einen Titer von 2,261 pM Malonat bzw. 3,645 pM Malonat auf. For example, the following malonate (malonyl-CoA) titers are determined using coryneform bacterial cells according to the invention (FIG. 24). The wild type C. glutamicum ATCC 13032 or its descendant the original type C. glutamicum DelAro 4 -4c / PcCg has a malonate titer of 0.508 pM under standard conditions. The strains C. glutamicum DelAro 4 -4clp cCg fasB- E622K, DelAro 4 -4c / PcCg asß-G1361 D, DelAro 4 -4c / PcCg asß-G2153E and DelAro 4 -4cl PcCg fasB- G2668S have malonate titer of 1. 148 pM, 0.658 pM, 0.694 and 0.484 pM, respectively. The fasB deletion strain DelAro 4 -4cl Pc c g AfasB even reaches 1.909 pM malonate. With the strain C. glutamicum DelAro 4 -4clp cC8 -C7 0.741 pM malonate are achieved. The strains C. glutamicum DelAro 4 -4cl PcC8 -C7 mufasO or C. glutamicum DelAro 4 -4cl PcC8 -C7 mufasO AfasB have a titer of 2.261 pM malonate or 3.645 pM malonate.
Polyphenol-ZPolyketid-Quantifizierung mittels Ethylacetatextraktion und LC-MS Messung Die Extraktion der Produkte Naringenin, Noreugenin und Resveratroi wird wie beschrieben durchgeführt (Kallscheuer et al. , 2016). Die während der Kultivierung entnommenen Proben wurden aufgetaut und mit 1 ml Ethylacetat versehen und bei 1.400 RPM und 20 °C für 10 Minuten in einem Eppendorf Thermomixer (Hamburg, Deutschland) inkubiert. Die Suspension wurde anschließend bei 16.000 g 5 Minuten zentrifugiert. Von der Ethylacetat-Phase wur den 800 pl in eine Lösungsmittel-resistente 2 ml Deep-Well-Platte (Eppendorf, Hamburg, Deutschland) überführt. Nach der Evaporation des Lösemittels über Nacht wurden die ge trockneten Extrakte in 800 pl Acetonitril resuspendiert und direkt für die LC-MS-Analyse ver wendet. Polyphenol-Z-polyketide quantification by means of ethyl acetate extraction and LC-MS measurement The extraction of the products naringenin, noreugenin and resveratroi is carried out as described (Kallscheuer et al., 2016). The samples taken during the cultivation were thawed and provided with 1 ml of ethyl acetate and incubated at 1,400 RPM and 20 ° C. for 10 minutes in an Eppendorf thermomixer (Hamburg, Germany). The suspension was then centrifuged at 16,000 g for 5 minutes. 800 μl of the ethyl acetate phase were transferred to a solvent-resistant 2 ml deep-well plate (Eppendorf, Hamburg, Germany). After evaporation of the solvent overnight, the dried extracts were resuspended in 800 pl acetonitrile and used directly for the LC-MS analysis.
Die LC-MS-Analyse der jeweiligen Produkte in den Extrakten wurde wie beschrieben mit einem Ultrahochleistungs-Flüssigkeitschromatographie 1290 Infinity System gekoppelt an ein 6130 Quadrupol LC-MS System (Agilent, Waldbronn, Deutschland) durchgeführt (Kallscheuer et al., 2016). Für die chromatographische Trennung wurde eine Kinetex 1.7 pm C18 Säule mit 100 A Porengröße (50 mm x 2,1 mm [interner Durchmesser]; Phenomenex, Torrance, CA, USA) bei 50 °C verwendet. Als mobile Phasen wurden 0, 1 % Essigsäure (Phase A) so wie Acetonitril + 0, 1 % Essigsäure (Phase B) bei einer Flussrate von 0,5 ml/min verwendet. Es folgte eine Gradientenelution, bei dem der Anteil von Phase B schrittweise erhöht wurde: Minute 0-6: 10-30 %, Minute 6-7: 30-50 %, Minute 7-8: 50-100 %, Minute 8-8,5: 100-10 %. Das Massenspektrometer wurde im negativen Elektrospray-Ionisationsmodus (ESI) betrie ben; die Datenaufnahme erfolgte im Selected-Ion-Monitoring-Modus (SIM). Für die Quantifi zierung wurden reine Produktstandards verschiedener Konzentrationen in Acetonitril ange setzt. Die gemessenen Flächen für die [M-H]— Massensignale ( m/z 271 für Naringenin, m/z 191 für Noreugenin, m/z 227 für Resveratroi) waren für Konzentrationen bis 250 mg/l linear. Als interner Standard diente Benzoat (Endkonzentration 100 mg/l, m/z 121 für Benzoat). Ei ne Eichkurve wurde basierend auf dem Verhältnis der gemessenen Flächen des Analyten zu internem Standard berechnet. The LC-MS analysis of the respective products in the extracts was carried out as described using an ultra-high performance liquid chromatography 1290 Infinity System coupled to a 6130 quadrupole LC-MS system (Agilent, Waldbronn, Germany) (Kallscheuer et al., 2016). A Kinetex 1.7 pm C18 column with 100 A pore size (50 mm × 2.1 mm [internal diameter]; Phenomenex, Torrance, CA, USA) at 50 ° C. was used for the chromatographic separation. 0.1% acetic acid (phase A) and acetonitrile + 0.1% acetic acid (phase B) were used as mobile phases at a flow rate of 0.5 ml / min. A gradient elution followed in which the proportion of phase B was gradually increased: minute 0-6: 10-30%, minute 6-7: 30-50%, minute 7-8: 50-100%, minute 8-8 , 5: 100-10%. The mass spectrometer was operated in negative electrospray ionization mode (ESI); data was recorded in selected ion monitoring mode (SIM). Pure product standards of various concentrations in acetonitrile were used for the quantification. The measured areas for the [M-H] mass signals (m / z 271 for naringenin, m / z 191 for noreugenin, m / z 227 for resveratroi) were linear for concentrations up to 250 mg / l. Benzoate served as the internal standard (final concentration 100 mg / l, m / z 121 for benzoate). A calibration curve was calculated based on the ratio of the measured areas of the analyte to the internal standard.
Mit den erfindungsgemäßen coryneformen Bakterienzellen werden folgende Polyphenol- bzw. Polyketid-Titer bestimmt, jeweils unter Standardbedingungen bei Wachstum auf Gluko se bzw. Glukose supplementiert mit p-Cumarsäure. Der Wildtyp C. glutamicum ATCC 13032 bzw. dessen Abkömmling der Urtyp C. glutamicum DelAro4-4c/PcCg pMKEx2-stsAh-4clPc weist unter Standardbedingungen einen Resveratrol-Titer von 8 mg/L bzw. 12 mg/L auf. Die Stämme C. glutamicum DelAro4-4c/pcCg fasB- E622K pMKEx2-stsAh-4clPc, DelAro4-4c/pcCg fasß-G1361 D pMKEx2-stsAh-4clPc, DelAro4-4c/pcCg fasß-G2153E pMKEx2-stsAh-4clPc und DelAro4-4c/PcCg fasB-G 2668S pMKEx2-stsAh-4clPc weisen Resveratrol-Titer von 9 mg/L bzw. 28,90 mg/L, 8,37 mg/L bzw. 18,20 mg/L, 8,49mg/L bzw. 20,30 mg/L und 7,89 mg/L bzw. 1 1 ,70 mg/L Resveratroi auf. Der fasB-Deletionsstamm DelAro4-4clPcCg AfasB pMKEx2- stsAh-4clPc erreicht sogar 9,49 mg/L bzw. 37 mg/L Resveratrol. Mit dem Stamm C. glutami- cum DelAro4-4clPcC8-C7 pMKEx2-stsAh-4clPc werden 14 mg/L bzw. 1 13 mg/L Resveratrol erreicht. Die Stämme C. glutamicum DelAro4-4clPccg-C7-mufasO pMKEx2-stsAh-4clPc bzw. C. glutamicum DelAro4-4clPccg-C7-mufasO-AfasB pMKEx2-stsAh-4clPc weisen einen Titer von 22,85 mg/L bzw. 262 mg/L Resveratrol und 22,73 mg/L und 260 mg/L Resveratrol auf. The following polyphenol or polyketide titers are determined with the coryneform bacterial cells according to the invention, in each case under standard conditions with growth to glucose or glucose supplemented with p-cumaric acid. The wild type C. glutamicum ATCC 13032 or its descendant the original type C. glutamicum DelAro 4 -4c / PcCg pMKEx2-stsAh-4clPc has a resveratrol titer of 8 mg / L or 12 mg / L under standard conditions. The strains C. glutamicum DelAro 4 -4c / p cCg fasB- E622K pMKEx2-stsAh-4clPc, DelAro 4 -4c / p cCg fasß-G1361 D pMKEx2-stsAh-4clPc, DelAro 4 -4c / p cCg fasß-Gx152EM stsAh-4clPc and DelAro 4 -4c / PcCg fasB-G 2668S pMKEx2-stsAh-4clPc have resveratrol titers of 9 mg / L and 28.90 mg / L, 8.37 mg / L and 18.20 mg / L, 8.49 mg / L or 20.30 mg / L and 7.89 mg / L or 1 1, 70 mg / L Resveratroi. The fasB deletion strain DelAro 4 -4cl PcCg AfasB pMKEx2- stsAh-4clPc even reaches 9.49 mg / L or 37 mg / L resveratrol. With the strain C. glutamicum DelAro 4 -4cl PcC8 -C7 pMKEx2-stsAh-4clPc 14 mg / L or 1 13 mg / L Resveratrol are achieved. The strains C. glutamicum DelAro 4 -4cl Pc c g -C7-mufasO pMKEx2-stsAh-4clPc or C. glutamicum DelAro 4 -4cl Pc c g -C7-mufasO-AfasB pMKEx2-stsAh-4clPc have a titer of 22. 85 mg / L or 262 mg / L resveratrol and 22.73 mg / L and 260 mg / L resveratrol.
Hinsichtlich der Naringenin-Herstellung weisen die erfindungsgemäßen coryneformen Bakterienzellen folgende Titer auf, jeweils unter Standardbedingungen bei Wachstum auf Glukose bzw. Glukose supplementiert mit p-Cumarsäure. Der Wildtyp C. glutamicum ATCC 13032 bzw. dessen Abkömmling der Urtyp C. glutamicum DelAro4-4c/pcCg pMKEx2-chsPh-chiPh weist unter Standardbedingungen einen Naringenin-Titer von 1 mg/L bzw. 2,1 mg/L auf. Die Stämme C. glutamicum DelAro4-4c/PcCg fasß-E622K pMKEx2-chsPh-chiPh, DelAro4-4c/pcCg fasß-G1361 D pMKEx2-chsPh-chiPh, DelAro4-4c/PcCg fasB- G2153E pMKEx2-chsPh-chiPh und DelAro4-4c/pcCg fasß-G2668S pMKEx2-chsPh-chiPh weisen Naringenin-Titer von 1 ,78 mg/L bzw. 7,1 1 mg/L, 1 ,32 mg/L bzw. 4,54 mg/L, 1 ,55 mg/L bzw. 5,08 mg/L und 1 , 16 mg/L bzw. 2,84 mg/L Naringenin auf. Der fasB-Deletionsstamm DelAro4-4clPcCg AfasB pMKEx2- chsPh-chiPh erreicht sogar 2, 15 mg/L bzw. 9,61 mg/L Naringenin. Mit dem Stamm C. glutamicum DelAro4-4clPcC8-C7 pMKEx2-chsPh-chiPh werden 3,5 mg/L bzw. 18,5 mg/L Naringe- nin erreicht. Die Stämme C. glutamicum DelAro4-4clPccg-C7-mufasO pMKEx2-chsPh-chiPh bzw. C. glutamicum DelAro4-4clPcC8-C7-mufasO-AfasB pMKEx2-chsPh-chiPh weisen einen Titer von 10,59 mg/L bzw. 65 mg/L Naringenin und 9,83 mg/L und 60 mg/L Naringenin auf. With regard to the production of naringenin, the coryneform bacterial cells according to the invention have the following titers, in each case under standard conditions with growth to glucose or glucose supplemented with p-cumaric acid. The wild type C. glutamicum ATCC 13032 or its descendant the original type C. glutamicum DelAro 4 -4c / p cCg pMKEx2-chsPh-chiPh has a naringenin titer of 1 mg / L or 2.1 mg / L under standard conditions. The C. glutamicum strains DelAro 4 -4c / PCCG fasß-E622K-pMKEx2 chsPh-chiPh, DelAro 4 -4c / p CCG fasß-G1361 D-pMKEx2 chsPh-chiPh, DelAro 4 -4c / PCCG FASB G2153E pMKEx2-chsPh- chiPh and DelAro 4 -4c / p cCg fasß-G2668S pMKEx2-chsPh-chiPh have naringenin titers of 1.78 mg / L and 7.1 1 mg / L, 1.32 mg / L and 4.54 mg, respectively / L, 1, 55 mg / L or 5.08 mg / L and 1, 16 mg / L or 2.84 mg / L naringenin. The fasB deletion strain DelAro 4 -4cl PcCg AfasB pMKEx2-chsPh-chiPh even reaches 2, 15 mg / L and 9.61 mg / L naringenin. With the strain C. glutamicum DelAro 4 -4cl PcC8 -C7 pMKEx2-chsPh-chiPh 3.5 mg / L and 18.5 mg / L naringeninin are achieved. The strains C. glutamicum DelAro 4 -4cl Pc c g -C7-mufasO pMKEx2-chsPh-chiPh and C. glutamicum DelAro 4 -4cl PcC8 -C7-mufasO-AfasB pMKEx2-chsPh-chiPh have a titer of 10.59 mg / L or 65 mg / L naringenin and 9.83 mg / L and 60 mg / L naringenin.
Die erfindungsgemäßen coryneformen Bakterienzellen weisen unter Standardbedingungen bei Wachstum auf Glukose folgende Noreugenin-Titer auf. Für den Wildtyp C. glutamicum ATCC 13032 pMKEx2-pcsAacg-short bzw. dessen Abkömmling der Urtyp C. glutamicum DelA- ro 4-4clpcCg pMKEx2-pcsAaC8-short konnte kein Noreugenin (0,002 mg/L) detektiert werden. Die Stämme C. glutamicum DelAro4-4c/pcCg asß-E622K pMKEx2-pcsAaCg-Short, DelAro4-4c/PcCg fasß-G1361 D pMKEx2-pcsAac5-short, DelAro4-4c/pcCg fasB- G2153E pMKEx2-pcsAaC8-Short und DelAro4-4c/pcCg fasB- G2668S pMKEx2-pcsAaCg-Short weisen Noreugenin-Titer von 0,004 mg/L, 0,003 mg/L, 0,003 mg/L und 0,003 mg/L Noreugenin auf. Mit dem Stamm C. glutamicum DelAro4-4clPccg-C7 pMKEx2-pcsAaCg-Short wird 0,86 mg/L Noreugenin bestimmt. Der Stamm C. glutamicum DelAro4-4clPcC8-C7-mufasO pMKEx2-pcsAaCg.Short weist einen Titer von 4,4 mg/L Noreugenin auf. Der Stamm C. glutamicum DelAro4-4clPcC8-C7-mufasO- AfasB pMKEx2- pcsAacg- short weist einen Titer von 4,51 mg/L Noreugenin auf. Tabelle 1 : The coryneform bacterial cells according to the invention have the following noreugenin titer under standard conditions when growing on glucose. No noreugenin (0.002 mg / L) could be detected for the wild type C. glutamicum ATCC 13032 pMKEx2-pcs Aa c g -s h ort or its descendant of the original type C. glutamicum DelAro 4 -4clp cCg pMKEx2-pcs AaC8-short will. The strains C. glutamicum DelAro 4 -4c / p cCg asß-E622K pMKEx2-pcs AaCg-Sh ort, DelAro 4 -4c / PcCg fasß-G1361 D pMKEx2-pcs Aa c 5 -short, DelAro 4 -4c / p cCg fasB - G2153E pMKEx2-pcs AaC8-Sh ort and DelAro 4 -4c / p cCg fasB- G2668S pMKEx2-pcs AaCg-Sh or t have noreugenin titers of 0.004 mg / L, 0.003 mg / L, 0.003 mg / L and 0.003 mg / L Noreugenin on. With the strain C. glutamicum DelAro 4 -4cl Pc c g -C7 pMKEx2-pcs AaCg-Sh or t 0.86 mg / L noreugenin is determined. The strain C. glutamicum DelAro 4 -4cl PcC8 -C7-mufasO pMKEx2-pcs AaCg.Sho r t has a titer of 4.4 mg / L noreugenin. The strain C. glutamicum DelAro 4 -4cl PcC8 -C7-mufasO- AfasB pMKEx2- pcs Aa c g - s h or t has a titer of 4.51 mg / L noreugenin. Table 1 :
Tabelle 2 Table 2
Tabelle 3: Table 3:

Claims

P a t e n t a n s p r ü c h e Patent claims
1. Coryneforme Bakterienzelle mit einer gegenüber ihrem Urtyp erhöhten Bereitstellung von Malonyl-CoA, dadurch gekennzeichnet, dass die Regulation und/oder Expression der Gene, ausgewählt aus der Gruppe enthaltend fasB, gltA, accBC und accD1 , und/oder die Funktionalität der durch sie kodierten Enzyme gezielt modifiziert ist. 1. Coryneform bacterial cell with an increased supply of malonyl-CoA compared to its original type, characterized in that the regulation and / or expression of the genes selected from the group comprising fasB, gltA, accBC and accD1, and / or the functionality of them encoded enzymes is specifically modified.
2. Coryneforme Bakterienzelle nach Anspruch 1 , dadurch gekennzeichnet, dass sie eine oder mehrere gezielte Modifikationen aufweist, ausgewählt aus der Gruppe enthaltend a. Verminderte oder ausgeschaltete Funktionalität der Fettsäuresynthase FasB; b. Mutation oder teilweise oder komplette Deletion des für die Fettsäuresynthase kodierende Gen fasB; c. Verminderte Funktionalität des mit dem Citratsynthase-Gen gtIA operativ verknüpften Promotors; d. Verminderte Expression des für die Citratsynthase CS kodierende Gens gltA; e. Verminderte oder ausgeschaltete Funktionalität der Operator-Bindestellen (fasO) für den Regulator FasR in den Promotorbereichen der Gene accBC und accD1 kodierend für die Acetyl-CoA-Carboxylase-Untereinheiten; f. Dereprimierte Expression der für die Acetyl-CoA-Carboxylase-Untereinheiten kodierenden Gene accBC und accD1; g. eine oder mehrere Kombinationen aus a) - f). 2. Coryneform bacterial cell according to claim 1, characterized in that it has one or more targeted modifications, selected from the group comprising a. Reduced or deactivated functionality of the fatty acid synthase FasB; b. Mutation or partial or complete deletion of the gene encoding the fatty acid synthase; c. Reduced functionality of the promoter operatively linked to the citrate synthase gene gtIA; d. Decreased expression of the gene coding for the citrate synthase CS gltA; e. Reduced or deactivated functionality of the operator binding sites (fasO) for the regulator FasR in the promoter regions of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits; f. Depressed expression of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits; G. one or more combinations of a) - f).
3. Coryneforme Bakterienzelle nach einem der Ansprüche 1 oder 2, dadurch gekennzeichnet, dass die Funktionalität der Fettsäuresynthase FasB vermindert oder ausgeschaltet ist und/oder das für die Fettsäuresynthase kodierende Gen fasB gezielt mutiert, bevorzugt durch eine oder mehrere Nukleotidsubstitutionen, oder teilweise oder komplett deletiert ist. 3. Coryneform bacterial cell according to claim 1 or 2, characterized in that the functionality of the fatty acid synthase FasB is reduced or switched off and / or the gene coding for the fatty acid synthase fasB is mutated in a targeted manner, preferably by one or more nucleotide substitutions, or partially or completely deleted is.
4. Coryneforme Bakterienzelle nach einem der Ansprüche 1 oder 2, dadurch gekennzeichnet, dass die Expression des für die Citratsynthase kodierende Gens gltA durch Mutation, bevorzugt mehrere Nukleotidsubstitutionen, des operativ-verknüpften Promotors vermindert ist. 4. Coryneform bacterial cell according to one of claims 1 or 2, characterized in that the expression of the gene coding for citrate synthase gltA is reduced by mutation, preferably several nucleotide substitutions, of the operatively linked promoter.
5. Coryneforme Bakterienzelle nach einem der Ansprüche 1 oder 2, dadurch gekennzeichnet, dass die Funktionalität der Operator-Bindestellen (fasO) für den Regulator FasR in den Promotorbereichen der Gene accBC und accD1 kodierend für die Acetyl-CoA-Carboxylase-Untereinheiten, bevorzugt durch eine oder mehrere Nukleotidsubstitutionen, vermindert oder ausgeschaltet ist und die Expression der für die Acetyl-CoA-Carboxylase-Untereinheiten kodierenden Gene accBC und accD1 dereprimiert, bevorzugt gesteigert, ist. 5. Coryneform bacterial cell according to one of claims 1 or 2, characterized characterized in that the functionality of the operator binding sites (fasO) for the regulator FasR in the promoter regions of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits, preferably by one or more nucleotide substitutions, is reduced or switched off and the expression of the for the genes accBC and accD1 encoding the acetyl-CoA carboxylase subunits is derepressed, preferably increased.
6. Coryneforme Bakterienzelle nach einem der Ansprüche 1 bis 5, dadurch gekennzeichnet, dass sie eine Kombination aus verminderter Expression und/oder Aktivität der6. Coryneform bacterial cell according to one of claims 1 to 5, characterized in that it is a combination of reduced expression and / or activity of
Citratsynthase (CS) und deregulierter, gesteigerter Expression und/oder Aktivität der Acetyl-CoA-Carboxylase-Untereinheiten (AccBC und AccD1 ) aufweist. Citrate synthase (CS) and deregulated, increased expression and / or activity of the acetyl-CoA carboxylase subunits (AccBC and AccD1).
7. Coryneforme Bakterienzelle nach einem der Ansprüche 1 bis 6, dadurch gekennzeichnet, dass sie eine Kombination aus verminderter Expression und/oder Aktivität der7. Coryneform bacterial cell according to one of claims 1 to 6, characterized in that it is a combination of reduced expression and / or activity of
Citratsynthase (CS) und deregulierter, gesteigerter Expression und/oder Aktivität der Acetyl-CoA-Carboxylase-Untereinheiten (AccBC und AccD1) und verminderter oder ausgeschalteter Funktionalität der Fettsäuresynthase FasB aufweist. Citrate synthase (CS) and deregulated, increased expression and / or activity of the acetyl-CoA carboxylase subunits (AccBC and AccD1) and reduced or eliminated functionality of the fatty acid synthase FasB.
8. Protein mit einer Fettsäuresynthase FasB isoliert aus coryneformen Bakterien deren Funktionalität vermindert oder ausgeschaltet ist zur erhöhten Bereitstellung von Malonyl- CoA in coryneformen Bakterien, dadurch gekennzeichnet, dass die Aminosäuresequenz wenigstens 70% Identität zu der Aminosäuresequenz ausgewählt aus der Gruppe enthaltend SEQ ID NO. 2, 4, 6, 8 und 10 oder Fragmenten oder Allelen davon aufweist. 8. Protein with a fatty acid synthase FasB isolated from coryneform bacteria whose functionality is reduced or switched off for increased provision of malonyl-CoA in coryneform bacteria, characterized in that the amino acid sequence is at least 70% identical to the amino acid sequence selected from the group comprising SEQ ID NO. 2, 4, 6, 8 and 10 or fragments or alleles thereof.
9. Nukleinsäuresequenz kodierend für eine Fettsäure-Synthase FasB aus coryneformen Bakterien, deren Funktionalität vermindert oder ausgeschaltet ist, ausgewählt aus der Gruppe enthaltend: a. eine Nukleinsäuresequenz enthaltend wenigstens 70% Identität zu der Nukleinsäuresequenz ausgewählt aus der Gruppe SEQ ID NO. 1 , 3, 5, 7 und 9 oder Fragmente davon, b. eine Nukleinsäuresequenz, die unter stringenten Bedingungen mit einer komplementären Sequenz einer Nukleinsäuresequenz ausgewählt aus der Gruppe SEQ ID NO. 1 , 3, 5, 7 und 9 oder Fragmenten davon hybridisiert, c. eine Nukleinsäuresequenz ausgewählt aus der Gruppe SEQ ID NO. 1 , 3, 5, 7 und 9 oder Fragmente davon, oder d. eine Nukleinsäuresequenz kodierend für eine Fettsäure-Synthase FasB entsprechend jeder der Nukleinsäuren gemäß a) - c) , die sich jedoch von diesen Nukleinsäuresequenzen gemäß a) - c) durch die Degeneriertheit des genetischen Codes oder funktionsneutrale Mutationen unterscheidet, zur erhöhten Bereitstellung von Malonyl-CoA in coryneformen Bakterien. 9. Nucleic acid sequence coding for a fatty acid synthase FasB from coryneform bacteria, the functionality of which is reduced or switched off, selected from the group comprising: a. a nucleic acid sequence containing at least 70% identity to the nucleic acid sequence selected from the group SEQ ID NO. 1, 3, 5, 7 and 9 or fragments thereof, b. a nucleic acid sequence which under stringent conditions with a complementary sequence of a nucleic acid sequence selected from the group SEQ ID NO. 1, 3, 5, 7 and 9 or fragments thereof hybridized, c. a nucleic acid sequence selected from the group SEQ ID NO. 1, 3, 5, 7 and 9 or fragments thereof, or d. a nucleic acid sequence coding for a fatty acid synthase FasB corresponding to each of the nucleic acids according to a) - c), but which differs from these nucleic acid sequences according to a) - c) by the degeneracy of the genetic code or functionally neutral mutations, for the increased provision of malonyl-CoA in coryneform bacteria.
10. Coryneforme Bakterienzelle nach einem der Ansprüche 1 bis 7, dadurch gekennzeichnet, dass sie ein Protein gemäß Anspruch 8 und/oder eine Nukleinsäuresequenz nach Anspruch 9 aufweist. 10. Coryneform bacterial cell according to one of claims 1 to 7, characterized in that it has a protein according to claim 8 and / or a nucleic acid sequence according to claim 9.
1 1. Coryneforme Bakterienzelle nach einem der Ansprüche 1 bis 8 und 10, dadurch gekennzeichnet, dass sie eine oder mehrere gezielte Modifikationen aufweist, ausgewählt aus der Gruppe enthaltend a. Verminderte oder ausgeschaltete Funktionalität der Fettsäuresynthase FasB mit wenigstens 70% Identität zu der Aminosäuresequenz ausgewählt aus der Gruppe enthaltend SEQ ID NO. 2, 4, 6, 8 und 10 oder Fragmenten oder Allelen davon; b. Mutation oder teilweise oder komplette Deletion des für die Fettsäuresynthase kodierende Gen fasB mit einer Nukleinsäuresequenz enthaltend wenigstens 70% Identität zu der Nukleinsäuresequenz ausgewählt aus der Gruppe SEQ ID NO. 1 , 3, 5, 7 und 9 oder Fragmente davon; c. Verminderte Funktionalität des mit dem Citratsynthase-Gen gltA operativ- verknüpften Promotors gemäß SEQ ID NO. 11 ; d. Verminderte Expression des für die Citratsynthase (CS) kodierende Gens gltA; e. Verminderte oder ausgeschaltete Funktionalität der Operator-Bindestellen (fasO) für den Regulator FasR in den Promotorbereichen der Gene accBC und accD1 kodierend für die Acetyl-CoA-Carboxylase-Untereinheiten gemäß SEQ ID NO. 13 und 15; f. Dereprimierte Expression der für die Acetyl-CoA-Carboxylase-Untereinheiten kodierenden Gene accBC und accD1 ; g. eine oder mehrere Kombinationen aus a) - f). 1 1. Coryneform bacterial cell according to one of claims 1 to 8 and 10, characterized in that it has one or more targeted modifications selected from the group containing a. Reduced or deactivated functionality of the fatty acid synthase FasB with at least 70% identity to the amino acid sequence selected from the group comprising SEQ ID NO. 2, 4, 6, 8 and 10 or fragments or alleles thereof; b. Mutation or partial or complete deletion of the gene encoding the fatty acid synthase fasB with a nucleic acid sequence containing at least 70% identity to the nucleic acid sequence selected from the group SEQ ID NO. 1, 3, 5, 7 and 9 or fragments thereof; c. Reduced functionality of the promoter operatively linked to the citrate synthase gene gltA according to SEQ ID NO. 11; d. Decreased expression of the gene coding for citrate synthase (CS) gltA; e. Reduced or deactivated functionality of the operator binding sites (fasO) for the regulator FasR in the promoter regions of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits according to SEQ ID NO. 13 and 15; f. Depressed expression of the genes accBC and accD1 coding for the acetyl-CoA carboxylase subunits; G. one or more combinations of a) - f).
12. Coryneforme Bakterienzelle nach einem der Ansprüche 1 bis 8, 10 und 11 , dadurch gekennzeichnet, dass die Modifikationen chromosomal-kodiert vorliegen. 12. Coryneform bacterial cell according to one of claims 1 to 8, 10 and 11, characterized in that the modifications are chromosomally encoded.
13. Coryneforme Bakterienzelle nach einem der Ansprüche 1-8 und 10-12, dadurch gekennzeichnet, dass sie nicht-rekombinant (non-GVO) verändert ist. 13. Coryneform bacterial cell according to one of claims 1-8 and 10-12, characterized characterized that it is non-recombinant (non-GMO) changed.
14. Coryneforme Bakterienzelle nach einem der Ansprüche 1-8 und 10-13, ausgewählt aus der Gruppe enthaltend Corynebacterium und Brevibacterium, bevorzugt Corynebacterium glutamicum, besonders bevorzugt Corynebacterium glutamicum ATCC 13032, Corynebacterium acetoglutamicum, Corynebacterium thermoaminogenes, Brevibacterium fiavum, Brevibacterium lactofermentum oder Brevibacterium divaricatum. 14. Coryneform bacterial cell according to one of claims 1-8 and 10-13, selected from the group comprising Corynebacterium and Brevibacterium, preferably Corynebacterium glutamicum, particularly preferably Corynebacterium glutamicum ATCC 13032, Corynebacterium acetoglutamicum, Corynebacterium thermoaminogenes or Brevibacterium fum, Brevibacterium fium .
15. Coryneforme Bakterienzelle nach einem der Ansprüche 1-8 und 10-14 zur Herstellung von Polyphenolen oder Polyketiden, dadurch gekennzeichnet, dass sie zusätzlich der katabole Stoffwechselweg von aromatischen Komponenten, bevorzugt ausgewählt aus der Gruppe enthaltend Phenylpropanoide und Benzoesäure-Derivate, ausgeschaltet ist. 15. Coryneform bacterial cell according to one of claims 1-8 and 10-14 for the production of polyphenols or polyketides, characterized in that it additionally the catabolic pathway of aromatic components, preferably selected from the group comprising phenylpropanoids and benzoic acid derivatives, is switched off.
16. Coryneforme Bakterienzelle nach einem der Ansprüche 1-8 und 10-15, dadurch gekennzeichnet, dass die Funktionalität und/oder Aktivität der Enzyme oder die Expression der sie kodierenden Gene beteiligt am katabolen Stoffwechselweg von aromatischen Komponenten durch Deletionen der Gencluster cg0344-47 (phdBCDE - Operon), cg2625-40 ( cat , ben und pca), cg 1226 {pobA ) und cg0502 ( qsuB ) ausgeschaltet sind. 16. Coryneform bacterial cell according to one of claims 1-8 and 10-15, characterized in that the functionality and / or activity of the enzymes or the expression of the genes encoding them participates in the catabolic pathway of aromatic components by deletions of the gene clusters cg0344-47 ( phdBCDE - Operon), cg2625-40 (cat, ben and pca), cg 1226 {pobA) and cg0502 (qsuB) are switched off.
17. Coryneforme Bakterienzelle nach einem der Ansprüche 1-8 und 10-16, dadurch gekennzeichnet, dass sie Gene kodierend für eine feedback-resistente 3-Deoxy-D- Arabinoheptulosonat-7-Phosphat-Synthase (aroH), bevorzugt aus E. coli, und für eine Tyrosinammonium-Lyase (tal), bevorzugt aus Flavobacertium johnsoniae, aufweist. 17. Coryneform bacterial cell according to one of claims 1-8 and 10-16, characterized in that it encodes genes for a feedback-resistant 3-deoxy-D-arabinoheptulosonate-7-phosphate synthase (aroH), preferably from E. coli , and for a tyrosine ammonium lyase (tal), preferably from Flavobacertium johnsoniae.
18. Coryneforme Bakterienzelle nach einem der Ansprüche 1-8 und 10-17, dadurch gekennzeichnet, dass sie zusätzlich aus Pflanzen abgeleitete Enzyme oder die sie kodierenden Gene für die Polyphenol- oder Polyketid-Synthese aufweist. 18. Coryneform bacterial cell according to one of claims 1-8 and 10-17, characterized in that it additionally has enzymes derived from plants or the genes coding for the polyphenol or polyketide synthesis.
19. Protein mit einer gesteigerten 5,7-Dihdroxy-2-Methylchromon-Synthase Aktivität19. Protein with increased 5,7-dihydroxy-2-methylchromone synthase activity
(PCSshort) zur Synthese von Polyketiden in coryneformen Bakterien, dadurch gekennzeichnet, dass die Aminosäuresequenz wenigstens 70% Identität zu der Aminosäuresequenz gemäß SEQ ID NO. 22 oder Fragmenten oder Allelen davon aufweist. (PCS short ) for the synthesis of polyketides in coryneform bacteria, characterized in that the amino acid sequence is at least 70% identical to the amino acid sequence according to SEQ ID NO. 22 or fragments or alleles thereof.
20. Nukleinsäuresequenz (pcsS ort) kodierend für eine 5,7-Dihydroxy-2-Methylchromon- Synthase mit gesteigerter Aktivität zur Polyketid-Herstellung in coryneformen Bakterien ausgewählt aus der Gruppe enthaltend: a. eine Nukleinsäuresequenz enthaltend wenigstens 70% Identität zu der Nukleinsäuresequenz gemäß SEQ ID NO. 21 oder Fragmente davon, b. eine Nukleinsäuresequenz, die unter stringenten Bedingungen mit einer komplementären Sequenz einer Nukleinsäuresequenz gemäß SEQ ID NO. 21 oder Fragmenten davon hybridisiert, c. eine Nukleinsäuresequenz gemäß SEQ ID NO. 21 oder Fragmenten davon, oder d. eine Nukleinsäuresequenz kodierend für eine 5,7-Dihydroxy-2-Methylchromon- Synthase (PCSsh0rt) entsprechend jeder der Nukleinsäuren gemäß a) - c), die an die Codonverwendung coryneformer Bakterien angepasst ist, oder e. die sich von diesen Nukleinsäuresequenzen gemäß a) - d) durch die Degeneriertheit des genetischen Codes oder funktionsneutrale Mutationen unterscheidet. 20 nucleic acid sequence (pcs S place) coding for a 5,7-dihydroxy-2-Methylchromon- synthase with increased activity for polyketide production in coryneform bacteria selected from the group consisting of: a. a nucleic acid sequence containing at least 70% identity to that Nucleic acid sequence according to SEQ ID NO. 21 or fragments thereof, b. a nucleic acid sequence which under stringent conditions with a complementary sequence of a nucleic acid sequence according to SEQ ID NO. 21 or fragments thereof hybridized, c. a nucleic acid sequence according to SEQ ID NO. 21 or fragments thereof, or d. a nucleic acid sequence coding for a 5,7-dihydroxy-2-methylchromone synthase (PCS sh0rt ) corresponding to each of the nucleic acids according to a) - c), which is adapted to the codon use of coryneform bacteria, or e. which differs from these nucleic acid sequences according to a) - d) by the degeneracy of the genetic code or function-neutral mutations.
21. Coryneforme Bakterienzelle nach einem der Ansprüche 1-8 und 10-18, dadurch gekennzeichnet, dass sie die aus Pflanzen abgeleiteten Gene zur Polyphenol- oder Polyketid-Produktion, ausgewählt aus der Gruppe enthaltend die Gene 4cl, sts, chs, chi und pcs aufweist. 21. Coryneform bacterial cell according to one of claims 1-8 and 10-18, characterized in that it contains the genes derived from plants for polyphenol or polyketide production, selected from the group containing the genes 4cl, sts, chs, chi and pcs having.
22. Coryneforme Bakterienzelle nach einem der Ansprüche 1-8, 10-18 und 21 , dadurch gekennzeichnet, dass die pflanzlichen Gene unter der Expressionskontrolle eines induzierbaren Promotors vorliegen. 22. Coryneform bacterial cell according to one of claims 1-8, 10-18 and 21, characterized in that the plant genes are under the expression control of an inducible promoter.
23. Coryneforme Bakterienzelle nach einem der Ansprüche 1-8, 10-19, 21 und 22, dadurch gekennzeichnet, dass sie das Gen 4clPc unter der Expressionskontrolle eines induzierbaren Promotors chromosomal-kodiert aufweist. 23. Coryneform bacterial cell according to one of claims 1-8, 10-19, 21 and 22, characterized in that it has the gene 4clPc chromosomally-encoded under the expression control of an inducible promoter.
24. Coryneforme Bakterienzelle nach einem der Ansprüche 1-8, 10-18 und 21-23, dadurch gekennzeichnet, dass sie ein Protein nach Anspruch 19 und/oder eine Nukleinsäuresequenz nach Anspruch 20 aufweist. 24. Coryneform bacterial cell according to one of claims 1-8, 10-18 and 21-23, characterized in that it has a protein according to claim 19 and / or a nucleic acid sequence according to claim 20.
25. Coryneforme Bakterienzelle nach einem der Ansprüche 1-8, 10-18 und 21-24, dadurch gekennzeichnet, dass sie die Gene ausgewählt aus der Gruppe enthaltend a. 4cl und sts für die Synthese von Polyphenolen, bevorzugt Stilbene, besonders bevorzugt Resveratrol, oder b. chs und chi für die Synthese von Polyphenolen, bevorzugt Flavonoide, besonders bevorzugt Naringenin, oder c. pcsshort für die Synthese von Polyketiden, bevorzugt Noreugenin unter der Kontrolle eines induzierbaren Promotors aufweist. 25. Coryneform bacterial cell according to one of claims 1-8, 10-18 and 21-24, characterized in that it contains the genes selected from the group comprising a. 4cl and sts for the synthesis of polyphenols, preferably stilbenes, particularly preferably resveratrol, or b. chs and chi for the synthesis of polyphenols, preferably flavonoids, particularly preferably naringenin, or c. pcs short for the synthesis of polyketides, preferably noreugenin under the control of an inducible promoter.
26. Coryneforme Bakterienzelle nach einem der Ansprüche 1-8, 10-18 und 21-25, dadurch gekennzeichnet, dass sie die Gene aufweist, ausgewählt aus der Gruppe enthaltend a. fasB und/oder gltA und/oder accBC und accD1 oder Kombinationen davon, deren Funktionalität und/oder Expression für eine erhöhte Bereitstellung von Malonyl- CoA gezielt modifiziert ist, und b. cg0344-47 (phdBCDE-Operon ), cg2625-40 ( cat , ben und pca), cg1226 ( pobA ) und cg0502 ( qsuB ) deren Funktionalität für den Abbau aromatischer Komponenten, bevorzugt aus der Gruppe enthaltend Phenylpropanoide oder Benzoesäure-Derivate, ausgeschaltet ist, und c. pcsshort kodierend für ein Protein mit einer gesteigerten 5,7-Dihdroxy-2- Methylchromon-Synthase-Aktivität (PCSsh0rt) für die Synthese von Polyketiden, bevorzugt Noreugenin, oder d. optional aroFI und tal für die Vorstufen-Synthese von Polyphenolen ausgehend von Glukose, und e. 4cl und sts für die Synthese von Polyphenolen, bevorzugt Stilbene, besonders bevorzugt Resveratrol, oder f. chs und chi für die Synthese von Polyphenolen, bevorzugt Flavonoide, besonders bevorzugt Naringenin. 26. Coryneform bacterial cell according to one of claims 1-8, 10-18 and 21-25, characterized in that it has the genes selected from the group comprising a. fasB and / or gltA and / or accBC and accD1 or combinations thereof, the functionality and / or expression of which is specifically modified for increased provision of malonyl-CoA, and b. cg0344-47 (phdBCDE-Operon), cg2625-40 (cat, ben and pca), cg1226 (pobA) and cg0502 (qsuB) whose functionality for the degradation of aromatic components, preferably from the group containing phenylpropanoids or benzoic acid derivatives, is switched off , and c. pcs sho r t coding for a protein with an increased 5,7-dihydroxy-2-methylchromone synthase activity (PCS sh0 r t ) for the synthesis of polyketides, preferably noreugenin, or d. optional aroFI and tal for the precursor synthesis of polyphenols starting from glucose, and e. 4cl and sts for the synthesis of polyphenols, preferably stilbenes, particularly preferably resveratrol, or f. chs and chi for the synthesis of polyphenols, preferably flavonoids, particularly preferably naringenin.
27. Coryneforme Bakterienzelle nach einem der Ansprüche 1-8, 10-18 und 21-26, ausgewählt aus der Gruppe enthaltend Corynebacterium und Brevibacterium, bevorzugt Corynebacterium glutamicum, besonders bevorzugt Corynebacterium glutamicum ATCC13032, Corynebacterium acetoglutamicum, Corynebacterium thermoaminogenes, Brevibacterium flavum, Brevibacterium lactofermentum oder Brevibacterium divaricatum. 27. Coryneform bacterial cell according to one of claims 1-8, 10-18 and 21-26, selected from the group comprising Corynebacterium and Brevibacterium, preferably Corynebacterium glutamicum, particularly preferably Corynebacterium glutamicum ATCC13032, Corynebacterium acetoglutamicum, Corynebacterium breibacterium, breoibacterium, brefibacterium, breoibibium, breoibacterium, breoibacterium, breoibacterium, breoibacterium, breoibacterium, breoibacterium, breoibacterium, breoibacterium Brefibacterium, Breoibacterium Breoibacterium Breoibacterium Breoibacterium Breoibacterium Breoibacterium Breoibacterium Breoibacterium, or Brevibacterium divaricatum.
28. Verfahren zur erhöhten Bereitstellung von Malonyl-CoA in coryneformen Bakterien enthaltend die Schritte: a. Bereitstellen einer Lösung enthaltend Wasser und eine C6-Kohlenstoff-Quelle; b. mikrobielle Umsetzung der C6-Kohlenstoffquelle in einer Lösung gemäß Schritt a) zu Malonyl-CoA in Anwesenheit einer coryneformen Bakterienzelle nach einem der Ansprüche 1-8 und 10-16. 28. A method for the increased provision of malonyl-CoA in coryneform bacteria comprising the steps: a. Providing a solution containing water and a C6 carbon source; b. microbial conversion of the C6 carbon source in a solution according to step a) to malonyl-CoA in the presence of a coryneform bacterial cell after a of claims 1-8 and 10-16.
29. Verfahren zur mikrobiellen Herstellung von Polyphenolen oder Polyketiden in coryneformen Bakterien enthaltend die Schritte: a. Bereitstellen einer Lösung enthaltend Wasser und eine C6-Kohlenstoff-Quelle, b. mikrobielle Umsetzung der C6-Kohlenstoffquelle in einer Lösung gemäß Schritt a) zu Polyphenolen oder Polyketiden, in Anwesenheit einer coryneformen Bakterienzelle nach einem der Ansprüche 1-8, 10-18 und 21-27, wobei zunächst Malonyl-CoA in erhöhter Konzentration als Intermediat bereitgestellt und zur mikrobiellen Synthese von Polyphenolen oder Polyketiden weiter umgesetzt wird; c. Induktion der Expression pflanzlicher Gene unter der Kontrolle eines induzierbaren Promotors durch Zugabe eines geeigneten Induktors in Schritt b), d. optional die Aufbereitung des gewünschten Produkts. 29. A method for the microbial production of polyphenols or polyketides in coryneform bacteria comprising the steps: a. Providing a solution containing water and a C6 carbon source, b. Microbial conversion of the C6 carbon source in a solution according to step a) to polyphenols or polyketides, in the presence of a coryneform bacterial cell according to one of claims 1-8, 10-18 and 21-27, initially providing malonyl-CoA in an increased concentration as an intermediate and further implemented for the microbial synthesis of polyphenols or polyketides; c. Induction of the expression of plant genes under the control of an inducible promoter by adding a suitable inducer in step b), d. optionally the preparation of the desired product.
30. Verfahren zur Polyphenol-Herstellung nach Anspruch 29, dadurch gekennzeichnet, dass die Lösung in Schritt b) mit der Polyphenol-Vorstufe, bevorzugt p-Cumarsäure, supplementiert wird. 30. A process for polyphenol production according to claim 29, characterized in that the solution in step b) is supplemented with the polyphenol precursor, preferably p-cumaric acid.
31. Verfahren nach einem der Ansprüche 29 oder 30, dadurch gekennzeichnet, dass die Kultivierung in einem diskontinuierliche oder kontinuierlichen, bevorzugt batch-, fed- batch-, repeated-fed-batch oder kontinuierlichen Modus erfolgt. 31. The method according to any one of claims 29 or 30, characterized in that the cultivation takes place in a discontinuous or continuous, preferably batch, fed-batch, repeated fed-batch or continuous mode.
32. Verwendung einer coryneformen Bakterienzelle gemäß einem der Ansprüche 1-8, 10-18 und 21-27 und/oder eines Proteins nach Anspuch 8 und/oder einer Nukleinsäuresequenz gemäß Anspruch 9 zur erhöhten Bereitstellung von Malonyl-CoA in coryneformen Bakterien. 32. Use of a coryneform bacterial cell according to one of claims 1-8, 10-18 and 21-27 and / or a protein according to claim 8 and / or a nucleic acid sequence according to claim 9 for the increased provision of malonyl-CoA in coryneform bacteria.
33. Verwendung einer coryneformen Bakterienzelle gemäß einem der Ansprüche 1-8, 10-18 und 21-27 und/oder eines Proteins nach Anspuch 19 und/oder einer Nukleinsäuresequenz gemäß Anspruch 20 zur Polyphenol- oder Polyketid-Herstellung in coryneformen Bakterien. 33. Use of a coryneform bacterial cell according to one of claims 1-8, 10-18 and 21-27 and / or a protein according to claim 19 and / or a nucleic acid sequence according to claim 20 for polyphenol or polyketide production in coryneform bacteria.
34. Zusammensetzung enthaltend Sekundärmetabolite ausgewählt aus der Gruppe der Polyphenole und Polyketide, bevorzugt der Stilbene, Flavonoide oder Polyketide, besonders bevorzugt Resveratrol, Naringenin und/oder Noreugenin, hergestellt mit einer coryneformen Bakterienzelle gemäß einem der Ansprüche 1-8, 10-18 und 21-27, und/oder einem oder mehreren Proteinen gemäß einem der Ansprüche 8 oder 19 und/oder einer oder mehrerer Nukleotidseuqenzen gemäß einem der Ansprüche 9 oder 20 und/oder einem Verfahren nach einem der Ansprüche 28-31. 34. Composition containing secondary metabolites selected from the group of polyphenols and polyketides, preferably the stilbene, flavonoids or polyketides, particularly preferably resveratrol, naringenin and / or noreugenin, produced with a coryneform bacterial cell according to one of claims 1-8, 10-18 and 21 -27, and / or one or more proteins according to one of claims 8 or 19 and / or one or more nucleotide sequences according to one of claims 9 or 20 and / or a method according to one of claims 28-31.
35. Verwendung von Resveratrol, Naringenin und/oder Noreugenin hergestellt mit einer coryneformen Bakterienzelle gemäß einem der Ansprüche 1-8, 10-18 und 21-27 und/oder nach einem Verfahren gemäß einem der Ansprüche 28-31 und/oder die35. Use of resveratrol, naringenin and / or noreugenin produced with a coryneform bacterial cell according to one of claims 1-8, 10-18 and 21-27 and / or according to a method according to one of claims 28-31 and / or
Verwendung einer Zusammensetzung nach Anspruch 34 zur Herstellung von Pharmazeutika, Lebensmitteln, Futtermitteln, und/oder zum Einsatz in der Pflanzenphysiologie. Use of a composition according to claim 34 for the production of pharmaceuticals, food, feed, and / or for use in plant physiology.
EP19816511.0A 2018-10-26 2019-09-21 Provision of malonyl-coa in coryneform bacteria and method for producing polyphenoles and polyketides with coryneform bacteria Pending EP3870723A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE102018008670.5A DE102018008670A1 (en) 2018-10-26 2018-10-26 Provision of malonyl-CoA in coryneform bacteria as well as processes for the production of polyphenols and polyketides with coryneform bacteria
PCT/DE2019/000248 WO2020083415A1 (en) 2018-10-26 2019-09-21 Provision of malonyl-coa in coryneform bacteria and method for producing polyphenoles and polyketides with coryneform bacteria

Publications (1)

Publication Number Publication Date
EP3870723A1 true EP3870723A1 (en) 2021-09-01

Family

ID=68807957

Family Applications (1)

Application Number Title Priority Date Filing Date
EP19816511.0A Pending EP3870723A1 (en) 2018-10-26 2019-09-21 Provision of malonyl-coa in coryneform bacteria and method for producing polyphenoles and polyketides with coryneform bacteria

Country Status (6)

Country Link
US (1) US20220033786A1 (en)
EP (1) EP3870723A1 (en)
JP (1) JP7554183B2 (en)
CN (1) CN112969782A (en)
DE (1) DE102018008670A1 (en)
WO (1) WO2020083415A1 (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110713962B (en) * 2019-09-06 2022-06-21 南京农业大学 Genetic engineering bacterium for high-yield production of malonyl coenzyme A and construction method and application thereof
CN116536310A (en) * 2022-01-26 2023-08-04 廊坊梅花生物技术开发有限公司 Promoter, threonine-producing recombinant microorganism and application thereof
CN114606279A (en) * 2022-03-21 2022-06-10 陕西科技大学 Method for synthesizing naringenin by taking tyrosine as substrate

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS5835197A (en) 1981-08-26 1983-03-01 Kyowa Hakko Kogyo Co Ltd Plamid pcg 2
GB2165546B (en) 1984-08-21 1989-05-17 Asahi Chemical Ind A plasmid containing a gene for tetracycline resistance and dna fragments derived therefrom
DE19929365A1 (en) * 1999-06-25 2000-12-28 Basf Lynx Bioscience Ag New genes from Corynebacterium glutamicum, useful for modifying cells for production of primary or secondary metabolites, e.g. amino or fatty acids
US6884614B1 (en) * 1999-07-01 2005-04-26 Basf Aktiengesellschaft Corynebacterium glutamicum genes encoding phosphoenolpyruvate: sugar phosphotransferase system proteins
CN101416957B (en) * 2008-12-10 2011-06-01 亚宝药业集团股份有限公司 Use of resveratrol or naringenin in preventing and treating diabetic nephropathy
IN2012DN06617A (en) * 2010-01-27 2015-10-23 Opx Biotechnologies Inc
JP2016165225A (en) * 2013-07-09 2016-09-15 味の素株式会社 Method for producing useful substance

Also Published As

Publication number Publication date
JP7554183B2 (en) 2024-09-19
JP2022503822A (en) 2022-01-12
WO2020083415A1 (en) 2020-04-30
DE102018008670A1 (en) 2020-04-30
WO2020083415A8 (en) 2021-05-20
CN112969782A (en) 2021-06-15
US20220033786A1 (en) 2022-02-03

Similar Documents

Publication Publication Date Title
EP2041276B1 (en) Method for producing l-amino acids by means of mutants of the glta gene coding for citrate synthase
EP2862932B1 (en) Genes encoding biofilm formation inhibitory proteins and a method for producing l-lysine using a bacterial strain with the inactivated genes
EP2553113B1 (en) Process for producing l-ornithine employing lyse overexpressing bacteria
DE60030988T2 (en) Process for producing L-amino acids by increasing cellular NADPH
EP3870723A1 (en) Provision of malonyl-coa in coryneform bacteria and method for producing polyphenoles and polyketides with coryneform bacteria
DE69735192T2 (en) MICROBIC MANUFACTURE OF SUBSTANCES FROM AROMATIC METABOLISM / I
EP2692729A1 (en) Method for the biotechnological manufacture of dihydrochalcones?
KR101766964B1 (en) A microorganism of corynebacterium genus having L-lysine productivity and method for producing L-lysine using the same
WO2006116962A2 (en) Method for the fermentative production of l-valine, l-isoleucine or l-lysine using coryneform bacteria with reduced or eliminated alanine aminotransferase activity
KR101740807B1 (en) A microorganism of corynebacterium genus having L-lysine productivity and method for producing L-lysine using the same
EP2089525B1 (en) Allels of the oxyr gene of coryneform bacteria
DE60312592T2 (en) Process for the preparation of L-lysine using coryneform bacteria containing an attenuated malate enzyme gene
KR101429814B1 (en) Corynebacterium sp. microorganism having enhanced L-threonine productivity by regulation of GDH activity and a method of producing L-threonine using the same
EP1659174A2 (en) Alleles of the mtK gene from coryneform bacteria
WO2022161569A1 (en) Production of 3,4-dihydroxybenzoate from d-xylose using coryneform bacteria
EP1244776B1 (en) Tetrahydropyrimidine oxygenase gene, polypeptides encoded by said gene and method for producing the same
EP1841859B1 (en) Alleles of the mqo-gene from coryneform bacteria
EP1259622B1 (en) Nucleotide sequences encoding proteins that take part in the biosynthesis of l-serine, improved method for microbially producing l-serine, and genetically modified microorganism suitable for use in said method
EP3050971B1 (en) Process for the enzymatic production of a 4-O-methylated cinnamic acid amide
WO2015082441A1 (en) Shuttle vectors and expression vectors for amycolatopsis
DE102005049527B4 (en) Process for the preparation of L-serine, gene sequence, vectors and microorganism
EP2499253A2 (en) Microorganisms having enhanced sucrose mutase activity
DE10231297A1 (en) Nucleotide sequences of coryneform bacteria coding for proteins involved in the biosynthesis of L-serine and methods for producing L-serine
WO2020011294A1 (en) D-xylose dehydrogenase from coryneform bacteria and process for preparing d-xylonate
EP4389881A1 (en) Genetically modified microorganism and its use for the production of d-chiro-inositol

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20210420

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)