EP3820999A1 - D-xylose-dehydrogenase aus coryneformen bakterien und verfahren zur herstellung von d-xylonat - Google Patents

D-xylose-dehydrogenase aus coryneformen bakterien und verfahren zur herstellung von d-xylonat

Info

Publication number
EP3820999A1
EP3820999A1 EP19752074.5A EP19752074A EP3820999A1 EP 3820999 A1 EP3820999 A1 EP 3820999A1 EP 19752074 A EP19752074 A EP 19752074A EP 3820999 A1 EP3820999 A1 EP 3820999A1
Authority
EP
European Patent Office
Prior art keywords
nucleic acid
acid sequence
seq
xylose
xylonate
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP19752074.5A
Other languages
English (en)
French (fr)
Inventor
Niklas TENHAEF
Stephan Noack
Christian BRÜSSELER
Jan Marienhagen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Forschungszentrum Juelich GmbH
Original Assignee
Forschungszentrum Juelich GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Forschungszentrum Juelich GmbH filed Critical Forschungszentrum Juelich GmbH
Publication of EP3820999A1 publication Critical patent/EP3820999A1/de
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0006Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • C12N1/205Bacterial isolates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/40Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/42Hydroxy-carboxylic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y101/00Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01175D-Xylose 1-dehydrogenase (1.1.1.175)

Definitions

  • the present invention relates to a D-xylose dehydrogenase from coryneform bacteria, nucleic acid sequences coding therefor, corresponding living organisms, preferably coryneform bacteria, containing a D-xylose dehydrogenase with increased expression and / or activity of D-xylose dehydrogenase and corresponding uses ,
  • the present invention also relates to a method for producing D-xylonate with a D-xylose dehydrogenase from coryneform bacteria.
  • D-xylonic acid (C 5 H 10 O 6 ) is an organic acid that can serve as a precursor for polyamides, polyesters and 1, 2,4-butanetriol (Toivari et al. 2012; https: //doi.org/10.1007/ s00253-012- 4288-5) and thus has a broad application potential in the pharmaceutical industry, the food industry and in the chemical industry.
  • D-xylonate the salt of D-xylonic acid
  • D-xylonate is one of the top 30 potentially high-quality platform chemicals based on renewable raw materials of the 2nd generation (Werpy et al. 2004; http://www.dtic.mil/dtic /tr/fulltext/u2/a436528.pdf).
  • D-xylonate has the potential to replace D-gluconate (CeH O ? ), Which has a global market of 100 kt / year.
  • D-xylonate is naturally formed in some bacteria through a two-step reaction.
  • D-xylose is oxidized to D-xylonolactone, with specific dehydrogenases being catalytically active, depending on the organism.
  • the D-xylonolactone can then be converted to the D-xylonate either by specific lactonases or spontaneously (without an enzyme catalyst).
  • specific lactonases or spontaneously (without an enzyme catalyst).
  • D-xylonate production strains e.g. yeast of the species Saccharomyces cerevisiae, bacteria of the species Escherichia coli and fungi of the species Aspergillus niger
  • yeast of the species Saccharomyces cerevisiae bacteria of the species Escherichia coli and fungi of the species Aspergillus niger
  • D-xylose dehydrogenases e.g. B. from Caulobacter crescentus (Toivari et al., 2012https: //doi.org/10.1007/s00253-012- 4288-5; Liu et al. 2012; https://doi.Org/10.1016/j.biortech .2011.08.065; US Patent 2012/0005788 A1).
  • D-xylonate can be electrochemical (Jokic et al. 1991; https://doi.org/10.1007/BF01020216), enzymatic (Pezzotti & Therisod 2006; https://doi.Org/10.1016/j.carres. 2006.05.023) or by chemical oxidation (Isbell & Hudson 1932; Isbell HS, Hudson CS (1932) The course of the oxidation of the aldose sugars by bromine water. Bur Standards J Res 8: 327-338; https: / / archive. org / details / courseofoxidatio83327isbe).
  • D-xylonate can be produced by fermentation of strains of coryneform bacteria, in particular Corynebacterium glutamicum (Yim et al. 2017; https://doi.org/10.1002/biot.201700040, Choi et al 2018; https: //doi.org/10.1007/s00253-017- 8653-2).
  • the oxidation of D-xylose to D-xylonate is mediated by heterologous expression of the xylose dehydrogenase from Caulobacter crescentus.
  • the expression of heterologous systems with regard to use in the pharmaceutical or food industry is disadvantageous and undesirable. Because all previously known production strains with a D-xylonate synthesis capacity, such as. B. Gluconobacter oxydans, need complex media for their growth, which makes cultivation much more complex, expensive and therefore uneconomical.
  • WO 2017/220059 A1 discloses that the inactivation or deletion of the iolR gene coding for the regulator protein loIR on a defined medium with D-glucose and D-xylose as carbon and energy sources causes the formation of D-xylonate.
  • the gene cg0196 coding for the regulator loIR is in connection with the production of the amino acid L-lysine in Klaffl et al. (2013; https://doi.org/10.1128/JB.00265-13).
  • the deletion of ioIR leads to the expression of the myo-inositol gene cluster as well as further, an estimated 22 genes with previously unknown or not clearly annotated function (Klaffl et al., 2013). Negative physiological effects as a consequence of the deregulation of these approx. 22 genes cannot be excluded. Therefore represents a Bacterial strain alone with such an iolR deletion is not a usable platform for an industrially interesting production strain that should be genetically clearly defined.
  • the object of the present invention is to be independent of or to avoid heterologous gene expression for the microbial production of D-xylonate in coryneform bacteria. It is also an object of the present invention to avoid such interventions in the metabolism of coryneform bacteria which can have far-reaching undefined physiological effects, as is the case, for example, when one or more centrally acting regulators (such as, for example, the regulator protein loIR) are switched off, which influence a large number of genes or proteins in a cell. It is therefore a further object of the present invention to provide a homologous system and one or more homologous structural elements which enable microbial production of D-xylonate with coryneform bacteria and at the same time overcome known disadvantages. A further object of the present invention is to provide a method for the microbial production of D-xylonate in coryneform bacteria, in which the known disadvantages are overcome.
  • the present invention provides a protein with the activity of a D-xylose dehydrogenase from coryneform bacteria. Furthermore, the present invention also relates to the use of this D-xylose dehydrogenase according to the invention for the production of D-xylonate. In a variant of the present invention, D-xylonate is produced in a homologous system, preferably in coryneform bacteria.
  • the present invention also relates to a coryneform bacterial cell for producing D-xylonate, characterized in that it has an increased expression and / or increased activity of a homologous D-xylose dehydrogenase according to the invention.
  • a corynform bacterial cell is preferably selected from the group comprising Corynebacterium and Brevibacterium.
  • the present invention also relates to a nucleic acid sequence which codes for a D-xylonate dehydrogenase according to the invention from a coryneform bacterial cell.
  • the present invention also relates to a coryneform bacterial cell in which there is increased expression of the nucleic acid sequence coding according to the invention.
  • the present invention also encompasses a coryneform bacterial cell with the aforementioned properties, which is not recombinantly modified and thus represents a non-genetically modified system (non-GMO) for producing D-xylonate.
  • non-GMO non-genetically modified system
  • the invention thus includes corynform bacterial cells which represent a homologous system for D-xylonate production and in which IolR-mediated deregulation of D-xylose dehydrogenase is present without changing the expression and / or activity of the regulatory protein loLR itself.
  • the present invention thus also relates to a corynform bacterial cell which is distinguished in that the functionality of one or more operatively linked lolR binding sites in the regulatory, non-coding region of the nucleic acid sequence coding for the D-xylose dehydrogenase is reduced or switched off or is switched off one or more lolR binding sites are partially or completely deleted.
  • the present invention furthermore relates to a process for the microbial production of D-xylonate, preferably with coryneform bacteria, comprising the steps: a) providing a solution comprising water and a C5 carbon source, b) microbial reaction of the C5 carbon source in a solution according to step a) to D-xylonate in the presence of a coryneform bacterial cell according to the invention in which the expression of a nucleic acid sequence coding for a homologous D-xylose
  • Dehydrogenase is enhanced and / or in which the activity of a homologous D-xylose dehydrogenase is increased, and in which c) optionally D-xylonate is isolated and / or processed from the solution.
  • the present invention also relates to a process in which the microbial conversion to D-xylonate takes place in a solution comprising water and a C5-
  • Carbon source selected from the group comprising: a) oligosaccharides or polysaccharides containing D-xylose units, b) D-xylose, preferably in a concentration of at least 10 g L 1 , c) biomass containing lignocellulose, cellulose or hemicellulose, its hydrolyzate or extract obtained therefrom containing D-xylose units, and d) a combination of a) to c).
  • bagasse preferably cane sugar bagasse, the hydrolyzate or extract obtained therefrom containing D-xylose units is used as the C5 carbon source.
  • the invention also relates to the use of a D-xylose dehydrogenase according to the invention from coryneform bacteria, a nucleic acid sequence according to the invention coding for such a D-xylose dehydrogenase and coryneform bacterial cells according to the invention for the production of D-xylonate, preferably with coryneform bacterial cells.
  • a D-xylose dehydrogenase according to the invention from coryneform bacteria
  • a nucleic acid sequence according to the invention coding for such a D-xylose dehydrogenase and coryneform bacterial cells according to the invention for the production of D-xylonate, preferably with coryneform bacterial cells.
  • the invention also includes D-xylonate production by means of the D-xylose dehydrogenase according to the invention in a heterologous system.
  • the invention also relates to the use of D-xylonate, produced with a D-xylose dehydrogenase according to the invention, a coryneform bacterial cell according to the invention or according to a method or a composition according to the invention, for the production of pharmaceuticals, foods, animal feeds, solvents, colorants and / or Components from the building materials industry, preferably cement or concrete.
  • the present invention provides a D-xylose dehydrogenase isolated from coryneform bacteria and a nucleic acid sequence coding for such a protein from coryneform bacteria.
  • the present invention relates to a D-xylose dehydrogenase in which the amino acid quenz at least 70% identity to the amino acid sequence according to SEQ ID NO. 2 or fragments thereof.
  • Proteins coding for an amino acid sequence with at least 75 or 80%, preferably at least 81, 82, 83, 84, 85 or 86% identity, particularly preferably 87, 88, 89, 90% identity, very particularly preferably at least, are also encompassed according to the invention 91, 92, 93, 94, 95% identity or most preferably 96, 97, 98, 99 or 100% identity to the amino acid sequence according to SEQ ID NO. 2 or fragments thereof.
  • the present invention relates to a D-xylose dehydrogenase containing an amino acid sequence according to SEQ ID NO. 2 or fragments thereof.
  • the invention also relates to a D-xylose dehydrogenase encoded by a nucleic acid sequence containing at least 70% identity to the nucleic acid sequence according to SEQ ID NO. 1 or fragments or alleles thereof.
  • the invention also encompasses nucleic acid sequences which have at least one 75% or 80%, preferably at least 81, 82, 83, 84, 85 or 86% identity, particularly preferably 87, 88, 89, 90% identity, very particularly preferably at least 91, 92 , 93, 94, 95% identity or most preferably 96, 97, 98, 99 or 100% identity to the nucleic acid sequence according to SEQ ID NO. 1 or fragments or alleles thereof.
  • the present invention relates to a D-xylose dehydrogenase encoded by a nucleic acid sequence according to SEQ ID NO. 1 or fragments or alleles thereof.
  • the protein according to the invention or the nucleic acid sequence according to the invention is isolated from coryneform bacteria, selected from the group comprising Corynebacterium and Brevibacterium, in particular Corynebacterium glutamicum, Corynebacterium acetoglutamicum, Corynebacterium thermoaminogenes, Brevibacterium flavumium or Brevibacterium lactifer.
  • the protein according to the invention or the nucleic acid sequence according to the invention is isolated from coryneform bacteria, selected from the group comprising Corynebacterium glutamicum ATCC13032, Corynebacterium acetoglutamicum ATCC15806, Corynebacterium acetoacidophilum ATCC13870, Corynebacterium Brevmiumccum4039c, 394
  • a protein from corynform bacteria is provided, with which the production of D-xylonate from D-xylose in corynform bacteria, that is to say in a homologous system, is made possible for the first time.
  • Inositol-2-dehydrogenase (lolG EC 1.1.1.18, coded by iolG; Klaffl et al, 2013; https://doi.org/10.1128/JB.00265-13) has the D-xylose according to the invention
  • Dehydrogenase remarkably shows no inositol-2-dehydrogenase activity.
  • the D-xylose dehydrogenase according to the invention which enables the production of D-xylonate from D-xylose in corynform bacteria according to the invention, also has no significant homology to other known D-xylose dehydrogenases, such as xylB from Caulobacter crescentus , A protein with the structure and the specific function of the D-xylose dehydrogenase according to the invention from corynform bacteria is not yet known.
  • homologous target sequence from coryneform bacteria for the production of D-xylonate from D-xylose in coryneform bacteria (thus in a homologous system) is identified and provided.
  • homologous target sequence homologous "target”
  • coryneform bacteria for the production of D-xylonate from D-xylose in coryneform bacteria (thus in a homologous system)
  • isolating and providing a nucleic acid sequence according to the invention coding for a D-xylose dehydrogenase according to the invention, one or more new structural elements and variations thereof are thus made available, with the aid of which, preferably in corynform bacteria as a homologous system, from D-xylose D -Xylonat can be made.
  • the D-xylonate is produced in vitro, preferably enzymatically with an isolated D-xylose dehydrogenase according to the invention, or in the living organism, preferably microbially in bacteria, yeasts or fungi.
  • D-xylonate production is particularly preferably carried out in coryneform bacteria or organisms of the genus Saccharomyces or Aspergillus.
  • the present invention provides for the first time a homologous system for the production of D-xylonate with coryneform bacteria.
  • the D-xylonate is produced in vitro, preferably enzymatically with an isolated D-xylose dehydrogenase according to the invention, or in the living organism, preferably microbially in bacteria, yeasts or fungi. D-xylonate production is particularly preferably carried out in coryneform bacteria or organisms of the genus Saccharomyces or Aspergillus.
  • the present invention furthermore clearly shows that, according to the invention, minimal and extremely definite nucleotide substitutions in the 5'-upstream regulatory areas of the coding gene sequences for IoIT 1 and IolG can achieve a significantly increased D-xylonate production: And this without Genes or structures from heterologous organisms have to be introduced into the corynform bacterial strain, which would be undesirable and also without drastic deletions of central Acting regulators (loIR) must be carried out, which can trigger far-reaching undefined physiological effects in an organism.
  • the few targeted nukeotide substitutions according to the invention are to such an extent that they also occur naturally which distinguishes the coryneform bacterial strain according to the invention as non-GMO.
  • the present invention thus provides a variant for the first time of a homologous system for the production of D-xylonate with coryneform bacteria.
  • “Homologous” in the sense of the invention means that the D-xylonate dehydrogenase according to the invention and the nucleic acid sequence encoding it are related to a common starting strain of coryneform bacterial cells. According to the invention, “homolog” is used synonymously with the term “non-heterologous” ,
  • D-xylose dehydrogenase according to the invention or the nucleic acid sequence according to the invention coding for it only has an identity of approximately 15% to the best-described D-xylose dehydrogenase (XylB encoded by the xylB gene) from Caulobacter cresentus (FIG. 1 ).
  • the present invention relates to a nucleic acid sequence isolated from coryneform bacteria coding for a D-xylose dehydrogenase.
  • a variant of the present invention relates to a nucleic acid sequence isolated from coryneform bacteria coding for a D-xylose dehydrogenase for the production of D-xylonate, the production according to the invention taking place both in vitro and in living organisms.
  • D-xylonate in vitro production of D-xylonate, and here preferably an enzymatic production using the D-xylose dehydrogenase according to the invention in isolated form.
  • a production of D-xylonate in living organisms is preferred, particularly preferably a microbial production of D-xylonate in host cells selected from the group comprising coryneform bacteria, yeasts and fungi.
  • a microbial production of D-xylonate in host cells of the genus selected from the group comprising Corynebacterium, Brevibacterium, Saccharomyces, and Aspergillus is particularly preferred according to the invention.
  • nucleic acid sequences are selected from the group comprising a) a nucleic acid sequence containing at least 70% identity to the nucleic acid sequence according to SEQ ID NO. 1 or fragments or alleles thereof, or b) a nucleic acid sequence which under stringent conditions with a complementary sequence of a nucleic acid sequence according to SEQ ID NO.
  • the present invention relates to nucleic acid sequences according to the invention for the production of D-xylonate.
  • D-xylonate is preferably produced in living microorganisms, particularly preferably in coryneform bacteria.
  • the present invention also relates to a nucleic acid sequence which is distinguished in that the functionality of one or more operatively linked loIR binding sites in the regulatory, non-coding region of the nucleic acid sequence coding for the D-xylose dehydrogenase is reduced or switched off, or one or several operatively linked lolR binding sites are partially or completely deleted.
  • a “reduced or deactivated functionality” does not refer to the functionality of the D-xylose dehydrogenase according to the invention and the nucleic acid sequence according to the invention encoding it, but specifically to the changed functionality of the IolR binding sites to which the centrally acting normally Regulatory protein loIR binds, and thereby represses the expression of the coding nucleic acid sequence.
  • “Decreased” or “switched off” in the sense of the present invention means that the expression of the coding nucleic acid sequence is less or no longer under the expression control of the regulator loIR compared to the situation in a wild-type host cell.
  • “reduced” or “switched off”, equivalent to “deregulated” or “derepressed” is to be provided.
  • nucleic acid sequence in the sense of the present invention means any homologous molecular unit that transports genetic information. This concerns correspondingly a homologous gene, preferably a naturally occurring and / or non-recombinant homologous gene, and a homologous transgene or codon-optimized homologous genes. According to the invention, the term “nucleic acid sequence” refers to a nucleic acid sequence or fragments or alleles thereof which encode or express a specific protein.
  • nucleic acid sequence preferably refers to a nucleic acid sequence containing regulatory sequences which precede the coding sequence (upstream, upstream, 5 ' non-coding sequence) and follow it (downstream, downstream, 3 ' non-coding sequence).
  • naturally occurring gene refers to a gene found in nature, for example from a wild-type strain of a coryneform bacterial cell, with its own regulatory sequences.
  • operatively linked region relates to an association of nucleic acid sequences on a single nucleic acid fragment, so that the function of one nucleic acid sequence is influenced by the function of the other nucleic acid sequence.
  • operatively linked in the sense of the invention means that the coding sequence is under the control of the regulatory region (in particular the promoter or the regulatory binding site) that regulates the expression the coding sequence regulated.
  • ioIR itself (negative autoregulation), iolT 1, iolC (and the other genes organized with iolC in a cluster or operon) are regulated by IoIR.
  • the nucleic acid sequence according to the invention coding for a D-xylose dehydrogenase according to the invention (and annotated in its function as inositol-2 dehydrogenase, coded by iolG) is organized in coryneform bacteria in the gene cluster of the myo-inositol catabolism (Klaffl et al, 2013; https://doi.org/10.1128/JB.00265- 13). Since the first gene in this gene cluster is the iolC gene, it is referred to in the following as the iolC cluster.
  • the regulatory region operatively linked to the iolC cluster consequently also regulates the expression of the iolG gene and thus the nucleic acid sequence according to the invention coding for the D-xylose dehydrogenase according to the invention.
  • the present invention also means, for example, “genetic change”, which means according to the invention that although a genetic engineering method is used, no insertions of nucleic acid molecules are generated.
  • “changes” are substitutions and / or Deletions are meant, preferably substitutions.
  • “Change” or “genetic change” in the sense of the present invention are preferably generated in a regulatory, non-coding region of the nucleic acids according to the invention.
  • a variant of the present invention relates to a nucleic acid sequence with one or more nucleotide substitutions or nucleotide deletions in the operatively linked lolR binding sites of the iolC gene cluster.
  • Preferred variants within the meaning of the invention are those selected from the group of nucleic acid sequences according to SEQ ID No. 7 and SEQ ID NO. 8th.
  • coryneform bacterial cells By isolating and providing a D-xylose dehydrogenase and a nucleic acid sequence according to the invention coding for a D-xylose dehydrogenase from coryneform bacterial cells, homologous, genetically defined, non-recombinant (non-GMO) coryneform bacterial cells can be produced for the first time microbial, preferably fermentative, production of D-xylonate are suitable.
  • non-recombinant is to be understood to mean that the genetic material of the coryneform bacterial cells according to the invention is only changed in the way that it occurs naturally, e.g. through natural recombination or natural mutation.
  • the coryneform bacterial cells according to the invention are thus distinguished as a non-genetically modified organism (non-GMO).
  • the present invention thus provides a system with which the microbial production of D-xylonate can be carried out in a significantly simpler, more stable, cheaper and more economical manner. Because all previously known production strains with a D-xylonate synthesis capacity, such as. B. Gluconobacter oxydans, need complex media for their growth, which makes cultivation much more complex, expensive and therefore uneconomical. In addition, all D-xylonate producers described so far are "non-natural" genetically modified organisms (GMOs), among others various yeast, fungi and bacteria. This creates a disadvantage for use in certain industrial areas (e.g. food and pharmaceutical industries) due to complex approval procedures.
  • GMOs genetically modified organisms
  • coryneform bacteria preferably of the genus Corynebacterium, are a "Generally Recognized As Safe” (GRAS) organism that can be used in all industrial areas. Coryneform bacteria achieve high growth rates and biomass yields on defined media (Grünberger et al., 2012) and there is extensive experience in the industrial use of coryneform bacteria (Becker et al., 2012).
  • GRAS Generally Recognized As Safe
  • a variant of the present invention is also the use of the nucleic acid sequences according to the invention described above for the production of living organisms, preferably microorganisms, particularly preferably bacteria, yeasts or fungi, very particularly preferred the genus coryneform bacteria such as Corynebacterium or Brevibacterium, Saccharomyces or Aspergillus, in particular Corynebacterium glutamicum, Saccharomyces cerevisiae or Aspergillus niger, for the production of D-xylonate.
  • microorganisms particularly preferably bacteria, yeasts or fungi
  • genus coryneform bacteria such as Corynebacterium or Brevibacterium, Saccharomyces or Aspergillus, in particular Corynebacterium glutamicum, Saccharomyces cerevisiae or Aspergillus niger, for the production of D-xylonate.
  • nucleic acid sequences are selected from the group comprising SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 63 or SEQ ID NO. 64 or fragments or alleles thereof for the production of coryneform bacterial cells or other organisms suitable according to the invention for the production of D-xylonate.
  • the variants according to SEQ ID NO. 7 or SEQ ID NO. 63 of the nucleic acid sequences according to the invention contain nucleotide exchanges, ie
  • substitutions in the operatively linked promoter region of the iolC gene cluster containing the nucleotide sequence (iolG) coding for the D-xylose dehydrogenase according to the invention are substitutions in the operatively linked promoter region of the iolC gene cluster containing the nucleotide sequence (iolG) coding for the D-xylose dehydrogenase according to the invention.
  • the variants according to SEQ ID NO. 8 or SEQ ID NO. 64 of the nucleic acid sequences according to the invention contain nucleotide deletions in the operatively linked promoter region of the iolC gene cluster containing the nucleotide sequence (iolG) coding for the D-xylose dehydrogenase according to the invention.
  • Another variant of the present invention relates to the use of a nucleic acid sequence according to SEQ ID NO. 7 or 8 for the production of coryneform bacteria. According to the invention, the use of the
  • the present invention also relates to nucleic acid sequences containing nucleotide substitutions or deletions in the operatively linked promoter region of the iolT1 gene of the myo-inositol / proton symporter.
  • Preferred variants include nucleic acid sequences according to SEQ ID NO. 9 or SEQ ID NO. 10.
  • a preferred variant of the present invention relates to the use of a nucleic acid sequence as shown in SEQ ID NO. 9 or SEQ ID NO. 10, where the operatively linked lolR binding sites are deleted for the production of coryneform bacteria.
  • the present invention also relates to a coryneform bacterial cell for producing D-xylonate, characterized in that it has an increased expression and / or increased activity of a homologous D-xylose dehydrogenase according to the invention.
  • “increased” is synonymous with “increased” or “improved”, “changed” or “deregulated” and is used synonymously. “Increased” in the sense of the present invention means, for example, the increased gene expression of a gene compared to the expression of the respective starting gene in the unchanged, naturally not increased state. The same is meant in the sense of the invention with regard to the increased enzyme activity.
  • the wild type of a coryneform bacterial cell represents a genetically unmodified starting gene or enzyme.
  • coryneform wild type cells of the genus Corynbacterium or Brevibacterium are particularly preferred; coryneform bacterial cells of the wild type Corynebacterium glutamicum ATCC 13032 are very particularly preferred.
  • a variant of the present invention comprises a coryneform bacterial cell which is distinguished in that it has an increased expression of a nucleic acid sequence in accordance with one of the variants described above.
  • Another variant of a coryneform bacterial cell according to the invention is characterized in that the increased expression of the D-xylose dehydrogenase is based on changes from the group comprising a) changing the regulation or signal structures for gene expression, b). Changing the transcription activity of the coding nucleic acid sequence, or c) increasing the number of gene copies of the coding nucleic acid sequence.
  • the invention includes changes in the signal structures of gene expression, such as, for example, by changing the repressor genes, activator genes, operators, promoters; Attenuators, ribosome binding sites, the start codon, terminators. Also included are the introduction of a stronger promoter, such as the tac promoter or an IPTG-inducible promoter.
  • a stronger promoter e.g. B. the tac promoter (Amann et al (Gene 1988 69: 301-15), or promoters from the group of promoters described in Patek et al (Microbiology 1996 142: 1297) is preferred, but not limiting, for the present invention.
  • An increased gene copy number of the nucleic acid sequence coding according to the invention can be chromosomally coded or vector-based, preferably plasmid-coded, in further variants of the invention coryneform bacterial cell e in which the increase in the number of copies is chromosomally-coded or extra-chromosomally-coded, preferably vector-coded or plasmid-coded.
  • suitable plasmids are those which are replicated in coryneform bacteria. Numerous known plasmid vectors such as e.g. B.
  • pZ1 (Menkel et al., Applied and Environmental Microbiology (1989) 64: 549-554), pEKExl (Eikmanns et al., Gene 102: 93-98 (1991)) or pHS2-1 (Sonnen et al., Gene 107: 69-74 (1991)) are based on the cryptic plasmids pHM1519, pBL1 or pGA1.
  • Other plasmid vectors such as e.g. B.
  • pCG4 US-A 4,489,160
  • pNG2 Serwold-Davis et al., FEMS Microbiology Letters 66, 119-124 (1990)
  • pAG1 US-A 5,158,891
  • Vectors with controllable expression can also be used, for example pEKEx2 (B. Eikmanns, 1991 Gene 102: 93-8; O. Kirchner 2003, J. Biotechnol. 104: 287-99).
  • the gene can also be expressed by integration into the chromosome in a single copy (P. Vasicova 1999, J. Bacteriol.
  • Another variant of the present invention relates to a coryneform bacterial cell, characterized in that the increased activity of the D-xylose dehydrogenase activity is based on changes selected from the group comprising a) an increase in the expression of the coding nucleic acid sequence, b) an expression of a nucleic acid sequence or fragments thereof, which codes for a D-xylose dehydrogenase with increased catalytic activity and / or substrate specificity, c) an increase in the stability of the mRNA derived from the coding nucleic acid sequence, or d) a change in the catalytic activity and / or substrate specificity of a homologous one D-xylose dehydrogenase for the conversion of D-xylose or a combination of a) - d).
  • the increase in mRNA stability can be achieved, for example, by mutating the terminal positions which control the termination of the transcription. Measures which lead to a change in the catalytic properties of enzyme proteins, in particular to a changed substrate specificity, are known from the prior art. In addition to partial or complete deletions of regulatory structures preferred according to the invention, changes such as e.g. B. includes transitions, transversions or insertions, as well as methods of directed evolution. Instructions for generating such changes can be found in well-known textbooks (R. Knippers "Molecular Genetics", 8th edition, 2001, Georg Thieme Verlag, Stuttgart, Germany).
  • a preferred variant of the present invention comprises a coryneform bacterial cell in which the functionality of one or more operatively linked lolR binding sites in the regulatory, non-coding region of the nucleic acid sequence coding for the D-xylose dehydrogenase is reduced or switched off or one or more lolR- Binding points are partially or completely deleted.
  • the present invention also relates to a coryneform bacterial cell which has a
  • Nucleic acid sequence with one or more nucleotide substitutions or nucleotide deletions in the operatively linked lolR binding sites of the iolC gene cluster (containing the nucleic acid sequence iolG coding for the D-xylose dehydrogenase according to the invention).
  • Preferred variants according to the invention include Sequences selected from the group of SEQ ID NO. 7 and SEQ ID NO. 8. Further variants according to the invention comprise sequences selected from the group comprising SEQ ID NO. 63 and SEQ ID NO. 64th
  • the present invention further relates to a coryneform bacterial cell which has a nucleic acid sequence with one or more nucleotide substitutions or nucleotide deletions in the operatively linked lolR binding sites of the iolT1 gene.
  • Variants according to the invention comprise sequences selected from the group of nucleic acid sequences SEQ ID NO. 9 and SEQ ID NO. 10th
  • An advantage of the change according to the invention of the IolR binding sites in the regulatory region which is assigned to the nucleic acid sequence coding for the D-xylose dehydrogenase according to the invention is that the coryneform bacteria according to the invention are changed non-recombinantly. It is particularly advantageous that the lolR regulator protein itself or the correspondingly coding iolR gene is not changed. This has the enormous advantage that negative physiological effects as a consequence of inactivation of iolR / loIR are excluded. As non-GMOs, the bacterial cells according to the invention thus represent a very attractive platform for the large-scale or industrial production of D-xylonate in a homologous system.
  • the present invention thus also relates to a coryneform bacterial cell which has not been modified in a recombinant manner.
  • a coryneform bacterial cell is also included which is not genetically modified (non-GMO).
  • the present invention also relates to a coryneform bacterial cell in which the increased copy number of a D-xylose dehydrogenase according to the invention encodes
  • Nucleic acid sequence is chromosomally encoded.
  • the present invention also relates to a coryneform bacterial cell in which the increased copy number of a nucleic acid sequence coding for D-xylose dehydrogenase according to the invention is vector-coded, preferably plasmid-coded.
  • Preferred variants of the present invention include coryneform bacteria in which the iolG gene is chromosomally-encoded and is present in an increased number of copies corresponding lolR binding sites are deleted.
  • the coryneform bacterial cell according to the invention additionally has an iolT1 gene which has been changed by deletions and which is therefore expressed independently of the lolR.
  • D-xylonate in addition to increasing the xylose dehydrogenase activity, to change the expression or activity of one or more other genes or proteins which are also regulated by the regulator protein loIR.
  • IoIT 1 myo-inositol / proton symporter
  • a corynform bacterial cell there is a deregulated iolT1 gene in which there is also an increased expression and / or increased activity of the D-xylose dehydrogenase according to the invention.
  • the iolT2 gene is also relevant for D-xylose catabolism.
  • a coryneform bacterial cell containing an increased expression of the iolT2 gene and / or an increased activity of the myo-inositol / proton symporter lolT2 are included according to the invention.
  • the present invention relates to a coryneform bacterial cell a) in which the activity of a D-xylose dehydrogenase according to the invention is increased, b) in which one nucleic acid sequence according to the invention coding for a D-xylose dehydrogenase according to the invention is expressed more intensely, c) in which a nucleic acid sequence coding for a myo-inositol / proton symporter (IoIT 1) according to SEQ ID NO. 3 or fragments or alleles thereof is increasingly expressed, d) in which a myo-inositol / proton symporter IoIT 1 with an amino acid sequence according to SEQ ID NO.
  • IoIT 1 myo-inositol / proton symporter
  • e) which selected a nucleic acid sequence coding for a myo-inositol / proton symporter (IoIT 1) with one or more nucleotide substitutions or nucleotide deletions in the operatively linked lolR binding sites of the iolT1 gene the group of nucleic acid sequences SEQ ID NO. 9 and SEQ ID NO. 10 or fragments thereof, f) in which a nucleic acid sequence coding for a myo-inositol / proton symporter (lolT2) according to SEQ ID NO.
  • IoIT 1 myo-inositol / proton symporter
  • a coryneform bacterial cell comprises defined changes in its genome, namely that of a deregulated iolT1 gene and a deregulated iolG gene. Changes in the regulatory regions of the iolT-1 gene and / or iolG gene (or of the iolC gene cluster containing the iolG gene) are further preferred. In particular, substitutions or deletions of the binding sites of the lolR regulator protein are preferred here. Deletions are further preferred.
  • the bacterial cells according to the invention are not genetically modified and do not have any recombinant DNA, which makes them non-GMOs for use in the large-scale production of D-xylonate, such as. B.
  • a nucleic acid sequence coding for a myo-inositol regulator loIR or fragments or alleles thereof can be completely or partially deleted or the expression of an iolR gene can be reduced or absent or a myo-inositol regulator loIR in it Activity reduced or completely switched off.
  • Preferred variants of a coryneform bacterial cell are selected from the group comprising Corynebacterium, Brevibacterium, in particular Corynebacterium glutamicum, Corynebacterium acetoglutamicum, Corynebacterium thermoaminogenes, Brevibacterium flavum, Brevibacterium lactofermentum or Brevibacterium divaricatum.
  • coryneform bacterial cell is selected from the group comprising Corynebacterium glutamicum ATCC13032, Corynebacterium acetoglutamicum ATCC15806, Corynebacterium acetoacidophilum ATCC13870, Corynebacterium thermoaminogenes FERM BP-1539, Brevibacter1c450umumumumumumum 140um Breumibacterium bacterium flavumum 140um, or Brevibacterium bacterium 138fumum 140um Breumibacterium 138fumlumumum is Corynebacterium glutamicum.
  • a D-xylose dehydrogenase according to the invention, a nucleic acid sequence according to the invention encoding it and a use according to the invention are also suitable for the production of D-xylonate in the broadest sense, in which e.g. a homologous expression system is not absolutely necessary.
  • heterologous systems or host cells or organisms are also encompassed which have the D-xylose dehydrogenase according to the invention and / or the nucleic acid sequence according to the invention encoding them and / or in which the use of the aforementioned elements (such as (regulatory)) Sequences, genes, proteins) or a process for the production of D-xylonate.
  • the invention thus encompasses both a coryneform bacterial cell and also a heterologous host system in which the expression of the iolR gene is reduced or missing, or the iolR gene is partially or completely deleted, or the activity of the lolR regulator protein is reduced or is completely switched off ,
  • D-xylonate preferably an enzymatic production with the aid of a purified D-xylose dehydrogenase according to the invention.
  • a microbial production of D-xylonate in host cells selected from the group containing coryneform bacteria is preferred, Yeast and mushrooms.
  • a microbial production of D-xylonate in host cells of the genus selected from the group comprising Corynebacterium, Brevibacterium, Saccharomyces, and Aspergillus is particularly preferred according to the invention.
  • a microbial production of D-xylonate in Corynebacterium is very particularly preferred according to the invention.
  • D-xylose production with Saccharomyces cerevisiae, Aspergillus niger or Corynebacterium glutamicum is also included.
  • the invention also relates to a use of the D-xylose dehydrogenase according to the invention or the nucleic acid sequence according to the invention encoding it for use in heterologous systems or in vitro systems for the biotechnological production of D-xylonate from D-xylose.
  • the present invention relates to a process for the preparation of D-xylonate, comprising the steps: a) providing a solution comprising water and a C5 carbon source, b) microbial conversion of the C5 carbon source in a solution according to step a)
  • D-xylonate in the presence of a coryneform bacterial cell according to the invention in which the expression of a nucleic acid sequence coding for a homologous D-xylose dehydrogenase is increased and / or in which the activity of a homologous D-xylose dehydrogenase is increased, and c) optional isolation and / or preparation of D-xylonate from the solution.
  • solution is to be understood as meaning “medium”, “culture medium”, “culture broth” or “culture solution”.
  • microbial is to be understood as synonymous with “biotechnological” or “fermentative”.
  • implantation is to be understood as synonymous with “metabolism”, “metabolism” or “cultivation”.
  • preparation is to be understood synonymously as “separation”, “concentration” or “purification”.
  • a coryneform bacterial cell according to the invention comprises a method in which the D-xylose dehydrogenase in step b) has an amino acid sequence of at least 70% identity to the amino acid sequence according to SEQ ID NO. 2 or fragments thereof or is encoded by a nucleic acid sequence which is at least 70% identical to the Nucleic acid sequence according to SEQ ID NO. 1 or fragments or alleles thereof.
  • Another variant of the present invention comprises a method using a coryneform bacterial cell according to the invention a) in which the activity of a D-xylose dehydrogenase according to the invention is increased, b) in which a nucleic acid sequence according to the invention coding for a D-xylose dehydrogenase according to the invention is expressed more strongly , c) in which a nucleic acid sequence coding for a myo-inositol / proton symporter (IoIT 1) according to SEQ ID NO.
  • IoIT 1 myo-inositol / proton symporter
  • a myo-inositol / proton symporter IoIT 1 with an amino acid sequence according to SEQ ID NO. 4 or fragments thereof in its activity is increased
  • coryneform bacterial cell which has a nucleic acid sequence coding for a myo-inositol regulator loIR or fragments thereof which are completely or partially deleted or in which the expression of an iolR gene is reduced or missing or a myolinosol regulator loIR that is reduced in activity or is completely switched off.
  • the present invention relates to a process in which the microbial conversion to D-xylonate takes place in a solution containing water and a C5 carbon source selected from the group comprising: a) oligosaccharides or polysaccharides containing D-xylose units, b ) D-xylose, preferably in a concentration of at least 10 gL 1 , c) biomass containing lignocellulose, cellulose or hemicellulose, its hydrolyzate or extract obtained therefrom containing D-xylose units, and d) a combination of a) to c).
  • a C5 carbon source selected from the group comprising: a) oligosaccharides or polysaccharides containing D-xylose units, b ) D-xylose, preferably in a concentration of at least 10 gL 1 , c) biomass containing lignocellulose, cellulose or hemicellulose, its hydrolyzate or extract obtained therefrom containing D-xylose units
  • bagasse preferably cane sugar bagasse
  • the hydrolyzate or extract obtained therefrom containing D-xylose is used as the C5 carbon source.
  • a variant of the method according to the invention comprises a method in which the culture solution contains D-glucose, preferably at least 8-10 g L 1 , in addition to D-xylose as carbon and energy sources at the beginning of the cultivation.
  • the culture medium to be used should suitably meet the requirements of the respective microorganisms. Descriptions of culture media of various microorganisms are contained in the manual “Manual of Methods for General Bacteriology” of the American Society for Bacteriology (Washington DC, USA, 1981).
  • sugar and carbohydrates such as glucose can be used as the carbon source , Sucrose, lactose, fructose, maltose, molasses, starch and cellulose, oils and fats such as soybean oil, sunflower oil, peanut oil and coconut fat, fatty acids such as palmitic acid, stearic acid and linoleic acid, alcohols such as glycerin and ethanol and organic acids such as acetic acid.
  • oils and fats such as soybean oil, sunflower oil, peanut oil and coconut fat
  • fatty acids such as palmitic acid, stearic acid and linoleic acid
  • alcohols such as glycerin and ethanol
  • organic acids such as acetic acid.
  • Malt extract, corn steep liquor, soybean meal and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate can be used.
  • the nitrogen sources can be used individually or as a mixture.
  • Potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts can be used as the source of phosphorus.
  • the culture medium should also contain salts of metals, such as magnesium sulfate or iron sulfate, which are necessary for growth.
  • essential growth substances such as amino acids and vitamins in addition to the substances mentioned above.
  • the feedstocks mentioned can be added to the culture in the form of a single batch or added in a suitable manner during the cultivation.
  • basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or acidic compounds such as hydrochloric acid, phosphoric acid or sulfuric acid are used in a suitable manner .
  • Anti-foaming agents such as fatty acid polyglycol esters can be used to control the development of foam.
  • suitable selectively acting substances for example antibiotics, can be added to the medium.
  • oxygen or oxygen-containing gas mixtures such as air are introduced into the culture.
  • the temperature of the culture is usually 20 ° C to 45 ° C and preferably 25 ° C to 40 ° C.
  • the culture continues until a maximum of D-xylonate has formed. This goal is usually achieved within 10 hours to 160 hours.
  • the present invention relates to methods in which the cultivation is carried out discontinuously or continuously, preferably in batch, fed-batch, repeated fed-batch mode or as a one-pot hydrolysis fermentation process.
  • a preferred variant of a method according to the invention takes place in fed-batch mode.
  • the "feeding" of D-xylose is particularly preferred.
  • the invention also includes a method in which the coryneform bacterial cell according to the invention is cultivated in a solution which additionally contains D-glucose, preferably in concentrations of at least 8-10 g L 1 .
  • the invention also includes a method in which a coryneform bacterial cell according to the invention is cultivated in a solution which additionally contains components selected from the group: a) nitrogen, preferably ammonium chloride, b) phosphate, preferably potassium phosphate, c) biotin, and d) a combination of a) - c).
  • This method is particularly preferred in the cultivation of a coryneform bacterial cell according to the invention with bagasse, preferably cane sugar bagasse, its hydrolyzate or extract obtained therefrom containing D-xylose as C5 carbon source.
  • bagasse preferably cane sugar bagasse, its hydrolyzate or extract obtained therefrom containing D-xylose as C5 carbon source.
  • Biotin is not absolutely necessary for the cultivation on bagasse, preferably hydrolyzed bagasse.
  • a coryneform bacterial cell is used which is not recombinantly modified.
  • the invention also encompasses a method in which a coryneform bacterial cell is used which is not genetically modified (non-GMO).
  • the present invention also relates to the use of a D-xylose dehydrogenase according to the invention or a nucleic acid sequence according to the invention or a coryneform bacterial cell according to the invention for producing D-xylonate.
  • D-xylonate is produced in vitro with purified enzyme.
  • the invention also relates to the use of a D-xylose dehydrogenase according to the invention or a nucleic acid sequence according to the invention for producing a host system selected from the group comprising coryneform bacteria, preferably Corynebacterium or Brevibacterium, yeasts, preferably Saccharomyces, and fungi, preferably Aspergillus.
  • a nucleotide sequence selected from the group SEQ ID NO is also included. 9 or SEQ ID NO. 10, preferably in combination with a nucleic acid sequence according to the invention, for the production of coryneform bacterial cells for the production of D-xylonate.
  • a preferred variant of the present invention is used for the microbial production of D-xylonate Corynebacterium glutamicum.
  • the present invention further relates to a composition
  • a composition comprising D-xylonate produced with a purified enzyme, an enzyme encoded by a nucleic acid sequence, a coryneform bacterial cell or a method according to the described variants of the present invention.
  • the composition according to the invention can contain further substances which are advantageous in the production of the desired products. A selection is known to the person skilled in the art from the prior art.
  • the present invention also relates to the use of D-xylonate produced with a purified enzyme, an enzyme encoded by a nucleic acid sequence, a coryneform bacterial cell or by a method according to the described variants of the present invention, and the use of a composition mentioned above for the production of pharmaceuticals, foodstuffs, animal feed, solvents, colorants and / or components of the building materials industry, preferably cement or concrete.
  • D-Xylonat has the potential to specifically improve the properties of cement or concrete. According to the invention, it is used as a water reducer, dispersant or retarder to extend the setting time of cement or concrete or other building materials. Tables and figures:
  • Table 1 shows an overview of bacterial strains and plasmids of the present invention.
  • the different strains C. glutamicum ATCC13032 iolG ⁇ C. glutamicum ATCC13032 iolG 2 and C. glutamicum ATCC13032 iolG 3 represent three integration strains of C. glutamicum ATCC 13032 with different numbers of iolG copies.
  • the strain C. glutamicum ATCC13032 / o / G 1 has an integration of the homologous iolG gene in the chromosome, specifically in the intergenic region between the C. cg 1121 and cg1122.
  • iolG 2 is based on iolG 1 and also contains a second integration of the homologous iolG gene in the intergenic region between cg0901 and cg0902.
  • iolG 3 is based on iolG 2 and also contains a third integration of the homologous iolG gene in the intergenic region between cg3327 and cg3328.
  • Table 2 shows an overview of the SEQ ID NO's of the present invention
  • FIG. 1 shows a homology comparison of the amino acid sequences (FIG. 1b) and nucleic acid sequences (FIG. 1a) coding for one of the D-xylose dehydrogenases (lolG) according to the invention from Corynebacterium glutamicum and the D-xylose dehydrogenase (XylB) Caulobacter crescentus.
  • LolG D-xylose dehydrogenases
  • FIG. 2 shows the plasmid pk19 mobsacB P 06 iolT1 with which nucleotide substitutions according to the invention were generated in the operatively linked regulatory binding region of the myolinositol transporter gene iolT 1 in the chromosome of Corynebacterium glutamicum.
  • FIG. 3 shows the position of the nucleotide substitutions according to the invention in the regulatory binding site of the myo-inositol transporter gene iolT 1 in comparison to the wild type. Relative to the start codon of IolT 1, a nucleotide was exchanged at positions -112 (C—> G) and -113 (A—> G). This corresponds to positions 665 and 666 in the overall sequence of the iolT1 gene according to the invention from FIG. 3, in which the nucleotides AC against
  • FIG. 4 shows the plasmid pk19 mobsacB P 0i3 iolC with the nucleotide substitutions according to the invention in the operatively linked regulatory binding region of the carbohydrate kinase gene iolC (of the iolC cluster containing iolG) in the chromosome of Corynebacterium glutamicum.
  • FIG. 5 shows the position of the nucleotide substitutions according to the invention in the regulatory binding site of the iolC gene in comparison to the wild type.
  • This regulatory region (before iolC) represents the regulatory region of the nucleic acid sequence operatively linked according to the invention coding for the D-xylose dehydrogenase according to the invention, since the iolG gene is in a cluster, the so-called iolC cluster of the myo-insitol catabolism , is organized. Relative to the start codon of IolC, one nucleotide each was exchanged at positions -59 (C-G) and -60 (A - + G).
  • Figure 6 shows the plasmid pK19 mobsacB P05- 09 iolC with the present invention Nukleotidsub- stitutionen in the operatively-linked regulatory binding region of the gene Carbohydratkinase- iolC (iolC the cluster containing iolG) in the chromosome of Corynebacterium glutami- cum were produced.
  • FIG. 7 shows the position of the nucleotide substitutions according to the invention in the regulatory binding site of the iolC gene in comparison to the wild type.
  • This regulatory region (before iolC) represents the regulatory region of the nucleic acid sequence operatively linked according to the invention coding for the D-xylose dehydrogenase according to the invention, since the iolG gene is in a cluster, the so-called iolC cluster of the myo-insitol catabolism , is organized.
  • Relative to the start codon of IolC a nucleotide was exchanged at positions -240 (A-> G), -239 (C-> G), -174 (A-> G) and -173 (C-> G). This corresponds to positions 143, 144, 211 and 212 in the overall sequence of the iolC gene according to the invention from FIG. 7, in which the nucleotides AC were substituted for GG.
  • Substitution is located 5 'upstream of the -10 box and the transcription start site (TSS) of the iolC gene.
  • TSS transcription start site
  • FIG. 8 shows plasmid pk19mo /) sacß_D iolG with which the nucleic acid sequence iolG coding for the D-xylose dehydrogenase according to the invention in the chromosome of Corynebacterium glutamicum was deleted.
  • FIG. 9 shows plasmid pk19 mobsacB ncr cons Ptuf / o / G with which the nucleic acid sequence iolG coding for the D-xylose dehydrogenase according to the invention in the chromosome of Coryne bacterium glutamicum was integrated into the intergenic region between cg1121 and cg1122 under the control of the constitutive Tuf promoter.
  • FIG. 10 shows plasmid pk19mobsacB CgLP4 P Tuf / o / G with which the nucleic acid sequence iolG coding for the D-xylose dehydrogenase according to the invention in the chromosome of Corynebacterium glutamicum under the control of the constitutive Tuf promoter was integrated into the intergenic region between cg0901 and cg0902.
  • FIG. 11 shows plasmid pk19mobsacB CgLP12 P Tuf iolG with which the nucleic acid sequence iolG coding for the D-xylose dehydrogenase according to the invention in the chromosome of Corynebacterium glutamicum was integrated into the intergenic region between cg3227 and cg3228 under the control of the constitutive Tuf promoter.
  • FIG. 12 shows plasmid pEKEx3 / o / G with which the nucleic acid sequence iolG coding for the D-xylose dehydrogenase according to the invention was increasingly expressed in Corynebacterium glutamicum.
  • FIG. 13 shows plasmid pET28b / ' o / G with which the nucleic acid sequence iolG coding for the D-xylose dehydrogenase according to the invention was increasingly expressed in Escherichia coli BL21.
  • FIGS. 14 and 15 show growth, D-xylose uptake or accumulation and the D-xylonate formation of different variants of coryneform bacterial strains.
  • FIG. 16 shows the D-xylonate formation of different variants of coryneformer Bacterial strains.
  • FIG. 17 shows the calibration of the absorption signal at 340 nm in the kinetic assay for NADH concentration in mM (blue dots). The valid calibration was set to the range 0 to 1 mM NADH and the corresponding regression line (dashed red line) with associated parameters, their values and errors are shown.
  • FIG. 18 shows conversion curves for the D-xylose dehydrogenase lolG according to the invention with D-xylose as substrate, for different D-xylose concentrations used (25 mM top left to 1 mM bottom right). The absorption measurements recorded are shown for a duration of 20 minutes.
  • FIG. 19 shows conversion curves for lolG with myo-inositol as substrate, illustration analogous to FIG. 18.
  • FIG. 20 shows the calculation of the initial reaction rates for D-xylose conversion with 10 g.
  • the formations of NADH are shown in mM after calibration of the absorption signal after approx. 2.5 minutes for 10 successive measurements (blue dots, duration approx. 2 minutes), each for different D-xylose concentrations from 25 mM (top left) to 1 mM (bottom right).
  • the respective initial reaction rates (red lines) result from the slope of the regression line in mM / min, the respective parameters of the calibration line with values and errors are shown in the individual legends.
  • FIG. 21 shows the parameter estimation of the Michaelis-Menten enzyme kinetics from initial reaction rates in the conversion of D-xylose by the D-xylonate dehydrogenase lolG according to the invention (black dots).
  • the parameters were determined using weighted non-linear regression assuming normally distributed measurement errors and thus correspond to the maximum likelihood estimator of the parameters of the Michael-Menten kinetics.
  • the resulting kinetics are shown as a black dashed line, and shaded areas additionally show kinetics based on random values, corresponding to the 2-dimensional normal distribution with covariance matrix of the maximum likelihood Estimator.
  • two PCR products were generated in a first step, which the 5 'region before the iolT1 gene (primer: PromiolT1_fw_fw / PromiolT1fw_rev) with the two nucleotides to be exchanged or the 3' region of the gene (primer: Piolt1_rev_fw / Pi-olt1_rev_rev) included.
  • the later homologous recombination 500 base pairs of the flanking regions were amplified.
  • the DNA fragments were fused together with the pk19mobsacß vector already cut via the restriction endonucleases xBal and EcoRI using Gibson assembly (Gibson et al., 2009) (https://doi.org/10.1038/NMETH.1318).
  • This plasmid pK19 / 77obsacß_P06 / ' o / T / thus obtained was transformed into E. coli DH5a by means of heat shock. Due to the kanamycin resistance gene present on the plasmid, only those clones that had taken up the plasmid could grow.
  • the mixture was opened in 4 mL BHIS medium preheated to 46 ° C. and incubated for 6 min at 46 ° C. The cells were then incubated for two hours at 30 ° C. at 170 rpm and the suspension was plated onto BHIS-Kan15 agar - Gene tested by transferring the clones onto BHI-Kan25 agar and onto BHI-Kan25 agar with 10% sucrose.
  • the cells cultured on BHI-Kan25 were kept for approx h in 5 ml of BHI medium and 100 ⁇ l of the culture and a 1:10 dilution were plated on BHI agar with 10% sucrose
  • the clones were on BHI-Kan25 agar and BHI agar with 10% sac transfer charose.
  • a colony PCR (primer: checkPromiolTlfw / checkPromiolTI rev) was carried out from the sucrose-resistant and kanamycin-sensitive clones with subsequent DNA sequencing in order to confirm the successful nucleotide substitutions.
  • PromiolT1_fw_fw TGCATGCCT GCAGGTCGACT G AAAAATT GAT CAGCAAACACC
  • PromiolTI fw_rev GGCAGACACGATATCCCCCGTCAATCGTACATAGGGAA
  • Pioltl _rev_fw CGGGGGATATCGTGTCTGCCACGATTAAAG
  • pioltl _rev_rev TT GT AAAACGACGGCCAGTGGAGT CCAAGAAGCACACG
  • a first step two PCR products were generated, the 5 'region in front of the iolC gene (primer: P013 iolC fw / P013 iolC rev) with the two nucleotides to be exchanged and the 3' region of the gene (Primer: P013 iolC rev_fw / P013 iolC rev_rev) included.
  • P013 iolC rev_fw / P013 iolC rev_rev 500 base pairs of the flanking regions were amplified.
  • the DNA fragments were fused together with the pk19mobsacß vector already cut via the restriction endonucleases xBal and EcoRI (Gibson et al., 2009) (https://doi.org/10.1038/NMETH.1318 ).
  • This plasmid pK19mobsacß_P013 / o / C thus obtained was transformed into E. coli DH5a by means of heat shock. Due to the kanamycin resistance gene present on the plasmid, only those clones that had taken up the plasmid could grow.
  • the mixture was overlaid with 800 pL, 4 ° C cold, 10% glycerol (v / v) and electroporated in an electroporator (2500 V, 25 pF, 200 W, 2 mm) transfer the mixture to 4 mL, preheated to 46 ° C, BHIS medium and incubate for 6 min at 46 ° C.
  • the cells were then incubated for two hours at 30 ° C. at 170 rpm and the suspension was plated onto BHIS-Kan15 agar.
  • the function of the sacB gene was then tested by transferring the clones onto BHI-Kan25 agar and onto BHI-Kan25 agar with 10% sucrose.
  • the cells cultured on BHI-Kan25 were cultivated for 5 h in 5 ml of BHI medium and 100 ⁇ l of the culture and a 1:10 dilution on BHI agar with 10% sucrose plated.
  • the clones were transferred to BHI-Kan25 agar and BHI agar with 10% sucrose.
  • a colony PCR (primer: Check Prom iolC fw / Check Prom iolC_rev) was carried out from the sucrose-resistant and kanamycin-sensitive clones with subsequent DNA sequencing in order to confirm the successful nucleotide substitution.
  • P013 iolC rev GACCCT CACGATCGCATCCCAT GACAAT AACAC
  • the DNA fragments together with the pk19mojbsacß vector which had already been cut via the restriction enducleases Xbal and EcoRI were obtained using Gibson Assembly merged (Gibson et ai, 2009) (DOI: 10.1038 / NMETH.1318).
  • This plasmid thus obtained was transformed into E. coli DH5a by means of heat shock. Due to the kanamycin resistance gene present on the plasmid, only those clones which had taken up the plasmid could grow. These were checked for the presence of the cloned insert by means of colony PCR and subsequent gel electrophoresis, and its DNA sequence was determined.
  • a 150 ⁇ l aliquot of electrocompetent C. glutamicum ATCC13032 ROQ iolT1 cells was thawed on ice, this was mixed with 1-4.5 pg of the plasmid and transferred to a 0.2 cm electroporation cuvette pre-cooled on ice.
  • the mixture was overlaid with 800 pL, 4 ° C cold, 10% glycerol (v / v) and electroporated in an electroporator (2500 V, 25 pF, 200 W, 2 mm). After the electroporation, the mixture was opened in 4 mL Preheated to 46 ° C., transferred to BHIS medium and incubated for 6 min at 46 ° C.
  • the cells were then incubated for two hours at 30 ° C. at 170 rpm and the suspension was plated onto BHIS-Kan15 agar of the sacB gene was tested by transferring the clones onto BHI-Kan25 agar and onto BHI-Kan25 agar with 10% sucrose.
  • the cells cultured on BHI-Kan25 were used for cultured for about 5 hours in 5 ml of BHI medium and 100 ⁇ l of the culture and a 1:10 dilution were plated on BHI agar with 10% sucrose
  • the clones were on BHI-Kan25 agar and BHI agar with 10% Sucrose transferred from the sucrose-resistant and kanamycin-sensitive clones e
  • a colony PCR (primer: P05-P09iolC_check_fw / P05-P09iolC_check_rev) was carried out with subsequent DNA sequencing in order to confirm the successful nucleotide substitutions.
  • P05-P09 iolC_fw_rev TAAGTTT CGCT ACT CATT CCCT AAT GCAAGT GAT AATCCC AG AT C AAT AAA
  • P09iolC_rev_fw GGAATGAGTAGCGAAACTTAGTGAAAAGGGCAGAGTTTGCAGGTCATAGGGTG
  • P05-P09iolC_rev_rev TT GT AAAACG ACGGCC AGT GT CC AGCT CAGCAAGC AGG
  • P05-P09iolC_check_fw GAGTTTTTCTGCGATGGCGGAACTT
  • P05-P09iolC check rev GGGGT CTT AAAAGT CT GATCGGT GG Change in the regulatory binding site in the promoter region of the Mvo inositol transporter IoIT 1 due to nucleotide deletions in C. alutamicum
  • two PCR products were generated in a first step, which the 5 'region in front of the / o / 7 f gene (primer: DP06iolT1_Fw_fw / DP06iolT1_Fw_rev) with the two deleted nucleotides or the 3' region of the gene (primer : DP06iolT1_rev_fw / DP06iolT1_rev_rev) included.
  • 500 base pairs of the flanking regions were amplified.
  • the DNA fragments were fused together with the pk19moösacß vector already cut via the restriction endonucleases xBal and EcoRI using Gibson assembly (Gibson et al., 2009) (https://doi.org/10.1038/NMETH.1318).
  • This plasmid pK19mobsacB_A Po 6 / o / Ti thus obtained was transformed into E. coli DH5a by means of heat shock. Due to the kanamycin resistance gene present on the plasmid, only those clones that had taken up the plasmid could grow.
  • the mixture was opened in 4 ml Preheated to 46 ° C., transferred to BHIS medium and incubated for 6 min at 46 ° C.
  • the cells were then incubated for two hours at 30 ° C. at 170 rpm and the suspension was plated onto BHIS-Kan15 agar sacB gene tested by transferring the clones onto BHI-Kan25 agar and onto BHI-Kan25 agar with 10% sucrose.
  • the cells cultivated on BHI-Kan25 were cultured for approx.
  • DP06iolT1 _Fw_fw TGCATGCCTGCAGGT CG ACT AATT GAT CAGCAAACACC
  • DPO610IT 1_Fw_rev ATCGTGGCAGACACGATATCCCGTCAATC
  • DP06iolT 1_rev_fw GAT AT CGT GT CT GCCACG ATT AAAG ACATT G
  • DPO610IT 1_rev_rev TTGT AAAACGACGGCCAGT GACTGCGAGT CCAAGAAGC
  • checkPromiolTI rev CAACT CATT ACGGCCAGCCAGT GAGC
  • two PCR products were generated in a first step, the 5 'region in front of the iolC gene (primer: DP013iolC_fw_fw / DP013iolC_fw_rev) with the two deleted nucleotides or the 3 'region of the gene (primer: DP013iolC_rev_fw / DP013iolC_rev_rev).
  • the cells were then incubated for two hours at 30 ° C. at 170 rpm and the suspension was plated onto BHIS-Kan15 agar
  • the function of the sacB gene was tested by transferring the clones to BHI-Kan25 agar and to BHI-Kan25 agar with 10% sucrose.
  • DP013iolC_fw_fw TGCATGCCTGCAGGTCGACTCCGTCTTCGAGGCGTTGG
  • DP013iolC_rev_fw GCGATCGTGAGGGTCGCCACATTCCATC
  • DP013iolC_rev_rev TT GT AAAACG ACGGCCAGT GCGCGGCTTGGCT CTT CAC
  • two PCR products were generated in a first step, which the 5 'region in front of the iolC gene (primer: AP05-P09iolC_fw_fw / AP05-P09iolC_fw_rev) with the two deleted nucleotides or the 3' region of the gene (primer : AP05-P09iolC_rev_fw / AP05-P09iolC_rev_rev) included.
  • 500 base pairs of the flanking regions were amplified in each case.
  • the DNA fragments were fused together with the pk19mobsacß vector which had already been cut via the restriction endonucleases xBal and EcoRI (Gibson et al., 2009) (https://doi.org/10.1038/NMETH.1318).
  • This plasmid pK19 mobsacB_A P05-09 iolC thus obtained was transformed into E. coli DH5a by means of heat shock. Due to the kanamycin resistance gene present on the plasmid, only those clones that had taken up the plasmid could grow.
  • the mixture was transferred into 4 ml BHIS medium preheated to 46 ° C. and incubated for 6 min at 46 ° C.
  • the cells were then incubated for two Incubated at 170 rpm for 30 hours at 30 ° C.
  • the suspension was plated onto BHIS-Kan15 agar, and the function of the sacB gene was then tested by using the clones on BHI-Kan25 agar and on BHI-Kan25 agar
  • the cells cultured on BHI-Kan25 were cultivated for 5 h in 5 ml of BHI medium and 100 ⁇ l of the culture and a 1:10 dilution on BHI agar with 10% sucrose plated.
  • the clones were transferred to BHI-Kan25 agar and BHI agar with 10% sucrose.
  • a colony PCR (primer: Check AP05-P09iolC_fw / Check DR05-P09iolC_rev) was carried out from the sucrose-resistant and kanamycin-sensitive clones with subsequent DNA sequencing in order to confirm the successful deletion.
  • AP05-P09iolC_fw_fw TGCAT GCCT GCAGGT CG ACTGGTT GGCGTTTTT GAGGT C
  • AP05-P09iolC_fw_rev T AAGTTT CGCT ACT C ATT CCCT AAT G C AAGT GAT AAT C AG AT- CAATAAAAGCCCTGGAT
  • AP05-P09iolC_rev_fw GGAAT GAGTAGCGAAACTT AGT GAAAAGGGCAGAGTTT - GCAGGT CAT AGTGCAACTTT GTT AACCC AP05-P09iolC_rev_rev: TTGTAAAACGACGGCCAGTGTCCAGCTCAGCAAGCAGG check AP05-P09iolC_fw: GAGTTTTT CT GCGATGGCGG AACTT check APQ5-P09iolC rev: GGGGTCTTAAAAGTCTGATCGGTGG
  • two PCR products were generated in a first step, the 5 'region of the iolG gene (primer: iolG front fw / iolG front rev) with the first three codons and the 3' region (primer: iolG rear fw / iolG behind rev) with the last six codons of the iolG gene.
  • the 5 'region of the iolG gene primer: iolG front fw / iolG front rev
  • the 3' region primer: iolG rear fw / iolG behind rev
  • the DNA fragments were combined with that already via the restriction endonucleases xBal and EcoRI Cut pk19mobsacß vector fused using Gibson assembly (Gibson et ai, 2009) (https://doi.org/10.1038/NMETH.1318).
  • the resulting plasmid pK19mobsacB_A ⁇ o ⁇ G was transformed into E. coli DH5a by means of heat shock. Due to the kanamycin resistance gene present on the plasmid, only those clones that had taken up the plasmid could grow.
  • the mixture was opened in 4 mL BHIS medium preheated to 46 ° C. and incubated for 6 min at 46 ° C. The cells were then incubated for two hours at 30 ° C. at 170 rpm and the suspension was plated onto BHIS-Kan15 agar - Gene tested by transferring the clones onto BHI-Kan25 agar and onto BHI-Kan25 agar with 10% sucrose.
  • the cells cultured on BHI-Kan25 were kept for approx h cultured in 5 ml of BHI medium and 100 ⁇ l of the culture and a 1:10 dilution were plated on BHI agar with 10% sucrose
  • the clones were transferred to BHI-Kan25 agar and BHI agar with 10% sucrose the sac charose-resistant and kanamycin-sensitive clones became one Colony PCR (primer: check iolG fw / check iolG rev) followed by gel electrophoresis to confirm the successful deletion.
  • iolG front fw TGCATGCCTGCAGGTCGACTGAAGAGTTCGGCATGAAGC
  • iolG front rev TACTCCCGGGCATATGGCGAAGGCTCTTGCTCAT
  • iolG rear fw GAGCCTT CGCCAT AT GCCCGGGAGT ACT GGAT CCGTT GAT GCGGCAC-
  • iolG rear rev TT GTAAAACG ACGGCCAGT GAT GACT CGCCATGCTT CAATACC check
  • iolG fw CGACGTTGCT GGT CTT GCTT CCAAG
  • the different C. glutamicum integration mutants C. glutamicum ATCC13032 iolG C. glutamicum ATCC 13032 iolG 2 , C. glutamicum ATCC 13032 / ' o / G 3 were designed according to Niebisch and Bott (2001) (https://doi.org/10.1007/s002030100262) each with vectors based on pK19 mobsacB via double homologous recombination (Schäfer et al., 1994) (https: //doi.ora/10.1016/0378- 1 119 (94) 90324-7).
  • PCR products were generated in a first step, which contained the flanking regions of the different integration loci, the constitutional promoter Tuf and the gene iolG (primer: NCS_PT uf_fw / NCS_PTuf_rev / NCS_Ptuf_iolG_fw / NCS_Ptuf_iolG__wv / CgLff4 / CgLf4_fv4 / CgLf4_fg_4 / CgLf4_fg / CfLv4_fg / CfLv4_fg / CgLf4_fw / NCS_Ptuf_iolG__fw / NCS_Pfuf CgLP4_iolG_fw / CgLP4_iolG_rev / CgLP4_rev_fw / CgLP4_rev_rev / CgLP4_re
  • the plasmids pk19 / 7700sacß ncr cons P Tuf / o / G, pk19 mobsacB CgLP4 P Tuf iolG and pk19 mobsacB CgLP12 P Tuf / ' o / G thus obtained were transformed into E. coli DH5a by means of heat shock. Due to the kanamycin resistance gene present on each of the constructed plasmids, only those clones which had taken up the plasmid could grow. These were checked for the presence of the cloned insert by means of colony PCR and subsequent gel electrophoresis, and its DNA sequence was determined.
  • a 150 pL aliquot of electrocompetent C. glutamicum cells was thawed on ice, mixed with 1-4.5 pg of the plasmid to be transformed in each case and transferred to a 0.2 cm electroporation cuvette that had been pre-cooled on ice.
  • the mixture was overlaid with 800 pL, 4 ° C cold, 10% glycerol (v / v) and electroporated in an electroporator (2500 V, 25 pF, 200 W, 2 mm). After the electroporation, the mixture was dissolved in 4 ml BHIS medium preheated to 46 ° C. and incubated for 6 min at 46 ° C.
  • the cells were then incubated for two hours at 30 ° C. at 170 rpm and the suspension was plated onto BHIS-Kan15 agar
  • the sacB gene was tested by transferring the clones to BHI-Kan25 agar and to BHI-Kan25 agar with 10% sucrose, and the cells cultured on BHI-Kan25 were selected for selection for successful excision in a second recombination event cultured for about 5 hours in 5 ml of BHI medium and 100 ⁇ l of the culture and a 1:10 dilution were plated on BHI agar with 10% sucrose
  • the clones were on BHI-Kan25 agar and BHI agar with 10% sucrose From the sucrose-resistant and kanamycin-sensitive clone
  • a colony PCR (primer: NCS check fw / NCS check rev / CgLP4_Check_fw / CgLP4_Check_rev / CgLP12_Check_f
  • NCS_PT uf_fw TTT AAATT GT GT CCAT GAGGCACAGGGT AGCTGGT AGTTT G
  • NCS_PTuf_rev T CTTGCT CAT ACGCGTT CCT CCT GGACTT C
  • NCS_Ptuf_iolG_fw AGGAACGCGTATGAGCAAGAGCCTTCGC
  • NCS_Ptuf_iolG_rev CGAAGCAT ATGCCCGGGAGTTT AAGCGT AG AAAT CT GGGC
  • NCS check fw CGG AAT GAT CTT GACCCTT GTTGGT G
  • NCS check rev AT CAAGCAG AT CT CT GAGCTGCT GGC
  • CgLP4_fw_rev CTACCCTGTGCATCAAAAAATCCGCCGTTC
  • CgLP4_PTuf_fw TTTTTT GAT GCACAGGGT AGCT GGT AGTTT G
  • CgLP4_iolG_rev CT CACTT AGTTT AAGCGT AGAAAT CTGGGC
  • CgLP4_rev_fw CT ACGCTT AAACT AAGT G AGTTTGG AT G
  • CgLP4_rev_rev TT GT AAAACGACGGCCAGT GT AGT ACGCGGAT AAAT GAT C
  • CgLP12_fw_fw T GCATGCCTGCAGGT CGACTCGTT GAAGACT CCGT CAAAC
  • CgLP12_fw_rev CT ACCCT GT GAT AT GCCGATT GCAAGAAAC
  • CgLP12_PT uf_fw AT CGGCAT AT CACAGGGT AGCTGGT AGTTT G
  • CgLP12 _iolG_rev ATTTTTT G ACT GATT AAG CGT AGAAAT CTGGGC
  • CgLP12_rev_fw CT ACGCTT AAT CAGT CAAAAAAT GTT G AAAT CAG
  • CgLP12_rev_rev TT GT AAAACGACGGCCAGT GTT GGCGCTT CTTT GAAG AG
  • CgLP12_Check_Fw CT CAAGGT CAT CCGT G AAAT GT GGC
  • C. glutamicum cells were suspended in 50 pL 2% DMSO and then incubated for 5 minutes at 95 ° C broken up. The cell debris was centrifuged for 1 min at 1,100 rpm and 3 ml of the supernatant was used as a template for the amplification of iolG (primer: p3_iolG_fw / p3_iolG_rev). This amplificate was fused together with the pEKEx3 vector already cut via the restriction enducleases pstl and EcoRI in the Gibson Assembly (Gibson et al., 2009) (https://doi.org/10.1038/NMETH.1318).
  • This plasmid pEKEx3 / o / G thus obtained was transformed into E. coli DH5a by heat shock. Due to the spectinomycin resistance mediated by the plasmid, only those clones that had taken up the plasmid could grow. These were checked for the presence of the cloned insert by means of colony PCR and subsequent gel electrophoresis, and its DNA sequence was determined. After isolation of the plasmid, a 150 ⁇ l aliquot of electrocompetent C. glutamicum cells was thawed on ice, this was mixed with 1-4.5 mg of the plasmid and transferred into a 0.2 cm electroporation cuvette which had been pre-cooled on ice.
  • the mixture was overlaid with 800 ml, 4 ° C., 10% glycerol (v / v) and electroporated in an electroporator (2500 V, 25 mR, 200 W, 2 mm). After the electroporation, the mixture was dissolved in 4 ml Preheated to 46 ° C., transferred to BHIS medium and incubated for 6 min at 46 ° C. The cells were then incubated at 170 rpm for two hours at 30 ° C. The suspension was then plated onto BHI-Spc100 agar.
  • p3_iolG_fw GCCAAGCTTGCATGCCTGCAGCT AGT AT AAGGAG AT AT AGAT AT -
  • p3_iolG_rev CT GTAAAACGACGGCCAGT GTTAAGCGT AGAAAT CT GGGC medium and cultivation conditions
  • the CGXII medium contained the following composition per liter of deionized water: 1 g K 2 HP0 4 , 1 g KH 2 PO 4 , 5 g urea, 13.25 mg CaCl 2 .2 H 2 0, 0.25 g MgSO 4 4 H 2 0.10 mg FeS0 4 7 H 2 0, 10 mg MnS0 4 ⁇ H 2 0, 0.02 mg NiCI 2 ⁇ 6 H 2 0,
  • a second preculture was then inoculated from this culture in 500 mL shake flasks with 50 mL defined CGXII medium as well as 10 g L 1 D-glucose and 30 g L 1 D-xylose as a source of carbon and energy and for 15 h at 30 ° C on one Rota- tion shaker at 130 rpm incubated 1.
  • the main culture was then inoculated onto an OD 60 o of 1 CGXII medium defined in 50 ml with 10 g of L 1 D-glucose and 30 g of L 1 D-xylose as sources of carbon and energy and for 56 h at 30 ° C. on one rotary shaker at 130 rpm incubated 1. Samples for measuring the concentrations of biomass, D-xylose and D-xylonate were taken from the main culture.
  • CGXII medium and pretreated bagasse hydrolyzate were used for D-xylonate production using batch and fed-batch processes.
  • the pretreatment of ground bagasse (0.25 - 1 cm) was carried out by incubation in 0.1 mol L 1 H 2 S0 4 at 121 ° C.
  • the subsequent hydrolysis took place in a parallel bioreactor system (Eppendorf / DASGIP, Weglich, Germany) with a working volume of 600 ml and a solution consisting of 180 g pretreated bagasse, 50 mM C 2 H 3 Na0 2 and 10.4 mL enzyme mix Cellic CTec2 (No- vomzymes, Bagsvserd, Denmark).
  • the pH was adjusted to pH 5 by means of KOH and the hy- rolyse was carried out at 50 ° C for 72 h at constant stirring speed (400 rev min -1). 8 g of NH 4 CI and 2 g of K 2 HP0 4 were then dissolved in 200 ml of deionized water and added to the hydrolyzate. The medium was then adjusted to pH 7 by 5 M NH OH for cultivation purposes. Some medium components (D-glucose, D-xylose, PCA, trace elements, AF204) were added sterile after autoclaving. In the case of the fed-batch process, a solution of 100 g L 1 D-glucose in deionized water was used.
  • the pH was regulated on both sides to pH 7 by adding 5 MH 3 P0 or 5 M NH OH.
  • the temperature and gassing rate were fixed at 30 ° C or 0.5 vvm. Aerobic process conditions (> 30% dissolved oxygen concentration) were prepared by controlling the stirrer speed - ensuring (400 1, 200 rpm 1). Online measurements were carried out for pH (405-DPAS-SC-K80 / 225, Mettler Toledo), DO (Visiferm DO 225, Hamilton) and exhaust gas composition (GA4, DASGIP AG).
  • the inoculation was carried out from an exponentially growing preculture on CGXII medium (20 g L 1 D-glucose) to a final OD of 2. Samples for measuring the concentrations of biomass, D-xylose and D-xylonate were taken from the main culture.
  • D-xylonate can be isolated from the cultivation solution according to known protocols and / or processed, ie separated, purified and / or concentrated.
  • An existing protocol (Liu et al., Bioresource Technology, 2012, 115: 244-248) was used for product purification as follows: 1. Cell separation with by centrifugation (4500 rpm for 10 min at 4 ° C); 2. Decolorization of the resulting supernatant in activated carbon (AC); 3. Filtration of the AC-treated supernatant (0.22 pm) and concentration using a rotary evaporator (100 mbar, 60 ° C water bath); 4. Filtration of the concentrate (0.22 pm) and precipitation of D-xylonate by adding EtOH (3: 1, v / v); Vacuum drying of the product for at least 12 h at -10 ° C.
  • the determination of the biomass was performed gravimetrically by transferring 2 ml of culture supernatant in a tared test tube, centrifugation at 13,000 rpm 1 for 10 min and resuspension in 0.9% (wv 1) NaCl. After a further centrifugation step, the supernatant was removed by decanting. The cell pellet was dried at 80 ° C for 24 h, followed by gravimetric cell dry weight determination. The supernatants were filtered using a cellulose acetate syringe filter (0.2 pm, DIA-Nielsen, Düren, Germany) for substrate and product quantification.
  • D-glucose and D-xylonate were separated by an isocratic exchange method on an HPLC (Agilent 1100 Infinity, Agilent Technologies, Santa Clara, CA).
  • HPLC Agilent 1100 Infinity, Agilent Technologies, Santa Clara, CA.
  • the method uses an organic resin HPLC column 300 x 8 mm (DIA-Nielsen, Düren, Germany) as the stationary phase, 0.1 MH 2 S0 4 with a flow rate of 0.6 mL min 1 as the mobile phase, a column temperature of 80 ° C and an injection volume of 10 pL.
  • D-glucose was detected by means of a refractive index detector at 35 ° C.
  • D-xylonate was detected by means of UV light absorption at 215 nm with a diode array detector.
  • the plasmid pET-28b- / o / G was transformed for heterologous gene expression of iolG in Escherichia coli BL21 and then cultivated in 2x 50ml_TerrificBroth (TB) medium with 50 mg / L kanamycin for 16 hours at 30 ° C and 250rpm. 10 mL each of these cultures were used to inoculate four bioreactor cultures with 20 g / L glycerol as the initial carbon source and with 50 mg / L Kanamycin to maintain the selection pressure. The bioreactor cultures were heated to 30 ° C. and the pH was titrated to pH 7 with ammonia water.
  • IPTG Isopropyl- ⁇ -D-thiogalactopyranoside
  • the digestion supernatant after centrifugation (23000 rpm, 4 ° C, 35 min) was applied via a Ni-NTA column (column volume 70 ml, flow 6 mL / min) (washing buffer: 50mMTris pH 7.5, 300mM NaCl, 2mM MgS0 4 25mMmmidazole; elution buffer: 50mM Tris pH 8.0, 300mM NaCl, 2mM MgSO 4 , 250mMmmmazole).
  • the eluate was collected to a total of 60 ml fractions and desalted over a Sephadex-G25 column (column volume 960 ml, flow 10 ml / min, desalination buffer: 10 mm Tris pH 7.6, 2 mm MgSO), of which a total of 150 ml were collected as protein-containing fractions and lyophilized.
  • the resulting lyophilisate had a protein content of 60% according to Bradford protein determination.
  • the enzyme tests for determining the activity of lolG lyophilisate were carried out in a total volume of 200 pL.
  • the enzymatic reactions were preheated to 30 ° C. by the rapid addition of 180 pL reaction mix (250 mM Tris-HCl, 22mMNAD + , 5 mM MgCl 2 and 125 pL / mLIolG lyophilisate solution with 2.5 mg / L, pH 7.5) ) submitted to 20 pL substrate solution (0 - 250 mM [0 - 25 mM final per reaction volume] D-xylose or myo-inositol).
  • the measurement of the increase in extinction at 340 nm was followed in the microtiter plate reader (> 30 min preheated to 30 ° C.) for approx. 20 min. After a short transient response of all measurement signals, the initial reaction rates were determined using linear regression over a 2-minute measurement period.
  • the gradients obtained in the unit [absorption units per minute] were determined in the NADH formation rate in the unit [mM NADH per minute] by calibration of the absorption signal over standard solutions with a known NADH concentration instead of substrate solutions, using Gaussian error propagation with consideration the calibration parameter covariance matrix.
  • the enzyme shows no activity on the substrate myo-inositol.
  • Vmax maximum enzyme activity
  • Km specific substrate affinity
  • strains show comparable growth on D-glucose as a carbon and energy source.
  • the wild-type strain C.glutamicum ATCC 13032 has a very low uptake of D-xylose and conversion into D-xylonate.
  • the maximum D-xylonate titer after 72 h is 40.0 mM here.
  • the strain C. glutamicum WT AioIR with deletion of the gene for the regulator loIR shows a significantly increased D-xylose uptake and D-xylonate production, due to the deregulated expression of the D-xylose transporter IoIT 1 and the D-xylose Dehydrogenase lolG.
  • the maximum D-xylonate titer after 72 h here is 214.7 mM.
  • the strain C. glutamicum WT AioIR AiolG with additional deletion of the gene for the D-xylose dehydrogenase lolG according to the invention shows a greatly reduced D-xylose uptake and D-xylonate formation, due to the lack of expression of the D-xylose dehydrogenase lolG.
  • the maximum D-xylonate titer after 72 h is 111.9 mM here.
  • glutamicum WT AioIR A / o / GpEKEx3- / o / G with additional plasmid-based expression of the gene for the D-xylose dehydrogenase lolG according to the invention shows the highest D-xylonate production, due to the high homologous expression of the D-xylose -Dehydrogenase lolG, which overcompensates for the lack of expression (AiolG).
  • the maximum D-xylonate titer after 72 h is 223.6 mM here.
  • FIG. 15 shows the D-xylonate formation of further variants of coryneform bacterial strains according to the invention, in which the functionality of operatively linked regulatory regions of the nucleic acid sequence coding for the D-xylose dehydrogenase according to the invention is changed 1 D-glucose and 30 g of L 1 D-xylose performed.
  • the wild-type strain C. glutamicum ATCC 13032 has a very low uptake of D-xylose and conversion into D-xylonate.
  • the maximum D-xylonate titer after 72 h is 40.0 mM here.
  • glutamicum WT P 06 iolT1 with a modified promoter sequence in the gene region of the D-xylose transporter lolT 1 shows a slightly increased D-xylose uptake and D-xylonate production, due to the deregulated expression of the D-xylose transporter lolT 1.
  • the maximum D-xylonate titer after 72 h is 80.0 mM here.
  • the strain C. glutamicum WTpEKEx3- / o / G with plasmid-based expression of the gene for the D-xylose dehydrogenase shows a significantly increased D-xylonate production, due to the homologous expression of the D-xylose dehydrogenase lolG.
  • the maximum D-xylonate titer after 72 h here is 213.9 mM.
  • glutamicum WT R 06 / o / PrEKEc3- / o / Q with an additional modified promoter sequence in the gene region of the D-xylose transporter lolT 1 shows the highest D-xylonate production, due to the simultaneous homologous expression of the D-xylose -Dehydrogenase lolG and the deregulated expression of the D-xylose transporter lolT 1.
  • the maximum D-xylonate titer after 72 h is 217.4 mM here.
  • FIG. 16 shows the D-xylonate formation of further variants of coryneform bacterial strains according to the invention in which the functionality of operationally linked regulatory areas has been changed or deleted. Shown are the strain C. glutamicum WT P 06 iolT1 with a modified promoter sequence in the gene region of the D-xylose transporter lolT 1, the strain C. glutamicum P 06 iolT1 Po ⁇ ogiolC according to the invention, in which, in addition to P 06 iolT1, the functionality of the operatively linked regulatory region of the nucleic acid sequence coding for D-xylose dehydrogenase (Pos-ogiolC) is changed and in comparison the strain C.
  • Pos-ogiolC D-xylonate formation of further variants of coryneform bacterial strains according to the invention in which the functionality of operationally linked regulatory areas has been changed or deleted. Shown are the strain C. glutamicum WT P 06 iolT1 with a modified
  • the strain WT C. glutamicum P 06 iolT1 with a modified promoter sequence in the gene region of the D-xylose transporter lolT 1 shows a slightly increased D-xylonate production, due to the deregulated expression of the D-xylose transporter lolT1.
  • the maximum D-xylonate titer after 72 h here is 74.73 mM.
  • glutamicum WT AioIR with deletion of the gene for the regulator lolR shows a significantly increased D-xylonate production, due to the deregulated expression of the D-xylose transporter lolT 1 and the D-xylose dehydrogenase lolG.
  • the maximum D-xylonate titer after 72 h is 205.53 mM here.
  • the strain C. glutamicum P 06 iolT1 Pos-ogiolC with a modified promoter sequence in the gene region of the D-xylose transporter lolT 1 and a modified functionality of the operatively linked regulatory region of the nucleic acid sequence coding for D-xylose dehydrogenase (Po-o iolC) shows a significantly increased D-xylonate production.
  • the maximum D-xylonate titer after 72 h here is 206.82 mM.
  • the present invention thus clearly shows that, according to the invention, minimal and extremely defined nucleotide substitutions in the 5 'upstream regulatory areas of the relevant coding gene sequences result in a significantly increased D-xylonate production: and this without heterologous genes or structures in the corynform bacterial strain must be introduced, which is an object of the present invention, and also without having to make drastic deletions on centrally acting regulators, which trigger far-reaching undefined physiological effects in an organism, which is also desired according to the invention.
  • the few targeted nukeotide substitutions according to the invention are to such an extent that they also occur naturally in nature, which characterizes the coryneform bacterial strain according to the invention as non-GMO.
  • Coryneform bacterial cell characterized in that the increased expression of the D-xylose dehydrogenase is based on changes selected from the group comprising: a) changing the regulation or signal structures for gene expression, b) changing the transcription activity of the coding nucleic acid sequence, c) increasing the Gene copy number of the coding nucleic acid sequence, and d) a combination of a) - c). 2.
  • Coryneform bacterial cell according to item 1 characterized in that the increased activity of the D-xylose dehydrogenase activity is based on changes selected from the group comprising a) increasing the expression of the coding nucleic acid sequence, b) expression of a nucleic acid sequence or fragments or alleles thereof, which codes for a D-xylose dehydrogenase with increased catalytic activity and / or substrate specificity, c) increase in the stability of the mRNA derived from the coding nucleic acid sequence, d) change in the catalytic activity and / or substrate specificity of a homologous D-xylose dehydrogenase for the conversion of D-xylose, and e) a combination of a) - d).
  • Coryneform bacterial cell according to one of the items 1 or 2 a) in which the activity of a D-xylose dehydrogenase according to the invention is increased, b) in which a nucleic acid sequence according to the invention is more strongly expressed, c) in which a nucleic acid sequence coding for a myo-inositol / Proton Symporter (IoIT 1) according to SEQ ID NO. 3 or fragments or alleles thereof amplified is expressed, d) in which a myo-inositol / proton symporter IoIT 1 with an amino acid sequence according to SEQ ID NO.
  • IoIT 1 myo-inositol / proton symporter
  • e) which has a nucleic acid sequence coding for a myo-inositol / proton symporter (IoIT 1) with one or more nucleotide substitutions or nucleotide deletions in the operatively linked lolR binding sites of the iolT1 gene, preferably selected from the group of nucleic acid sequences SEQ ID NO. 9 and SEQ ID NO. 10 or fragments or alleles thereof, f) in which a nucleic acid sequence coding for a myo-inositol / proton symporter (lolT2) according to SEQ ID NO.
  • IoIT 1 myo-inositol / proton symporter
  • a nucleic acid sequence coding for a myo-inositol regulator loIR or fragments or alleles thereof is completely or partially deleted, m) the expression of an iolR gene is reduced or missing, n) a myo-inositol regulator loIR is reduced in its activity or is completely switched off, or o) a combination of a) - n). 4.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

Die vorliegende Erfindung betrifft eine D-Xylose-Dehydrogenase aus coryneformen Bakterien, für sie kodierende Nukleinsäuresequenzen, entsprechende lebende Organismen, bevorzugt coryneforme Bakterien, enthaltend eine D-Xylose-Dehydrogenase mit gesteigerter Expression und/oder Aktivität der D-Xylose-Dehydrogenase sowie entsprechende Verwendungen. Die vorliegende Erfindung betrifft auch ein Verfahren zur Herstellung von D-Xylonat mit einer D-Xylose-Dehydrogenase aus coryneformen Bakterien.

Description

Beschreibung
D-Xylose-Dehydrogenase aus coryneformen Bakterien
und Verfahren zur Herstellung von D-Xylonat
Die vorliegende Erfindung betrifft eine D-Xylose-Dehydrogenase aus coryneformen Bakterien, für sie kodierende Nukleinsäuresequenzen, entsprechende lebende Organismen, bevorzugt coryneforme Bakterien, enthaltend eine D-Xylose-Dehydrogenase mit gesteigerter Expression und/oder Aktivität der D-Xylose-Dehydrogenase sowie entsprechende Verwendungen. Die vorliegende Erfindung betrifft auch ein Verfahren zur Herstellung von D- Xylonat mit einer D-Xylose-Dehydrogenase aus coryneformen Bakterien.
D-Xylonsäure (C5H10O6) ist eine organische Säure, die als Vorstufe für Polyamide, Polyester und 1 ,2,4-butantriol dienen kann (Toivari et al. 2012;https://doi.org/10.1007/s00253-012- 4288-5) und weist somit ein breites Anwendungspotenzial in der pharmazeutischen Industrie, der Lebensmittelindustrie und in der chemischen Industrie auf.
D-Xylonat, das Salz der D-Xylonsäure, zählt zu den Top 30 der potenziell hochwertigen, auf nachwachsenden Rohstoffen der 2. Generation basierenden, Plattform-Chemikalien (Werpy et al. 2004; http://www.dtic.mil/dtic/tr/fulltext/u2/a436528.pdf). D-Xylonat hat das Potential D- Gluconat (CeH O?) zu ersetzen, welches einen globalen Markt von 100 kt/Jahr besitzt.
D-Xylonat wird natürlicherweise in einigen Bakterien über eine zweistufige Reaktion gebildet. In der ersten Reaktion wird D-Xylose zu D-Xylonolacton oxidiert, wobei hier je nach Organismus spezifische Dehydrogenasen katalytisch aktiv sind. Das D-Xylonolacton kann anschließend entweder durch spezifische Lactonasen oder spontan (ohne Enzymkatalysator) zum D-Xylonat umgewandelt werden. Zum Beispiel für die Spezies Gluconobacter oxydans und Pseudomonas fragi werden hohe Produkttiter an D-Xylonat berichtet (Toivari et al., 2012; https://doi.org/10.1007/s00253-012-4288-5; Buchert et al. 1988,https://doi.org/10.1007/BF01028079).
Darüber hinaus wurden alternative D-Xylonat-Produktionsstämme (z. B. Hefe der Spezies Saccharomyces cerevisiae, Bakterien der Spezies Escherichia coli und Pilze der Spezies Aspergillus niger) durch eine heterologe Expression von D-Xylose-Dehydrogenasen, z. B. aus Caulobacter crescentus, erzeugt (Toivari et al., 2012https://doi.org/10.1007/s00253-012- 4288-5; Liu et al. 2012; https://doi.Org/10.1016/j.biortech.2011.08.065; US Patent 2012/0005788 A1). Neben der mikrobiellen Produktion kann D-Xylonat elektrochemisch (Jokic et al. 1991 ; https://doi.org/10.1007/BF01020216), enzymatisch (Pezzotti & Therisod 2006; https://doi.Org/10.1016/j.carres.2006.05.023) oder durch chemische Oxidation (Isbell & Hud- son 1932; Isbell HS, Hudson CS (1932) The course of the oxidation of the aldose sugars by bromine water. Bur Standards J Res 8:327-338; https://archive. org/details/courseofoxidatio83327isbe) hergestellt werden.
Es ist bekannt, dass D-Xylonat durch Fermentation von Stämmen coryneformer Bakterien, insbesondere Corynebacterium glutamicum, hergestellt werden kann (Yim et al. 2017; https://doi.org/10.1002/biot.201700040, Choi et al 2018; https://doi.org/10.1007/s00253-017- 8653-2). Die Oxidation von D-Xylose zu D-Xylonat wird hierbei durch heterologe Expression der Xylose-Dehydrogenase von Caulobacter crescentus vermittelt. Allerdings ist die Expression heterologer Systeme mit Blick auf die Anwendung in der Pharma- bzw. Lebensmittelindustrie nachteilig und unerwünscht. Denn alle bislang bekannten Produktionsstämme mit einer D-Xylonat-Synthesekapazität, wie z. B. Gluconobacter oxydans, benötigen komplexe Medien für ihr Wachstum, wodurch die Kultivierung deutlich aufwendiger, teurer und damit unwirtschaftlicher wird.
Bei Untersuchungen zur Substratoptimierung im Zuge der mikrobiellen Produktion von Aminosäuren (wiez. B. L-Lysin und L-Glutamat) sowie anderen Vorstufen der industriellen Biotechnologie mit coryneformen Bakterien, wurde die Fähigkeit der Aufnahme natürlicherweise nicht-metabolisierter Substrate, wie D-Xylose, untersucht. Es konnte gezeigt werden, dass der myo-lnositol/Proton-Symporter (IoIT 1 ) zur Aufnahme von D-Xylose in Corynebacterium glutamicum beiträgt (Brüsseler et al., 2018; https://doi.Org/10.1016/j.biortech.2017.10.098). Allerdings wird die D-Xylose von coryneformen Bakterien natürlicherweise nicht verstoffwechselt und akkumuliert daher im Medium.
Die WO 2017/220059 A1 offenbart, dass die Inaktivierung bzw. Deletion des iolR-Genes kodierend für das Regulatorprotein loIR auf definiertem Medium mit D-Glucose und D-Xylose als Kohlenstoff- und Energiequellen die Bildung von D-Xylonat bewirkt.
Das für den Regulator loIR kodierende Gen cg0196 ist im Zusammenhang mit der Produktion der Aminosäure L-Lysin in Klaffl et al. (2013; https://doi.org/10.1128/JB.00265-13) beschrieben. Die Deletion von ioIR führt zur Expression des myo-lnositol-Genclusters sowie weiterer, schätzungsweise 22 Gene mit bisher unbekannter bzw. nicht eindeutig annotierter Funktion (Klaffl et al., 2013). Negative physiologische Effekte als Konsequenz der Deregulation dieser ca. 22 Gene sind nicht auszuschließen. Daher repräsentiert ein Bakterienstamm alleine mit einer solchen iolR-Deletion keine brauchbare Plattform für einen industriell interessanten Produktionsstamm, der genetisch eindeutig definiert sein sollte.
Die Aufgabe der vorliegenden Erfindung ist es, von einer heterologen Genexpression zur mik- robiellen Herstellung von D-Xylonat in coryneformen Bakterien unabhängig zu sein bzw. die- se zu vermeiden. Ferner ist es eine Aufgabe der vorliegenden Erfindung, derartige Eingriffe in den Stoffwechsel coryneformer Bakterien zu vermeiden, die weitreichend Undefinierte physiologische Auswirkungen haben können, wie es zum Beispiel der Fall ist, wenn ein oder mehrere zentral agierende Regulatoren (wie z. B. des Regulatorproteins loIR) ausgeschaltet sind, die Einfluss auf eine Vielzahl von Genen oder Proteinen in einer Zelle ausüben. Somit ist eine weitere Aufgabe der vorliegenden Erfindung die Bereitstellung eines homologen Sys- tems und eines oder mehrerer homologer Strukturelemente, die eine mikrobielle Herstellung von D-Xylonat mit coryneformen Bakterien ermöglichen und gleichzeitig bekannte Nachteile überwinden. Eine weitere Aufgabe der vorliegenden Erfindung ist es, ein Verfahren zur mik- robiellen Herstellung von D-Xylonat in coryneformen Bakterien bereitzustellen, bei dem die bekannten Nachteile überwunden werden.
Diese Aufgaben werden durch die vorliegende Erfindung, wie nachfolgend ausgeführt, in vorteilhafter Weise gelöst. Es folgt zunächst die kurze Beschreibung der vorliegenden Erfindung, ohne dass der Ge- genstand der Erfindung dadurch limitiert wird.
Gegenstand der vorliegenden Erfindung ist die Bereitstellung eines Proteins mit der Aktivität einer D-Xylose-Dehydrogenase aus coryneformen Bakterien. Ferner betrifft die vorliegende Erfindung auch die Verwendung dieser erfindungsgemäßen D- Xylose-Dehydrogenase zur Herstellung von D-Xylonat. In einer Variante der vorliegenden Erfindung erfolgt die Herstellung von D-Xylonat in einem homologen System, bevorzugt in coryneformen Bakterien.
Gegenstand der vorliegenden Erfindung ist auch eine coryneforme Bakterienzelle zur Herstellung von D-Xylonat, dadurch gekennzeichnet, dass sie eine gesteigerte Expression und/oder erhöhte Aktivität einer erfindungsgemäßen homologen D-Xylose-Dehydrogenase aufweist. Bevorzugt ist eine corynforme Bakterienzelle ausgewählt aus der Gruppe enthaltend Cory- nebacterium und Brevibacterium.
Gegenstand der vorliegenden Erfindung ist auch eine Nukleinsäuresequenz, die für eine erfindungsgemäße D-Xylonat-Dehydrogenase aus einer coryneformen Bakterienzelle kodiert.
Gegenstand der vorliegenden Erfindung ist auch eine coryneforme Bakterienzelle bei der eine erhöhte Expression der erfindungsgemäß kodierenden Nukleinsäuresequenz vorliegt. Die vorliegende Erfindung umfasst auch eine coryneforme Bakterienzelle mit zuvor genannten Eigenschaften, die nicht-rekombinant verändert ist und somit ein nicht-genetisch verändertes System (non-GVO) zur Herstellung von D-Xylonat darstellt.
Erfindungsgemäß umfasst sind somit corynforme Bakterienzellen, die ein homologes System zur D-Xylonat-Herstellung darstellen und bei denen eine lolR-vermittelte Deregulation der D- Xylose-Dehydrogenase vorliegt, ohne die Expression und/ oder Aktivität des Regulatorproteins loLR selbst zu verändern. Gegenstand der vorliegenden Erfindung sind somit auch eine corynforme Bakterienzelle, die sich dadurch auszeichnet, dass die Funktionalität einer oder mehrerer operativ-verknüpfter lolR-Bindestellen im regulatorischen, nicht-kodierenden Bereich der Nukleinsäuresequenz kodierend für die D-Xylose- Dehydrogenase vermindert oder ausgeschaltet ist oder eine oder mehrere lolR-Bindestellen teilweise oder komplett deletiert sind. Gegenstand der vorliegenden Erfindung ist ferner ein Verfahren zur mikrobiellen Herstellung von D-Xylonat, bevorzugtmit coryneformen Bakterien, enthaltend die Schritte: a) Bereitstellen einer Lösung enthaltend Wasser und eine C5-Kohlenstoff-Quelle, b) mikrobielle Umsetzung der C5-Kohlenstoffquelle in einer Lösung gemäß Schritt a) zu D- Xylonat in Anwesenheit einer erfindungsgemäßen coryneformen Bakterienzelle, in der die Expression einer Nukleinsäuresequenz kodierend für eine homologe D-Xylose-
Dehydrogenase verstärkt ist und/oder in der die Aktivität einer homologen D-Xylose- Dehydrogenase gesteigert ist, und bei dem c) optional die Isolierung und/oder Aufbereitung von D-Xylonat aus der Lösung erfolgt.
Gegenstand der vorliegenden Erfindung ist auch ein Verfahren, bei dem die mikrobielle Umsetzung zu D-Xylonat in einer Lösung erfolgt, enthaltend Wasser und eine C5-
Kohlenstoff-Quelle ausgewählt aus der Gruppe enthaltend: a) Oligosaccharide oder Polysaccharide, enthaltend D-Xylose-Einheiten, b) D-Xylose, bevorzugt in einer Konzentration von wenigstens 10 g L 1, c) Lignocellulose-, Cellulose-, oder Hemicellulose-haltige Biomasse, deren Hydrolysat oder daraus gewonnener Extrakt enthaltend D-Xylose-Einheiten, und d) eine Kombination von a) bis c). In einer bevorzugten Variante des erfindungsgemäßen Verfahrens wird als C5-Kohlenstoff- quelle Bagasse, bevorzugt Rohrzucker-Bagasse, deren Hydrolysat oder daraus gewonnener Extrakt enthaltend D-Xylose-Einheiten eingesetzt.
Die Erfindung betrifft auch die Verwendung einer erfindungsgemäßen D-Xylose- Dehydrogenase aus coryneformen Bakterien, einer erfindungsgemäßen Nukleinsäuresequenz kodierend für eine solche D-Xylose-Dehydrogenase sowie erfindungsgemäße coryneforme Bakteriezellen, zur Herstellung von D-Xylonat, bevorzugt mit coryneformen Bakterienzellen. Neben der D-Xylonat-Herstellung in einem homologen System (corynforme Bakterien) ist erfindungsgemäß ebenso die D-Xylonat-Herstellung mittels der erfindungsgemäßen D-Xylose-Dehydrogenase in einem heterologen System umfasst.
Die Erfindung betrifft auch die Verwendung von D-Xylonat, hergestellt mit einer erfindungsgemäßen D-Xylose-Dehydrogenase, einer erfindungsgemäßen coryneformen Bakterienzelle oder nach einem erfindungsgemäßen Verfahren oder einer erfindungsgemäßen Zusammensetzung, zur Herstellung von Pharmazeutika, Lebensmitteln, Futtermitteln, Lösungsmitteln, Färbemitteln und/oder Komponenten der Baustoff-Industrie, bevorzugt Zement oder Beton.
Nachfolgend wird der Gegenstand der Erfindung durch Beispiele und anhand von Figuren näher erläutert, ohne dass der Gegenstand der Erfindung dadurch limitiert wird. Der Beschreibung der Ausführungsbeispiele sind einige Definitionen vorangestellt, die für das Verständnis der vorliegenden Erfindung wichtig sind.
Gegenstand der vorliegenden Erfindung ist die Bereitstellung einer D-Xylose-Dehydrogenase isoliert aus coryneformen Bakterien und einer Nukleinsäuresequenz kodierend für ein sol- ches Protein aus coryneformen Bakterien.
Die vorliegende Erfindung betrifft eine D-Xylose-Dehydrogenase, bei der die Aminosäurese- quenz wenigstens 70% Identität zu der Aminosäuresequenz gemäß SEQ ID NO. 2 oder Fragmenten davon aufweist.
Erfindungsgemäß umfasst sind auch Proteine kodierend für eine Aminosäuresequenz mit wenigstens 75 oder 80%, bevorzugt wenigstens 81 , 82, 83, 84, 85 oder 86% Identität, be- sonders bevorzugt 87, 88, 89, 90 % Identität, ganz besonders bevorzugt wenigstens 91 , 92, 93, 94, 95 % Identität oder höchst bevorzugt 96, 97, 98, 99 oder 100% Identität zu der Ami- nosäuresequenz gemäß SEQ ID NO. 2 oder Fragmenten davon. Im Weiteren betrifft die vor- liegende Erfindung eine D-Xylose-Dehydrogenase enthaltend eine Aminosäuresequenz ge- mäß SEQ ID NO. 2 oder Fragmente davon. Gegenstand der Erfindung ist auch eine D-Xylose-Dehydrogenase kodiert durch eine Nukleinsäuresequenz enthaltend wenigstens 70% Identität zu der Nukleinsäuresequenz gemäß SEQ ID NO. 1 oder Fragmente oder Allele davon. Erfindungsgemäß umfasst sind auch Nukleinsäuresequenzen, welche wenigstens eine 75% oder 80%, bevorzugt wenigstens 81 , 82, 83, 84, 85 oder 86% Identität, besonders bevorzugt 87, 88, 89, 90 % Identität, ganz besonders bevorzugt wenigstens 91 , 92, 93, 94, 95 % Identität oder höchst bevorzugt 96, 97, 98, 99 oder 100%ldentität zu der Nukleinsäuresequenz gemäß SEQ ID NO. 1 oder Fragmenten oder Allele davon aufweist. Im Weiteren betrifft die vorliegende Erfindung eine D-Xylose-Dehydrogenase kodiert durch eine Nukleinsäuresequenz gemäß SEQ ID NO. 1 oder Fragmente oder Allele davon. In einer weiteren Variante der vorliegenden Erfindung wird das erfindungsgemäße Protein oder die erfindungsgemäße Nukleinsäuresequenz aus coryneformen Bakterien isoliert, ausgewählt aus der Gruppe enthaltend Corynebacterium und Brevibacterium, insbesondere Corynebacterium glutamicum, Corynebacterium acetoglutamicum, Corynebacterium thermoaminogenes, Brevibacterium flavum, Brevibacterium lactofermentum oder Brevibacterium divaricatum.
In einer bevorzugten Variante der vorliegenden Erfindung wird das erfindungsgemäße Pro- tein oder die erfindungsgemäße Nukleinsäuresequenz aus coryneformen Bakterien isoliert, ausgewählt aus der Gruppe enthaltend Corynebacterium glutamicum ATCC13032, Corynebacterium acetoglutamicum ATCC15806, Corynebacterium acetoacidophilum ATCC13870, Corynebacterium thermoaminogenes FERM BP-1539, Brevibacterium flavum ATCC14067,
Brevibacterium lactofermentum ATCC13869, Brevibacterium divaricatum ATCC14020.
Erfindungsgemäß wird ein Protein aus corynformen Bakterien bereitgestellt, mit dem die Herstellung von D-Xylonat aus D-Xylose in corynformen Bakterien, also in einem homologen System, erstmals ermöglicht wird. Im Gegensatz zu der beschriebenen Annotation als lnositol-2-Dehydrogenase (lolG EC 1.1.1.18, kodiert durch iolG; Klaffl et al, 2013; https://doi.org/10.1128/JB.00265-13) weist die erfindungsgemäße D-Xylose-
Dehydrogenasebemerkenswerter Weise keine lnositol-2-Deyhdrogenase-Aktivität auf. Unerwartet weist die erfindungsgemäße D-Xylose-Dehydrogenase, mit der erfindungsgemäß die Herstellung von D-Xylonat aus D-Xylose in corynformen Bakterien ermöglicht wird, zudem keine Signifikate Homologie zu anderen bekannten D-Xylose-Dehydrogenasen, wie beispielsweise xylB aus Caulobacter crescentus, auf. Ein Protein mit der Struktur und der spezifischen Funktion der erfindungsgemäßen D-Xylose-Dehydrogenase aus corynformen Bakterien ist bislang nicht bekannt. Entgegen dem allgemeinen Fachwissen zu strukturellen und funktionellen Eigenschaften von iolG/lolG ist es der vorliegenden Erfindung zu verdanken, dass eine konkrete homologe Zielsequenz (homologes "target") aus coryneformen Bakterien zur Produktion von D-Xylonat aus D-Xylose in coryneformen Bakterien (somit in einem homologen System) identifiziert und bereitgestellt wird. Durch die Isolierung und Bereitstellung von einer erfindungsgemäßen Nukleinsäuresequenz, kodierend für eine erfindungsgemäße D-Xylose-Dehydrogenase, werden somit ein oder mehrere neue Strukturelemente und Variationen davon verfügbar gemacht, mit deren Hilfe, bevorzugt in corynformen Bakterien als homologem System, aus D-Xylose D-Xylonat hergestellt werden kann. Erfindungsgemäß erfolgt die D-Xylonat-Herstellung in-vitro, bevorzugt enzmyatisch mit einer isolierten erfindungsgemäßen D-Xylose-Dehydrogenase, oder im lebenden Organismus, bevorzugt mikrobiell in Bakterien, Hefen oder Pilzen. Besonders bevorzugt erfolgt die D-Xylonat-Herstellung in coryneformen Bakterien oder Organismen der Gattung Saccharomyces oder Aspergillus. Die vorliegende Erfindung stellt in einer Variante erstmals ein homologes System zur Herstellung von D-Xylonat mit coryneformen Bakterien zur Verfügung.
Durch die Isolierung und Bereitstellung von einer erfindungsgemäßen Nukleinsäuresequenz, kodierend für eine erfindungsgemäße D-Xylose-Dehydrogenase, werden somit ein oder mehrere neue Strukturelemente verfügbar gemacht, mit deren Hilfe aus D-Xylose D-Xylonat hergestellt werden kann. Erfindungsgemäß erfolgt die D-Xylonat-Herstellung in-vitro, bevor- zugt enzmyatisch mit einer isolierten erfindungsgemäßen D-Xylose-Dehydrogenase, oder im lebenden Organismus, bevorzugt mikrobiell in Bakterien, Hefen oder Pilzen. Besonders be- vorzugt erfolgt die D-Xylonat-Herstellung in coryneformen Bakterien oder Organismen der Gattung Saccharomyces oder Aspergillus. Die vorliegende Erfindung zeigt ferner eindeutig, dass sich durch erfindungsgemäß minimale und äußerst definite Nukleotid-Substitutionen in den 5'-upstream regulatorischen Bereichen der kodierenden Gensequenzen für IoIT 1 und IolG eine deutlich erhöhte D-Xylonat-Produktion erzielen läßt: Und dies, ohne dass Gene oder Strukturen aus heterologen Oranismen in den corynformen Bakterienstamm eingeführt werden müssen, was unerwünscht wäre, und auch ohne dass drastische Deletionen an zent- ral agierenden Regulatoren (loIR) vorgenommen werden müssen, die weitreichend undefi- nierte physiologische Auswirkungen in einem Organismus auslösen können. Die erfindungs- gemäß wenigen gezielten Nukeotid-Substitutionen befinden sich dabei in einem Ausmaß, wie sie durchaus auch in der Natur Vorkommen was den erfindungsgemäßen coryneformen Bakterienstamm als non-GVO auszeichnet. Die vorliegende Erfindung stellt somit in einer Variante erstmals ein homologes System zur Herstellung von D-Xylonat mit coryneformen Bakterien zur Verfügung.
Unter„homolog“ im Sinne der Erfindung ist zu verstehen, dass die erfindungsgemäße D- Xylonat-Dehydrogenase und die sie kodierende Nukleinsäuresequenz verwandtschaftlich von einem gemeinsamen Ausgangsstamm coryneformer Bakterienzellen abstammen.„Ho- molog“ wird erfindungsgemäß synonym benutzt mit dem Begriff„nicht heterolog“.
Bemerkenswert ist, dass die erfindungsgemäße D-Xylose-Dehydrogenase bzw. die sie kodierende erfindungsgemäße Nukleinsäuresequenz nur eine Identität von ungefähr 15 % zu der am besten beschriebenen D-Xylose-Dehydrogenase (XylB kodiert durch das Gen xylB) aus Caulobacter cresentus aufweist (Figur 1).
Gegenstand der vorliegenden Erfindung ist eine Nukleinsäuresequenz isoliert aus coryneformen Bakterien kodierend für eine D-Xylose-Dehydrogenase. Eine Variante der vorliegenden Erfindung betrifft eine Nukleinsäuresequenz isoliert aus coryneformen Bakterien kodierend für eine D-Xylose-Dehydrogenase zur Herstellung von D-Xylonat, wobei die Herstellung erfindungsgemäß sowohl in-vitro als auch in lebenden Organismen erfolgt.
Weitere erfindungsgemäße Varianten betreffen eine in-vitro-Herstellung von D-Xylonat, und hier bevorzugt eine enzymatische Herstellung mit Hilfe der erfindungsgemäßen D-Xylose- Dehydrogenase in isolierter Form. Erfindungsgemäß bevorzugt ist eine Herstellung von D- Xylonat in lebenden Organismen, besonders bevorzugt eine mikrobielle Herstellung von D- Xylonat in Wirtszellen ausgewählt aus der Gruppe enthaltend coryneforme Bakterien, Hefen und Pilze. Erfindungsgemäß besonders bevorzugt ist eine mikrobielle Herstellung von D- Xylonat in Wirtszellen der Gattung ausgewählt aus der Gruppe enthaltend Corynebacterium, Brevibacterium, Saccharomyces, und Aspergillus. Erfindungsgemäß ganz besonders bevorzugt ist eine mikrobielle Herstellung von D-Xylonat in Corynebacterium. Es ist erfindungsgemäß auch die D-Xylose-Herstellung mit Saccharomyces cerevisiae, Aspergillus niger oder Corynebacterium glutamicum umfasst. Erfindungsgemäß umfasst sind Nukleinsäuresequenzen ausgewählt aus der Gruppe enthaltend a) eine Nukleinsäuresequenz enthaltend wenigstens 70% Identität zu der Nukleinsäuresequenz gemäß SEQ ID NO. 1 oder Fragmente oder Allele davon, oder b) eine Nukleinsäuresequenz, die unter stringenten Bedingungen mit einer komplementären Sequenz einer Nukleinsäuresequenz gemäß SEQ ID NO. 1 und/oder Fragmenten und/oder Allelen davon hybridisiert, oder c) eine Nukleinsäuresequenz gemäß SEQ ID NO. 1 oder Fragmente oder Allelen davon, oder d) eine Nukleinsäuresequenz kodierend für eine D- Xylose-Dehydrogenase entsprechend jeder der Nukleinsäuren gemäß a) - c), die sich jedoch von diesen Nukleinsäuresequenzen gemäß a) - c) durch die Degeneriertheit des genetischen Codes oder funktionsneutrale Mutationen unterscheidet. Gegenstand der vorliegenden Erfindung sind erfindungsgemäße Nukleinsäuresequenzen zur Herstellung von D-Xylonat. Die Herstellung von D-Xylonat erfolgt erfindungsgemäß bevorzugt in lebenden Mikroorganismen, besonders bevorzugt in coryneformen Bakterien.
Gegenstand der vorliegenden Erfindung ist auch eine Nukleinsäuresequenz, die sich dadurch auszeichnet, dass die Funktionalität einer oder mehrerer operativ-verknüpfter loIR- Bindestellen im regulatorischen, nicht-kodierenden Bereich der erfindungsgemäßen Nukleinsäuresequenz kodierend für die D-Xylose-Dehydrogenase vermindert oder ausgeschaltet ist oder eine oder mehrere operativ-verknüpfte lolR-Bindestellen teilweise oder komplett deletiert sind.
Im Sinne der vorliegenden Erfindung bezieht sich eine „verminderte oder ausgeschaltete Funktionalität“ nicht auf die Funktionalität der erfindungsgemäßen D-Xylose-Dehydrogenase und die sie kodierende erfindungsgemäße Nukleinsäuresequenz, sondern speziell auf die veränderte Funktionalität der lolR-Bindungsstellen, an die normalerweise das zentral- agierende Regulator-Protein loIR bindet, und wodurch die Expression der kodierenden Nukleinsäuresequenz reprimiert wird. „Vermindert“ oder „ausgeschaltet“ im Sinne der vorliegenden Erfindung meint, dass die Expression der kodierenden Nukleinsäuresequenz im Vergleich zur Situation in einer Wildtyp-Wirtszelle schlechter oder nicht mehr unter der Expressionskontrolle des Regulators loIR steht. Im Sinne der vorliegenden Erfindung ist „vermindert“ oder„ausgeschaltet“, gleichbedeutend für„dereguliert“ oder„dereprimiert“ zu versehen.
Der Begriff „Nukleinsäuresequenz“ im Sinne der vorliegenden Erfindung meint jede homologe molekulare Einheit, die genetische Information transportiert. Dies betrifft entsprechend ein homologes Gen, bevorzugt ein natürlicherweise vorkommendes und/oder nicht-rekombinantes homologes Gen, sowie ein homologes Transgen oder Codon-optimierte homologe Gene. Der Begriff„Nukleinsäuresequenz“ bezieht sich erfindungsgemäß auf eine Nukleinsäuresequenz oder Fragmente oder Allele davon, die ein spezifisches Protein kodiert bzw. exprimiert. Bevorzugt bezieht sich der Begriff „Nukleinsäuresequenz“ auf eine Nukleinsäuresequenz enthaltend regulatorische Sequenzen, die der kodierenden Sequenz vorangehen (upstream, stromaufwärts, 5'-nicht-kodierende Sequenz) und nachfolgen (downstream, stromabwärts, 3'-nicht-kodierende Sequenz). Der Begriff „natürlicherweise vorkommendes“ Gen betrifft ein in der Natur gefundenes Gen, z.B. aus einem Wildtyp- Stamm einer coryneformen Bakterienzelle, mit seinen eigenen regulatorischen Sequenzen.
Der Begriff „operativ-verknüpfter Bereich“ betrifft im Sinne der vorliegenden Erfindung eine Assoziation von Nukleinsäuresequenzen auf einem einzelnen Nukleinsäure-Fragment, so dass die Funktion der einen Nukleinsäuresequenz durch die Funktion der anderen Nukleinsäuresequenz beeinflusst ist. Im Kontext eines Promotors oder einer Bindungsstelle für ein Regulator-Protein meint der Begriff„operativ-verknüpft“ im Sinne der Erfindung, dass die kodierende Sequenz unter der Kontrolle der regulatorischen Region (insbesondere des Promotors oder der Regulator-Bindestelle) steht, die die Expression der kodierenden Sequenz reguliert.
Es wird vermutet, dass mehr als 22 verschiedene Gene durch das Regulatorprotein loIR reguliert werden. Es ist bekannt, dass z.B. ioIR selbst (negative Autoregulation), iolT 1 , iolC (und die mit iolC in einem Cluster oder Operon organisierten weiteren Gene) durch IoIR reguliert werden. Die erfindungsgemäße Nukleinsäuresequenz kodierend für eine erfindungsgemäße D-Xylose-Dehydrogenase (und in ihrer Funktion annotiert als lnositol-2- Dehydrogenase, kodiert durch iolG) ist in coryneformen Bakterien in dem Gencluster des myo-lnositol-Katabolismus organisiert (Klaffl et al, 2013; https://doi.org/10.1128/JB.00265- 13). Da das erste Gen in diesem Gencluster das iolC-Gen ist, wird es erfindungsgemäß im Weiteren als iolC-Cluster bezeichnet. Die mit dem iolC-Cluster operativ-verknüpfte, regulatorische Region regelt folglich auch die Expression des iolG-Gens und damit die erfindungsgemäße Nukleinsäuresequenz kodierend für die erfindungsgemäße D-Xylose- Dehydrogenase.
Die vorliegende Erfindung meint mit dem Begriff „Veränderung“ beispielsweise auch „genetische Veränderung“, wobei erfindungsgemäß gemeint ist, dass zwar eine gentechnische Methode angewandt wird, aber keine Insertionen von Nukleinsäuremolekülen erzeugt werden. Im Sinne der Erfindung sind mit„Veränderungen“ Substitutionen und/oder Deletionen gemeint, bevorzugt Substitutionen.„Veränderung“ oder„genetische Veränderung“ im Sinne der vorliegenden Erfindung werden bevorzugt in einem regulatorischen, nicht- kodierenden Bereich der erfindungsgemäßen Nukleinsäuren erzeugt. Es sind alle denkbaren Positionen in einem regulatorischen Bereich kodierender Gene oder Gen-Cluster im Sinne der Erfindung gemeint und umfasst, deren Veränderungen eine messbare Auswirkung auf die Funktionalität der iolR-Bindungsstellen und lolR-Bindung, im Sinne von„vermindert“ oder „ausgeschaltet“, hat.
Eine erfindungsgemäße Variante der vorliegenden Erfindung betrifft eine Nukleinsäuresequenz mit einer oder mehreren Nukleotidsubstitutionen oder Nukleotiddeletionen in den operativ-verknüpften lolR-Bindestellen des iolC-Genclusters aufweist. Bevorzugte Varianten im Sinne der Erfindung sind solche ausgewählt aus der Gruppe von Nukleinsäuresequenzen gemäß SEQ ID No. 7 und SEQ ID NO. 8.
Durch die erfindungsgemäße Isolierung und Bereitstellung einer D-Xylose-Dehydrogenase und einer erfindungsgemäßen Nukleinsäuresequenz kodierend für eine D-Xylose- Dehydrogenase aus coryneformen Bakterienzellen, können erstmals homologe, genetisch definierte, nicht-rekombinante (non-GVO) coryneforme Bakterienzellen hergestellt werden, die zur mikrobiellen, bevorzugt fermentativen, Produktion von D-Xylonat geeignet sind. Unter dem Begriff„nicht-rekombinant“ ist im Sinne der vorliegenden Erfindung zu verstehen, dass das genetische Material der erfindungsgemäßen coryneformen Bakterienzellen lediglich so verändert ist, wie es auf natürliche Weise, z.B. durch natürliche Rekombination oder natürliche Mutation, entstehen könnte. Die erfindungsgemäßen coryneformen Bakterienzellen zeichnen sich somit als nicht-gentechnisch veränderter Organismus (non- GVO) aus.
Dies eröffnet auch die Möglichkeit, industriell interessante Produktionsstämme coryneformer Bakterien weiter zu optimieren, ohne rekombinantes oder heterologes Genmaterial in die Zelle einbringen zu müssen. Die vorliegende Erfindung stellt somit ein System bereit, mit dem die mikrobielle Produktion von D-Xylonat deutliche einfacher, stabiler, preiswerter und wirtschaftlicher durchgeführt werden kann. Denn alle bislang bekannten Produktionsstämme mit einer D-Xylonat-Synthesekapazität, wie z. B. Gluconobacter oxydans, benötigen komplexe Medien für ihr Wachstum, wodurch die Kultivierung deutlich aufwendiger, teurer und damit unwirtschaftlicher wird. Außerdem sind alle bisher beschriebenen D-Xylonat- Produzenten "nicht-natürliche" gentechnisch veränderte Organismen (GVO), u.a. verschiedene Hefe, Pilze und Bakterien. Dadurch entsteht ein Nachteil für die Verwendung in bestimmten industriellen Bereichen (z. B. Lebensmittel- und Pharmaindustrie) infolge aufwändiger Genehmigungsverfahren.
Die erfindungsgemäße coryneforme Bakterienzellebietet eine Vielzahl von Vorteilen, von denen eine Auswahl nachfolgend beschrieben wird. Bei coryneformen Bakterien, bevorzugt der Gattung Corynebacterium, handelt es sich um einen„Generally Recognized As Safe“ (GRAS)-Organismus, welcher in allen industriellen Bereichen eingesetzt werden kann. Coryneforme Bakterien erreichen auf definierten Medien hohe Wachstumsraten und Biomasseerträge (Grünberger et al., 2012) und es existiert umfangreiche Erfahrung im industriellen Einsatz coryneformer Bakterien (Becker et al., 2012).
In einer Variante der vorliegenden Erfindung ist auch die Verwendung der zuvor beschriebenen erfindungsgemäßen Nukleinsäuresequenzen zur Herstellung von lebenden Organismen, bevorzugt Mikroorganismen, besonders bevorzugt Bakterien, Hefen oder Pilzen, ganz besonders bevorzugt der Gattung coryneformer Bakterien wie Corynebacterium oder Brevibacterium, Saccharomyces oder Aspergillus, insbesondere Corynebacterium glutamicum, Saccharomyces cerevisiae oder Aspergillus niger, für die Herstellung von D- Xylonat umfasst.
Erfindungsgemäß umfasst sind Nukleinsäuresequenzen ausgewählt aus der Gruppe enthaltend SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 63 oder SEQ ID NO. 64 oder Fragmente oder Allele davon zur Herstellung coryneformer Bakterienzellen oder anderer erfindungsgemäß geeigneter Organismen für die Herstellung von D-Xylonat. Die Varianten gemäß SEQ ID NO. 7 bzw. SEQ ID NO. 63 der erfindungsgemäßen Nukleinsäuresequenzen enthalten Nukleotid-Austausche, also
Substitutionen, in der operativ-verknüpften Promotorregion des iolC-Genclusters enthaltend die Nukleotidsequenz (iolG) kodierend für die erfindungsgemäße D-Xylose-Dehydrogenase. Die Varianten gemäß SEQ ID NO. 8 bzw. SEQ ID NO. 64 der erfindungsgemäßen Nukleinsäuresequenzen enthalten Nukleotid-Deletionen in der operativ-verknüpften Promotorregion des iolC-Genclusters enthaltend die Nukleotidsequenz (iolG) kodierend für die erfindungsgemäße D-Xylose-Dehydrogenase. Eine weitere Variante der vorliegenden Erfindung betrifft die Verwendung einer Nukleinsäuresequenz gemäß SEQ ID NO. 7 oder 8 zur Herstellung coryneformer Bakterien. Erfindungsgemäß umfasst ist auch die Verwendung der Nukleinsäuresequenzen ausgewählt aus der Gruppe enthaltend SEQ ID NO. 63 und SEQ ID NO. 64 zur Herstellung coryneformer Bakterien.
Gegenstand der vorliegenden Erfindung sind auch Nukleinsäuresequenzen enthalten Nukleotid-Substitutionen oder -Deletionen in der operativ-verknüpften Promotorregion des iolT1-Gens des myo-lnositol/Proton-Symporters. Bevorzugte Varianten umfassen Nukleinsäuresequenzen gemäß SEQ ID NO. 9 oder SEQ ID NO. 10. Eine bevorzugte Variante der vorliegenden Erfindung betrifft die Verwendung einer Nukleinsäuresequenz gemäß SEQ ID NO. 9 oder SEQ ID NO. 10, bei derdie operativ-verbundenen lolR- Bindestellen deletiert sind zur Herstellung coryneformer Bakterien. Besonders bevorzugt ist eine coryneforme Bakterienzelle bei der eine oder mehrere Veränderungen, ausgewählt aus der Gruppe enthaltend eine oder mehrere Substitutionen oder eine oder mehrere Deletionen im Chromosom, vorliegen.
Gegenstand der vorliegenden Erfindung ist auch eine coryneforme Bakterienzelle zur Herstellung von D-Xylonat, dadurch gekennzeichnet, dass sie eine gesteigerte Expression und/oder erhöhte Aktivität einer erfindungsgemäßen homologen D-Xylose-Dehydrogenase aufweist.
Im Sinne der vorliegenden Erfindung ist„gesteigert“ gleichbedeutend mit„erhöht“, oder „verbessert“, „verändert“ oder „dereguliert“ zu verstehen und wird synonym verwendet. „Gesteigert“ im Sinne der vorliegenden Erfindung meint beispielsweise die gesteigerte Genexpression eines Gens im Vergleich zu der Expression des jeweiligen Ausgangsgens im unveränderten, natürlicherweise nicht gesteigerten Zustand. Gleiches ist im Sinne der Erfindung bezüglich der erhöhten Enzymaktivität gemeint. Beispielsweise stellt der Wildtyp einer coryneformen Bakterienzelle ein genetisch nicht verändertes Ausgangsgen oder - enzym dar. Bevorzugt sind coryneforme Wildtypzellen der Gattung Corynbacterium oder Brevibacterium; besonders bevorzugt sind coryneforme Bakterienzellen des Wildtyps Corynebacterium glutamicum; ganz besonders bevorzugt sind coryneforme Bakterienzellen des Wildtyps Corynebacterium glutamicum ATCC 13032.
In einer Variante der vorliegenden Erfindung ist eine coryneforme Bakterienzelle umfasst, die sich dadurch auszeichnet, dass sie eine gesteigerte Expression einer Nukleinsäuresequenz gemäß einer der zuvor beschriebenen Varianten aufweist. Eine weitere Variante einer erfindungsgemäßen coryneformen Bakterienzelle zeichnet sich dadurch aus, dass die gesteigerte Expression der D-Xylose-Dehydrogenase auf Veränderungen beruht, ausgewählt aus der Gruppe enthaltend a) Veränderung der Regulation oder von Signalstrukturen zur Genexpression, b) . Veränderung der Transkriptionsaktivität der kodierenden Nukleinsäuresequenz, oder c) Erhöhung der Genkopienzahl der kodierenden Nukleinsäuresequenz. Erfindungsgemäß umfasst sind dabei Veränderung der Signalstrukturen der Genexpression, wie beispielsweise durch Veränderung der Repressorgene, Aktivatorgene, Operatoren, Promotoren; Attenuatoren, Ribosomenbindungsstellen, des Startkodons, Terminatoren. Ebenso umfasst sind das Einführen eines stärkeren Promoters, wie beispielsweise des tac-Promotors oder einen IPTG-induzierbaren Promotors. Das Einführen eines stärkeren Promoters, wie z. B. den tac- Promoter (Amann et al (Gene 1988 69:301-15), oder Promotoren aus der Gruppe der bei Patek et al (Microbiology 1996 142:1297) beschriebenen Promotoren ist bevorzugt, aber nicht limitierend für die vorliegende ERfindung. Weitere Beispiele finden sich in der WO 96/15246 oder in Boyd and Murphy (Journal of Bacteriology 170: 5949 (1988)), in Voskuil and Chambliss (Nucleic Acids Research 26: 3548 (1998), in Jensen and Hammer (Biotechnology and Bioengineering 58: 191 (1998)), in P tek et al. (Microbiology 142: 1297 (1996)), in Knippers ("Molekulare Genetik", 6th Edition, Georg Thieme Verlag, Stuttgart, Germany, 1995) oder auch bei Winnacker ("Gene und Klone", VCH Verlagsgesellschaft, Weinheim, Germany, 1990). Eine erhöhte Genkopienzahl der erfindungsgemäß kodierenden Nukleinsäuresequenz kann in weiteren Varianten der Erfindung chromosomal-kodiert oder Vektor-basiert, bevorzugt Plasmid-kodiert, vorliegen. Gegenstand der vorliegenden Erfindung ist eine coryneforme Bakterienzelle, bei der die Erhöhung der Kopienzahl chromosomal- kodiert oder extra-chromosomal-kodiert, bevorzugt Vektor-kodiert oder Plasmid-kodiert, vorliegt. Erfindungsgemäß eignen sich als Plasmide solche, die in coryneformen Bakterien repliziert werden. Zahlreiche bekannte Plasmidvektoren wie z. B. pZ1 (Menkel et al., Applied and Environmental Microbiology (1989) 64: 549-554), pEKExl (Eikmanns et al., Gene 102:93-98 (1991)) oder pHS2-1 (Sonnen et al., Gene 107:69-74 (1991)) beruhen auf den kryptischen Plasmiden pHM1519, pBL1 oder pGA1. Andere Plasmidvektoren wie z. B. solche, die auf pCG4 (US-A 4,489,160), oder pNG2 (Serwold-Davis et al., FEMS Microbiology Letters 66, 119-124 (1990)), oder pAG1 (US-A 5,158,891) beruhen, können in gleicher Weise verwendet werden (O. Kirchner 2003, J. Biotechnol. 104:287-99). Ebenso können Vektoren mit regulierbarer Expression benutzt werden, wie zum Beispiel pEKEx2 (B. Eikmanns, 1991 Gene 102:93-8; O. Kirchner 2003, J. Biotechnol. 104:287-99). Auch kann das Gen durch Integration in das Chromosom in einfacher Kopie (P. Vasicova 1999, J. Bacteriol. 181 :6188-91), oder mehrfacher Kopie (D. Reinscheid 1994 Appl. Environ Microbiol 60:126-132) exprimiert werden. Die Transformation des gewünschten Stammes mit dem Vektor zur Erhöhung der Kopienzahl erfolgt durch Konjugation oder Elektroporation des gewünschten Stammes von beispielsweise C. glutamicum. Die Methode der Konjugation ist beispielsweise bei Schäfer et al. (Applied and Environmental Microbiology (1994) 60:756- 759) beschrieben. Methoden zur Transformation sind beispielsweise bei Tauch et al. (FEMS Microbiological Letters (1994)123:343-347) beschrieben.
Eine weitere Variante der vorliegenden Erfindung betrifft eine coryneforme Bakterienzelle gekennzeichnet dadurch, dass die erhöhte Aktivität der D-Xylose-Dehydrogenase-Aktivität auf Veränderungen beruht, ausgewählt aus der Gruppe enthaltend a) eine Erhöhung der Expression der kodierenden Nukleinsäuresequenz, b) eine Expression einer Nukleinsäuresequenz oder Fragmenten davon, die für eine D-Xylose-Dehydrogenase mit erhöhter katalytischer Aktivität und/oder Substratspezifität kodiert, c) eine Erhöhung der Stabilität der mRNA abgeleitet von der kodierenden Nukleinsäuresequenz, oder d) eine Veränderung der katalytischen Aktivität und/oder Substratspezifität einer homologen D- Xylose-Dehydrogenase für den Umsatz von D-Xylose oder eine Kombination von a) - d). Die Erhöhung der mRNA-Stabilität kann beispielsweise durch Mutation der terminalen Positionen erreicht werden, welche den Abbruch der Transkription steuern. Maßnahmen, die zu einer Veränderung der katalytischen Eigenschaften von Enzymproteinen führen, insbesondere zu einer veränderten Substratspezifität sind aus dem Stand der Technik bekannt. Neben erfindungsgemäß bevorzugten partiellen oder kompletten Deletionen regulatorischer Strukturen sind erfindungsgemäß auch Veränderungen, wie z. B. Transitionen, Transversionen oder Insertionen umfasst, sowie Methoden der gerichteten Evolution. Anleitungen zur Erzeugung derartiger Veränderungen können bekannten Lehrbüchern (R. Knippers „Molekulare Genetik“, 8. Auflage, 2001 , Georg Thieme Verlag, Stuttgart, Deutschland) entnommen werden.
Eine bevorzugte Variante der vorliegenden Erfindung umfasst eine coryneforme Bakterienzelle bei der die Funktionalität einer oder mehrerer operativ-verknüpfter lolR- Bindestellen im regulatorischen, nicht-kodierenden Bereich der Nukleinsäuresequenz kodierend für die D-Xylose-Dehydrogenase vermindert oder ausgeschaltet ist oder eine oder mehrere lolR-Bindestellen teilweise oder komplett deletiert sind. Gegenstand der vorliegenden Erfindung ist auch eine coryneforme Bakterienzelle, die eine
Nukleinsäuresequenz mit einer oder mehreren Nukleotidsubstitutionen oder Nukleotiddeletionen in den operativ-verknüpften lolR-Bindestellen des iolC-Genclusters (enthaltend die für die erfindungsgemäße D-Xylose-Dehydrogenase kodierende Nukleinsäuresequenz iolG) aufweist. Erfindungsgemäß bevorzugte Varianten umfassen Sequenzen ausgewählt aus der Gruppe von SEQ ID NO. 7 und SEQ ID NO. 8. Weitere erfindungsgemäße Varianten umfassen Sequenzen ausgewählt aus der Gruppe enthaltend SEQ ID NO. 63 und SEQ ID NO. 64.
Die vorliegende Erfindung betrifft weiter eine coryneforme Bakterienzelle, die eine Nukleinsäuresequenz mit einer oder mehreren Nukleotidsubstitutionen oder Nukleotiddeletionen in den operativ-verknüpften lolR-Bindestellen des iolT1-Gens aufweist. Erfindungsgemäße Varianten umfassen Sequenzen ausgewählt aus der Gruppe von Nukleinsäuresequenzen SEQ ID NO. 9 und SEQ ID NO. 10.
Ein Vorteil der erfindungsgemäßen Veränderung der lolR-Bindungsstellen in der regulatorischen Region, die der erfindungsgemäßen Nukleinsäuresequenz kodierend für die erfindungsgemäße D-Xylose-Dehydrogenase zugeordnet ist, ist dass die entsprechend erfindungsgemäßen coryneformen Bakterien nicht-rekombinant verändert sind. Insbesondere vorteilhaft ist, dass das lolR-Regulatorprotein selbst oder das entsprechend kodierende iolR-Gen nicht verändert ist. Dies hat den enormen Vorteil, dass negative physiologische Effekte als Konsequenz einer Inaktivierung von iolR/loIR ausgeschlossen sind. Als non-GVO stellen die erfindungsgemäßen Bakterienzellen damit eine sehr attraktivePlattform dar für die großtechnische oder industrielle Produktion von D-Xylonat in einem homologen System.
Die vorliegende Erfindung betrifft somit auch eine coryneforme Bakterienzelle, die nicht- rekombinant verändert ist. Somit ist erfindungsgemäß auch eine coryneforme Bakterienzelle umfasst, die nicht-gentechnisch verändert (non-GVO) ist.
Gegenstand der vorliegenden Erfindung ist auch eine coryneforme Bakterienzelle bei der die erhöhte Kopienzahl einer erfindungsgemäßen D-Xylose-Dehydrogenase kodierenden
Nukleinsäuresequenz chromosomal-kodiert vorliegt.
Gegenstand der vorliegenden Erfindung ist auch eine coryneforme Bakterienzelle bei der die erhöhte Kopienzahl einer erfindungsgemäßen D-Xylose-Dehydrogenase kodierenden Nukleinsäuresequenz vektor-kodiert, bevorzugt plasmid-kodiert, vorliegt.
In bevorzugte Varianten der vorliegenden Erfindung sind coryneforme Bakterien umfasst, bei denen das iolG-Gen chromosomal-kodiert in erhöhter Kopienzahl vorliegt und die entsprechenden lolR-Bindungsstellen deletiert sind. In einer weiteren bevorzugten Variante weist die erfindungsgemäße coryneforme Bakterienzelle zusätzlich ein durch Deletionen verändertes iolT1-Gen auf, das aufgrund dessen lolR-unabhängig exprimiert wird. Diese nicht-rekombinanten, also homologen und zudem genau definierten, corynformen Bakterienzellen eignen sich vorteilhafter Weise für die großtechnische mikrobielle Produktion von D-Xylonat in Lösungen mit D-Xylose haltigen Kohlenstoff- und Energiequellen.
Erfindungsgemäß kann es für die Produktion von D-Xylonat vorteilhaft sein, zusätzlich zur Erhöhung der Xylose-Dehydrogenase-Aktivität die Expression oder Aktivität eines oder mehrere anderer Gene oder Proteine zu verändern, die ebenfalls durch das Regulatorprotein loIR reguliert werden.
Normalerweise können genetisch nicht-veränderte coryneforme Bakterien D-Xylose als einzige Kohlenstoff- und Energiequelle nicht verstoffwechseln. Es ist bekannt, dass der sogenannte Isomerase- und Weimberg-Stoffwechselweg für die oxidative Metabolisierung von D-Xylose in corynforme Bakterien heterolog implementiert werden muss. Durch die heterologe Expression entsprechender Gene aus Organismen wie z. B. xylB aus Caulobacter crescentus, kann auch ein corynformes Bakterium D-Xylose enzymatisch umsetzen. Eine heterologe Expression ist erfindungsgemäß jedoch vorrangig nicht erwünscht, aufgrund der damit verbundenen negativen Eigenschaften für eine industrielle D- Xylonat-Produktion. Ferner ist bekannt, dass ein myo-lnositol/Proton-Symporter (IoIT 1), dessen Gene unter der Kontrolle des lolR-Regulatorproteins stehen, zur Aufnahme von D- Xylose in die Zelle coryneformer Bakterien beiträgt. Durch Veränderungen, wie Deletionen oder Nukleotidsubstitutionen, in der regulatorischen Region des iolT1-Gens, durch welche die Bindung des iolR-Regulatorgens verhindert wird, kann somit ein von der Regulation des iolR-Regulators unabhängiger Bakterienstamm generiert werden. In einer weiteren Variante einer erfindungsgemäßen corynformen Bakterienzelle liegt ein dereguliertes iolT1-Gen vor, bei der auch eine erfindungsgemäß gesteigerte Expression und/oder erhöhte Aktivität der erfindungsgemäßen D-Xylose-Dehydrogenase vorliegt. Das Gen iolT2 ist ebenfalls relevant für den D-Xylose Katabolismus. Eine coryneforme Bakterienzelle enthaltend eine verstärkte Expression iolT2-Gens und/oder eine erhöhte Aktivität des myo-lnositol/Proton-Symporter lolT2 sind erfindungsgemäß umfasst.
Gegenstand der vorliegenden Erfindung ist eine coryneforme Bakterienzelle a) bei der die Aktivität einer erfindungsgemäßen D-Xylose-Dehydrogenase gesteigert ist, b) bei der eine erfindungsgemäße Nukleinsäuresequenz kodierend für eine erfindungsgemäße D-Xylose- Dehydrogenase verstärkt exprimiert ist, c) bei der eine Nukleinsäuresequenz kodierend für einen myo-lnositol/Proton-Symporter (IoIT 1) gemäß SEQ ID NO. 3 oder Fragmente oder Allele davon verstärkt exprimiert ist, d) bei der ein myo-lnositol/Proton-Symporter IoIT 1 mit einer Aminosäuresequenz gemäß SEQ ID NO. 4 oder Fragmente davon in seiner Aktivität gesteigert ist, e) die eine Nukleinsäuresequenz kodierend für einen myo-lnositol/Proton- Symporter (IoIT 1 ) mit einer oder mehreren Nukleotidsubstitutionen oder Nukleotiddeletionen in den operativ-verknüpften lolR-Bindestellen des iolT1-Gens ausgewählt aus der Gruppe von Nukleinsäuresequenzen SEQ ID NO. 9 und SEQ ID NO. 10 oder Fragmente davon, aufweist, f) bei der eine Nukleinsäuresequenz kodierend für einen myo-lnositol/Proton- Symporter (lolT2) gemäß SEQ ID NO. 5 oder Fragmente oder Allele davon verstärkt exprimiert ist, g) bei der ein myo-lnositol/Proton-Symporter lolT2 mit einer Aminosäuresequenz gemäß SEQ ID NO. 6 oder Fragmente davon in seiner Aktivität gesteigert ist, h) bei der beide Nukleinsäuresequenzen kodierend für myo-lnositol/Proton- Symporter IoIT 1/2 nach c) und f) verstärkt exprimiert sind, i) bei der beide myo- lnositol/Proton-Symporter lolT1/2 nach d) und g) in ihrer Aktivität gesteigert sind, j) die eine Nukleinsäuresequenz aufweist, bei der die Funktionalität einer oder mehrerer operativ- verknüpfter lolR-Bindestellen im regulatorischen, nicht-kodierenden Bereich des iolC- Genclusters (enthaltend iolG kodierend für eine erfindungsgemäße D-Xylose- Dehydrogenase) vermindert oder ausgeschaltet ist oder eine oder mehrere lolR-Bindestellen teilweise oder komplett deletiert sind, k) die eine Nukleinsäuresequenz aufweist, die eine oder mehrere Nukleotidsubstitutionen oder Nukleotiddeletionen in den operativ-verknüpften lolR-Bindestellen des iolC-Genclusters aufweist, bevorzugt ausgewählt aus der Gruppe enthaltend Nukleinsäuresequenzen gemäß SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 63 und SEQ ID NO. 64 oder Fragmente oder Allele davon, oder I) eine Kombination aus a) - k).
In einer bevorzugten Variante einer erfindungsgemäßen coryneformen Bakterienzelle umfasst diese definierte Veränderungen ihres Genoms, nämlich die eines deregulierten iolT1-Gens und eines deregulierten iolG-Gens. Weiter bevorzugt sind Veränderungen der regulatorischen Bereiche des iolT-1-Gens oder/und iolG-Gens (bzw. des iolC-Genclusters, enthaltend das iolG-Gen). Insbesondere sind hier Substitutionen oder Deletionen der Bindungsstellen des lolR-Regulatorproteins bevorzugt. Weiter bevorzugt sind Deletionen. Die entsprechend erfindungsgemäßen Bakterienzellen sind nicht genetisch verändert und weisen keine rekombinante DNA auf, was sie als non-GVO für den Einsatz in der großtechnischen Produktion von D-Xylonat, wie z. B. der Pharma- oder Lebensmittelindustrie, besonders vorteilhaft auszeichnet. In einer Variante der vorliegenden Erfindung kann auch eine Nukleinsäuresequenz kodierend für einen myo-lnositol-Regulator loIR oder Fragmente oder Allele davon komplett oder teilweise deletiert sein oder die Expression eines iolR-Gens vermindert sein oder fehlen oder ein myo-lnositol-Regulator loIR in seiner Aktivität vermindert oder komplett ausgeschaltet sein.
Bevorzugte Varianten einer coryneformen Bakterienzelle sind ausgewählt aus der Gruppe enthaltend Corynebacterium, Brevibacterium, insbesondere Corynebacterium glutamicum, Corynebacterium acetoglutamicum, Corynebacterium thermoaminogenes, Brevibacterium flavum, Brevibacterium lactofermentum oder Brevibacterium divaricatum. Besonders bevorzugte Varianten einer coryneformen Bakterienzelle sind ausgewählt aus der Gruppe enthaltend Corynebacterium glutamicum ATCC13032, Corynebacterium acetoglutamicum ATCC15806, Corynebacterium acetoacidophilum ATCC13870, Corynebacterium thermoaminogenes FERM BP-1539, Brevibacterium flavum ATCC14067, Brevibacterium lactofermentum ATCC 13869 oder Brevibacterium divaricatum ATCC 14020. Besonders bevorzugt aber nicht limitierend ist Corynebacterium glutamicum.
Eine erfindungsgemäße D-Xylose-Dehydrogenase, eine sie kodierende erfindungsgemäße Nukleinsäuresequenz sowie eine erfindungsgemäße Verwendung ist zudem auch für die Herstellung von D-Xylonat im weitesten Sinne geeignet, bei der z.B. ein homologes Expressionssystem nicht zwingend erforderlich ist. Somit sind erfindungsgemäß auch heterologe Systeme oder Wirtszellen oder Organismen umfasst, die die erfindungsgemäße D-Xylose-Dehydrogenase und/oder die sie kodierende erfindungsgemäße Nukleinsäuresequenz aufweisen und/oder in denen eine erfindungsgemäße Verwendung der zuvor genannten Elemente (wie z. B. (regulatorische) Sequenzen, Gene, Proteine) oder ein Verfahren zur Herstellung von D-Xylonat erfolgt. Erfindungsgemäß umfasst ist somit sowohl eine coryneforme Bakterienzelle also auch ein heterologes Wirtssystem, bei der die Expression des iolR-Gens vermindert ist oder fehlt, oder das iolR-Gen teilweise oder komplett deletiert, oder das lolR-Regulatorprotein in seiner Aktivität vermindert oder komplett ausgeschaltet ist.
Weitere erfindungsgemäße Varianten betreffen eine in-vitro-Herstellung von D-Xylonat, bevorzugt eine enzymatische Herstellung mit Hilfe einer aufgereinigten erfindungsgemäßen D-Xylose-Dehydrogenase. Erfindungsgemäß bevorzugt ist eine mikrobielle Herstellung von D-Xylonat in Wirtszellen ausgewählt aus der Gruppe enthaltend coryneforme Bakterien, Hefen und Pilze. Erfindungsgemäß besonders bevorzugt ist eine mikrobielle Herstellung von D-Xylonat in Wirtszellen der Gattung ausgewählt aus der Gruppe enthaltend Corynebacterium, Brevibacterium, Saccharomyces, und Aspergillus. Erfindungsgemäß ganz besonders bevorzugt ist eine mikrobielle Herstellung von D-Xylonat in Corynebacterium. Es ist erfindungsgemäß auch die D-Xylose-Herstellung mit Saccharomyces cerevisiae, Aspergillus niger oder Corynebacterium glutamicum umfasst.
Die Erfindung betrifft auch eine Verwendung der erfindungsgemäßen D-Xylose- Dehydrogenase oder die sie kodierende erfindungsgemäße Nukleinsäuresequenz zum Einsatz in heterologen Systemen oder in-vitro-Systemen zur biotechnologischen Herstellung von D-Xylonat aus D-Xylose.
Gegenstand der vorliegenden Erfindung ist ein Verfahren zur Herstellung von D-Xylonat, enthaltend die Schritte: a) Bereitstellen einer Lösung enthaltend Wasser und eine C5-Kohlenstoff-Quelle, b) mikrobielle Umsetzung der C5-Kohlenstoffquelle in einer Lösung gemäß Schritt a) zu
D-Xylonat in Anwesenheit einer erfindungsgemäßen coryneformen Bakterienzelle, in der die Expression einer Nukleinsäuresequenz kodierend für eine homologe D- Xylose-Dehydrogenase verstärkt ist und/oder in der die Aktivität einer homologen D- Xylose-Dehydrogenase gesteigert ist, und c) optionale Isolierung und/oder Aufbereitung von D-Xylonat aus der Lösung.
Unter „Lösung“ ist erfindungsgemäß gleichbedeutend zu verstehen „Medium“, „Kulturmedium“,„Kulturbrühe“ oder„Kulturlösung“. Im Sinne der vorliegenden Erfindung ist „mikrobiell“ gleichbedeutend zu verstehen mit„biotechnologisch“ oder„fermentative“. Unter „Umsetzung“ ist erfindungsgemäß ist gleichbedeutend zu verstehen „Verstoffwechslung“, „Metabolisierung“ oder „Kultivierung“. Unter „Aufbereitung“ ist erfindungsgemäß ist gleichbedeutend zu verstehen„Abtrennung“,„Aufkonzentrierung“ oder„Aufreinigung“.
In Varianten des erfindungsgemäßen Verfahrens wird eine erfindungsgemäße coryneforme Bakterienzelle eingesetzt. Erfindungsgemäß umfasst ist ein Verfahren, bei dem die D- Xylose-Dehydrogenase in Schritt b) eine Aminosäuresequenz von wenigstens 70% Identität zu der Aminosäuresequenz gemäß SEQ ID NO. 2 oder Fragmenten davon aufweist oder durch eine Nukleinsäuresequenz kodiert ist, die wenigstens 70% Identität zu der Nukleinsäuresequenz gemäß SEQ ID NO. 1 oder Fragmente oder Allele davon aufweist. Eine weitere Variante der vorliegenden Erfindung umfasst ein Verfahren unter Einsatz einer erfindungsgemäßen coryneformen Bakterienzelle a) bei der die Aktivität einer erfindungsgemäßen D-Xylose-Dehydrogenase gesteigert ist, b) bei der eine erfindungsgemäße Nukleinsäuresequenz kodierend für eine erfindungsgemäße D-Xylose- Dehydrogenase verstärkt exprimiert ist, c) bei der eine Nukleinsäuresequenz kodierend für einen myo-lnositol/Proton-Symporter (IoIT 1 ) gemäß SEQ ID NO. 3 oder Fragmente oder Allele davon verstärkt exprimiert ist, d) bei der ein myo-lnositol/Proton-Symporter IoIT 1 mit einer Aminosäuresequenz gemäß SEQ ID NO. 4 oder Fragmente davon in seiner Aktivität gesteigert ist, e) die eine Nukleinsäuresequenz kodierend für einen myo-lnositol/Proton- Symporter (IoIT 1 ) mit einer oder mehreren Nukleotidsubstitutionen oder Nukleotiddeletionen in den operativ-verknüpften lolR-Bindestellen des iolT1-Gens ausgewählt aus der Gruppe von Nukleinsäuresequenzen SEQ ID NO. 9 und SEQ ID NO. 10 oder Fragmente oder Allele davon, aufweist, f) bei der eine Nukleinsäuresequenz kodierend für einen myo- lnositol/Proton-Symporter (lolT2) gemäß SEQ ID NO. 5 oder Fragmente oder Allele davon verstärkt exprimiert ist, g) bei der ein myo-lnositol/Proton-Symporter lolT2 mit einer Aminosäuresequenz gemäß SEQ ID NO. 6 oder Fragmente davon in seiner Aktivität gesteigert ist, h) bei der beide Nukleinsäuresequenzen kodierend für myo-lnositol/Proton- Symporter IoIT 1/2 nach c) und f) verstärkt exprimiert sind, i) bei der beide myo- lnositol/Proton-Symporter lolT1/2 nach d) und g) in ihrer Aktivität gesteigert sind, j) die eine Nukleinsäuresequenz aufweist, bei der die Funktionalität einer oder mehrerer operativ- verknüpfter lolR-Bindestellen im regulatorischen, nicht-kodierenden Bereich des iolC- Genclusters (enthaltend iolG kodierend für eine erfindungsgemäße D-Xylose- Dehydrogenase) vermindert oder ausgeschaltet ist oder eine oder mehrere lolR-Bindestellen teilweise oder komplett deletiert sind, k) die eine Nukleinsäuresequenz aufweist, die eine oder mehrere Nukleotidsubstitutionen oder Nukleotiddeletionen in den operativ-verknüpften lolR-Bindestellen des iolC-Genclusters aufweist, bevorzugt ausgewählt aus der Gruppe enthaltend Nukleinsäuresequenzen gemäß SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 63 und SEQ ID NO. 64 oder Fragmente oder Allele davon, oder I) eine Kombination aus a) - k) aufweist.
In einer Variante des erfindungsgemäßen Verfahrens kann auch eine coryneforme Bakterienzelle eingesetzt sein, die eine Nukleinsäuresequenz aufweist, kodierend für einen myo-lnositol-Regulator loIR oder Fragmenten davon, die komplett oder teilweise deletiert sind oder in der die Expression eines iolR-Gens vermindert ist oder fehlt oder ein myo- lnositol-Regulator loIR, der in seiner Aktivität vermindert oder komplett ausgeschaltet ist. Gegenstand der vorliegenden Erfindung ist ein Verfahren bei dem die mikrobielle Umsetzung zu D-Xylonat in einer Lösung erfolgt, enthaltend Wasser und eine C5-Kohlenstoff-Quelle ausgewählt aus der Gruppe enthaltend: a) Oligosaccharide oder Polysaccharide, enthaltend D-Xylose-Einheiten, b) D-Xylose, bevorzugt in einer Konzentration von wenigstens 10 gL 1, c) Lignocellulose-, Cellulose-, oder Hemicellulose-haltige Biomasse, deren Hydrolysat oder daraus gewonnener Extrakt enthaltend D-Xylose-Einheiten, und d) eine Kombination von a) bis c).
In einer bevorzugten Variante des erfindungsgemäßen Verfahrens wird als C5-Kohlenstoff- quelle Bagasse, bevorzugt Rohrzucker-Bagasse, deren Hydrolysat oder daraus gewonnener Extrakt enthaltend D-Xylose eingesetzt. In einer Varianten des erfindungsgemäßen Verfahrens ist ein Verfahren umfasst, bei dem die Kulturlösung als Kohlenstoff- und Energiequellen zu Beginn der Kultivierung D-Glukose, bevorzugt wenigstens 8 -10 g L 1, neben D-Xylose enthält. Das zu verwendende Kulturmedium sollte in geeigneter Weise den Ansprüchen der jeweiligen Mikroorganismen genügen. Beschreibungen von Kulturmedien verschiedenener Mikroorganismen sind im Handbuch "Manual of Methods for General Bacteriology” der American Society for Bacteriology (Washington D.C., USA, 1981) enthalten. Neben D-Xylose als Ausgangssubstrat der D-Xylonatbildung können als Kohlenstoffquelle Zucker und Kohlehydrate wie z.B. Glucose, Saccharose, Lactose, Fructose, Maltose, Melasse, Stärke und Cellulose, Öle und Fette wie z. B. Sojaöl, Sonnenblumenöl, Erdnussöl und Kokosfett, Fettsäuren wie z. B. Palmitinsäure, Stearinsäure und Linolsäure, Alkohole wie z. B. Glycerin und Ethanol und organische Säuren wie z. B. Essigsäure verwendet werden. Diese Stoffe können einzeln oder als Mischung verwendet werden. Als Stickstoffquelle können organische, Stickstoff-haltige Verbindungen wie Peptone, Hefeextrakt, Fleischextrakt,
Malzextrakt, Maisquellwasser, Sojabohnenmehl und Harnstoff oder anorganische Verbindungen wie Ammoniumsulfat, Ammoniumchlorid, Ammoniumphosphat, Ammoniumcarbonat und Ammoniumnitrat verwendet werden. Die Stickstoffquellen können einzeln oder als Mischung verwendet werden. Als Phosphorquelle können Kaliumdihydrogenphosphat oder Dikaliumhydrogenphosphat oder die entsprechenden Natrium-haltigen Salze verwendet werden. Das Kulturmedium sollte weiterhin Salze von Metallen enthalten wie z.B. Magnesiumsulfat oder Eisensulfat, die für das Wachstum notwendig sind. Schließlich können essentielle Wuchsstoffe, wie Aminosäuren und Vitamine zusätzlich zu den oben genannten Stoffen eingesetzt werden. Die genannten Einsatzstoffe können zur Kultur in Form eines einmaligen Ansatzes hinzugegeben oder in geeigneter Weise während der Kultivierung zugefüttert werden.Zur pH - Kontrolle der Kultur werden basische Verbindungen wie Natriumhydroxid, Kaliumhydroxid, Ammoniak oder saure Verbindungen wie Salzsäure, Phosphorsäure oder Schwefelsäure in geeigneter Weise eingesetzt. Zur Kontrolle der Schaumentwicklung können Antischaummittel wie z.B. Fettsäurepolyglykolester eingesetzt werden. Zur Aufrechterhaltung der Stabilität von Plasmiden können dem Medium geeignete selektiv wirkende Stoffe, z.B. Antibiotika, hinzugefügt werden. Um aerobe Bedingungen aufrechtzuerhalten werden Sauerstoff oder Sauerstoff-haltige Gasmischungen wie z.B. Luft in die Kultur eingetragen. Die Temperatur der Kultur liegt normalerweise bei 20°C bis 45°C und vorzugsweise bei 25°C bis 40°C. Die Kultur wird solange fortgesetzt, bis sich ein Maximum an D-Xylonat gebildet hat. Dieses Ziel wird normalerweise innerhalb von 10 Stunden bis 160 Stunden erreicht.
Die vorliegende Erfindung betrifft Verfahren bei dem die Kultivierung diskontinuierlich oder kontinuierlich, bevorzugt im batch-, fed-batch-, repeated-fed-batch-Modus oder als Ein-Topf- Hydrolyse-Fermentationsprozess erfolgt.
Eine bevorzugte Variante eines erfindungsgemäßen Verfahrens erfolgt im fed-batch-Modus. Besonders bevorzugt ist die„Zufütterung“ von D-Xylose.
Erfindungsgemäß umfasst ist auch ein Verfahren bei dem die Kultivierung einer erfindungsgemäßen coryneformen Bakterienzelle in einer Lösung erfolgt, die zusätzlich D- Glukose, bevorzugt in Konzentrationen von wenigstens 8-10 g L 1, enthält. Erfindungsgemäß umfasst ist auch ein Verfahren bei dem die Kultivierung einer erfindungsgemäßen coryneformen Bakterienzelle in einer Lösung erfolgt, die zusätzlich Komponenten enthält, ausgewählt aus der Gruppe: a) Stickstoff, bevorzugt Ammoniumchlorid, b) Phosphat, bevorzugt Kaliumphosphat, c) Biotin, und d) eine Kombination von a) - c). Besonders bevorzugt ist dieses Verfahren bei der Kultivierung einer erfindungsgemäßen coryneformen Bakterienzelle mit Bagasse, bevorzugt Rohrzucker-Bagasse, deren Hydrolysat oder daraus gewonnener Extrakt enthaltend D-Xylose, als C5-Kohlenstoffquelle.Für die Kultivierung auf Bagasse, bevorzugt hydrolysierter Bagasse, ist der Einsatz von Biotin nicht zwingend erforderlich.
In einer bevorzugten Variante des erfindungsgemäßen Verfahrens wird eine coryneforme Bakterienzelle eingesetzt, die nicht-rekombinant verändert ist. Somit ist erfindungsgemäß auch ein Verfahren umfasst, bei dem eine coryneforme Bakterienzelle eingesetzt wird, die nicht-gentechnisch verändert (non-GVO) ist.
Gegenstand der vorliegenden Erfindung ist auch die Verwendung einer erfindungsgemäßen D-Xylose-Dehydrogenase oder einer erfindungsgemäßen Nukleinsäuresequenz oder einer erfindungsgemäßen coryneformen Bakterienzelle zur Herstellung von D-Xylonat. In einer Variante der vorliegenden Erfindung erfolgt die Herstellung von D-Xylonat in-vitro mit gereinigtem Enzym.
Die Erfindung betrifft auch die Verwendung einer erfindungsgemäßen D-Xylose- Dehydrogenase oder einer erfindungsgemäßen Nukleinsäuresequenz zur Herstellung eines Wirtssystems ausgewählt aus der Gruppe enthaltend coryneforme Bakterien, bevorzugt Corynebacterium oder Brevibacterium, Hefen, bevorzugt Saccharomyces, und Pilze, bevorzugt Aspergillus. Erfindungsgemäß umfasst ist auch eine Nukleotidsequenz ausgewählt aus der Gruppe SEQ ID NO. 9 oder SEQ ID NO. 10, bevorzugt in Kombination mit einer erfindungsgemäßen Nukleinsäuresequenz, zur Herstellung coryneformer Bakterienzellen für die Herstellung von D-Xylonat. Eine bevorzugte Variante der vorliegenden Erfindung wird zur mikrobiellen Herstellung von D-Xylonat Corynebacterium glutamicum verwendet.
Die vorliegende Erfindung betrifft ferner eine Zusammensetzung enthaltend D-Xylonat herstellt mit einem gereinigten Enzym, einem Enzym kodiert durch eine Nukleinsäuresequenz, eine coryneforme Bakterienzelle oder einem Verfahren gemäß den beschriebenen Varianten der vorliegenden Erfindung. Die erfindungsgemäße Zusammensetzung kann weitere Stoffe aufweisen, die bei der Herstellung der gewünschten Produkte vorteilhaft sind. Eine Auswahl ist dem Fachmann aus dem Stand der Technik bekannt.
Gegenstand der vorliegenden Erfindung ist auch die Verwendung von D-Xylonat hergestellt mit einem gereinigten Enzym, einem Enzym kodiert durch eine Nukleinsäuresequenz, einer coryneformen Bakterienzelle oder nach einem Verfahren gemäß den beschriebenen Varian- ten der vorliegenden Erfindung sowie die Verwendung einer zuvor genannten Zusammen- setzung zur Herstellung von Pharmazeutika, Lebensmitteln, Futtermitteln, Lösungsmitteln, Färbemitteln und/oder Komponenten der Baustoff-Industrie, bevorzugt Zement oder Beton. D-Xylonat weist dabei das Potential auf, gezielt die Eigenschaften von Zement oder Beton zu verbessern. Erfindungsgemäß findet es Verwendung als Wasserverminderer, Dispergiermit- tel oder Verzögerer zur Verlängerung der Abbindezeit von Zement oder Beton oder andren Baumitteln. Tabellen und Figuren:
Tabelle 1 zeigt eine Übersicht anBakterienstämmen und Plasmiden der vorliegenden Erfin- düng. Die verschiedenen Stämme C. glutamicum ATCC13032 iolG\ C. glutamicum ATCC13032 iolG2 und C. glutamicum ATCC13032 iolG3 repräsentieren drei Integrationsstämme von C. glutamicum ATCC 13032 mit unterschiedlicher Anzahl von iolG- Kopien. Der Stamm C. glutamicum ATCC13032 /o/G1 weist eine Integration des homologen iolG- Gens im Chromosom auf, und zwar in der intergenen Region zwischen den C. cg 1121 und cg1122. iolG2 basiert auf iolG1 und enthält zusätzlich eine zweite Integration des homologen iolG- Gens in der intergenen Region zwischen cg0901 und cg0902. iolG3 basiert auf iolG2 und enthält zusätzlich eine dritte Integration des homologen iolG- Gens in der intergenen Region zwischen cg3327 und cg3328.
Tabelle 2 zeigt eine Übersicht der SEQ ID NO's der vorliegenden Erfindung
Figur 1 zeigt einen Homologievergleich der Aminosäuresequenzen (Figur 1b) und Nuklein- säuresequenzen (Figur 1a) kodierend für eine der erfindungsgemäßen D-Xylose- Dehydrogenasen(lolG) aus Corynebacterium glutamicum und der D-Xylose-Dehydrogenase (XylB) Caulobacter crescentus.
Figur 2 zeigt das Plasmid pk19 mobsacB P06 iolT1 mit dem erfindungsgemäß Nukleotidsub- stitutionen in der operativ-verknüpften regulatorischen Binderegion des myo-lnositol- Transportergens iolT 1 im Chromosom von Corynebacterium glutamicum erzeugt wurden.
Figur 3 zeigt die Position der erfindungsgemäßen Nukleotidsubstitutionen in der regulatori- schen Bindestelle des myo-lnositol-Transportergens iolT 1 im Vergleich zum Wildtyp. Relativ zum Startcodon von IolT 1 wurden an den Positionen -112 (C— >G) und -113 (A— >G) jeweils ein Nukleotid ausgetauscht. Dies entspricht den Positionen 665 und 666 in der Gesamtse- quenz des erfindungsgemäßen iolT1-Gens der Figur 3, bei dem die Nukleotide AC gegen
GG substituiert wurden. Diese Substitution befindet sich zwischen der -35 und -10 box des iolT1-Gens. Figur 4 zeigt das Plasmid pk19 mobsacB P0i3 iolC mit dem erfindungsgemäß Nukleotidsubsti- tutionen in der operativ-verknüpften regulatorischen Binderegion des Carbohydratkinasegens iolC (des iolC-Clusters enthaltend iolG) im Chromosom von Corynebacterium glutamicum erzeugt wurden.
Figur 5 zeigt die Position der erfindungsgemäßen Nukleotidsubstitutionen in der regulatori- schen Bindestelle des iolC-Gens im Vergleich zum Wildtyp. Diese regulatorische Region (vor iolC) stellt die erfindungsgemäß operativ-verknüpfte regulatorische Region der Nukleinsäu- resequenz kodierend für die erfindungsgemäße D-Xylose-Dehydrogenase dar, da das iolG- Gen in einem Cluster, dem sogenannten iolC-Cluster des myo-lnsitol-Katabolismus, organi- siert ist. Relativ zum Startcodon von IolC wurden an den Positionen -59 (C—G) und -60 (A -+G) jeweils ein Nukleotid ausgetauscht. Dies entspricht den Positionen 383 und 384 in der Gesamtsequenz des erfindungsgemäßen iolC-Gens der Figur 5, bei dem die Nukleotide AC gegen GG substituiert wurden. Diese Substitution befindet sich zwischen der -10-box und der Transkriptions-Start-Stelle (TSS) des iolC-Gens.
Figur 6 zeigt das Plasmid pk19 mobsacB P05-09 iolC mit dem erfindungsgemäß Nukleotidsub- stitutionen in der operativ-verknüpften regulatorischen Binderegion des Carbohydratkinase- gens iolC (des iolC-Clusters enthaltend iolG) im Chromosom von Corynebacterium glutami- cum erzeugt wurden.
Figur 7 zeigt die Position der erfindungsgemäßen Nukleotidsubstitutionen in der regulatori- schen Bindestelle des iolC-Gens im Vergleich zum Wildtyp. Diese regulatorische Region (vor iolC) stellt die erfindungsgemäß operativ-verknüpfte regulatorische Region der Nukleinsäu- resequenz kodierend für die erfindungsgemäße D-Xylose-Dehydrogenase dar, da das iolG- Gen in einem Cluster, dem sogenannten iolC-Cluster des myo-lnsitol-Katabolismus, organi- siert ist. Relativ zum Startcodon von IolC wurden an den Positionen -240 (A->G), -239 (C- >G), -174 (A->G) und -173 (C->G) jeweils ein Nukleotid ausgetauscht. Dies entspricht den Positionen 143, 144, 211und 212 in der Gesamtsequenz des erfindungsgemäßen iolC-Gens der Figur 7, bei dem die jeweils die Nukleotide AC gegen GG substituiert wurden. Diese
Substitution befindet sich 5'-upstream der -10-box und der Transkriptions-Start-Stelle (TSS) des iolC-Gens. TI
Figur 8 zeigt Plasmid pk19mo/)sacß_ D iolG mit dem die Nukleinsäuresequenz iolG kodierend für die erfindungsgemäße D-Xylose-Dehydrogenase im Chromosom von Corynebacterium glutamicum deletiert wurde.
Figur 9 zeigt Plasmid pk19 mobsacB ncr cons Ptuf /o/Gmit demdie Nukleinsäuresequenz iolG kodierend für die erfindungsgemäße D-Xylose-Dehydrogenase im Chromosom von Coryne- bacterium glutamicum unter Kontrolle des konstitutiven Tuf-Promotor in die intergene Region zwischen cg1121 und cg1122 integriert wurde.
Figur 10 zeigt Plasmid pk19mobsacB CgLP4 PTuf/o/Gmit dem die Nukleinsäuresequenz iolG kodierend für die erfindungsgemäße D-Xylose-Dehydrogenase im Chromosom von Coryne- bacterium glutamicum unter Kontrolle des konstitutiven Tuf-Promotor in die intergene Region zwischen cg0901 und cg0902 integriert wurde.
Figur 11 zeigt Plasmid pk19mobsacB CgLP12 PTuf iolG mit dem die Nukleinsäuresequenz iolG kodierend für die erfindungsgemäße D-Xylose-Dehydrogenase im Chromosom von Co- rynebacterium glutamicum unter Kontrolle des konstitutiven Tuf-Promotor in die intergene Region zwischen cg3227 und cg3228 integriert wurde.
Figur 12 zeigt Plasmid pEKEx3 /o/Gmit die Nukleinsäuresequenz iolG kodierend für die er- findungsgemäße D-Xylose-Dehydrogenase in Corynebacterium glutamicum verstärkt expri- miert wurde.
Figur 13 zeigt Plasmid pET28b /'o/Gmit demdie Nukleinsäuresequenz iolG kodierend für die erfindungsgemäße D-Xylose-Dehydrogenase in Escherichia coli BL21 verstärkt exprimiert wurde.
Figuren 14 und 15 zeigen Wachstum, D-Xylose Aufnahme bzw. Akkumulation und die D- Xylonat-Bildung unterschiedlicher Varianten coryneformer Bakterienstämme.
Figur 16 zeigt die D-Xylonat-Bildung unterschiedlicher Varianten coryneformer Bakterienstämme.
Figur 17 zeigt die Kalibration des Absorptionssignals bei 340 nm im kinetischen Assay zu NADH-Konzentration in mM (Blaue Punkte). Die gültige Kalibration wurde auf den Bereich 0 bis 1 mM NADH festgelegt und die entsprechende Regressionsgerade (gestrichelte rote Linie) mit zugehörigen Parametern, deren Werten und Fehler sind eingezeichnet.
Figur 18 zeigt Umsatzkurven für die erfindungsgemäße D-Xylose-Dehydrogenase lolG mit D-Xylose als Substrat, für verschiedene, eingesetzte D-Xylose-Konzentrationen (25 mM oben links bis 1 mM unten rechts). Dargestellt sind die aufgezeichneten Absorptionsmessungen für eine Dauer von 20 Minuten.
Figur 19 zeigt Umsatzkurven für lolG mit myo-lnositol als Substrat, Darstellung analog zu Figur 18.
Figur 20 zeigt die Berechnung der Anfangsreaktionsraten zum D-Xyloseumsatz mit lolG. Gezeigt sind die Bildungen von NADH in mM nach Kalibration des Absoprtionssignals nach ca. 2.5 Minuten für 10 aufeinander folgende Messungen (blaue Punkte, ca. 2 Minuten Dauer), jeweils für verschiedene eingesetzte D-Xylosekonzentrationen von 25 mM (oben links) bis 1 mM (unten rechts). Die jeweiligen Anfangsreaktionsraten (rote Linien) ergeben sich aus der Steigung der Regressionsgerade in mM/min, die jeweiligen Parameter der Kalibrationsgerade mit Werten und Fehlern sind in den einzelnen Legenden gezeigt.
Figur 21 zeigt die Parameterschätzung der Michaelis-Menten Enzymkinetik aus Anfangsreaktionsraten bei der Umsetzung von D-Xylose durch die erfindungsgemäße D- Xylonat-Dehydrogenase lolG (schwarze Punkte). Die Parameter wurde mittels gewichteter nicht-linearer Regression bestimmt unter der Annahme normal verteilter Messfehler und entsprechen somit dem Maximum-Likelihood-Schätzer der Parameter der Michael-Menten Kinetik. Die resultierende Kinetik ist als schwarze gestrichelte Linie gezeigt, als schattierte Flächen eingezeichnet sind zusätzlich Kinetiken basierend auf Zufallswerten, entsprechend der 2-dimensionalen Normalverteilung mit Kovarianzmatrix des Maximum-Likelihood- Schätzers.
Die vorliegende Erfindung wird durch die folgenden Beispiele näher erläutert, die jedoch nicht limitierend sind:
Veränderung der reaulatorischen Bindestelle im Promotorbereich des MvO-lnositol-
Transporters lolT1 durch Nukleotidsubstitutionen in C. glutamicum
C. glutamicum ATCC13032 P06iolT1 wurden nach Niebisch und Bott (2001) (https://doi.org/10.1007/s002030100262) mit dem Vektor pK19mobsacB über doppelt homo- loge Rekombination(Schäfer et a/., 1994) (https://doi.org/10.1016/0378-1119(94)90324-7) konstruiert. Dazu wurden in einem ersten Schritt zwei PCR-Produkte generiert, die die 5’- Region vor dem iolT1- Gens (Primer: PromiolT1_fw_fw / PromiolT1fw_rev) mit den zwei aus- zutauschenden Nucleotiden bzw. die 3’-Region des Gens (Primer: Piolt1_rev_fw / Pi- olt1_rev_rev) enthielten. Für die spätere homologe Rekombination wurden jeweils 500 Ba- senpaare der flankierenden Regionen amplifiziert. Im zweiten Schritt wurden die DNA- Fragmente zusammen mit dem bereits über die Restriktionsendonucleasen xBal und EcoRI geschnittenen pk19mobsacß-Vektor mittels Gibson Assembly fusioniert (Gibson et al., 2009) (https://doi.org/10.1038/NMETH.1318). Dieses so erhaltene Plasmid pK19/77obsacß_P06/'o/T/wurde mittels Hitzeschock in E. coli DH5a transformiert. Durch das auf dem Plasmid vorliegenden Kanamycinresistenzgen, konnten nur solche Klone wachsen, die das Plasmid aufgenommen hatten. Diese wurden mittels Kolonie-PCR und anschließen- der Gelelektrophorese auf Vorhandensein des klonierten Inserts überprüft, und dessen DNA- Sequenz bestimmt. Nach Isolierung des Plasmids wurde ein 150 pl_ Aliquot elektrokompe- tenter C. glutamicum Zellen auf Eis aufgetaut, dieses mit 1-4,5 pg des Plasmids vermischt und in eine auf Eis vorgekühlte 0,2 cm Elektroporationsküvette überführt. Die Mixtur wurde mit 800 pl_, 4 °C kaltem, 10 %igem Glycerin (v/v) überschichtet und im Elektroporator (2500 V, 25 pF, 200 W, 2 mm elektroporiert. Nach der Elektroporation wurde die Mixtur in 4 mL, auf 46 °C vorgewärmtem, BHIS Medium überführt und für 6 min bei 46 °C inkubiert. Anschließend wurden die Zellen für zwei Stunden bei 30 °C mit 170 Upm inkubiert und die Suspension auf BHIS-Kan15-Agar ausplattiert. Anschließend wurde die Funktion des sacB- Gens getestet, indem die Klone auf BHI-Kan25-Agar und auf BHI-Kan25-Agar mit 10%- Saccharose übertragen wurden. Zur Selektion auf erfolgreiche Exzision bei einem zweiten Rekombinationsereignis, wurden die auf BHI-Kan25 kultivierten Zellen für ca. 5 h in 5 ml BHI- Medium kultiviert und 100 pl der Kultur und einer 1 :10-Verdünnung auf BHI-Agar mit 10 % Saccharose ausplattiert. Die Klone wurden auf BHI-Kan25-Agar und BHI-Agar mit 10 % Sac- charose übertragen. Von den Saccharoseresistenten und Kanamycin-sensitiven Klonen wur- de eine Kolonie-PCR (Primer: checkPromiolTlfw / checkPromiolTI rev) mit anschließender DNA-Sequenzierung durchgeführt, um die erfolgreiche Nukelotidsubstitutionen zu bestäti- gen.
Primer:
PromiolT1_fw_fw : TGCATGCCT GCAGGTCGACT G AAAAATT GAT CAGCAAACACC
PromiolTI fw_rev: GGCAGACACGATATCCCCCGTCAATCGTACATAGGGAA
Pioltl _rev_fw: CGGGGGATATCGTGTCTGCCACGATTAAAG
pioltl _rev_rev: TT GT AAAACGACGGCCAGTGGAGT CCAAGAAGCACACG
checkPromiolTlfw: T ACG AATGCCCACTTCGCACCCTT
checkPromiolTI rev: CAACTCATTACGGCCAGCCAGTGAGC
Veränderung der requlatorischen Bindestelle im Promotorbereich der Carbohvdratkinase IolC durch Nukleotidsubstitutionen in C. alutamicum
C. glutamicum ATCC13032 P06iolT1P0:ziolC wurden nach Niebisch und Bott (2001 ) (https://doi.org/10.1007/s002030100262) mit dem Vektor pK19 mobsacB über doppelt homo- loge Rekombination(Schäfer et al., 1994) (https://doi.orq/10.1016/0378-1 119(94)90324-7) konstruiert. Dazu wurden in einem ersten Schritt zwei PCR-Produkte generiert, die die 5’- Region vor dem iolC- Gens (Primer: P013 iolC fw / P013 iolC rev) mit den zwei auszutau- schenden Nucleotiden bzw. die 3’-Region des Gens (Primer: P013 iolC rev_fw / P013 iolC rev_rev) enthielten. Für die spätere homologe Rekombination wurden jeweils 500 Basenpaa- re der flankierenden Regionen amplifiziert. Im zweiten Schritt wurden die DNA-Fragmente zusammen mit dem bereits über die Restriktionsendonucleasen xBal und EcoRI geschnitte- nen pk19mobsacß-Vektor mittels Gibson Assembly fusioniert (Gibson et al., 2009) (https://doi.org/10.1038/NMETH.1318). Dieses so erhaltene Plasmid pK19mobsacß_P013/o/C wurde mittels Hitzeschock in E. coli DH5a transformiert. Durch das auf dem Plasmid vorliegenden Kanamycinresistenzgen, konnten nur solche Klone wachsen, die das Plasmid aufgenommen hatten. Diese wurden mittels Kolonie-PCR und anschließen- der Gelelektrophorese auf Vorhandensein des klonierten Inserts überprüft, und dessen DNA- Sequenz bestimmt. Nach Isolierung des Plasmids wurde ein 150 pL Aliquot elektrokompe- tenter C. glutamicum ATCC13032 P 06iolT1 -Zellen auf Eis aufgetaut, dieses mit 1-4,5 pg des Plasmids vermischt und in eine auf Eis vorgekühlte 0,2 cm Elektroporationsküvette überführt. Die Mixtur wurde mit 800 pL, 4 °C kaltem, 10 %igem Glycerin (v/v) überschichtet und im Elektroporator (2500 V, 25 pF, 200 W, 2 mm elektroporiert. Nach der Elektroporation wurde die Mixtur in 4 mL, auf 46 °C vorgewärmtem, BHIS Medium überführt und für 6 min bei 46 °C inkubiert. Anschließend wurden die Zellen für zwei Stunden bei 30 °C mit 170 Upm inkubiert und die Suspension auf BHIS-Kan15-Agar ausplattiert. Anschließend wurde die Funktion des sacB-Ge ns getestet, indem die Klone auf BHI-Kan25-Agar und auf BHI-Kan25-Agar mit 10%- Saccharose übertragen wurden. Zur Selektion auf erfolgreiche Exzision bei einem zweiten Rekombinationsereignis, wurden die auf BHI-Kan25 kultivierten Zellen für ca. 5 h in 5 ml BHI-Medium kultiviert und 100 pl der Kultur und einer 1 :10-Verdünnung auf BHI-Agar mit 10 % Saccharose ausplattiert. Die Klone wurden auf BHI-Kan25-Agar und BHI-Agar mit 10 % Saccharose übertragen. Von den Saccharoseresistenten und Kanamycin-sensitiven Klonen wurde eine Kolonie-PCR (Primer: Check Prom iolC fw / Check Prom iolC_rev) mit anschließender DNA-Sequenzierung durchgeführt, um die erfolgreiche Nukelotidsubstitutio- nen zu bestätigen.
Primer:
P013 iolC fw: T GCAT GCCT GCAGGT CG ACT GGAT GCCGT CTT CGAGGC
P013 iolC rev: GACCCT CACGATCGCATCCCAT GACAAT AACAC
P013 iolC rev_fw: GGGAT GCG AT CGT GAGGGT CGCCACATT C
P013 iolC rev_rev: TT GT AAAACGACGGCCAGTGCTTGGCT CTT CACT GAAACCAG
Check Prom iolC fw: TCTCGTTTTCTAGGCGTGCTCCGGG
Check Prom iolC rev: CG ACGGTT CGCACGAGT AGT CA
Veränderung der requlatorischen Bindestelle im Promotorbereich der Carbohvdratkinase lo/C durch Nukleotidsubstitutionen in C. alutamicum
C. glutamicum ATCC 13032 Rob iolT1 Pos-o 9/0/C wurde nach Niebisch und Bott (2001 ) (DOI 10.1007/s002030100262) mit dem Vektor pK19 mobsacB über doppelt homologe Rekombination (Schäferei a/., 1994) (https://doi.Org/10.1016/0378-
1 1 19(94)90324-7) konstruiert. Dazu wurden in einem ersten Schritt zwei PCR- Produkte generiert, die die 5’- Region vor dem kodierenden Bereich des iolC- Gens (Primer: P05-P09 iolC_fw_fw / P05-P09 iolC_fw_rev) mit den vier auszutauschen- den Nucleotiden bzw. die 3’-Ende von iolC (Primer: P05-P09iolC_rev_fw/ P05- P09iolC_rev_rev) enthielten. Für die spätere homologe Rekombination wurden je- weils 500 Basenpaare der flankierenden Regionen amplifiziert. Im zweiten Schritt wurden die DNA-Fragmente zusammen mit dem bereits über die Restriktionsen- donucleasen Xbal und EcoRI geschnittenen pk19mojbsacß-Vektor mittels Gibson Assembly fusioniert (Gibson et ai, 2009)(DOI:10.1038/NMETH.1318). Dieses so er- haltene Plasmid wurde mittels Hitzeschock in E. coli DH5a transformiert. Durch das auf dem Plasmid vorliegenden Kanamycinresistenzgen konnten nur solche Klone wachsen, die das Plasmid aufgenommen hatten. Diese wurden mittels Kolonie-PCR und anschließender Gelelektrophorese auf Vorhandensein des Monierten Inserts überprüft, und dessen DNA-Sequenz bestimmt. Nach Isolierung des Plasmids wurde ein 150 pl_ Aliquot elektrokompetenter C. glutamicum ATCC13032 ROQ iolT1 -Zellen auf Eis aufgetaut, dieses mit 1-4,5 pg des Plasmids vermischt und in eine auf Eis vorgekühlte 0,2 cm Elektroporationsküvette überführt. Die Mixtur wurde mit 800 pL, 4 °C kaltem, 10 %igem Glycerin (v/v) überschichtet und im Elektroporator (2500 V, 25 pF, 200 W, 2 mm elektroporiert. Nach der Elektroporation wurde die Mixtur in 4 mL, auf 46 °C vorgewärmtem, BHIS Medium überführt und für 6 min bei 46 °C in- kubiert. Anschließend wurden die Zellen für zwei Stunden bei 30 °C mit 170 Upm inkubiert und die Suspension auf BHIS-Kan15-Agar ausplattiert. Anschließend wurde die Funktion des sacB- Gens getestet, indem die Klone auf BHI-Kan25-Agar und auf BHI-Kan25-Agar mit 10%- Saccharoseübertragen wurden. Zur Selektion auf erfolg- reiche Exzision bei einem zweiten Rekombinationsereignis, wurden die auf BHI- Kan25 kultivierten Zellen für ca. 5 h in 5 ml BHI-Medium kultiviert und 100 pl der Kul tur und einer 1 :10-Verdünnung auf BHI-Agar mit 10% Saccharose ausplattiert. Die Klone wurden auf BHI-Kan25-Agar und BHI-Agar mit 10% Saccharose übertragen. Von den Saccharose-resistenten und Kanamycin-sensitiven Klonen wurde eine Ko- lonie-PCR (Primer: P05-P09iolC_check_fw / P05-P09iolC_check_rev)mit anschlie- ßender DNA-Sequenzierung durchgeführt, um die erfolgreiche Nukelotidsubstitutio- nen zu bestätigen.
Primer:
P05-P09 iolC_fw_fw:TGCATGCCTGCAGGTCGACTGGTTGGCGTTTTTGAGGTC
P05-P09 iolC_fw_rev: TAAGTTT CGCT ACT CATT CCCT AAT GCAAGT GAT AATCCC AG AT C AAT AAA
P05-
P09iolC_rev_fw:GGAATGAGTAGCGAAACTTAGTGAAAAGGGCAGAGTTTGCAGGTCATAGGGTG
CAA
P05-P09iolC_rev_rev: TT GT AAAACG ACGGCC AGT GT CC AGCT CAGCAAGC AGG
P05-P09iolC_check_fw:GAGTTTTTCTGCGATGGCGGAACTT
P05-P09iolC check rev: GGGGT CTT AAAAGT CT GATCGGT GG Veränderung der requlatorischen Bindestelle im Promotorbereich des Mvo-Inositol- Transporters IoIT 1 durch Nukleotiddeletionen in C. alutamicum
C. glutamicum ATCC13032 DR06iolT1 wurden nach Niebisch und Bott (2001) (https://doi.org/10.1007/s002030100262) mit dem Vektor pK19 mobsacB über doppelt homologe Rekombination(Schäfer et al., 1994) (https://doi.org/10.1016/0378-1 119(94)90324-7) konstruiert. Dazu wurden in einem ersten Schritt zwei PCR-Produkte generiert, die die 5’- Region vor dem /o/7 f-Gens (Primer: DP06iolT1_Fw_fw / DP06iolT1_Fw_rev) mit den zwei deletierten Nucleotiden bzw. die 3’-Region des Gens (Primer: DP06iolT1_rev_fw / DP06iolT1_rev_rev) enthielten. Für die spätere homologe Rekombination wurden jeweils 500 Basenpaare der flankierenden Regionen amplifiziert. Im zweiten Schritt wurden die DNA-Fragmente zusammen mit dem bereits über die Restriktionsendonucleasen xBal und EcoRI geschnittenen pk19moösacß-Vektor mittels Gibson Assembly fusioniert (Gibson et al., 2009) (https://doi.org/10.1038/NMETH.1318). Dieses so erhaltene Plasmid pK19mobsacB_A P o6/o/Ti wurde mittels Hitzeschock in E. coli DH5a transformiert. Durch das auf dem Plasmid vorliegenden Kanamycinresistenzgen, konnten nur solche Klone wachsen, die das Plasmid aufgenommen hatten. Diese wurden mittels Kolonie-PCR und anschließender Gelelektrophorese auf Vorhandensein des klonierten Inserts überprüft, und dessen DNA-Sequenz be stimmt. Nach Isolierung des Plasmids wurde ein 150 pl_ Aliquot elektrokompetenter C. glu tamicum Zellen auf Eis aufgetaut, dieses mit 1-4,5 pg des Plasmids vermischt und in eine auf Eis vorgekühlte 0,2 cm Elektroporationsküvette überführt. Die Mixtur wurde mit 800 pl_, 4 °C kaltem, 10 %igem Glycerin (v/v) überschichtet und im Elektroporator (2500 V, 25 pF, 200 W, 2 mm elektroporiert. Nach der Elektroporation wurde die Mixtur in 4 ml_, auf 46 °C vorge wärmtem, BHIS Medium überführt und für 6 min bei 46 °C inkubiert. Anschließend wurden die Zellen für zwei Stunden bei 30 °C mit 170 Upm inkubiert und die Suspension auf BHIS- Kan15-Agar ausplattiert. Anschließend wurde die Funktion des sacB- Gens getestet, indem die Klone auf BHI-Kan25-Agar und auf BHI-Kan25-Agar mit 10%- Saccharose übertragen wurden. Zur Selektion auf erfolgreiche Exzision bei einem zweiten Rekombinationsereignis, wurden die auf BHI-Kan25 kultivierten Zellen für ca. 5 h in 5 ml BHI-Medium kultiviert und 100 mI der Kultur und einer 1 :10-Verdünnung auf BHI-Agar mit 10 % Saccharose ausplattiert. Die Klone wurden auf BHI-Kan25-Agar und BHI-Agar mit 10 % Saccharose übertragen. Von den Saccharoseresistenten und Kanamycin-sensitiven Klonen wurde eine Kolonie-PCR (Primer: checkPromiolTlfw / checkPromiolH rev) mit anschließender DNA-Sequenzierung durchgeführt, um die erfolgreiche Deletion zu bestätigen.
Primer:
DP06iolT1 _Fw_fw: TGCATGCCTGCAGGT CG ACT AATT GAT CAGCAAACACC DPO610IT 1_Fw_rev: ATCGTGGCAGACACGATATCCCGTCAATC
DP06iolT 1_rev_fw: GAT AT CGT GT CT GCCACG ATT AAAG ACATT G
DPO610IT 1_rev_rev: TTGT AAAACGACGGCCAGT GACTGCGAGT CCAAGAAGC
checkPromiolTlfw: T ACG AATGCCCACTT CGCACCCTT
checkPromiolTI rev: CAACT CATT ACGGCCAGCCAGT GAGC
Veränderung der requlatorischen Bindestelle im Promotorbereich der Carbohvdratkinase lolC durch Nukleotiddeletionenin C. alutamicum
C. glutamicum ATCC13032 P06iolT1 DR013 iolC wurden nach Niebisch und Bott (2001 ) (https://doi.org/10.1007/s002030100262) mit dem Vektor pK19 mobsacB über doppelt homo- loge Rekombination(Schäfer et a/., 1994) (https://doi.org/10.1016/0378-1 1 19(94190324-7) konstruiert. Dazu wurden in einem ersten Schritt zwei PCR-Produkte generiert, die die 5’- Region vor dem iolC- Gens (Primer: DP013iolC_fw_fw / DP013iolC_fw_rev) mit den zwei deletierten Nucleotiden bzw. die 3’-Region des Gens (Primer: DP013iolC_rev_fw / DP013iolC_rev_rev) enthielten. Für die spätere homologe Rekombination wurden jeweils 500 Basenpaare der flankierenden Regionen amplifiziert. Im zweiten Schritt wurden die DNA-Fragmente zusammen mit dem bereits über die Restriktionsendonucleasen xBal und EcoRI geschnittenen pk19/nobsacß-Vektor mittels Gibson Assembly fusioniert (Gibson et al., 2009) (https://doi.org/10.1038/NMETH.1318). Dieses so erhaltene Plasmid pK19 mobsacB_A P0i3/o/Cwurde mittels Hitzeschock in E. coli DH5a transformiert. Durch das auf dem Plasmid vorliegenden Kanamycinresistenzgen, konnten nur solche Klone wachsen, die das Plasmid aufgenommen hatten. Diese wurden mittels Kolonie-PCR und anschließender Gelelektro- phorese auf Vorhandensein des klonierten Inserts überprüft, und dessen DNA-Sequenz be- stimmt. Nach Isolierung des Plasmids wurde ein 150 mI_ Aliquot elektrokompetenter C. glutamicum ATCC 13032 P06iolT1 -Zellen auf Eis aufgetaut, dieses mit 1 -4,5 pg des Plasmids vermischt und in eine auf Eis vorgekühlte 0,2 cm Elektroporationsküvette überführt. Die Mix tur wurde mit 800 pL, 4 °C kaltem, 10 %igem Glycerin (v/v) überschichtet und im Elektropo- rator (2500 V, 25 pF, 200 W, 2 mm elektroporiert. Nach der Elektroporation wurde die Mixtur in 4 ml_, auf 46 °C vorgewärmtem, BHIS Medium überführt und für 6 min bei 46 °C inkubiert. Anschließend wurden die Zellen für zwei Stunden bei 30 °C mit 170 Upm inkubiert und die Suspension auf BHIS-Kan15-Agar ausplattiert. Anschließend wurde die Funktion des sacB- Gens getestet, indem die Klone auf BHI-Kan25-Agar und auf BHI-Kan25-Agar mit 10%- Sac- charose übertragen wurden. Zur Selektion auf erfolgreiche Exzision bei einem zweiten Re- kombinationsereignis, wurden die auf BHI-Kan25 kultivierten Zellen für ca. 5 h in 5 ml BHI- Medium kultiviert und 100 pl der Kultur und einer 1 :10-Verdünnung auf BHI-Agar mit 10 % Saccharose ausplattiert. Die Klone wurden auf BHI-Kan25-Agar und BHI-Agar mit 10 % Sac- charose übertragen. Von den Saccharoseresistenten und Kanamycin-sensitiven Klonen wur- de eine Kolonie-PCR (Primer: Check Prom iolC fw / Check Prom iolC rev) mit anschließen- der DNA-Sequenzierung durchgeführt, um die erfolgreiche Deletion zu bestätigen.
Primer:
DP013iolC_fw_fw: TGCATGCCTGCAGGTCGACTCCGTCTTCGAGGCGTTGG
DP013iolC_fw_rev: GT GGCGACCCT CACGATCGCAT CCCAT G
DP013iolC_rev_fw: GCGATCGTGAGGGTCGCCACATTCCATC
DP013iolC_rev_rev: TT GT AAAACG ACGGCCAGT GCGCGGCTTGGCT CTT CAC
Check Prom iolC fw: TCTCGTTTTCTAGGCGTGCTCCGGG
Check prom iolC_rev: CGACGGTTCGCACGAGTAGTCA
Veränderung der requlatorischen Bindestelle im Promotorbereich der Carbohvdratkinase
IolC durch Nukleotiddeletionen in C. alutamicum
C. glutamicum ATCC13032 P06iolT1 DRO5-09 iolC wurden nach Niebisch und Bott (2001) (https://doi.org/10.1007/s002030100262) mit dem Vektor pK19 mobsacB über doppelt homologe Rekombination(Schäfer et al., 1994) (https://doi.orq/10.1016/0378-1 119(94)90324-7) konstruiert. Dazu wurden in einem ersten Schritt zwei PCR-Produkte generiert, die die 5’- Region vor dem iolC- Gens (Primer: AP05-P09iolC_fw_fw / AP05-P09iolC_fw_rev) mit den zwei deletierten Nucleotiden bzw. die 3’-Region des Gens (Primer: AP05-P09iolC_rev_fw / AP05-P09iolC_rev_rev) enthielten. Für die spätere homologe Rekombination wurden je- weils 500 Basenpaare der flankierenden Regionen amplifiziert. Im zweiten Schritt wurden die DNA-Fragmente zusammen mit dem bereits über die Restriktionsendonucleasen xBal und EcoRI geschnittenen pk19mobsacß-Vektor mittels Gibson Assembly fusioniert (Gibson et al., 2009) (https://doi.org/10.1038/NMETH.1318). Dieses so erhaltene Plasmid pK19 mobsacB_A P05-09 iolC wurde mittels Hitzeschock in E. coli DH5a transformiert. Durch das auf dem Plasmid vorliegenden Kanamycinresistenzgen, konnten nur solche Klone wachsen, die das Plasmid aufgenommen hatten. Diese wurden mittels Kolonie-PCR und anschließender Gel- elektrophorese auf Vorhandensein des klonierten Inserts überprüft, und dessen DNA- Sequenz bestimmt. Nach Isolierung des Plasmids wurde ein 150 mI_ Aliquot elektrokompe- tenter C. glutamicum ATCC 13032 P06iolT1 -Zellen auf Eis aufgetaut, dieses mit 1-4,5 pg des Plasmids vermischt und in eine auf Eis vorgekühlte 0,2 cm Elektroporationsküvette überführt. Die Mixtur wurde mit 800 pl_, 4 °C kaltem, 10 %igem Glycerin (v/v) überschichtet und im Elektroporator (2500 V, 25 pF, 200 W, 2 mm elektroporiert. Nach der Elektroporation wurde die Mixtur in 4 ml_, auf 46 °C vorgewärmtem, BHIS Medium überführt und für 6 min bei 46 °C inkubiert. Anschließend wurden die Zellen für zwei Stunden bei 30 °C mit 170 Upm inkubiert und die Suspension auf BHIS-Kan15-Agar ausplattiert. Anschließend wurde die Funktion des sacB- Gens getestet, indem die Klone auf BHI-Kan25-Agar und auf BHI-Kan25-Agar mit
10%- Saccharose übertragen wurden. Zur Selektion auf erfolgreiche Exzision bei einem zweiten Rekombinationsereignis, wurden die auf BHI-Kan25 kultivierten Zellen für ca. 5 h in 5 ml BHI-Medium kultiviert und 100 pl der Kultur und einer 1:10-Verdünnung auf BHI-Agar mit 10 % Saccharose ausplattiert. Die Klone wurden auf BHI-Kan25-Agar und BHI-Agar mit 10 % Saccharose übertragen. Von den Saccharoseresistenten und Kanamycin-sensitiven Klonen wurde eine Kolonie-PCR (Primer: Check AP05-P09iolC_fw / Check DR05- P09iolC_rev) mit anschließender DNA-Sequenzierung durchgeführt, um die erfolgreiche Deletion zu bestätigen.
AP05-P09iolC_fw_fw: TGCAT GCCT GCAGGT CG ACTGGTT GGCGTTTTT GAGGT C
AP05-P09iolC_fw_rev: T AAGTTT CGCT ACT C ATT CCCT AAT G C AAGT GAT AAT C AG AT- CAATAAAAGCCCTGGAT
AP05-P09iolC_rev_fw: GGAAT GAGTAGCGAAACTT AGT GAAAAGGGCAGAGTTT - GCAGGT CAT AGTGCAACTTT GTT AACCC AP05-P09iolC_rev_rev: TTGTAAAACGACGGCCAGTGTCCAGCTCAGCAAGCAGG Check AP05-P09iolC_fw: GAGTTTTT CT GCGATGGCGG AACTT Check APQ5-P09iolC rev: GGGGTCTTAAAAGTCTGATCGGTGG
Deletion der D-Xylose-Dehvdroaenase lolG in C. glutamicum
C. glutamicum ATCC13032 AiolG wurden nach Niebisch und Bott (2001) (https://doi.org/10.1007/s002030100262) mit dem Vektor pK19 mobsacB über doppelt homo- loge Rekombination(Schäfer et al., 1994) (https://doi.orq/10.1016/0378-1119(94)90324-7) konstruiert. Dazu wurden in einem ersten Schritt zwei PCR-Produkte generiert, die die 5’- Region des iolG- Gens (Primer: iolG vorne fw / iolG vorne rev) mit den ersten drei Codons bzw. die 3’-Region (Primer: iolG hinten fw / iolG hinten rev) mit den letzten sechs Codons des iolG- Gens enthielten. Für die spätere homologe Rekombination wurden jeweils 500 Ba- senpaare der flankierenden Regionen amplifiziert. Im zweiten Schritt wurden die DNA- Fragmente zusammen mit dem bereits über die Restriktionsendonucleasen xBal und EcoRI geschnittenen pk19mobsacß-Vektor mittels Gibson Assembly fusioniert (Gibson et ai, 2009) (https://doi.org/10.1038/NMETH.1318). Dieses so erhaltene Plasmid pK19mobsacB_A\o\G wurde mittels Hitzeschock in E. coli DH5a transformiert. Durch das auf dem Plasmid vorlie- genden Kanamycinresistenzgen, konnten nur solche Klone wachsen, die das Plasmid auf- genommen hatten. Diese wurden mittels Kolonie-PCR und anschließender Gelelektrophorese auf Vorhandensein des klonierten Inserts überprüft, und dessen DNA-Sequenz bestimmt. Nach Isolierung des Plasmids wurde ein 150 pL Aliquot elektrokompetenter C. glutamicum Zellen auf Eis aufgetaut, dieses mit 1-4,5 pg des Plasmids vermischt und in eine auf Eis vorgekühlte 0,2 cm Elektroporationsküvette überführt. Die Mixtur wurde mit 800 pL, 4 °C kaltem, 10 %igem Glycerin (v/v) überschichtet und im Elektroporator (2500 V, 25 pF, 200 W, 2 mm elektroporiert. Nach der Elektroporation wurde die Mixtur in 4 mL, auf 46 °C vorgewärmtem, BHIS Medium überführt und für 6 min bei 46 °C inkubiert. Anschließend wurden die Zellen für zwei Stunden bei 30 °C mit 170 Upm inkubiert und die Suspension auf BHIS-Kan15-Agar ausplattiert. Anschließend wurde die Funktion des sacB- Gens getestet, indem die Klone auf BHI-Kan25-Agar und auf BHI-Kan25-Agar mit 10%- Saccharose übertragen wurden. Zur Selektion auf erfolgreiche Exzision bei einem zweiten Rekombinationsereignis, wurden die auf BHI-Kan25 kultivierten Zellen für ca. 5 h in 5 ml BHI-Medium kultiviert und 100 pl der Kultur und einer 1 :10-Verdünnung auf BHI-Agar mit 10 % Saccharose ausplattiert. Die Klone wurden auf BHI-Kan25-Agar und BHI-Agar mit 10 % Saccharose übertragen. Von den Sac charoseresistenten und Kanamycin-sensitiven Klonen wurde eine Kolonie-PCR (Primer: check iolG fw / check iolG rev) mit anschließender Gelelektrophorese durchgeführt, um die erfolgreiche Deletion zu bestätigen.
Primer:
iolG vorne fw: TGCATGCCTGCAGGTCGACTGAAGAGTTCGGCATGAAGC
iolG vorne rev: TACTCCCGGGCATATGGCGAAGGCTCTTGCTCAT
iolG hinten fw: GAGCCTT CGCCAT AT GCCCGGGAGT ACT GGAT CCGTT GAT GCGGCAC-
CTCGC
iolG hinten rev: TT GTAAAACG ACGGCCAGT GAT GACT CGCCATGCTT CAATACC check iolG fw: CGACGTTGCT GGT CTT GCTT CCAAG
check iolG rev: GGTT AGT GAT GT AGCGCAGGCCGTG
Chromosomale Integration der D-Xylose-Dehvdroaenase IolG in C. glutamicum
Die verschiedenen C. glutamicum Integrationsmutanten C. glutamicum ATCC13032 iolG C. glutamicum ATCC 13032 iolG2 , C. glutamicum ATCC 13032 /'o/G3 wurden nach Niebisch und Bott (2001) (https://doi.org/10.1007/s002030100262) jeweils mit Vektoren auf Basis von pK19 mobsacB über doppelt homologe Rekombination(Schäfer et al., 1994) (https://doi.ora/10.1016/0378-1 119(94)90324-7) konstruiert. Dazu wurden in einem ersten Schritt PCR-Produkte generiert, die die flankierenden Regionen der verschiedenen Integrati- onsloci, den konstitutionellen Promotor Tuf und das Gen iolG enthielten (Primer: NCS_PT uf_fw / NCS_PTuf_rev / NCS_Ptuf_iolG_fw / NCS_Ptuf_iolG_rev / CgLP4_fw_fw / CgLP4_fw_rev / CgLP4_PTuf_fw / CgLP4_PTuf_rev / CgLP4_iolG_fw / CgLP4_iolG_rev / CgLP4_rev_fw / CgLP4_rev_rev / CgLP12_fw_fw / CgLP12_fw_rev / CgLP12_PTuf_fw / CgLP12_PTuf_rev / CgLP12_iolG_fw / CgLP12_iolG_rev / CgLP12_rev_fw / CgLP12_rev_rev). Im zweiten Schritt wurden die DNA-Fragmente zusammen mit dem be- reits über die Restriktionsendonucleasen xBal und EcoRI geschnittenen pk19mo0sacß- Vektoren jeweils mittels Gibson Assembly fusioniert (Gibson et al., 2009) (https://doi.org/10.1038/NMETH.1318). Die so erhaltenen Plasmide pk19/7700sacß ncr cons PTuf/o/G , pk19 mobsacB CgLP4 PTuf iolG und pk19 mobsacB CgLP12 PTuf/ 'o/G wurden mittels Hitzeschock in E. coli DH5a transformiert. Durch das jeweils auf denkonstruierten Plasmiden vorliegenden Kanamycinresistenzgen, konnten nur solche Klone wachsen, die jeweils das Plasmid aufgenommen hatten. Diese wurden mittels Kolonie-PCR und anschließender Gel- elektrophorese auf Vorhandensein des klonierten Inserts überprüft, und dessen DNA- Sequenz bestimmt. Nach Isolierung des Plasmids wurde ein 150 pL Aliquot elektrokompe- tenter C. glutamicum Zellen auf Eis aufgetaut, dieses mit 1-4,5 pg des jeweils zu transformie- renden Plasmids vermischt und in eine auf Eis vorgekühlte 0,2 cm Elektroporationsküvette überführt. Die Mixtur wurde mit 800 pL, 4 °C kaltem, 10 %igem Glycerin (v/v) überschichtet und im Elektroporator (2500 V, 25 pF, 200 W, 2 mm elektroporiert. Nach der Elektroporation wurde die Mixtur in 4 ml_, auf 46 °C vorgewärmtem, BHIS Medium überführt und für 6 min bei 46 °C inkubiert. Anschließend wurden die Zellen für zwei Stunden bei 30 °C mit 170 Upm inkubiert und die Suspension auf BHIS-Kan15-Agar ausplattiert. Anschließend wurde jeweils die Funktion des sacB- Gens getestet, indem die Klone auf BHI-Kan25-Agar und auf BHI- Kan25-Agar mit 10%- Saccharose übertragen wurden. Zur Selektion auf erfolgreiche Exzisi- on bei einem zweiten Rekombinationsereignis, wurden die auf BHI-Kan25 kultivierten Zellen für ca. 5 h in 5 ml BHI-Medium kultiviert und 100 pl der Kultur und einer 1 :10-Verdünnung auf BHI-Agar mit 10 % Saccharose ausplattiert. Die Klone wurden auf BHI-Kan25-Agar und BHI- Agar mit 10 % Saccharose übertragen. Von den Saccharoseresistenten und Kanamycin- sensitiven Klonen wurde eine Kolonie-PCR (Primer: NCS check fw / NCS check rev / CgLP4_Check_fw / CgLP4_Check_rev / CgLP12_Check_fw / CgLP12_Check_rev) mit an- schließender DNA-Sequenzierung durchgeführt, um jeweils die erfolgreiche Integration zu bestätigen. Primer:
NCS_PT uf_fw: TTT AAATT GT GT CCAT GAGGCACAGGGT AGCTGGT AGTTT G
NCS_PTuf_rev: T CTTGCT CAT ACGCGTT CCT CCT GGACTT C
NCS_Ptuf_iolG_fw: AGGAACGCGTATGAGCAAGAGCCTTCGC
NCS_Ptuf_iolG_rev: CGAAGCAT ATGCCCGGGAGTTT AAGCGT AG AAAT CT GGGC
NCS check fw: CGG AAT GAT CTT GACCCTT GTTGGT G
NCS check rev: AT CAAGCAG AT CT CT GAGCTGCT GGC
CgLP4_fw_fw: TGCAT GCCT GCAGGT CG ACT CTT CT GGGTCGGCGATAC
CgLP4_fw_rev: CTACCCTGTGCATCAAAAAATCCGCCGTTC
CgLP4_PTuf_fw: TTTTTT GAT GCACAGGGT AGCT GGT AGTTT G
CgLP4_PTuf_rev: T CTT GCT CAT ACGCGTT CCTCCT GGACTT C
CgLP4_iolG_fw: AGGAACGCGTATGAGCAAGAGCCTTCGC
CgLP4_iolG_rev: CT CACTT AGTTT AAGCGT AGAAAT CTGGGC
CgLP4_rev_fw: CT ACGCTT AAACT AAGT G AGTTTGG AT G
CgLP4_rev_rev: TT GT AAAACGACGGCCAGT GT AGT ACGCGGAT AAAT GAT C
CgLP4_Check_fw: TGCAGGTCACTGTGGAAAATCG
CgLP4_Check_rev: AATCAGCATCACCCATCCCTTCAC
CgLP12_fw_fw: T GCATGCCTGCAGGT CGACTCGTT GAAGACT CCGT CAAAC
CgLP12_fw_rev: CT ACCCT GT GAT AT GCCGATT GCAAGAAAC
CgLP12_PT uf_fw: AT CGGCAT AT CACAGGGT AGCTGGT AGTTT G
CgLP12_PT uf_rev: T CTT GCT CAT ACGCGTTCCT CCT GGACTT C
CgLP12 _iolG_fw: AGGAACGCGTATGAGCAAGAGCCTTCGC
CgLP12 _iolG_rev: ATTTTTT G ACT GATT AAG CGT AGAAAT CTGGGC
CgLP12_rev_fw: CT ACGCTT AAT CAGT CAAAAAAT GTT G AAAT CAG
CgLP12_rev_rev: TT GT AAAACGACGGCCAGT GTT GGCGCTT CTTT GAAG AG
CgLP12_Check_Fw: CT CAAGGT CAT CCGT G AAAT GT GGC
CgLP12_Check_Rev: TTGGCTTTCCATGCTTTGAGGACT
Plasmid-basierte Expression der D-Xylose-Dehvdroaenase lolG in C. glutamicum
Im ersten Schritt zur Isolation genomischer DNA wurden C. glutamicum- Zellen durch Sus- pension in 50 pL 2 %-igem DMSO und anschließender Inkubation für 5 Minuten bei 95 °C aufgebrochen. Die Zelltrümmer wurden für 1 min bei 1 1.000 Upm abzentrifugiert und 3 mI_ des Überstandes als Template zur Amplifikation von iolG verwendet (Primer: p3_iolG_fw / p3_iolG_rev). Dieses Amplifikat wurde zusammen mit dem bereits über die Restriktionsen- donucleasen pstl und EcoRI geschnittenen pEKEx3 Vektor im Gibson Assembly fusioniert (Gibson et al., 2009) (https://doi.org/10.1038/NMETH.1318). Dieses so erhaltene Plasmid pEKEx3 /o/Gwurde mittels Hitzeschock in E. coli DH5a transformiert. Durch die vom Plasmid vermittelte Spectinomycinresistenz, konnten nur solche Klone wachsen, die das Plasmid aufgenommen hatten. Diese wurden mittels Kolonie-PCR und anschließender Gelelektro- phorese auf Vorhandensein des klonierten Inserts überprüft, und dessen DNA-Sequenz be- stimmt. Nach Isolierung des Plasmids wurde ein 150 pl_ Aliquot elektrokompetenter C. glu- tamicum Zellen auf Eis aufgetaut, dieses mit 1-4,5 mg des Plasmids vermischt und in eine auf Eis vorgekühlte 0,2 cm Elektroporationsküvetten überführt. Die Mixtur wurde mit 800 mI_, 4 °C kaltem, 10 %igem Glycerin (v/v) überschichtet und im Elektroporator (2500 V, 25 mR, 200 W, 2 mm elektroporiert. Nach der Elektroporation wurde die Mixtur in 4 ml_, auf 46 °C vorge wärmtem, BHIS Medium überführt und für 6 min bei 46 °C inkubiert. Anschließend wurden die Zellen für zwei Stunden bei 30 °C mit 170 Upm inkubiert. Die Suspension wurde anschließend auf BHI-Spc100-Agar ausplattiert.
Primer:
p3_iolG_fw: GCCAAGCTTGCATGCCTGCAGCT AGT AT AAGGAG AT AT AGAT AT -
GAGCAAGAGCCTTCGC
p3_iolG_rev: CT GTAAAACGACGGCCAGT GTTAAGCGT AGAAAT CT GGGC Medium und Kultivierunqsbedinqunqen
Zur Kultivierung von C. glutamicum- Stämmen wurde komplexes Brain Heart Infusion- Medium (BHI, Difco Laboratories, Detroit, USA) und definiertes CGXII-Medium verwendet. Das CGXII-Medium enthielt pro Liter entionisiertem Wasser folgende Zusammensetzung: 1 g K2HP04, 1 g KH2P04, 5 g Harnstoff, 13.25 mg CaCI2 · 2 H20, 0.25 g MgS04 7 H20, 10 mg FeS04 7 H20, 10 mg MnS04 · H20, 0.02 mg NiCI2 · 6 H20,
0.313 mg CuS04 · 5 H20, 1 mg ZnS04 7 H20, 0.2 mg Biotin, 3,4-Dihydroxybenzoat, 0.02 % (v v 1) Antischaum AF204. Für die Kultivierung von Stämmen mit dem Expressionsvektor pEKEx3 wurde Spectinomycin und isopropyl ß-D-thiogalactoside (IPTG) zu finalen Konzent rationen von 100 pg mL 1 bzw. 1 mmol L 1 zugegeben. Alle Chemikalien wurden von Sigma- Aldrich (Steinheim, Deutschland) erworben. Zunächst wurden Vorkulturen auf BHI-Medium in Reagenzgläsern aus Einzelkolonien beimpft und für 8 h bei 30 °C auf einem Rotationsschüttler bei 170 U min 1 inkubiert. Aus dieser Kultur wurde dann eine zweite Vorkultur in 500 mL Schüttelkolben mit 50 mL definiertem CGXII Medium sowie 10 g L 1 D-Glucose und 30 g L 1 D-Xylose als Kohlenstoff- und Energiequelle beimpft und für 15 h bei 30 °C auf einem Rota- tionsschüttler bei 130 U min 1 inkubiert. Anschließend wurde die Hauptkultur auf eine OD60o von 1 in 50 mL definiertem CGXII-Medium mit 10 g L 1 D-Glucose und 30 g L 1 D-Xylose als Kohlenstoff- und Energiequellen beimpft und für 56 h bei 30 °C auf einem Rotationsschüttler bei 130 U min 1 inkubiert. Aus der Hauptkultur wurden Proben zur Messung der Konzentrati- onen von Biomasse, D-Xylose und D-Xylonat entnommen.
Herstellung von Baqasse-Hvdrolvsat
Zur D-Xylonat-Produktion mittels Batch und Fed-Batch-Verfahren wurde definiertes CGXII- Medium und vorbehandeltes Bagasse-Hydrolysat verwendet. Die Vorbehandlung gemahle- ner Bagasse (0.25 - 1 cm) erfolgte durch Inkubation in 0.1 mol L 1 H2S04 bei 121 °C. Die anschließende Hydrolyse erfolgte in einem parallelen Bioreaktorsystem (Eppendorf/DASGIP, Jülich, Deutschland) mit einem Arbeitsvolumen von 600 ml_ und einer Lösung bestehend aus 180 g vorbehandelter Bagasse, 50 mM C2H3Na02 und 10.4 mL Enzymmix Cellic CTec2 (No- vomzymes, Bagsvserd, Dänemark). Der pH wurde auf pH 5 mittels KOH gestellt und die Hyd- rolyse erfolgte bei 50 °C für 72 h bei konstanter Rührerdrehzahl (400 U min-1). Anschließend wurden 8 g NH4CI und 2 g K2HP04 in 200 mL entionisiertem Wasser gelöst und dem Hydro- lysat zugegeben. Danach wurde das Medium für Kultivierungszwecke auf pH 7 durch 5 M NH OH eingestellt. Einige Mediumkomponenten (D-Glucose, D-Xylose, PCA, Spuren- elemente, AF204) wurden steril nach dem Autoklavieren hinzugefügt. Im Fall des Fed-Batch- Prozesses wurde eine Lösung von 100 g L 1 D-Glucose in entionisiertem Wasser eingesetzt.
Während der Kultivierung wurde der pH-Wert zweiseitig auf pH 7 durch Zuführung von 5 M H3P0 bzw. 5 M NH OH geregelt. Die Temperatur und Begasungsrate wurde auf 30 °C bzw. 0.5 vvm fixiert. Aerobe Prozessbedingungen (> 30 % Gelöstsauerstoffkonzentration) wurden durch Regelung der Rührerdrehzahl (400 - 1 ,200 U min 1) gewährleistet. Online- Messungen wurden für pH (405-DPAS-SC-K80/225, Mettler Toledo), DO (Visiferm DO 225, Hamilton) und Abgaszusammensetzung (GA4, DASGIP AG) durchgeführt. Die Inokulation erfolgte von einer exponentiell wachsenden Vorkultur auf CGXII-Medium (20 g L 1 D- Glucose) auf eine finale OD von 2. Aus der Hauptkultur wurden Proben zur Messung der Konzentrationen von Biomasse, D-Xylose und D-Xylonat entnommen.
Gegen Ende der Fermentation kann D-Xylonat aus der Kultivierungslösung nach bekannten Protokollen isoliert und/oder aufbereitet, d.h. abgetrennt, aufgereinigt und/oder aufkon- zentriert werden. Für die Produktaufreinigung wurdeein bestehendes Protokoll (Liu et al., Bioresource Technology, 2012, 115: 244-248) wie folgt angewendet: 1. Zellabtrennung mit- tels Zentrifugation (4500 rpm für 10 min bei 4°C); 2. Entkolorisierung des resultierenden Überstandes in aktiviertem Kohlenstoff (AC); 3. Filtration des AC-behandelten Überstandes (0.22 pm) und Aufkonzentrierungmittels Rotationsverdampfer (100 mbar, 60°C Wasserbad); 4. Filtration des Konzentrats (0.22 pm) und Präzipitation von D-Xylonat durch Zugabe von EtOH (3:1 , v/v); Vakuumtrocknung des Produktes für mindestens 12 h bei -10°C.
Die Bestimmung der Biomasse erfolgte gravimetrisch durch Überführung von 2 mL Kultur- überstand in ein gewogenes Reagenzglas, Zentrifugation bei 13,000 U min 1 für 10 min und Resuspension in 0.9 % (w v 1) NaCI. Nach einem weiterem Zentrifugationsschritt wurde der Überstand mittels Dekantieren entfernt. Das Zellpellet wurde getrocknet bei 80 °C für 24 h, gefolgt von gravi metrischer Zelltrockengewichtsbestimmung. Zur Substrat und Produktquan- tifizierung wurden die Überstände mithilfe eines Zellulose-Acetat Spritzenfilters (0.2 pm, DIA- Nielsen, Düren, Deutschland) gefiltert. Die Trennung von D-Glucose und D-Xylonat erfolgte durch eine isokratische Austauschmethode auf einer HPLC (Agilent 1100 Infinity, Agilent Technologies, Santa Clara, CA). Die Methode verwendet eine Organic Resin HPLC-Säule 300 x 8 mm (DIA-Nielsen, Düren, Deutschland) als stationäre Phase, 0.1 M H2S04 mit einer Flussrate von 0.6 mL min 1 als mobile Phase, eine Säulentemperatur von 80 °C und ein In- jektionsvolumen von 10 pL. Die Detektion von D-Glucose erfolgte mittels Refraktionsindex- Detektor bei 35 °C. D-Xylonat wurde mittels UV-Licht-Absorption bei 215 nm mit einem Dio- den-Array-Detektor detektiert. Entsprechende Konzentrationswerte wurden mittels externer Standards und gewichteter linearer Regression ermittelt. Zur Quantifizierung von D-Xylose wurde ein enzymatischer Assay (Xylose Assay Kit, Megazymes, Wickow, Irland) genutzt. Alle Pipettierungsschritte wurde mithilfe eines automatisierten Liquid-Handling-Systems (Free- dom Evo 200, Tecan Group Ltd., Männedorf, Schweiz), durchgeführt. Der Anstieg an NADH wurde bei 340 nm mittels Plattenlesegerät gemessen (Infinite M200, Tecan Group Ltd., Män- nedorf, Schweiz).
Isolierung der erfindunqsqemäßen D-Xylose-Dehvdroqenase lolG
Das Plasmid pET-28b-/o/G wurde zur heterologen Genexpression von iolG in Escherichia coli BL21 transformiert und anschließend in 2x 50ml_TerrificBroth (TB) Medium mit 50 mg/L Kanamycin für 16 Stunden bei 30 °C und 250Upm kultiviert. Je 10 mL dieser Kulturen wur- de genutzt um vier Bioreaktorkulturen anzuimpfenmit 20 g/L Glycerin als initiale Kohlen- stoffquelle und mit 50 mg/L Kanamycin zur Erhaltung des Selektionsdrucks. Die Bioreaktor- kulturen wurden auf 30 °C temperiert und der pH-Wert mit Ammoniakwasser auf pH 7 titriert. Ca. 5 h nach Kultivierungsstart wurde die Genexpression durch Zugabe von 250 pM Isopropyl-ß-D-thiogalactopyranosid (IPTG) induziert, sowie erneut nach ca. 32 h. Nach voll- ständiger Verstoffwechselung der initialen Glycerinmenge wurde konzentrierte Substratlö- sung mit 700 g/L Glycerin und 20 g/L MgS04*7H20 automatisch zudosiert mit einer Rate von 20 ml_/h, basierend auf einem 2-Punktregleger (an: DO > 30%, aus: DO < 10%). Nach ca. 10 h Dauer der Zufütterungsphase wurden die Kulturen geerntet und die Zellen wurden vom Kulturmedium durch 20-minütige Zentrifugation (8000Upm) abgetrennt. Die Zellmasse wurde bei -20°C gelagert.
Ca. 60 g Zellmasse wurden in 150 ml_ Äquilibrationspuffer (50 mMTris-HCI, 2 mM MgS04, 300 mM NaCI, pH 7.0) auf Eis resuspendiertfür 30 min. Die Zellsuspension wurde in einer Umlaufkühlzelle mittels Ultraschallsonde (Ultraschallprozessor UP 200S Dr. Hielscher S14D-Sonotrode, Cycle 0,5 Amplitude 70) für 30 min aufgeschlossen. Der Aufschlussüber- stand nach Zentrifugation (23000Upm, 4 °C, 35min) wurde über eine Ni-NTA-Säule (Säu- lenvolumen 70 ml_, Fluss 6 mL/min) aufgegeben (Waschpuffer: 50mMTris pH 7.5, 300mM NaCI, 2mM MgS0425mMlmidazol; Elutionspuffer: 50 mMTris pH 8.0, 300 mM NaCI, 2mM MgS04, 250mMlmidazol). Das Eluat wurde Fraktionen zu insgesamt 60 ml_ aufgefangen und über eine Sephadex-G25 Säule entsalzt (Säulenvolumen 960mL, Fluss 10mL/min, Entsalzungspuffer: lOmMTris pH 7.6, 2mM MgS0 ), wovon insgesamt 150 mL als protein- haltige Fraktionen gesammelt und lyophilisiert wurden. Das resultierende Lyophilisat hatte einen Proteingehalt von 60% nach Bradford Proteinbestimmung.
Bestimmung der D-Xylose-Dehvdroqenase Aktivität
In einem Gesamtvolumen von 200 pL wurden die Enzymtests zur Aktivitätsbestimmung von lolG Lyophilisat durchgeführt. Die enzymatischen Reaktionen wurden durch schnelle Zugabe von 180 pL Reaktionsmix (250 mMTris-HCI, 22mMNAD+, 5 mM MgCI2 und 125 pL/mLIolG- Lyophilisatlösung mit 2.5mg/L, pH 7,5, >30 min vorgewärmt auf 30 °C) auf 20 pL vorgelegte Substratlösung (0 - 250 mM [0 - 25 mM final pro Reaktionsvolumen] D-Xylose oder myo- Inositol). Die Messung der Extinktionsanstiege bei 340 nm wurde im Mikrotiterplattenlesegerät (>30 min vorgewärmt auf 30 °C) für ca. 20 min verfolgt. Nach einem kurzen Einschwingverhalten aller Messsignale wurden die Anfangsreaktionsraten mittels linearer Regression bestimmt über 2 min Messdauer. Die erhaltenden Steigungen in der Einheit [Absorptionseinheiten pro Minute] wurden in die NADH-Bildungsrate in der Einheit [mM NADH pro Minute] mittels Kalibration des Absorptionssignals über Standardlösungen mit bekannter NADH Konzentration anstelle von Substratlösungen bestimmt, unter Anwendung Gauß'scher Fehler fortpflanzung mit Berücksichtigung der Kalibrationsparameterkovarianzmatrix. Das Enzym zeigt keine Aktivität bezüglich des Substrats myo-lnositol.
Zur Bestimmung der maximalen Enzymaktivität (Vmax) und der spezifischen Substrataffinität (Km) bezüglich d-Xylose wurden die experimentellen Daten mittels nichtlinearer Regression an eine Michaelis-Menten-Kinetik gefittet. Die enzymkinetischen Parameter aus den Experi- menten wurden zu Vmax = 18,8 ± 3,3 U/L und Km = 28,0 ± 7,1 mM bestimmt.
D-Xylonat-Bildunq im homologen Wirtssvstem corvneformer Bakterien durch gesteigerte Ex- pression der erfindunqsqemäßen D-Xylose-Dehvdrogenase
Experimente zu Wachstum, D-Xylose-Aufnahme und D-Xylonat-Bildung unterschiedlicher Varianten coryneformer Bakterienstämme im Vergleich zum Wildtyp wurden in Schüttelkol- ben in definiertem CGXII-Medium mit 10 g L 1 D-Glucose und 30 g L‘1 D-Xylose durchgeführt Die nachfolgenden Beispiele zeigen eindeutig, dass die erfindungsgemäße D-Xylose- Dehydrogenase-Aktivität für die D-Xylonat-Bildung in coryneformen Bakterien verantwortlich ist Figuren 14 und 15.
Wie Figur 14 zu entnehmen ist, zeigen alle Stämme ein vergleichbares Wachstum auf D- Glucose als Kohlenstoff- und Energiequelle. Der Wildtyp-Stamm C.glutamicum ATCC 13032 weist eine sehr niedrige Aufnahme von D-Xylose und Umsetzung in D-Xylonat auf. Der ma- ximale D-Xylonat-Titer nach 72 h beträgt hier 40.0 mM. Der Stamm C. glutamicum WT AioIR mit Deletion des Gens für den Regulator loIR zeigt eine deutlich erhöhte D-Xylose-Aufnahme und D-Xylonat-Produktion, bedingt durch die deregulierte Expression des D-Xylose- Transporters IoIT 1 sowie der D-Xylose-Dehydrogenase lolG. Der maximale D-Xylonat-Titer nach 72 h beträgt hier 214.7 mM. Der Stamm C. glutamicum WT AioIR AiolG mit zusätzlicher Deletion des Gens für die erfindungsgemäße D-Xylose-Dehydrogenase lolG zeigt eine stark reduzierte D-Xylose-Aufnahme und D-Xylonatbildung, bedingt durch die fehlende Expression der D-Xylose-Dehydrogenase lolG. Der maximale D-Xylonat-Titer nach 72 h beträgt hier 111.9 mM. Der Stamm C. glutamicum WT AioIR A/o/GpEKEx3-/o/Gmit zusätzlicher plasmid- basierter Expression des Gens für die erfindungsgemäße D-Xylose-Dehydrogenase lolG zeigt die höchste D-Xylonatproduktion, bedingt durch die hohe homologe Expression der D- Xylose-Dehydrogenase lolG, welche die fehlende Expression ( AiolG) überkompensiert. Der maximale D-Xylonat-Titer nach 72 h beträgt hier 223.6 mM.
Figur 15 zeigt die D-Xylonatbildung weiterer Varianten erfindungsgemäßer coryneformer Bakterienstämme, bei denen die Funktionalität operativ-verbundener regulatorischer Bereiche der Nukleinsäuresequenz kodierend für die erfindungsgemäße D-Xylose- Dehydrogenase verändert ist.Die Experimente wurden in Schüttelkolben in definiertem CGXII-Medium mit 10 g L'1 D-Glucose und 30 g L 1 D-Xylose durchgeführt. Der Wildtyp-Stamm C. glutamicum ATCC 13032 weist eine sehr niedrige Aufnahme von D- Xylose und Umsetzung in D-Xylonat auf. Der maximale D-Xylonat-Titer nach 72 h beträgt hier 40.0 mM. Der Stamm C. glutamicum WT P06 iolT1 mit veränderter Promotorsequenz im Genbereich des D-Xylose-Transporters lolT 1 zeigt eine leicht erhöhte D-Xylose-Aufnahme und D-Xylonat-Produktion, bedingt durch die deregulierte Expression des D-Xylose- Transporters lolT 1. Der maximale D-Xylonat-Titer nach 72 h beträgt hier 80.0 mM.
Der Stamm C. glutamicum WTpEKEx3-/o/Gmit plasmid-basierter Expression des Gens für die D-Xylose-Dehydrogenase zeigt eine deutlich erhöhte D-Xylonat-Produktion, bedingt durch die homologe Expression der D-Xylose-Dehydrogenase lolG. Der maximale D- Xylonat-Titer nach 72 h beträgt hier 213.9 mM. Der Stamm C. glutamicum WT R06/o/PrEKEc3-/o/Q mit zusätzlicher veränderter Promotorsequenz im Genbereich des D- Xylose-Transporters lolT 1 zeigt die höchste D-Xylonatproduktion, bedingt durch die gleich- zeitige homologe Expression der D-Xylose-Dehydrogenase lolG und die deregulierte Expression des D-Xylose-Transporters lolT 1. Der maximale D-Xylonat-Titer nach 72 h beträgt hier 217.4 mM.
Figur 16 zeigt die D-Xylonatbildung weiterer Varianten erfindungsgemäßer coryneformer Bakterienstämme, bei denen die Funktionalität operativ-verbundener regulatorischer Berei- che verändert bzw. deletiert sind. Gezeigt sind der Stamm C. glutamicum WT P06 iolT1 mit veränderter Promotorsequenz im Genbereich des D-Xylose-Transporters lolT 1 , der erfin- dungsgemäße Stamm C. glutamicum P06iolT1 Po^ogiolC, bei dem zusätzlich zu P06iolT1 die Funktionalität des operativ-verbundenen regulatorischen Bereichs der Nukleinsäuresequenz kodierend für die D-Xylose-Dehydrogenase (Pos-ogiolC) verändert ist und im Vergleich dazu der Stamm C. glutamicum WT AioIR, mit Deletion des Gens für den Regulator lolR. Die Ex- perimente wurden in Schüttelkolben in definiertem CGXII-Medium mit 10 g L 1 D-Glucose und 30 g L 1 D-Xylose durchgeführt. Der Stamm WT C. glutamicum P06 iolT1 mit veränderter Promotorsequenz im Genbereich des D-Xylose-Transporters lolT 1 zeigt eine leicht erhöhte D-Xylonat-Produktion, bedingt durch die deregulierte Expression des D-Xylose-Transporters lolT1. Der maximale D-Xylonat-Titer nach 72 h beträgt hier 74,73 mM. Der Stamm C. glutamicum WT AioIR mit Deletion des Gens für den Regulator lolR zeigt eine deutlich erhöhte D- Xylonat-Produktion, bedingt durch die deregulierte Expression des D-Xylose-Transporters lolT 1 sowie der D-Xylose-Dehydrogenase lolG. Der maximale D-Xylonat-Titer nach 72 h be- trägt hier 205,53 mM. Der Stamm C. glutamicum P06iolT1 Pos-ogiolC mit veränderter Promo- torsequenz im Genbereich des D-Xylose-Transporters lolT 1 und veränderter Funktionalität des operativ-verbundenen regulatorischen Bereichs der Nukleinsäuresequenz kodierend für die D-Xylose-Dehydrogenase (Po -o iolC) zeigt eine deutlich erhöhte D-Xylonat-Produktion. Der maximale D-Xylonat-Titer nach 72 h beträgt hier 206,82 mM.
Die vorliegende Erfindung zeigt somit eindeutig, dass durch erfindungsgemäß minimale und äußerst definierte Nukleotid-Substitutionen in den 5'-upstream regulatorischen Bereichen der relevanten kodierenden Gensequenzen eine deutlich erhöhte D-Xylonat-Produktion erzielt wird: Und dies, ohne dass heterologe Gene oder Strukturen in den corynformen Bakterien- stamm eingeführt werden müssen, was eine Aufgabe der vorliegenden Erfindung ist, und auch ohne dass drastische Deletionen an zentral agierenden Regulatoren vorgenommen werden müssen, die weitreichend Undefinierte physiologische Auswirkungen in einem Orga- nismus auslösen, was ebenfalls erfindungsgemäß gewünscht ist. Die erfindungsgemäß we- nigen gezielten Nukeotid-Substitutionen befinden sich dabei in einem Ausmaß, wie sie durchaus auch natürlicherweise in der Natur Vorkommen was den erfindungsgemäßen co- ryneformen Bakterienstamm als non-GVO auszeichnet.
Gegenstand der vorliegenden Erfindung sind auch folgende Ausführunqsbeispiele:
1 . Coryneforme Bakterienzelle, dadurch gekennzeichnet, dass die gesteigerte Expression der D-Xylose-Dehydrogenase auf Veränderungen beruht, ausgewählt aus der Gruppe enthaltend: a) Veränderung der Regulation oder von Signalstrukturen zur Genexpression, b) Veränderung der Transkriptionsaktivität der kodierenden Nukleinsäuresequenz, c) Erhöhung der Genkopienzahl der kodierenden Nukleinsäuresequenz, und d) eine Kombination aus a) - c). 2. Coryneforme Bakterienzelle gemäß Gegenstand 1 , dadurch gekennzeichnet, dass die erhöhte Aktivität der D-Xylose-Dehydrogenase-Aktivität auf Veränderungen beruht, ausgewählt aus der Gruppe enthaltend a) Erhöhung der Expression der kodierenden Nukleinsäuresequenz, b) Expression einer Nukleinsäuresequenz oder Fragmenten oder Allelen davon, die für eine D-Xylose-Dehydrogenase mit erhöhter katalytischer Aktivität und/oder Substratspezifität kodiert, c) Erhöhung der Stabilität der mRNA abgeleitet von der kodierenden Nukleinsäuresequenz, d) Veränderung der katalytischen Aktivität und/oder Substratspezifität einer homologen D-Xylose-Dehydrogenase für den Umsatz von D-Xylose, und e) eine Kombination aus a) - d).
3. Coryneforme Bakterienzelle nach einem der Gegenstände 1 oder 2 a) bei der die Aktivität einer erfindungsgemäßen D-Xylose-Dehydrogenase gesteigert ist, b) bei der eine erfindungsgemäße Nukleinsäuresequenz verstärkt exprimiert ist, c) bei der eine Nukleinsäuresequenz kodierend für einen myo-lnositol/Proton- Symporter (IoIT 1 ) gemäß SEQ ID NO. 3 oder Fragmente oder Allele davon verstärkt exprimiert ist, d) bei der ein myo-lnositol/Proton-Symporter IoIT 1 mit einer Aminosäuresequenz gemäß SEQ ID NO. 4 oder Fragmente davon in seiner Aktivität gesteigert ist, e) die eine Nukleinsäuresequenz kodierend für einen myo-lnositol/Proton-Symporter (IoIT 1) mit einer oder mehreren Nukleotidsubstitutionen oder Nukleotiddeletionen in den operativ-verknüpften lolR-Bindestellen des iolT1-Gens aufweist, bevorzugt ausgewählt aus der Gruppe von Nukleinsäuresequenzen SEQ ID NO. 9 und SEQ ID NO. 10 oder Fragmente oder Allele davon, f) bei der eine Nukleinsäuresequenz kodierend für einen myo-lnositol/Proton- Symporter (lolT2) gemäß SEQ ID NO. 5 oder Fragmente oder Allele davon verstärkt exprimiert ist, g) bei der ein myo-lnositol/Proton-Symporter lolT2 mit einer Aminosäuresequenz gemäß SEQ ID NO. 6 oder Fragmente davon in seiner Aktivität gesteigert ist, h) bei der beide Nukleinsäuresequenzen kodierend für myo-lnositol/Proton-Symporter IoIT 1/2 nach c) und f) verstärkt exprimiert sind, i) bei der beide myo-lnositol/Proton-Symporter lolT1/2 nach d) und g) in ihrer Aktivität gesteigert sind, j) die eine erfindungsgemäße Nukleinsäuresequenz aufweist, bei der die Funktionalität einer oder mehrerer operativ-verknüpfter lolR-Bindestellen im regulatorischen, nicht-kodierenden Bereich des iolC-Genclusters, enthaltend iolG kodierend für eine erfindungsgemäße D-Xylose-Dehydrogenase, vermindert oder ausgeschaltet ist oder eine oder mehrere lolR-Bindestellen teilweise oder komplett deletiert sind, k) die eine Nukleinsäuresequenzkodierend für eine D-Xylose-Dehydrogenase aufweist, die eine oder mehrere Nukleotidsubstitutionen oder Nukleotiddeletionen in den operativ-verknüpften lolR-Bindestellen des iolC-Genclusters aufweist, bevorzugt ausgewählt aus der Gruppe enthaltend Nukleinsäuresequenzen gemäß SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 63 und SEQ ID NO. 64 oder Fragmente oder Allele davon,
I) eine Nukleinsäuresequenz kodierend für einen myo-lnositol-Regulator loIR oder Fragmenten oder Allele davon komplett oder teilweise deletiert ist, m) die Expression eines iolR-Gens vermindert ist oder fehlt, n) ein myo-lnositol-Regulator loIR in seiner Aktivität vermindert oder komplett ausgeschaltet ist, oder o) eine Kombination aus a) - n). 4. Verfahren zur Herstellung von D-Xylonat, bevorzugt mit coryneformen Bakterien, nach einem der Gegenstände 1 bis 3, enthaltend die Schritte: a) Bereitstellen einer Lösung enthaltend Wasser und eine C5-Kohlenstoff-Quelle, b) mikrobielle Umsetzungder C5-Kohlenstoffquelle in einer Lösung gemäß Schritt a) zu D-Xylonat in Anwesenheit einer coryneformen Bakterienzellein der die Expression einer Nukleinsäuresequenz kodierend für eine homologe D-Xylose-Dehydrogenase verstärkt ist und/oder in der die Aktivität einer homologen D-Xylose-Dehydrogenase gesteigert ist, und c) optionale Isolierungund/oder Aufbereitung von D-Xylonat aus der Lösung.
Tabelle 1 : _
Stamm _ Referenz _
C. glutamicum ATCC13032 Wildtyp Abe et al., 1967
(https://doi.Org/10.2323/jgam.13.279)
C. glutamicum ATCC 13032 P05 iolT1 Brüsseler et
al., 2018(https://doi.org/10.1016/j.biortech.2017.10.0 98)
C. glutamicum ATCC 13032 P06 iolT1Po erfindungsgemäß
iolC
C. glutamicum ATCC 13032 RO5 ίoIT1RO5.09 erfindungsgemäß
iolC
C. glutamicum ATCC13032 DR06 iolT 1 erfindungsgemäß
C. glutamicum ATCC13032 DR0i3 iolC erfindungsgemäß
C. glutamicum ATCC 13032 AP 05-09 iolC erfindungsgemäß
C. glutamicum ATCC 13032 D/o/G erfindungsgemäß
C. glutamicum ATCC 13032 iolG' erfindungsgemäß
C. glutamicum ATCC13032 /o/G erfindungsgemäß
C. glutamicum ATCC 13032 /o/GJ erfindungsgemäß
C. glutamicum ATCC13032 pEKEx3 iolG Erfindungsgemäß
Thermo Fisher Scientific (Waltham, MA, USA)
E.coli DH5 et
E.coli BL21(DE3) Merck (Darmstadt, Deutschland)
Plasmid
pEKEx3 Gande et al., 2007
(https://doi.Org/10.1128/JB.00254-07)
pk19 mobsacB Schäfer et al., 1994
(https://doi.org/10.1016/0378-11 19(94)90324-7) pET-28b
Merck (Darmstadt, Deutschland) pk19 mobsacB P06iolT1 Brüsseler et al.,2018
(https://doi.Org/10.1016/j.biortech.2017.10.098) erfindungsgemäß
erfindungsgemäß
erfindungsgemäß
erfindungsgemäß
erfindungsgemäß
pk19 mobsacB A iolG erfindungsgemäß
pk19 mobsacB CgLP12 PTUf iolG erfindungsgemäß
pk19 mobsacB CgLP4 PTUf iolG erfindungsgemäß
pk19 mobsacB ncr cons PTUf iolG erfindungsgemäß
pEKEx3 iolG erfindungsgemäß Tabelle 2:

Claims

P a t e n t a n s p r ü c h e
1. D-Xylose-Dehydrogenase isoliert aus coryneformen Bakterien, dadurch gekennzeichnet, dass die Aminosäuresequenz wenigstens 70% Identität zu der Aminosäuresequenz gemäß SEQ ID NO. 2 oder Fragmenten davon aufweist. 2. D-Xylose-Dehydrogenase nach Anspruch 1 ,
enthaltend eine Aminosäuresequenz gemäß SEQ ID NO.
2 oder Fragmenten davon.
3. D-Xylose-Dehydrogenase nach Anspruch 1 ,
kodiert durch eine Nukleinsäuresequenz enthaltend wenigstens 70% Identität zu der Nukleinsäuresequenz gemäß SEQ ID NO. 1 oder Fragmente oder Allele davon.
4. D-Xylose-Dehydrogenase nach Anspruch 1 oder 2,
kodiert durch eine Nukleinsäuresequenz gemäß SEQ ID NO. 1 oder Fragmente oder Allele davon.
5. Nukleinsäuresequenz isoliert aus coryneformen Bakterien kodierend für eine D-Xylose- Dehydrogenase gemäß einem der Ansprüche 1 - 4,
ausgewählt aus der Gruppe enthaltend: a) eine Nukleinsäuresequenz enthaltend wenigstens 70% Identität zu der Nukleinsäuresequenz gemäß SEQ ID NO. 1 oder Fragmente oder Allele davon, b) eine Nukleinsäuresequenz, die unter stringenten Bedingungen mit einer komplementären Sequenz einer Nukleinsäuresequenz gemäß SEQ ID NO. 1 oder Fragmenten oder Allelen davon hybridisiert, c) eine Nukleinsäuresequenz gemäß SEQ ID NO. 1 oder Fragmente oder Allele davon, und d) eine Nukleinsäuresequenz kodierend für eine D-Xylose-Dehydrogenase entsprechend jeder der Nukleinsäuren gemäß a) - c) , die sich jedoch von diesen Nukleinsäuresequenzen gemäß a) - c) durch die Degeneriertheit des genetischen Codes oder funktionsneutrale Mutationen unterscheidet, zur Herstellung von D-Xylonat, bevorzugt in coryneformen Bakterien.
6. Nukleinsäuresequenz nach Anspruch 5, dadurch gekennzeichnet, dass die Funktionalität einer oder mehrerer operativ- verknüpfter lolR-Bindestellen im regulatorischen, nicht-kodierenden Bereich des iolC- Genclusters, enthaltend iolG kodierend für eine D-Xylose-Dehydrogenase gemäß einem der Ansprüche 1 - 4, vermindert oder ausgeschaltet ist oder eine oder mehrere lolR- Bindestellen teilweise oder komplett deletiert sind.
7. Nukleinsäuresequenz nach einem der Ansprüche 5 oder 6,
dadurch gekennzeichnet, dass sie eine oder mehrere Nukleotidsubstitutionen oder Nukleotiddeletionen in den operativ-verknüpften lolR-Bindestellen des iolC-Genclusters aufweist, bevorzugt ausgewählt aus der Gruppe von Nukleinsäuresequenzen gemäß SEQ ID NO. 7 und SEQ ID NO. 8 oder Fragementen oder Allelen davon.
8. Nukleinsäuresequenz nach einem der Ansprüche 5 oder 6,
dadurch gekennzeichnet, dass sie eine oder mehrere Nukleotidsubstitutionen oder Nukleotiddeletionen in den operativ-verknüpften lolR-Bindestellen des iolC-Genclusters aufweist, bevorzugt ausgewählt aus der Gruppe von Nukleinsäuresequenzen gemäß SEQ ID No. 63 und SEQ ID NO. 64 oder Fragementen oder Allelen davon.
9. Protein nach einem der Ansprüche 1 - 4,
oder Nukleinsäuresequenz nach einem der Ansprüche 5 -8,
isoliert aus coryneformen Bakterien ausgewählt aus der Gruppe
entbaltenöCorynebacterium, Brevibacterium, insbesondere Corynebacterium
glutamicum, Corynebacterium acetoglutamicum, Corynebacterium thermoaminogenes, Brevibacterium flavum, Brevibacterium lactofermentum oder Brevibacterium divaricatum ist.
10. Protein nach einem der Ansprüche 1 - 4,
oder Nukleinsäuresequenz nach einem der Ansprüche 5 - 8,
isoliert aus coryneformen Bakterien ausgewählt aus der Gruppe enthaltend
Corynebacterium glutamicum ATCC13032
Corynebacterium acetoglutamicum ATCC 15806
Corynebacterium acetoacidophilum ATCC 13870
Corynebacterium thermoaminogenes FERM BP-1539
Brevibacterium flavum ATCC 14067
Brevibacterium lactofermentum ATCC 13869
Brevibacterium divaricatum ATCC14020.
11. Coryneforme Bakterienzelle zur Herstellung von D-Xylonat dadurch gekennzeichnet, dass sie eine gesteigerte Expression und/oder erhöhte Aktivität einer homologen D- Xylose-Dehydrogenase nach einem der Ansprüche 1 -4 oder Fragemente davon aufweist.
12. Coryneforme Bakterienzelle nach Anspruch 11 ,
dadurch gekennzeichnet, dass sie eine Nukleinsäuresequenz gemäß einem der Ansprüche 5 - 8 aufweist, bei der die Funktionalität einer oder mehrerer operativ- verknüpftelolR-Bindestellen im regulatorischen, nicht-kodierenden Bereich der
Nukleinsäuresequenz kodierend für die D-Xylose-Dehydrogenase im iolC-Gencluster vermindert oder ausgeschaltet ist oder eine oder mehrere lolR-Bindestellen teilweise oder komplett deletiert sind.
13. Coryneforme Bakterienzelle nach einem der Ansprüche 11 oder 12,
dadurch gekennzeichnet, dass sie eine Nukleinsäuresequenz mit einer oder mehreren Nukleotidsubstitutionen oder Nukleotiddeletionen in den operativ-verknüpften lolR- Bindestellen des iolC-Genclusters aufweist, bevorzugt ausgewählt aus der Gruppe enthaltend Nukleinsäuresequenzen gemäß SEQ ID NO. 7 und SEQ ID NO. 8 oder Fragmente oder Allele davon.
14. Coryneforme Bakterienzelle nach einem der Ansprüche 11 oder 12,
dadurch gekennzeichnet, dass sie eine Nukleinsäuresequenz mit einer oder mehreren Nukleotidsubstitutionen oder Nukleotiddeletionen in den operativ-verknüpften lolR- Bindestellen des iolC-Genclusters aufweist, bevorzugt ausgewählt aus der Gruppe enthaltend Nukleinsäuresequenzen gemäß SEQ ID NO. 63 und SEQ ID NO. 64 oder Fragmente oder Allele davon.
15. Coryneforme Bakterienzelle nach einem der Ansprüche 11- 14,
dadurch gekennzeichnet, dass sie eine Nukleinsäuresequenz mit einer oder mehreren Nukleotidsubstitutionen oder Nukleotiddeletionen in den operativ-verknüpften lolR- Bindestellen des iolT1-Gens, bevorzugt ausgewählt aus der Gruppe von
Nukleinsäuresequenzen SEQ ID NO. 9 und SEQ ID NO. 10 oder Fragmente oder Allele davon.
16. Coryneforme Bakterienzelle nach einem der Ansprüche 11-15,
ausgewählt aus der Gruppe enthaltend Corynebacterium, Brevibacterium, insbesondere Corynebacterium glutamicum, Corynebacterium acetoglutamicum, Corynebacterium thermoaminogenes, Brevibacterium flavum, Brevibacterium lactofermentum oder Brevibacterium divaricatum.
17. Coryneforme Bakterienzelle nach einem der Ansprüche 11- 16, dadurch gekennzeichnet, dass sie eine Bakterienzelle ist ausgewählt aus der Gruppe enthaltend:
Corynebacterium glutamicum ATCC 13032
Corynebacterium acetoglutamicum ATCC 15806
Corynebacterium acetoacidophilum ATCC 13870
Corynebacterium thermoaminogenes FERM BP-1539
Brevibacterium flavum ATCC14067
Brevibacterium lactofermentum ATCC13869
Brevibacterium divaricatum ATCC 14020.
18. Coryneforme Bakterienzelle nach einem der Ansprüche 11 - 17,
bei der die erhöhte Kopienzahl einer erfindungsgemäßen D-Xylose-Dehydrogenase kodierenden Nukleinsäuresequenz chromosomal-kodiert vorliegt.
19. Coryneforme Bakterienzelle nach Anspruch 11 - 18,
dadurch gekennzeichnet, dass sie nicht-rekombinant verändert ist.
20. Coryneforme Bakterienzelle nach einem der Ansprüche 11 - 19,
bei der die erhöhte Kopienzahl einer erfindungsgemäßen D-Xylose-Dehydrogenase kodierenden Nukleinsäuresequenzextra-chromosomal-kodiert, bevorzugt Plasmid- kodiert oder Vektor-kodiert, vorliegt.
21 . Coryneforme Bakterienzelle nach einem der Ansprüche 11 - 20, a) bei der die Aktivität einer D-Xylose-Dehydrogenase nach einem der Ansprüche 1 - 4 oder 9 - 10 gesteigert ist, b) bei der eine Nukleinsäuresequenz nach einem der Ansprüche 5 - 10 verstärkt exprimiert ist, c) bei der eine Nukleinsäuresequenz kodierend für einen myo-lnositol/Proton- Symporter (IoIT 1 ) gemäß SEQ ID NO. 3 oder Fragmente oder Allele davon verstärkt exprimiert ist, d) bei der ein myo-lnositol/Proton-Symporter IoIT 1 mit einer Aminosäuresequenz gemäß SEQ ID NO. 4 oder Fragmente davonin seiner Aktivität gesteigert ist, e) die eine Nukleinsäuresequenz kodierend für einen myo-lnositol/Proton-Symporter (IoIT 1 ) mit einer oder mehreren Nukleotidsubstitutionen oder Nukleotiddeletionen in den operativ-verknüpften lolR-Bindestellen des iolT1-Gens aufweist, bevorzugt ausgewählt aus der Gruppe von Nukleinsäuresequenzen SEQ ID NO. 9 und SEQ ID NO. 10 oder Fragmente oder Allele davon, f) bei der eine Nukleinsäuresequenz kodierend für einen myo-lnositol/Proton- Symporter (lolT2) gemäß SEQ ID NO. 5 oder Fragmente oder Allele davon verstärkt exprimiert ist, g) bei der ein myo-lnositol/Proton-Symporter lolT2 mit einer Aminosäuresequenz gemäß SEQ ID NO. 6 oder Fragmente davon in seiner Aktivität gesteigert ist, h) bei der beide Nukleinsäuresequenzen kodierend für myo-lnositol/Proton-Symporter IoIT 1/2 nach c) und f) verstärkt exprimiert sind, i) bei der beide myo-lnositol/Proton-Symporter IoIT 1/2 nach d) und g) in ihrer Aktivität gesteigert sind, j) die eine Nukleinsäuresequenz gemäß einem der Ansprüche 5 - 10 aufweist, bei der die Funktionalität einer oder mehrerer operativ-verknüpfter lolR-Bindestellen im regulatorischen, nicht-kodierenden Bereich des iolC-Genclusters, enthaltend iolG kodierend für eine D-Xylose-Dehydrogenase gemäß einem der Ansprüche 1 - 4 oder 5 - 10, vermindert oder ausgeschaltet ist oder eine oder mehrere lolR- Bindestellen teilweise oder komplett deletiert sind, k) die eine Nukleinsäuresequenzkodierend für eine D-Xylose-Dehydrogenase aufweist, die eine oder mehrere Nukleotidsubstitutionen oder Nukleotiddeletionen in den operativ-verknüpften lolR-Bindestellen des iolC-Genclusters aufweist, bevorzugt ausgewählt aus der Gruppe enthaltend Nukleinsäuresequenzen gemäß SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 63 und SEQ ID NO. 64 oder Fragmente oder Allele davon, oder
L) eine Kombination aus a) - k).
22. Verfahren zur Herstellung von D-Xylonat, enthaltend die Schritte: a) Bereitstellen einer Lösung enthaltend Wasser und eine C5-Kohlenstoff-Quelle, b) mikrobielle Umsetzungder C5-Kohlenstoffquelle in einer Lösung gemäß Schritt a) zu D-Xylonat in Anwesenheit einer coryneformen Bakterienzellein der die Expression einer Nukleinsäuresequenz kodierend für eine homologe D-Xylose-Dehydrogenase verstärkt ist und/oder in der die Aktivität einer homologen D-Xylose-Dehydrogenase gesteigert ist, und c) optionale Isolierungund/oder Aufbereitung von D-Xylonat aus der Lösung.
23. Verfahren nach Anspruch 22,
bei dem eine coryneforme Bakterienzelle nach einem der Ansprüche 11 - 21 eingesetzt wird.
24. Verfahren nach einem der Ansprüche 22 oder 23,
bei dem die D-Xylose-Dehydrogenase in Schritt b) eine Aminosäuresequenz von wenigstens 70% Identität zu der Aminosäuresequenz gemäß SEQ ID NO. 2 oder Fragmenten davon aufweistoder durch eine Nukleinsäuresequenz kodiert ist, die wenigstens 70% Identität zu der Nukleinsäuresequenz gemäß SEQ ID NO. 1 oder Fragmente oder Allele davon aufweist.
25. Verfahren nach einem der Ansprüche -22 - 24,
dadurch gekennzeichnet, dass die mikrobielle Umsetzung in einer Lösung erfolgt, enthaltend Wasser und eine C5-Kohlenstoff-Quelle ausgewählt aus der Gruppe enthaltend: a) Oligosaccharide oder Polysaccharide, enthaltend D-Xylose-Einheiten b) D-Xylose, bevorzugt in einer Konzentration von wenigstens 10 g L‘1 c) Lignocellulose-, Cellulose-, oder Hemicellulose-haltige Biomasse, deren Hydrolysat oder daraus gewonnener Extrakt enthaltend D-Xylose-Einheiten, und d) eine Kombination von a) bis c).
26. Verfahren nach einem der Ansprüche -22 - 24,
bei dem die C5-Kohlenstoffquelle Bagasse, bevorzugt Rohrzucker-Bagasse, deren Hydrolysat oder daraus gewonnener Extrakt enthaltend D-Xylose-Einheiten ist.
27. Verfahren nach einem der Ansprüche -22 - 26,
dadurch gekennzeichnet, dass die Kultivierung diskontinuierlich oder kontinuierlich, bevorzugt im batch-, fed-batch-, repeated-fed-batch-Modus oder als Ein-Topf-Hydrolyse- Fermentationsprozess erfolgt.
28. Verfahren nach einem der Ansprüche 22 - 27,
dadurch gekennzeichnet, dass die Lösung als Kohlenstoff- und Energiequellen zu Beginn der Kultivierung D-Glukose, bevorzugt wenigstens 8 -10 g L 1, neben D-Xylose enthält.
29. Verfahren nach einem der Ansprüche 22 - 28,
dadurch gekennzeichnet, dass die Kultivierung im fed-batch-Modus, bevorzugt mit Zufütterung von D-Xylose, erfolgt.
30. Verfahren nach einem der Ansprüche -22 - 29,
dadurch gekennzeichnet, dass eine coryneforme Bakterienzelle eingesetzt wird, die nicht-rekombinant verändert (non-GVO) ist.
31. Verwendung einer D-Xylose-Dehydrogenase gemäß einem der Ansprüche 1 - 4 oder 9 - 10 oder einer Nukleinsäuresequenz gemäß einem der Ansprüche 5 - 10 oder einer coryneformen Bakterienzelle gemäß einem der Ansprüche 11 - 21 zur Herstellung von D-Xylonat.
32. Verwendung einer D-Xylose-Dehydrogenase gemäß einem der Ansprüche 1 - 4 oder 9- 10 oder einer Nukleinsäuresequenz gemäß einem der Ansprüche 5 - 10 zur Herstellung eines Wirtssystems ausgewählt aus der Gruppe coryneformen Bakterien, bevorzugt Corynebacterium oder Brevibacterium, Hefen, bevorzugt Saccharomyces, und Pilzen, bevorzugt Aspergillus.
33. Verwendung nach Anspruch 31 ,
zur mikrobiellen Herstellung von D-Xylonat mit Corynebacterium glutamicum.
34. Verwendung einer Nukleinsäuresequenz gemäß einem der Ansprüche 5 - 10 oder einer Nukleotidsequenz ausgewählt aus der Gruppe enthaltend SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9 oder SEQ ID NO. 10 zur Herstellung coryneformer Bakterienzellen für die
Herstellung von D-Xylonat.
35. Verwendung einer Nukleinsäuresequenz gemäß einem der Ansprüche 5 - 10 oder einer Nukleotidsequenz ausgewählt aus der Gruppe enthaltend SEQ ID NO. 63 und SEQ ID NO. 64 zur Herstellung coryneformer Bakterienzellen für die Herstellung von D-Xylonat.
36. Zusammensetzung enthaltend D-Xylonat herstellt mit einem Enzym gemäß einem der
Ansprüche 1 - 4 und 9 - 10, einem Enzym kodiert durch eine Nukleinsäuresequenz nach einem der Ansprüche 5 - 10, einer coryneformen Bakterienzelle gemäß einem der Ansprüche 11- 21 oder einem Verfahren nach einem der Ansprüche 22 - 30.
37. Verwendung von D-Xylonat hergestellt mit einem Enzym gemäß einem der Ansprüche 1 - 4 und 9 - 10, einem Enzym kodiert durch eine Nukleinsäuresequenz nach einem der
Ansprüche 5 - 10, einer coryneformen Bakterienzelle gemäß einem der Ansprüche 11 - 21 oder nach einem Verfahren gemäß einem der Ansprüche 22 - 30, oder die Verwendung einer Zusammensetzung nach Anspruch 36 zur Herstellung von Pharmazeutika, Lebensmitteln, Futtermitteln, Lösungsmitteln, Färbemitteln und/oder Komponenten der Baustoff-Industrie, bevorzugt Zement oder Beton.
EP19752074.5A 2018-07-11 2019-06-29 D-xylose-dehydrogenase aus coryneformen bakterien und verfahren zur herstellung von d-xylonat Pending EP3820999A1 (de)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE102018005439 2018-07-11
PCT/DE2019/000173 WO2020011294A1 (de) 2018-07-11 2019-06-29 D-xylose-dehydrogenase aus coryneformen bakterien und verfahren zur herstellung von d-xylonat

Publications (1)

Publication Number Publication Date
EP3820999A1 true EP3820999A1 (de) 2021-05-19

Family

ID=67551463

Family Applications (1)

Application Number Title Priority Date Filing Date
EP19752074.5A Pending EP3820999A1 (de) 2018-07-11 2019-06-29 D-xylose-dehydrogenase aus coryneformen bakterien und verfahren zur herstellung von d-xylonat

Country Status (6)

Country Link
US (1) US12312608B2 (de)
EP (1) EP3820999A1 (de)
JP (1) JP7556793B2 (de)
CN (1) CN112585263A (de)
DE (1) DE112019003478A5 (de)
WO (1) WO2020011294A1 (de)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN120118815B (zh) * 2025-03-11 2026-04-03 湖北大学 用于生产木糖酸的运动发酵单胞菌工程菌株、其构建方法和应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1108790A2 (de) * 1999-12-16 2001-06-20 Kyowa Hakko Kogyo Co., Ltd. Neue Polynukleotide

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS5835197A (ja) 1981-08-26 1983-03-01 Kyowa Hakko Kogyo Co Ltd プラスミドpcg2
GB2165546B (en) 1984-08-21 1989-05-17 Asahi Chemical Ind A plasmid containing a gene for tetracycline resistance and dna fragments derived therefrom
DE4440118C1 (de) 1994-11-11 1995-11-09 Forschungszentrum Juelich Gmbh Die Genexpression in coryneformen Bakterien regulierende DNA
FI20095278A0 (fi) 2009-03-18 2009-03-18 Valtion Teknillinen Ksylonihapon valmistus
KR101447579B1 (ko) * 2012-09-26 2014-10-15 주식회사 디와이내츄럴 미생물을 이용한 d-카이로 이노시톨의 생산 방법
JP6221478B2 (ja) 2013-08-02 2017-11-01 三菱ケミカル株式会社 ペントース資化能を有する微生物を用いた有機化合物の製造方法
DE102016007810B4 (de) 2016-06-25 2023-12-07 Forschungszentrum Jülich GmbH Verfahren zur Herstellung von D-Xylonat
CN106967159B (zh) 2017-03-14 2020-10-13 莲花健康产业集团股份有限公司 iolT1和iolT2蛋白在木糖转运中的应用

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1108790A2 (de) * 1999-12-16 2001-06-20 Kyowa Hakko Kogyo Co., Ltd. Neue Polynukleotide

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BR�SSELER CHRISTIAN ET AL: "The myo-inositol/proton symporter IolT1 contributes to d-xylose uptake in Corynebacterium glutamicum", BIORESOURCE TECHNOLOGY, vol. 249, 1 February 2018 (2018-02-01), AMSTERDAM, NL, pages 953 - 961, XP093348668, ISSN: 0960-8524, DOI: 10.1016/j.biortech.2017.10.098 *
CHOI JAE WOONG ET AL: "Development of a high-copy-number plasmid via adaptive laboratory evolution ofCorynebacterium glutamicum", APPLIED MICROBIOLOGY AND BIOTECHNOLOGY, SPRINGER BERLIN HEIDELBERG, BERLIN/HEIDELBERG, vol. 102, no. 2, 25 November 2017 (2017-11-25), pages 873 - 883, XP036396517, ISSN: 0175-7598, [retrieved on 20171125], DOI: 10.1007/S00253-017-8653-2 *
RADEK ANDREAS ET AL: "Engineering ofCorynebacterium glutamicumfor minimized carbon loss during utilization ofd-xylose containing substrates", JOURNAL OF BIOTECHNOLOGY, ELSEVIER, AMSTERDAM NL, vol. 192, 7 October 2014 (2014-10-07), pages 156 - 160, XP029104817, ISSN: 0168-1656, DOI: 10.1016/J.JBIOTEC.2014.09.026 *
See also references of WO2020011294A1 *

Also Published As

Publication number Publication date
CN112585263A (zh) 2021-03-30
US20210292716A1 (en) 2021-09-23
DE112019003478A5 (de) 2021-04-08
US12312608B2 (en) 2025-05-27
JP7556793B2 (ja) 2024-09-26
WO2020011294A1 (de) 2020-01-16
JP2021524262A (ja) 2021-09-13

Similar Documents

Publication Publication Date Title
EP2041276B1 (de) Verfahren zur herstellung von l-aminosäuren mittels mutanten des glta-gens kodierend für citratsynthase
EP1094111B1 (de) Coryneforme Bakterien mit einer Deletion der Phosphoenolpyruvat-Carboxykinase und ihre Verwendung
DE102010003419B4 (de) Verfahren zur fermentativen Herstellung von L-Ornithin
EP1067192B1 (de) L-Lysin produzierende coryneforme Bakterien und Verfahren zur Herstellung von L-Lysin
DE60030988T2 (de) Verfahren zur Herstellung Von L-Aminosäuren durch Erhöhung des zellulären NADPH
WO2007039532A2 (de) Verfahren zur fermentativen herstellung von l-aminosäuren unter verwendung coryneformer bakterien, die in der lage sind, glycerin als alleinige kohlenstoffquelle zu nutzen
DE102004013503A1 (de) Verfahren zur Herstellung von L-Aminosäuren unter Verwendung coryneformer Bakterien
WO2003093490A1 (de) Verfahren zur mikrobiellen herstellung von aromatischen aminosäuren und anderen metaboliten des aromatischen aminosäurebiosyntheseweges
EP2089525B1 (de) Allele des oxyr-gens aus coryneformen bakterien
DE10112992A1 (de) Verfahren zur fermentativen Herstellung von L-Aminosäuren unter Verwendung coryneformer Bakterien
CN112646767B (zh) 具有增强的l-谷氨酸生产力的菌株及其构建方法与应用
DE102016007810B4 (de) Verfahren zur Herstellung von D-Xylonat
EP4389881A1 (de) Genetisch modifizierter mikroorganismus und dessen verwendung zur herstellung von d-chiro-inositol
DE60312592T2 (de) Verfahren zur Herstellung von L-Lysin unter Verwendung Coryneformer Bakterien die ein attenuiertes Malat Enzym-gen enthalten
DE102004009454A1 (de) Verfahren zur fermentativen Herstellung von L-Aminosäuren unter Verwendung von rekombinanten Mikroorganismen
DE10117816A1 (de) Verfahren zur fermentativen Herstellung von L-Aminosäuren unter Verwendung coryneformer Bakterien
WO2020011294A1 (de) D-xylose-dehydrogenase aus coryneformen bakterien und verfahren zur herstellung von d-xylonat
DE10144493A1 (de) Verfahren zur fermentativen Herstellung von L-Aminosäuren unter Verwendung coyneformer Bakterien
EP1924694B1 (de) Verfahren zur produktion von aminosäuren mit mikroorganismen
EP1259622B1 (de) Nukleotidsequenzen kodierend fur proteine beteiligt an der biosynthese von l-serin, verbessertes verfahren zur mikrobiellen herstellung von l-serin sowie ein dazu geeigneter genetisch veranderter mikroorganismus
CN112538491B (zh) 一种基于yh66_08550基因的产l-异亮氨酸的重组菌株及其构建方法与应用
DE19953809A1 (de) Verfahren zur fermentativen Herstellung von L-Lysin unter Verwendung coryneformer Bakterien
WO2022161569A1 (de) Herstellung von 3,4-dihydroxybenzoat aus d-xylose mit coryneformen bakterien
DE10139062A1 (de) Verfahren zur fermentativen Herstellung von L-Aminosäuren unter Verwendung coryneformer Bakterien
DE10220574A1 (de) Verfahren zur Herstellung von Aminosäuren mit coryneformen Bakterien unter Verwendung von Phosphoglucose-Isomerasen aus coryneformen Bakterien

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20201214

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

17Q First examination report despatched

Effective date: 20221222