EP3268467A1 - Verfahren zur mikrobiellen de novo synthese von terpenen - Google Patents

Verfahren zur mikrobiellen de novo synthese von terpenen

Info

Publication number
EP3268467A1
EP3268467A1 EP16710137.7A EP16710137A EP3268467A1 EP 3268467 A1 EP3268467 A1 EP 3268467A1 EP 16710137 A EP16710137 A EP 16710137A EP 3268467 A1 EP3268467 A1 EP 3268467A1
Authority
EP
European Patent Office
Prior art keywords
synthase
seq
bacterium
heterologous
methanol
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP16710137.7A
Other languages
English (en)
French (fr)
Inventor
Jens Schrader
Markus Buchhaupt
Frank Sonntag
Cora KRONER
Heike Brueser
Hartwig Schroeder
Ralf Pelzer
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
BASF SE
Original Assignee
BASF SE
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by BASF SE filed Critical BASF SE
Publication of EP3268467A1 publication Critical patent/EP3268467A1/de
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P5/00—Preparation of hydrocarbons or halogenated hydrocarbons
    • C12P5/007—Preparation of hydrocarbons or halogenated hydrocarbons containing one or more isoprene units, i.e. terpenes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1229—Phosphotransferases with a phosphate group as acceptor (2.7.4)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90—Isomerases (5.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01034—Hydroxymethylglutaryl-CoA reductase (NADPH) (1.1.1.34)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y203/00—Acyltransferases (2.3)
    • C12Y203/03—Acyl groups converted into alkyl on transfer (2.3.3)
    • C12Y203/0301—Hydroxymethylglutaryl-CoA synthase (2.3.3.10)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y205/00—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5)
    • C12Y205/01—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5) transferring alkyl or aryl groups, other than methyl groups (2.5.1)
    • C12Y205/0101—(2E,6E)-Farnesyl diphosphate synthase (2.5.1.10), i.e. geranyltranstransferase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
    • C12Y207/01036—Mevalonate kinase (2.7.1.36)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/04—Phosphotransferases with a phosphate group as acceptor (2.7.4)
    • C12Y207/04002—Phosphomevalonate kinase (2.7.4.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/01—Carboxy-lyases (4.1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/01—Carboxy-lyases (4.1.1)
    • C12Y401/01033—Diphosphomevalonate decarboxylase (4.1.1.33), i.e. mevalonate-pyrophosphate decarboxylase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y402/00—Carbon-oxygen lyases (4.2)
    • C12Y402/03—Carbon-oxygen lyases (4.2) acting on phosphates (4.2.3)
    • C12Y402/03104—Alpha-humulene synthase (4.2.3.104)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y503/00—Intramolecular oxidoreductases (5.3)
    • C12Y503/03—Intramolecular oxidoreductases (5.3) transposing C=C bonds (5.3.3)
    • C12Y503/03002—Isopentenyl-diphosphate DELTA-isomerase (5.3.3.2)

Definitions

  • the invention relates to a methylotrophic bacterium, to a process for the microbial de novo synthesis of sesquiterpenes or diterpenes from methanol and / or ethanol, and to the use of the methylotrophic bacterium for the microbial de novo synthesis of
  • the invention relates to the field of white
  • Microorganisms such as Escherichia coli or Saccharomyces cerevisiae have been described (Martin et al., 2003, Nature biotechnology 21, 796-802, Asadoilahi et al., 2008, Biotechnology and
  • terpenes in particular amorpha-4,1-dienes, or
  • acetoacetyl-CoA synthase acetoacetyl-CoA thiolase
  • various intermediates of the mevalonate pathway became the medium added.
  • An alternative source of carbon for fermentation is not suggested.
  • US 201 1/0229958 A1 shows microorganisms for the production of isoprene compounds in E. coli. Heterologous expression of an acetoacetyl-CoA synthase (acetoacetyl-CoA thiolase) is again required and mevalonate was added to the medium. An inexpensive alternative carbon source for fermentation is not proposed.
  • the source of carbon is an unspecified sugar.
  • An alternative carbon source for fermentation is not mentioned.
  • bacteria are to be provided which enable a microbial de novo synthesis of terpenes from an alternative carbon source.
  • the bacteria should be able to grow on the alternative carbon source as the only source of carbon, and in particular it should not be necessary to add expensive substrate additives, such as acetoacetate or D, L-mevalonate.
  • a fermentation process for the microbial de novo synthesis of terpenes from an alternative carbon source is to be provided, which enables a simple downstream purification of the recovered terpene products.
  • sesquiterpenes and diterpenes should be producible with high yield.
  • the conversion and yield of the process in both the shake flask and in the fermenter during up-scaling for biotechnological application should be promising or sufficient.
  • a first embodiment of the invention relates to a methylotrophic bacterium comprising recombinant DNA coding for at least one polypeptide having enzymatic activity Expression in said bacterium, wherein said at least one polypeptide having enzymatic activity is selected from the group consisting of
  • At least one enzyme of a heterologous mevalonate pathway selected from the group consisting of hydroxymethylglutaryl-CoA synthase (HMG-CoA synthase),
  • HMG-CoA reductase Hydroxymethylglutaryl-CoA reductase
  • mevalonate kinase mevalonate kinase
  • the invention also relates to a methylotrophic bacterium comprising a heterogeneous terpene synthase and recombinant DNA encoding at least one polypeptide having enzymatic activity for expression in said bacterium, characterized in that said at least one polypeptide having enzymatic activity is selected from the group consisting of
  • At least one enzyme of a heterologous mevalonate pathway selected from the group consisting of hydroxymethylglutaryl-CoA synthase (HMG-CoA synthase),
  • HMG-CoA reductase Hydroxymethylglutaryl-CoA reductase
  • mevalonate kinase mevalonate kinase
  • phosphomevalonate kinase phosphomevalonate decarboxylase
  • the invention also relates to a methylotrophic bacterium comprising a heterologous hydroxymethylglutaryl-CoA synthase (HMG-CoA synthase) and a hydroxymethylglutaryl-CoA reductase (HMG-CoA reductase) as enzymes of a heterologous mevalonate pathway and recombinant DNA coding for at least one polypeptide having enzymatic activity for expression in said bacterium, characterized in that said at least one polypeptide having enzymatic activity is selected from the group consisting of
  • At least one further enzyme of a heterologous mevalonate pathway selected from the group consisting of mevalonate kinase, phosphomevalonate kinase,
  • the bacterium according to the invention particularly preferably has at least the following enzymes: heterologous hydroxymethylglutary! CoA synthase (HMG-CoA synthase) and
  • HMG CoA reductase Hydroxymethyl glutaryl CoA reductase
  • the bacterium additionally comprises a synthase of a prenyl diphosphate precursor.
  • heterologous is to be understood as meaning an enzyme or a group of enzymes, for example those of the mevalonate pathway, which naturally do not occur in an organism which should now have the enzyme or the group of enzymes according to the invention
  • the heteroioge terpene synthase or the enzymes of the heterologous mevalonate pathway does not occur in the methylotrophic bacterium according to the invention, but originate from one or more other species.
  • the bacterium according to the invention surprisingly enables a microbial de novo synthesis of terpenes from an alternative carbon source, such as methanol and / or ethanol.
  • the said bacterium can grow in heterologously expressed enzymes of the otherwise naturally occurring in this bacterium mevalonate pathway (MVA way) on methanol and / or ethanol as the sole Kohlenstoffqueile and synthesize desired terpenes de novo with high yield.
  • a special feature of the methylotrophic bacterium used is the presence of the molecule acetoacetyl-CoA in Primärstoffwechsei, here the ethylmalonyl-CoA pathway
  • the bacterium of the invention surprisingly with at least one heterologously expressed enzyme of the otherwise naturally occurring in this bacterium mevalonate on methanol and / or ethanol. Furthermore, the presence of the molecule acetoacetyl-CoA in Primärstoffwechsei makes a heteroioge expression of acetoacetyl-CoA synthase superfluous. According to a further preferred modification of the invention, the
  • methylotrophic bacterium no recombinant DNA coding for a heteroioge expression of acetoacetyl-CoA synthase (acetoacetyl-CoA-thiolase) on.
  • the synthase of a prenyl diphosphate precursor in the context of the present invention converts in particular isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP) enzymatically to a prenyl diphosphate precursor, wherein the prenyl diphosphate precursor is preferably selected from the group consisting of farnesyl diphosphate (FPP) (C15) and geranylgeranyl diphosphate (GGPP) (C20) -
  • the formed acyclic prenyl diphosphates (synonymous here with isoprenyl diphosphates) - FPP and GGPP - are the precursors of a variety of terpenes.
  • the substrates of the heterologous terpene synthase are preferably from the prenyidiphosphate precursors mentioned
  • the inventive bacterium comprises recombinant DNA encoding polypeptides having enzymatic activity for heterologous expression in said bacterium, said polypeptides having enzymatic activity comprising the following enzymes:
  • MVA pathway the enzymes of a heterologous Mevaionatweges (MVA pathway), namely hydroxymethyl glutaryl-CoA synthase (HMG-CoA synthase), hydroxymethylglutaryl-CoA reductase (HMG-CoA reductase), evalonate kinase, phosphomevalonate kinase,
  • HMG-CoA synthase hydroxymethyl glutaryl-CoA synthase
  • HMG-CoA reductase hydroxymethylglutaryl-CoA reductase
  • evalonate kinase phosphomevalonate kinase
  • a preferred bacterium according to the invention is characterized in that the at least one enzyme of the heterologous virionate pathway - namely an enzyme selected from the group consisting of hydroxymethylglutaryl-CoA synthase (HMG-CoA synthase), hydroxymethylglutaryl-CoA reductase (HMG) CoA reductase), mevalonate kinase,
  • HMG-CoA synthase hydroxymethylglutaryl-CoA synthase
  • HMG hydroxymethylglutaryl-CoA reductase
  • mevalonate kinase mevalonate kinase
  • Isopentenylpyrophosphate isomerase has a peptide sequence with an identity of at least 60% to the peptide sequence according to SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5 or SEQ ID NO. 6 or is encoded by a nucleic acid sequence which is capable of hybridizing with the corresponding nucleic acid sequence coding for the specific peptide sequences under stringent hybridization conditions.
  • the enzymes which has a peptide sequence with an identity of at least 60% to the peptide sequence according to SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5 or SEQ ID NO. 6, it is preferred to understand that the enzymes have a peptide sequence which is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97% %, at least 98% or at least 99% is identical to one of the specific
  • Peptide sequence identity is typically determined using a sequence comparison algorithm. For this purpose, two sequences are compared with one another either over their entire length or over the length of a previously defined segment which makes up at least half of the amino acids of one of the two sequences. Within the comparison window, ie the range of the two sequences to be compared, the number of identical amino acids is determined at identical or comparable positions. For this purpose it may be necessary to introduce gaps in a sequence.
  • a Amino acid sequence particularly preferred with a known in the art
  • Algorithm can be performed, in particular with one of the following algorithms that are provided on the homepage of the NCBi: BLASTp, PS! -Blast, PHI-BLAST or DELTA-BLAST (see also Johnson 2008, Nucleic Acids Res 36 (Web Server issue ): W5-9, Boratyn 2012, Biol Direct. 17 (7): 12, Ye 2012, BMC Bioinformatics 13:13, Ye 2013, Nucleic Acids Res 41: (Web Server issue): W34-40; Marchler-Bauer 2009 , Nucleic Acids Res. 37
  • variants of the enzymes to be used according to the invention can be encoded by nucleic acid sequences which are capable of binding under stringent conditions with the nucleic acid sequences coding for the specific peptide sequences
  • Hybridization conditions to hybridize Stringent hybridization conditions in the sense of the present invention are described in Southern 1975, J. Mol. Biol. 98 (3): 503-517. Again, it will be understood that such variants of the enzymes are intended to have substantially the biological activity of the aforementioned enzymes having a specific peptide sequence.
  • a methyiotrophic bacterium comprises recombinant DNA encoding at least one polypeptide having enzymatic activity for heterologous expression in said bacterium, said polypeptides having enzymatic activity comprising the following enzymes:
  • VMA pathway a heterologous mevalonate pathway
  • H-MG-CoA synthase Hydroxymethylglyl-CoA synthase
  • HMG-CoA reductase hydroxymethylglobutyl-CoA reductase
  • mevalonate kinase mevalonate kinase
  • phosphomevalonate kinase phosphomevalonate kinase
  • pyrophosphome valonate decarboxylase isopentenyl pyrophosphate isomerase
  • the enzymes a peptide sequence with an identity of at least 60% in each case to the peptide sequence according to SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5 or SEQ ID NO. 6 or are encoded by nucleic acid sequences capable of hybridizing with the corresponding nucleic acid sequences encoding the specific peptide sequences under stringent hybridization conditions.
  • the enzymes of the heterologous mevalonate pathway namely hydroxymethylglyl-CoA synthase (HMG-CoA synthase), hydroxymethylglutaryl-CoA reductase (HMG-CoA reductase), mevalonate kinase, phosphomevalonate Kinase, pyrophosphomevaionate decarboxylase and isopentenyl pyrophosphate isomerase, a peptide sequence each having at least 65% independently, at least 70%, at least 75%, optionally at least 80%, more preferably at least 85%, more preferably at least 90%, preferably at least 95%, more preferably at least 98%, and most preferably at least 99% to the peptide sequence SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO.
  • the enzymes of the heterologous mevalonate pathway are hydroxymethylglutaryl-CoA synthase (HMG-CoA synthase), hydroxymethyiglutaryl-CoA reductase (HMG-CoA synthase).
  • the recombinant DNA encoding said enzymes of the heterologous mevalonate pathway comprises the following polynucleotides each having at least 60%, at least 65%, at least 70%, at least 75%, optionally at least 80% identity %, in particular at least 85%, more particularly at least 90%, preferably at least 95%, more preferably at least 98% and particularly preferably at least 99% to one
  • nucleic acid sequence identity is hereby typically with a
  • Sequence comparison algorithm determined. For this purpose, two sequences are compared with one another either over their entire length or over the length of a previously defined segment which makes up at least half of the nucleotides of one of the two sequences. Within the comparison window, i. of the region of the two sequences to be compared, the number of identical nucleotides is determined at identical or comparable positions. For this purpose it may be necessary to introduce gaps in a sequence.
  • an amino acid sequence is particularly preferably with a known in the art
  • Algorithm can be performed, in particular with one of the following algorithms that are provided on the homepage of the NCBI: BLASTn, megablast or
  • the polynucleotides used according to the invention are the genes hmgs (SEQ ID No. 7), hmgr (SEQ ID No. 8), mvaK1 (SEQ ID No. 9), mvaK2 (SEQ ID No. 10), mvaD (SEQ ID NO: 11) and fni (SEQ ID NO.12) from Myxococcus xanthus.
  • the enzymes of the heterologous mevalonate pathway of a bacterium according to this embodiment have the peptide sequences according to SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5 or SEQ ID NO. 6 on.
  • prokaryotic MVA genes in particular from Myxococcus xanthus, has advantages.
  • the comparable GC content such as from Myxococcus xanthus of about 70%, results in a very good Codon Adaptation Indices (CAI), for example between about 0.7 and about 0.9, for the MVA genes.
  • CAI Codon Adaptation Indices
  • the recombinant DNA coding for the said enzymes of the heterologous mevalonate pathway is arranged in a single operon. This allows better co-regulation of expression using a single promoter. If necessary, further heterologous genes can be integrated into such an operon.
  • Mevalonate pathway synonymous here with MVA genes called.
  • the ribosome binding site (RBS) of at least one of said MVA genes is optimized with regard to translation initiation for heterologous expression in the bacterium.
  • the RBS of the gene is for the heterologous
  • Isopentenyl pyrophosphate isomerase optimized for translational initiation Such an RBS-optimized variant of the gene, in particular of the gene fni from Myxococcus xanthus, has a TIR (translation initiation rate according to Salis 2011) of 50 to 200,000, preferably 50 to 100,000, particularly preferably 50,000 to 100,000.
  • TIR translation initiation rate according to Salis 2011
  • the RBS of the gene is for the heterologous
  • HMG-CoA synthase Hydroxymethylglutaryl-CoA synthase
  • Such an RBS-optimized variant of the gene in particular the gene hmgs from Myxococcus xanthus, has a TIR of 50 to 100,000, preferably from 50 to 50,000, particularly preferably from 1,000 to 50,000.
  • the recombinant DNA of the bacterium further encodes for at least one heterologous terpene synthase, wherein the
  • Terpene synthase is selected from the group consisting of a sesquiterpene synthase and terpene synthase. It can be seen that the sesquiterpenes or diterpenes formed by said terpene synthases are biotechnologically valuable products.
  • the at least one heterologous terpene synthase is a sesquiterpene synthase.
  • the sesquiterpene synthase is preferably an enzyme for the synthesis of a cyclic sesquiterpene, the sesquiterpenes being in particular selected from the group consisting of ⁇ -humulene, various sainalene epimers, such as ⁇ -santalen, ⁇ -santalen, epi- ⁇ -santalen or ⁇ exo-bergamot, and bisabolene, such as ß-bisabolene.
  • the sesquiterpene synthase is more preferably an ⁇ -humulene synthase or a santalen synthase. It should be noted that in particular the salen synthase has a very broad product spectrum and thus a wide variety of different sesquiterpene of Santa! En type is available.
  • the sesquiterpene synthase is preferably a plant sesquiterpene synthase
  • the sesquiterpene synthase is an enzyme from an organism, wherein the organism is selected from the group consisting of the genus Zingiber and Santaium. Sesquiterpene synthases from other organisms may also be used if appropriate.
  • the sesquiterpene synthase according to a further aspect comprises a peptide sequence having an identity of at least 60% to a polypeptide selected from the group consisting of a polypeptide of the peptide sequence according to SEQ ID NO. 15, a polypeptide of the
  • Sesquiterpene synthases within the meaning of the invention may also be enzymes having corresponding activity, which are encoded by polynucleotides comprising nucleic acid sequences which hybridize to a nucleotide sequence encoding one of the polypeptides of SEQ ID NO: 15, 45 or 46 under stringent hybridization conditions ,
  • the said peptide sequence of a sesquiterpene synthase furthermore preferably has an identity of at least 65%, at least 70%, at least 75%, optionally at least 80%, in particular at least 85%, more particularly at least 90%, preferably at least 95%, more preferably at least 98 % and more preferably at least 99%, to a polypeptide selected from the group consisting of a polypeptide of the peptide sequence according to SEQ ID NO. 5, a polypeptide of the peptide sequence according to SEQ ID NO. 45 and a polypeptide of the peptide sequence according to SEQ ID NO. 46th
  • the sesquiterpene synthase is an enzyme comprising a polypeptide with corresponding activity from Zingibe rzerumbet, Santaium album or Santaium spicatum.
  • the sesquiterpene synthase is in particular the ⁇ -humulene synthase from Zingiber zerumbet which comprises a polypeptide according to the peptide sequence according to SEQ ID NO. 15 has.
  • the ⁇ -humule synthase which is a polypeptide according to the peptide sequence according to SEQ ID NO. 15, comprising a recombinant DNA comprising a polynucleotide having a nucleic acid sequence according to SEQ ID NO. 16 coded.
  • sesquiterpene synthase is, in particular, the Santalene synthase SsaSSy from Santalum album, which contains a polypeptide according to the peptide sequence according to SEQ ID NO. 45 has.
  • sesquiterpene synthase is preferably the santalen synthase SspiSSy from Santalum spicatum
  • the at least one heterologous terpene synthase is a diterpene synthase.
  • the diterpene synthase is preferably an enzyme for the synthesis of a diterpene, wherein the diterpene is selected from the group consisting of sclareol, cis-abienol, abitadiene, isopimaradiene, manool and larixol.
  • the diterpene synthase of plant origin is in particular from the genera Salvia or Abies.
  • the diterpene synthase according to a further aspect comprises a peptide sequence with an identity of at least 40% to a polypeptide of the peptide sequence according to SEQ ID NO. 47th
  • Diterpene synthases within the meaning of the invention may also be enzymes having corresponding activity, which are encoded by polynucleotides comprising nucleic acid sequences which hybridize to a nucleotide sequence encoding the polypeptide of SEQ ID NO: 47 under stringent hybridization conditions.
  • the said peptide sequence of a diterpene synthase further preferably has an identity of at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, optionally at least 80%, in particular at least 85%. , in particular at least 90%, preferably at least 95%, more preferably at least 98% and particularly preferably at least 99%, to a polypeptide of
  • the diterpene synthase is further preferably selected from the group consisting of the two monofunctional type I and type II diterpene synthases SsLPS, the salvia sclarea LPP synthase and SsSCS, the S.
  • diterpene synthase is, in particular, the bifunctional type I / type II diterpene synthase cis-abienol synthase AbCAS from Abies baisamea, which comprises a polypeptide according to the peptide sequence according to SEQ ID NO. 47 has.
  • cis-abienol synthase of a M. extorquens AM1 codon optimized polynucleotide most preferably from a polynucleotide having a sequence with SEQ ID NO: 50.
  • the prenyl diphosphate precursors - such as FPP or GGPP - form the respective substrates of terpene synthases.
  • the appropriate synthase must be selected to provide the appropriate prenyl diphosphate precursor.
  • the RBS of the gene for sesquiterpene synthase is optimized with regard to translation initiation.
  • Such an RBS-optimized variant of the gene has a TIR (translation initiation rate) of at least 50,000, in particular 50,000 to 400,000, preferably from 200,000 to 300,000, particularly preferably 210,000 to 250,000.
  • the bacterium according to a further embodiment in addition to the recombinant DNA encoding at least one enzyme of a heterologous mevalonate pathway, further comprises recombinant DNA encoding at least one prenyl diphosphate precursor synthase as needed.
  • the synthase of a prenyl diphosphate precursor is either an endogenous or a heterologous enzyme.
  • the gene coding therefor is preferably overexpressible with the aid of a suitable promoter.
  • the bacterium in addition to the recombinant DNA, further comprises at least one enzyme of a heterologous mevalonate pathway
  • telomere sequence a sequence of amino acids in a prenyl diphosphate precursor.
  • a heterologous synthase of a prenyl diphosphate precursor may be expressible in addition to a corresponding endogenous enzyme.
  • the synthase of the prenyl diphosphate precursor is an enzyme selected from the group consisting of farnesyl diphosphate synthase (FPP synthase) and geranylgeranyl diphosphate synthase (GGPP synthase).
  • FPP synthase farnesyl diphosphate synthase
  • GGPP synthase geranylgeranyl diphosphate synthase
  • the prenyl diphosphate precursors formed by said synthases, FPP or GGPP are important precursor molecules for a synthesis of biotechnoiogically valuable sesquiterpenes or diterpenes.
  • the prenyl diphosphate precursor synthase is a heterologous FPP synthase, which may be a eukaryotic or prokaryotic heterologous FPP synthase.
  • the heterologous FPP synthase may be, for example, of bacterial origin or derived from a fungus.
  • the heterologous FPP synthase is in particular an enzyme from a fungus, preferably from a yeast, such as the genus Saccharomyces.
  • the FPP synthase according to a further aspect comprises a peptide sequence with an identity of at least 60% to the peptide sequence according to SEQ ID NO. 13.
  • the FPP synthase is in particular a eukaryotic FPP synthase.
  • FPP synthases within the meaning of the invention may also be enzymes having corresponding activity, which are encoded by polynucleotides comprising nucleic acid sequences which hybridize to a nucleotide sequence encoding the polypeptide of SEQ ID NO: 13 under stringent hybridization conditions.
  • the said peptide sequence of an FPP synthase according to a further embodiment preferably has an identity of at least 65%, at least 70%, at least 75%, optionally at least 80%, in particular at least 85%, more particularly at least 90%, preferably at least 95%, further preferably at least 98%, and more preferably at least 99%, to SEQ ID NO. 13 on.
  • the recombinant DNA coding for the FPP synthase comprises a polynucleotide having an identity of at least 60%, at least 65%, at least 70%, at least 75%, optionally at least 80%, in particular at least 85% , in particular at least 90%, preferably at least 95%, more preferably at least 98% and particularly preferably at least 99% to a nucleotide sequence according to SEQ ID NO 14.
  • the FPP synthase is preferably a FPP synthase from Saccharomyces cerevisiae. FPP synthases from other organisms may also be used if appropriate.
  • the FPP synthase is in particular the FPP synthase ERG20 from Saccharomyces cerevisiae, which is a polypeptide according to SEQ ID NO. 13 has.
  • the FPP synthase ERG20 from Saccharomyces cerevisiae comprising a polypeptide according to SEQ ID NO. 13 in particular from a Poiynukieotid with a sequence according to SEQ ID NO. 14 coded.
  • the synthase of a prenyl diphosphate precursor is a heterologous geranylgeranyl diphosphate synthase (GGPP synthase).
  • the heterologous GGPP synthase is in particular a corresponding enzyme from a bacterium, a plant or a fungus.
  • the GGPP synthase is an enzyme from an organism, wherein the organism is selected from the group consisting of a bacterium of the family Enterobacteriaceae, a plant of the genus Taxus and a fungus of the genus
  • Enterobacteriaceae may be, for example, corresponding enzymes from bacteria of the genus Pantoea.
  • the GGPP synthase according to a further aspect comprises a peptide sequence having a Identity of at least 60% to a polypeptide selected from the group consisting of a polypeptide of the peptide sequence of SEQ ID NO. 43, a polypeptide of
  • GGPP synthases within the meaning of the invention may also be enzymes having corresponding activity which are encoded by polynucleotides comprising nucleic acid sequences which hybridize to a nucleotide sequence encoding one of the polypeptides of SEQ ID NO: 43, 44 or 42 under stringent hybridization conditions ,
  • the said peptide sequence of a GGPP synthase further preferably has an identity of at least 65%, at least 70%, at least 75%, optionally at least 80%, in particular at least 85%, more particularly at least 90%, preferably at least 95%, more preferably at least 98 % and more preferably at least 99%, to a polypeptide selected from the group consisting of a polypeptide of the peptide sequence according to SEQ ID NO. 43, a polypeptide of the peptide sequence according to SEQ ID NO. 44 and a polypeptide of the peptide sequence according to SEQ ID NO. 42nd
  • the GGPP synthase is an enzyme having a polypeptide with corresponding activity from Pantoea aggiomerans or Pantoea ananatis, Taxus canadensis or
  • GGPP synthase is an enzyme selected from the group consisting of GGPP synthase crtE from Pantoea aggiomerans
  • the RBS of the recombinant DNA ie the gene for the heterologous synthase of a prenyl diphosphate precursor, such as FPP or GGPP synthase, is optimized with regard to the initiation of transtation.
  • Such an RBS-optimized variant of the gene has a TIR (transiation initiation rate) of from 500 to 100,000, preferably from 10,000 to 50,000, particularly preferably from 20,000 to 40,000.
  • the RBS for the genes encoding the heterologous terpene synthase and the heterologous synthase of a prenyl diphosphate precursor are adapted such that the TIR value for the heterologous terpene synthase is higher than the TIR value for the heterologous synthase of a prenyl diphosphate precursor. This can prevent the accumulation of prenyl diphosphate precursors, possibly with toxic effects.
  • the recombinant DNA is codon-optimized for expression in the bacterium of the invention.
  • the gene encoding the heterologous terpene synthase is codon-optimized for the bacterium of the invention.
  • the recombinant DNA for FPP synthase encodes the ERG20 FPP synthase from Saccharomyces cerevisiae and encodes the recombinant DNA for the sesquiterpene synthase which zerumbet the ⁇ -humic synthase from zingiber.
  • the inducible promoters may be of different nature, so that they are independently adjustable.
  • all genes for expression of the enzymes mentioned here are provided with the same common inducible promoter.
  • Inducible promoter systems are known in principle to the person skilled in the art.
  • a very “dense" promoter system is used here, so that the expression of the recombinant genes can be targeted only at a desired time of cultivation
  • a particularly "dense" promoter system is advantageous since otherwise growth-influencing effects may occur.A particular preference is given to a cumate-inducible system.
  • the recombinant DNA is plasmid-expressing or chromosomally expressible. This too can be configured differently for the respective genes. Suitable chromosomal sites and techniques for stable integration into the genome are known to those skilled in the art.
  • suitable plasmids with the recombinant DNA are introduced into the bacterium by transformation.
  • the bacterium of the invention is thus preferably by transformation with one or more plasmid (s), which (s) the corresponding
  • the bacterium according to the invention comprises at least one plasmid introduced by transformation, wherein the at least one plasmid comprises the following recombinant DNA:
  • Recombinant DNA encoding at least one enzyme of a heterologous mevalonate pathway as mentioned above, wherein the enzyme of the mevalonate pathway is selected from the group consisting of hydroxymethylglutaryl-CoA synthase (HMG-CoA synthase), hydroxymethylglutaryl-CoA reductase (HMG-CoA Reductase), mevalonate Kinase, phosphomevaionate kinase, pyrophosphome valonate decarboxylase and isopentenyl pyrophosphate isomerase;
  • HMG-CoA synthase hydroxymethylglutaryl-CoA synthase
  • HMG-CoA Reductase hydroxymethylglutaryl-CoA reductase
  • mevalonate Kinase phosphomevaionate kinase
  • pyrophosphome valonate decarboxylase pyrophosphome valonate decarboxylase
  • the methy! Otrophic bacterium in the sense of the present invention is in particular a proteobacterium.
  • a preferred methylotrophic proteobacterium is selected from the genera Methylobacterium and Methylomonas.
  • the methylotrophic proteobacterium is a strain of the genus Methylobacterium, in particular a strain of Methylobacterium extorquens. Particularly preferred is the strain Methylobacterium extorquens AM1 or the strain Methylobacterium extorquens PA1.
  • a strain of the methylotrophic bacterium in particular of the genera Methylobacterium and Methylomonas, preferably of Methylobacterium extorquens AM1 or PA1, with no carotenoid biosynthesis activity, preferably with a defect in the gene crtNb (diapolycopene oxidase) (Van Dien et al., 2003, Appl Environ Microbiol 69, 7563-6.).
  • Such a strain has no carotenoid biosynthesis activity, in particular lacks a diapolycopin oxidase activity. This makes it possible to further improve the terpene synthesis rate.
  • a further aspect of the present invention relates to a process for the microbial de novo synthesis of sesquiterpenes or diterpenes from methanol and / or ethanol, comprising the following steps:
  • a methanol and / or ethanol-containing aqueous medium culturing a methylotrophic bacterium according to one of the above-described embodiments in said medium in a bioreactor, wherein methanol and / or ethanol is converted by the bacterium to a terpene,
  • the aqueous medium used may comprise methanol, ethanol or a mixture of methanol and ethanol. If necessary, additional substrates can be added. It may be advantageous that only methanol or ethanol is contained in the aqueous medium, ie the microbial de novo synthesis of sesquiterpenes or diterpenes takes place either from methanol or from ethanol.
  • methanol can be produced both from petrochemical and renewable raw materials or, in the future, even from CO2. There are neither seasonal (weather and season) nor regional
  • Methanol and ethanol meet these requirements better than carbon from sugars.
  • the use of methanol / ethanol is more advantageous for the production of terpenes than from Kohlenhdyraten.
  • the use of ethanol also has numerous advantages: For example, ethanol is available from biomass fermentation, ie bioethanol, as a "natural" substrate.
  • the bacteria according to the invention grow both on methanol and on ethanol as the sole carbon source.
  • methanol and / or ethanol is contained in the medium mentioned as the sole carbon source for the cultivation of said bacterium. This is understood to mean in particular that no further Kohienstoffqueile is purposefully added to the medium or contained in larger proportions. It can be seen that traces of other carbon sources are not always avoidable and may be included without departing from the scope of said inventive development of the method.
  • a methanol- and / or ethanol-limited fed-batch fermentation is carried out.
  • an accompanying separation of the sesquiterpene or diterpene from the bioreactor ie in particular an in-situ product removal (ISPR) takes place in the fermenter.
  • ISPR in-situ product removal
  • ISPR In-process product removal
  • the cultivation takes place in an aqueous-organic two-phase system, wherein the organic phase is in particular formed by an aliphatic hydrocarbon compound, in particular an alkane, preferably dodecane or decane.
  • the terpenes formed have good solubility in said organic phase.
  • the cultivation is carried out at a substantially constant pH.
  • the process is carried out at a dissolved oxygen level of> 30% and / or a methanol or ethanol concentration of about 1 g / L.
  • Another aspect of the present invention relates to the use of a methanol or ethanol containing medium for cultivating a recombinant methylotrophic
  • the use of a methanol or ethanol minimal medium reduces the risk of contamination, since methanol and ethanol are toxic or growth-inhibiting for many microorganisms, as well as the expense of product processing, since no complex constituents have to be separated from the actual product.
  • sugar is not only glucose, the purification of which is regularly necessary to ensure yields, with cost of evaluation of an evaluated purification, (ii) an increase sugar prices in the next few years, whereas methanol and ethanol prices
  • methanol and ethanol significantly reduce contamination risks compared to sugar-based fermentations, which reduces sterilization costs
  • methanol or ethanol Minimal medium contains no complex chemical compounds unlike medium containing glucose or other sugar sources (such as corn steep liquor or lignocellulose) as a carbon source, which
  • a suitable fermentation medium may, for example, have the following composition: water, methanol or ethanol and further components selected from the group consisting of PI PES, NaH 2 PO 4, K 2 HPO 4, MgCl 2, (NH 4) 2 SO 4, CaCl 2, sodium citrate, ZnSO 4, MnCl 2, FeSO 4, (4) 6 ⁇ 7 ⁇ 24, CuSO 4 and CoCl 2
  • a further increase in terpene formation can be achieved by blocking the carotenoid synthesis of the Proteobacterium used.
  • the said strains of the genus Methyiobacterium or of the genus Methytomonas with a lack of carotenoid biosynthesis activity, in particular with a lack of diapolycopin oxidase activity are advantageously used.
  • a maximum terpene concentration of more than 1.5 g / l, in particular of about 1.65 g / l, based in each case on the volume of the aqueous phase, can thus be achieved.
  • the previously mentioned mutant according to the invention of Methyiobacterium extorquens AM1 with a lack of carotenoid biosynthesis activity, in particular with a lack of diapolycopen oxidase activity, has increased terpene production.
  • Another aspect of the present invention relates to the use of a methylotrophic bacterium according to one of the embodiments described above for the microbial de novo synthesis of terpenes from methanol and / or ethanol
  • the terpenes formed by the process of the invention are selected from the Group consisting of sesquiterpenes (C 5) and terterpenes (C20).
  • sesquiterpenes in the sense of the method according to the invention are, on the one hand, sesquiterpenes. Accordingly, the biotechnologically interesting sesquiterpenes include, for example
  • Bisabolenes, such as the ⁇ -bisabolene, are also sesquiterpenes, which are obtainable by the process according to the invention. Suitable sesquiterpene synthases are those skilled in the art
  • methylotrophic bacteria can thus be optionally equipped with the corresponding recombinant genes coding for the suitable sesquiterpene synthases.
  • the methyiotrophic bacterium also has an FPP synthase in the above-mentioned sense; terpenes in the sense of the method according to the invention are, on the other hand, diterpenes.
  • diterpenes selected from the group consisting of sclareol, cis-abienol, abitadiene, isopimaradiene, manooi and larixol belong to the biotechnologically interesting diterpenes.
  • Suitable diterpene synthases are known in principle to the person skilled in the art.
  • the abovementioned methylotrophic bacteria can thus optionally be equipped with the corresponding recombinant genes coding for the appropriate diterpene synthases.
  • the methyiotrophic bacterium in addition to the heterologously expressed genes of the MVA pathway, also has a GGPP synthase in the above-mentioned sense.
  • the sesquiterpene is ⁇ -humulene of the formula I.
  • a bioreactor for the purposes of the present invention, any suitable vessel for
  • Cultivation of bacteria In the simplest case, this is understood as a shake flask. In particular, it refers to a fermenter.
  • the bioreactor may be suitable for continuous operation, discontinuous operation, fed-batch operation or batch production.
  • Another aspect of the present invention relates to said sesquiterpenes (C15) and diterpenes (C20) obtainable by a process according to one of the illustrated embodiments.
  • a methylotrophic bacterium comprising recombinant DNA encoding at least one polypeptide having enzymatic activity for expression in said bacterium, characterized in that said at least one polypeptide having enzymatic activity is selected from the group consisting of
  • At least one enzyme of a heterologous mevalonate pathway selected from the group consisting of hydroxymethyl glutaryl-CoA synthase (H G-CoA synthase),
  • HMG-CoA reductase Hydroxymethylglutaryl-co-eductase
  • mevaionate kinase mevaionate kinase
  • heterologous terpene synthase is selected from the group consisting of a sesquiterpene synthase and a diterpene synthase.
  • the heterologous terpene synthase is a sesquiterpene synthase, wherein the sesquiterpene synthase is an enzyme for the synthesis of a cyclic sesquiterpene, the sesquiterpene is in particular selected from the group consisting of a-humulene and epimers of santalen, such as ⁇ -santalen, ⁇ -santalen, epi- ⁇ -santalen or ⁇ -exo-bergamotene, and bis-bisenes, such as b-bisabolites.
  • santalen such as ⁇ -santalen, ⁇ -santalen, epi- ⁇ -santalen or ⁇ -exo-bergamotene
  • bis-bisenes such as b-bisabolites.
  • heterologous terpene synthase is a diterpene synthase, in particular an enzyme for the synthesis of a diterpene, the diterpene in particular selected from the group consisting of sclareol, cis-abienol, abitadiene, isopimaradiene, manool and larixol.
  • FPP synthase farnesyl diphosphate synthase
  • GGPP synthase geranylgeranyl diphosphate synthase
  • the synthase of a prenyl diphosphate precursor is a heterologous GGPP synthase, wherein the heterologous GGPP synthase is an enzyme from an organism selected from the group consisting of bacteria, plants and fungi.
  • a method for the microbial de novo synthesis of sesquiterpenes or diterpenes from methanol and / or ethanol comprising the following steps:
  • a methanol and / or ethanol-containing aqueous medium culturing a methyiotrophic bacterium according to one of embodiments 1 to 12 in said medium in a bioreactor, wherein methanol and / or ethanol is converted by the bacterium to a terpene,
  • Methylobacterium extorquens A 1 including the endogenous terpene synthesis via the deoxyxyloxy-5-phosphate pathway (DXP), the heterologously integrated fermentation pathway (characterized by the two borders), a heterologous ⁇ -humulene Synthase zssl and a heterologous FPP synthase ERG20.
  • DXP deoxyxyloxy-5-phosphate pathway
  • M. extorquens has no IPP isomerase (fni).
  • the heterologously integrated MVA genes include hydroxymethylglutaryl-CoA synthase (hmgs), hydroxymethylglutaryl-CoA reductase (hmgr), mevalonate kinase (mvaK), phosphomevalonate kinase (mvaK2), pyrophosphome valonate decarboxylase (mvaD) and isopentenylpyrophosphate isomerase (fni).
  • dxs 1-deoxy-D-xylulose-5-phosphate synthase
  • dxr 1-deoxy-D-xylose-5-phosphate reductase
  • hrd HMB-PP reductase
  • ispA endogenous FPP synthase
  • Isopentenyl pyrophosphate GPP geranyl pyrophosphate, FPP: farnesyl pyrophosphate.
  • Fig. 2 shows a chromatographic comparison of ⁇ -humus standard (upper panel, black line) and a sample of M. extorquens comprising pFS33 (pCM80-zssl, upper panel, light gray line).
  • the internal standard Zerumbone elutes after 11.5 minutes.
  • a-humulene in the pFS33 sample was identified by comparison of the mass spectra presented under the chromatogram.
  • Fig. 3 shows the tolerance of Methylobacterium extorquens AM1 to ⁇ -humulene directly dissolved in the aqueous phase or dissolved in the dodecane phase as the second organic phase.
  • Maximum growth rates in appropriate medium without ⁇ -humulene (Mmax) are examples of Methylobacterium extorquens AM1 to ⁇ -humulene directly dissolved in the aqueous phase or dissolved in the dodecane phase as the second organic phase.
  • ⁇ -humulene in the dodecane phase has a slightly lower impact than in the aqueous phase because it has less contact with the cells.
  • FIG. 4 shows the ⁇ -humulen production of M. extorquens AM1 carrying the plasmids pFS33 (pCM80-zssl), pFS34 (pCM80-zssl-ERG20), pFS45 (pHC1 15-zssi), pFS46 (pHC115-zssl-ERG20), pFS49 (pQ2148F-zssl) and pFS50 (pQ2148F-zssl-ERG20). Black bars show the production without induction, whereas the gray bars represent the induction production.
  • pCM80 carries a constitutive promoter. Concentrations were compared 48 hours after culture (pFS33, 34) and after induction (pFS45, 46, 49, 50, respectively);
  • FIG. 5 shows the ⁇ -humulene production of M. extorquens carrying the plasmids with optimized ribosome binding sites (RBS) for ⁇ -humoral synthase (zssl), FPP- Synthase (ERG20) and IPP isomerase (fni) in various combinations.
  • RBS ribosome binding sites
  • zssl ⁇ -humoral synthase
  • FPP- Synthase FPP- Synthase
  • fni IPP isomerase
  • Black bars plasmids (pFS49, pFS57) containing only zssl hatched bars: plasmids (pFS50, pFS58, pFS60a, pFS60b) containing zssl and ERG20, gray bars: plasmids (pFS61b, pFS62a, pFS62b) containing zssl, ERG20 and the six genes of the mevalonate pathway.
  • B a- Humans production of M.
  • Fig. 7 Cell dry weight and formed ⁇ -humulene concentration of the strain CM502 carrying pFS62b in fermentation 5 (according to Table 3). Time 0 gives the
  • Standard deviations of the ⁇ -humulen concentrations were determined from the same sample by three times analysis. Black squares: ⁇ -humulene concentration, gray circles: cell dry weight.
  • Fig. 8 shows the chromatographic comparison of cis-abienol standard (upper panel, labeled line) and a sample of. extorquens comprising ppjo16 (pQ2148F-AbCAS-ERG20F96C-MVA, upper panel, labeled line).
  • the internal standard Zerumbon elutes after 11, 3 minutes.
  • Cis-abienol in the 6s6 sample was identified by comparison of the assensus spectra presented under the chromatogram.
  • Example 1 Recombinant ⁇ -humulen preparation. Material and Methods 1.1 Chemicals, media and bacterial strains
  • Methylobacterium extorquens AM1 (Peel and Quayle, 1961. Biochem J. 81, 465-9) was cultured at 30 ° C in minimal media using the media described by Kiefer et al., 2009 (PLoS ONE.4, e7831 ) has been used.
  • the fermentation medium contains a final concentration of 30 mM PIPES, 1, 45 mM NaH 2 PO 4 , 1, 88 mM K 2 HPO 4 , 1, 5 mM MgCl 2 , 1, 36 mM (NH 4 ) 2 S0 4 , 20 ⁇ C CaCl 2, 45.6 ⁇ sodium citrate (Na 3 C 6 H 5 0 7 * 2H 2 0), 8.7 ⁇ ZnS0 4 * 7H 2 0, 15.2 ⁇ MnCl 2 * 4H 2 0, 36 ⁇ FeS0 4 * 7H 2 0 , 1 ⁇ (NH 4 ) B Mo 7 0 24 * 4H 2 0, 0.3 ⁇ CuS0 4 * 5H 2 0 and 12.6 ⁇ CoCl 2 * 6H 2 0.
  • Escherichia coli strain DH5D (Gibco-BRL, Rockville, USA) was cultured in lysogeny broth (LB) medium (Bertani, 1951. J. Bacteriol., 62, 293-300) at 37X. Tetracycline hydrochloride was used in concentration 0 pg / ml for E. coli and M. extorquens. Cumate (4-isopropylbenzoic acid) was used as an inducer at a final concentration of 100 ⁇ diluted from a 100 mM stock solution dissolved in ethanol (shake-flask culture) or methanol (bioreactor culture).
  • Ribosome binding sites were designed using the ribosome binding site calculator (Salis, 201 1, Methods in Enzymology, ed V. Christopher, 19-42, Academic Press).
  • the codon adaptation index (CAl) was determined by the CAI calculator (Puigbo et al., 2008, BMC Bioinformatics, 9, 65).
  • MVA Mevalonate Pathway
  • telomere sequence was used as a "mega" primer along with HMGS-fw and HMGS-rev for the final amplification of hmgs (SEQ ID NO 7) without the coRI restriction fragment.
  • the mevalonate pathway operon of M was used as a "mega" primer along with HMGS-fw and HMGS-rev for the final amplification of hmgs (SEQ ID NO 7) without the coRI restriction fragment.
  • xanthus having the genes hmgr (SEQ ID NO 8), mvaKI (SEQ ID NO 9), mvaKZ (SEQ ID NO 10), mvsD (SEQ ID NO 11) and fni (SEQ ID NO 12) encoding HMG-CoA reductase, mevalonate kinase, phosphomevalonate kinase, pyrophosphome-valonate reductase and isopentenyl pyrophosphate isomerase, respectively-was isolated from the plasmid pUC18-mva-op (Mi et al., 2014, Microbial cel! Factories 13, 170).
  • primers pQF-MCS-fw and pQF-MCS-rev were annealed by heating 100 ⁇ annealing buffer (10 mM TRIS pH 7.5, 50 mM NaCl, 1 mM EDTA) containing 10 ⁇ each of primers for 15 min followed by slow cooling
  • the assembled primers were ligated into pQ2148 which was cut with SpeI and Xh resulting in plasmid pQ2148F.
  • the ⁇ -humulen synthase gene zss1 originally derived from Z / ngiberzerumbet (Yu et al., 2008, Planta. 227, 1291-9) (Accession number AB263736.1), was codon-optimized for M. extorquens AM1
  • the DNA sequence according to SEQ ID NO 16 was obtained.
  • the codon-optimized gene according to SEQ ID NO 16 was confirmed for insertion into pCM80 (Marx and Lidstrom, 2001, Microbiology. 147, 2065-2075) and pHC1 15 (Chou and Marx , 2012, Ceti reports.1, 133-40) using primers ZSSi-fw and ZSSI-rev.
  • TIR translation initiation rate
  • pQ2148F was amplified using primers ZSSI-RBS-fw and ZSSI-rev.
  • the RBS-optimized variant of zssl with a TIR of 221 .625 has the nucleic acid sequence AGCTTAAGGATAAAGAAGGAGGTAAAAC (SEQ ID NO 41).
  • the gene for the FPP synthase ERG20 from Saccharomyces cerevisiae was amplified from genomic DNA with the primers ERG20-fw and ERG20-rev.
  • RBS-optimized variants were amplified with primers ERG20-RBS35k-fw or ERG20-RBS20k-fw in combination with ERG20-rev-2 resulting in two ERG20 PCR products, each having an RBS with a TIR of 36,800 or 22,000.
  • the RBS-optimized variant of ERG20 with a TIR of 22,000 has the nucleic acid sequence
  • the RBS-optimized variant of ERG20 with a TIR of 36,800 has the nucleic acid sequence
  • Operon was excised from pUC18-mva-op with BamH'l and EcoRI and re-inserted into pFS34-bmgs alike digested resulting in pFS44.
  • the plasmids pFS45 (1 pHC 15 zssl) pFS46 (PHC1 5-zssl-ERG20) and pFS47 (PHC1 15 zssl- ERG20- 7mö i s-MVAop) were constructed by cutting out ZSSI from pFS33 by zssl- ERG20 from pFS34 and zssl-ERG20- / 7 / 77ö's MVAop from pFS44 with AM and EccR followed by their insertion into similarly digested pHC1 15,
  • Plasmids pFS49 (pQ2148F-zssl) and pFS50 (pQ2148F-zssl-ERG20) were constructed by excising zssi and zssl-ERG20 with A ⁇ and Xba ⁇ from pFS33 and pFS34, respectively, followed by their insertion into equally digested pQ2148F. Hrngs and VAop were excised from pFS44 by Xba ⁇ and EccR ⁇ and then inserted into the same
  • Insertion of hmgs V Aop into pFS60a and pFS60b resulted in plasmids pFS61 a (zssl RBS ° P t -ERG20 35k - / j / 775fs-MVAop) and pFS61b (zssl RBSi: i P t -ERG20 35k - 7/77, respectively) ⁇ s-MVAop).
  • the RBS of the IPP isomerase gene / fr / was optimized for pFS61a and pFS61b by insertion of initially assembled primers fni-RBSopt-fw and fni-RBSopt-rev (annealing method see above) in restriction sites Hpa ⁇ and BamM.
  • the resulting plasmids pFS62a and pFS62b have a TIR of 65,000 for the fh RBS.
  • the optimized RBS for the gene fni in this case has the nucleotide sequence gttctaggaggaataata (SEQ ID NO 48).
  • Plasmids pFS61 a and pFS61 b and pFS62a and pFS62b the nucleotide sequence SEQ ID NO 90 with a TIR of 189 on.
  • ERG20-RB ATC GTATCG ATACATCAAACC AAAGGACTTTACAG GTAGTAG
  • pUC18 expression vector for Escherichia coli, Amp R lacZ promoter, Norrander pBR322ori 1983 pACCRT plasmid, for the expression of diapophytoene synthase and Sandman MN desaturase in Escherichia coli, Amp R ; contains genes for n
  • pHC115 expression vector for Methyiobacterium extorquens with Cumat Chou inducible pmxaF promoter variant Kan R , OriT, pBR322ori 2012, Cell reports. 1 ,
  • Recovery plasmids were cultured in methanol containing minimal medium containing tetracycline hydrochloride (see above). Precultures were inoculated from agar plates in test tubes with 5 ml of medium and shaken for 48-72 h at 30 ° C and 180 rpm. Main cultures with 12 ml medium in 100 ml baffled shake flasks were inoculated with a preculture to a D of 0.1. After culturing for 16 h at 30 ° C and 120 rpm, the main cultures reached the early exponential growth phase (0,3 ⁇ 0.3-0.6). Cumate was then added for induction and 3 ml of dodecane added as the organic phase.
  • M. extorquens AM1 precultures were cultured in test tubes with 5 ml of methanol minimal medium (MM) for 48 h.
  • the tolerance of M. extorquens AM1 to 20% (v / v) dodecane was examined by growth comparison (ODeoo) of cultures containing 15 ml MM and cultures with 12 ml MM and 3 ml dodecane. Cultures for growth comparison with and without dodecane were inoculated from a preculture.
  • the ⁇ -human tolerance was tested in two ways: tolerance to ⁇ -humients added directly to the aqueous phase and tolerance to ⁇ -humants dissolved in the organic dodecane layer.
  • pure ⁇ -human dissolved in ethanol was added to 100 ml of vial shake flask containing 15 ml of MM with final concentrations of ⁇ -humates of 1000, 500, 250, 100, 50, 25, 10 and 5 mg / L. Appropriate amounts of ethanol were added to the MM as negative controls.
  • the flasks with the different ⁇ -human concentrations and the associated negative controls were inoculated with a preculture without ⁇ -humants to an ODeoo of 0.1. The ⁇ was recorded over 30 h.
  • Dodecane sample was dried with NaS0 4 .
  • 25 ⁇ M of 1 mM Zerumbon dissolved in dodecane was added to 225 ⁇ M Dodecan sample.
  • Intracellular ⁇ -humulen was extracted as follows: resuspended cell pellet was added to a 4 ml GC vessel along with about 300 mg of 0.2 mm glass beads. The lines were intensified geloud 3 x 30 s with interim ice cooling. The lysed cells were extracted three times with 1 ml of hexane followed by a volume reduction to 1 ml by a stream of nitrogen. As an internal standard, 25 ⁇ of 1 mM Zerumbon dissolved in hexane was added to 225 ⁇ sample. ⁇ -Humans were analyzed and quantified by GC-MS (GC17A with Q5050).
  • Mass spectrometer Shimadzu, Kyoto, Japan
  • an equity 5 column (Supelco, 30 mx 0.25 mm x 0.25 ⁇ ). Measurements were carried out in duplicate as follows: carrier gas: helium; Split injection (8: 1) at 250X; Flow rate: 2.2 ml / min; Interface temperature: 250 ° C; Program: 80 ° C hold for 3 min, 16 D C / min to 240 ° C, hold for 2 min. Retention time was 9.3 min for ⁇ -humulen and 11.5 min for Zerumbon.
  • ⁇ -humulen in the samples was identified by comparing three major fragmentations of the mass spectra with a purchased ⁇ -humulene standard (relative intensity in clamps): 93 (15.5), 41 (1, 4), 80 (6.7 ).
  • a calibration curve with concentrations of 4500, 2250, 900, 675, 450, 225, 90, 67.5, 22.5, 9 and 4.5 ⁇ ⁇ -humulen with 100 ⁇ Zerumbon each was used.
  • Precipitated proteins were separated by centrifugation (5 min, 16000g, 4 ° C) and the supernatant was taken up in 100 ⁇ (tetrahydrofurans (THF) for HPLC analysis after drying with nitrogen.)
  • THF tetrahydrofurans
  • saponified extracts the supernatant was assayed for Protein removal was incubated with 10% KOH solution (dissolved in methanol) for 2 h at RT The upper organic phase was then dried with nitrogen and taken up in 100 ⁇ THF for HPLC analysis.
  • BINOS 1001 Gas Analyzer (Rosemount Analytical, Hanau, DE).
  • the methanol concentration was monitored online and regulated with a ProcessTRACE 1.21 MT system (Trace Analytics, Braunschweig, DE) equipped with a dialysis probe, half-hourly.
  • the methanol feed was made as follows: below a concentration of 1 g / L, 0.79 g (1 mL) and below 0.5 g / L, 1.42 g (1.8 mL) was added methanol via a Watson Marlow 505Du peristaltic pump (Cornwali, England) supplied.
  • Anti-foam B emulsion (Sigma-Aldrich) was added manually to reduce foaming, in addition to a six-blade tubular stirrer mounted directly above the liquid phase as a mechanical foam breaker.
  • the fermenter was inoculated with an ODeO of 0.5-1 with a preculture that was in shake flask for 72 h
  • Samples were taken manually, from which cell dry matter and ODeO were determined from the aqueous phase and ⁇ -humulen in the organic dodecane phase were measured as described above.
  • Methylobacterium extorquens AM1 endogenously produces a farnesyl pyrophosphate (FPP) pool, which, however, is converted to menaquinone, hopanes, and carotenoids (see Figure 1).
  • FPP farnesyl pyrophosphate
  • this bacterium could synthesize ⁇ -humans by integrating a heterologous ⁇ -humulene synthase.
  • Plasmid pCM80 carries the strong pmxaF promoter and was chosen as a vector for the expression of the ⁇ -humulen synthase gene.
  • a codon-optimized variant of the Zingiber gene was introduced into pCM80 to yield pFS33.
  • Cultivation was carried out under the conditions described above as aqueous-organic two-phase cultures, with dodecane serving as the organic phase.
  • dodecane serving as the organic phase.
  • the strong hydrophobicity of ⁇ -humulen leads to a complete accumulation in the dodecane phase, since
  • ⁇ -humulen concentrations can be measured directly in the dodecane phase and volatilization of ⁇ -humulen is reduced by the high boiling point of dodecane.
  • M. extorquens AM1 tolerates 20%
  • M. extorquens AM1 (hereinafter also abbreviated to: AM1) comprising plasmid pFS33 was able to produce ⁇ -humulen as the peak with similar retention time and mass spectrum compared to the ⁇ -humulen standard in Fig. 2 shows.
  • AM1 M. extorquens A 1 with the empty vector control no ⁇ -humulen can be detected.
  • a 1_pFS33 and AM1_pFS34 2.3 mg / L ⁇ -humulen were measured.
  • the FPP synthase ERG20 of pFS34 does not appear to increase the ⁇ -humene concentration. The reasons for this are unknown.
  • M. extorquens cultures as a second phase.
  • ⁇ -humulen was added directly to the aqueous phase.
  • the results shown in FIG. 3 show that M. extorquens is suitable as a production platform for terpenes, in particular for ⁇ -humulen.
  • Piasmid system with inducible promoter used.
  • the genes for ⁇ -humulene synthase alone, in combination with FPG synthase ERG20 and in combination with ERG20 and the MVA pathway genes were cloned in plasmid pHC115, which carries a co-inducible promoter (Chou and Marx, 2012) the plasmids pFS45, pFS46 and pFS47, respectively.
  • Plasmid pQ2148 contains the very dense coumate inducible 2148 promoter. Zss ⁇ alone and again in combination with ERG20 as well as with the MVA genes were introduced into pQ2148F yielding pFS49 (zsä), pFS50 (ssl-ERG20) and pFS52 (ssl -E RG20-M VA). Colonies were obtained after transformation into M. extorquens for pFS49, pFS50 and also pFS52, although the colonies for pFS52 were very small even after 8 days growth at 30X. The ⁇ -humulen concentrations reached 11 mg / L in AM1_pFS49 and 17 mg / L in
  • AM1_pFS50 (see Figure 4), which is a 6-fold or 1.6-fold increase in the zsst-ERG20 construct over pFS34 and pFS46, respectively.
  • the background production ie without induction, was only 5%.
  • the balance of flux imbalances in the metabolism can be achieved by a variety of measures.
  • TIR translation initiation rate
  • RBS ribosome binding sites
  • TIR of ⁇ -humulen synthase RBS was increased 146-fold in the plasmids pFS57 (zss 225k ), pFS58 (zssi 225k -ERG20), and pFS59 (zssl 225k -ERG20-MVA) (see Table 2).
  • TIR Translation Initiation Rates
  • extorquens AM1 with unknown RBS Intermediates: AAc-CoA: acetoacetyl-CoA, HMG-CoA: hydroxymethylglutaryl-CoA, IPP: isopentenylpyrophosphate, DMAPP: dimethylallylpyrophosphate, FPP: farnesylpyrophosphate:
  • TIR Plasmid translation initiation rate
  • the TIR of ERG20 RBS was increased in the ratio of about 1:10 (pFS61b) to the TIR of zssl RBS (see Table 2).
  • the RBS optimization of ERG20 in combination with zssl RBS Optimization did not increase ⁇ -muulen formation without MVA (pFS60a and pFS60b, see FIG. 5).
  • the heterologous expression of the MVA pathway in M. extorquens was carried out according to the last-described embodiment by adaptation of the RBS of the ⁇ -humulen synthase, the FPP synthase and the ⁇ -somerase. Concentrations of 58 mg / L ⁇ -humulen were achieved by M. extorquens comprising pFS62b (zssl zz0k -ERG20 20k - // 7 / i5k -MVA). After all, this is a threefold increase over a strain of overexpressed ⁇ -humene synthase and overexpressed FPP synthase in the absence of the heterologous MVA pathway.
  • Precursor FPP (see FIG. 1).
  • the use of a carotenoid-deficient mutant could according to a further embodiment even increase ⁇ -humene production.
  • strain CM502 Carotenoid extraction and analysis (supra) of strain CM502 showed that it produces diapolycopene, but no lycopene, which has an identical UV spectrum but a different retention time (see Figure 6A).
  • Diapolycopin produces, but no esterified / glycosylated derivatives.
  • the ⁇ -humulen production of strain AcrtNö with plasmid pFS62b was again significantly increased by about 30% to M.
  • extorquens AM1 wild-type with plasmid pFS62b (see Fig. 6B).
  • One A production titre of at least 75 mg / i ⁇ -humients in the chippings could thus be achieved.
  • M. extorquens-based ⁇ -human production In order to test the performance of the M extorquens-based ⁇ -human production according to the invention, methanol-simulated fed-batch fermentations were carried out.
  • the aqueous-organic two-phase cultivations described above were used.
  • M. extorquens AM1 or ⁇ / iNb having the plasmid pFS62b were grown to an ODeO of 5-10 before the expression of the ⁇ -human synthesis pathway with cumate was induced and a dodecane phase was added.
  • the further cultivation was carried out at constant pH, dissolved oxygen level of> 30% and methanol concentrations of about 1 g / L.
  • Average ODeoo values of 80-90 were achieved by fermentation (see Table 3) corresponding to a cell density of about 30 g / l. As shown in Fig. 7, ⁇ -humic production was growth-dependent. High ⁇ -human concentrations of 0.73 g / L to 1.02 g / L were formed from strain M. extorquens AM1 with plasmid pFS62b. A maximum ⁇ -human concentration of 1.65 g / l was produced by strain M. extorquens ⁇ with plasmid pFS62b, a 57% increase compared to the highest concentration of 1.02 g / l by strain AM1 with plasmid pFS62b ( see Table 3).
  • the maximum product concentration of 1.65 g / L represents a 22-fold increase compared to the highest concentration achieved by shake flask cultivation, with the ⁇ -humene / ODeO ratio remaining constant at about 20 mg * VOD 6 oo.
  • the maximum theoretically possible yield of de novo synthesizable ⁇ -humic acid per methanol is 0.26 g / g.
  • the maximum yield of 0.031 g of humene / gMeOH achieved in fermentation 5 corresponds to 12% of the maximum theoretical yield.
  • Methylobacterium extorquens AM 1 (Peel and Quayle 1961, Biochem J, 81, 465-9) was incubated at 30 ° C in minimal medium according to Kiefer et al. (Kiefer et al., 2009) were cultured with 123 mM methanol.
  • Escherichia coli strain DH5a (Gibco-BRL, Rockville, USA) was cultured in Ysogeny broth (LB) medium (Bertani 1951, J Bacterio !, 62, 293) at 37 ° C.
  • Tetracycline hydrochloride was used at a concentration of 10 pg / ml for E. coli and M. extorquens.
  • Cumate (4-isopropylbenzoic acid) was used as an inducer and used starting from a 100 mM stock solution dissolved in ethanol in a final concentration of 00 ⁇ .
  • Dodecane was purchased from VWR (Darmstadt, DE). .2 Genetic manipulations and plasmid construction
  • Plasmids for the synthesis of cis-abienol were constructed from plasmid pfs62b.
  • ppjo 6 pQ2148F-AbCAS-ERG20F96C-MVA
  • the cis-abienol synthase gene AbCAS originally derived from Abies balsamea (Zerbe et al., 2012, J Biol Chem, 287, 12121-31) (Accession number JN254808. 1)
  • codon-optimized for M. extorquens AM codon-optimized for M. extorquens AM to obtain the DNA sequence of SEQ ID NO 50.
  • the codon-optimized gene of SEQ ID NO 50 was amplified for insertion into pfs62b using primers pj05 and pj25.
  • the RBS of the AbCAS gene has the nucleic acid sequence
  • TATT AAT ATT AAG AG GAG GT AAT AA (SEQ ID NO 51) with a translation initiation rate (TIR) of 233,000.
  • the gene for the GGPP synthase ERG20F96C (SEQ ID NO 52) (Ignea et al., 2015, Metabolic Engineering, 27, 65-75) from Saccharomyces cerevisiae was obtained by mutagenesis PCR with the primers pj26, pj16, pj17 and pj10 from ERG20 ,
  • the TIR of the RBS of ERG20F96C was set to 10,000 and has the nucleic acid sequence
  • Plasmid ppjo16 was constructed by inserting the PCR products of AbCAS and ERG20F96C by Gibson cloning into Spei and XbaI-cut vector pfs62b. 2
  • the corresponding RBS have a TIR of 145,000 for the gene NtLPPS with the DNA sequence CAACGGCCCTTACAAAAGGAGGTTAATTATT (SEQ ID NO 56) and for the gene NtABS a TIR of 130,000 with the DNA sequence
  • the codon-optimized NtLPPS gene according to SEQ ID NO 54 was amplified with the primers pj05 and pj27, for the amplification of the codon-optimized NtABS (SEQ ID NO 55) the primers pj28 and pj29 were used.
  • the gene ERG20F96C was carried out
  • Plasmid ppjo17 was constructed by inserting the PCR products of NtLPPS, NtABS and ERG20F96C by Gibson cloning into the Spei and XbaI cut vector pfs62b.
  • Methylobacterium extorquens AM 1, containing the cis-abienol recovery plasmids were cultured in methanol minimal medium containing tetracycline-5 hydrochloride (see above).
  • Precultures were inoculated from agar plates in test tubes with 5 ml of medium and shaken for 48 h at 30 ° C and 180 rpm.
  • Main cultures with 12 ml of medium in 100 ml
  • Bison shake flasks were inoculated with a preculture to an OD600 of 0.1. After culturing for 16 h at 30 ° C, the main cultures reached the early exponential
  • 1 ml dodecane sample was dried with NaSO 4.
  • 25 ⁇ M of a dodecane solution containing 1 mM Zerumbon was added to 225 ⁇ M dodecane sample.
  • Cis-abienol was analyzed and quantified by GC-MS (GC17A with Q5050
  • Mass spectrometer Shimadzu, Kyoto, Japan), equipped with an Equity 5 column (Supeico, 30 m x 0.25 mm x 0.25 ⁇ ). Measurements were carried out as follows: carrier gas: helium; Split injection (2: 1) at 250 ° C; Flow rate: 2.2 ml / min; Interface temperature: 250 ° 5 C; Program: 80 ° C hold for 3 min, 16 ° C / min to 240 ° C, hold for 2 min. Retention time was 14.1 min for cis-abienol and 1.1 min for zerumbon.
  • Cis-abienol in the samples was identified by comparing three major fragmentation of the mass spectra with a commercially purchased cis-abienol standard (relative intensity in parentheses): 1 19 (15.9), 134 (30.3), 191 (6, 0). For one
  • Quantification was a calibration curve with the concentrations 100, 50, 20, 10, 5, 2, 1 mg / L cis-abienol each with 00 ⁇ Zerumbon used
  • GGPP should either be converted directly to cis-abienol by the bifunctional cis-abienol synthase AbCAS from Nicotiana tabacum or stepwise via the production of LPP from GGPP by the LPP synthase NtLPPS from Nicotiana tabacum, where LPP is subsequently replaced by the cis-abienol synthase NtABS, also from Nicotiana tabacum, to be converted to cis-abienol.
  • two plasmid variants ppjo16 and ppjo17 were constructed for cis-abienol synthesis.
  • the cultivation was carried out under the conditions described above as aqueous-organic two-phase cultures, with dodecane serving as the organic phase.
  • a suppressor mutant of M. extorquens A 1 containing plasmid ppjo16 (called 16s6) was able to produce cis-abienol as the peak with same retention time and mass spectrum compared to cis-abieno! Standard in Figure 1 shows.
  • no cis-abienol was detectable for M. extorquens AM1 with the empty vector control (pQ2148F).
  • 16s6 of M. extorquens AM1 with ppjo16 21.1 mg / L cis-abienol was measured in the dodecane phase, which corresponds to a product concentration of 5.3 mg / L cis-abienol in the culture broth.
  • SEQ ID NO 59 represents the sequence of the promoter region in the plasmid ppjo16, while under SEQ ID NO 60 the mutated promoter sequence is deposited in plasmid ppjo16 from the suppressor mutant 16s6.
  • Methyiobacterium extorquens A 1 (Peel and Quayie 1961, Biochem J, 81, 465-9) was incubated at 30 ° C in minimal medium according to Kiefer et al. (Kiefer et al., PLoS One, e7831) at 123 mM
  • Escherichia coli strain DH5a (Gibco-BRL, Rockville, USA) was cultured in lysogeny broth (LB) medium (Bertani 1951) at 37 ° C. Tetracycline hydrochloride was in a
  • Tetracycline Hydrochloride was purchased from Sigma-Aldrich (Steinheim, DE). Dodecane was purchased from VWR (Darmstadt, DE).
  • Ribosome binding sites were designed using the ribosome binding site calculator (Salis 201, Methods in Enzymology, ed V. Christopher, 19-42, Academic Press).
  • the codon-optimized gene according to SEQ ID NO 61 was amplified for the insertion in pfsBOb (Sonntag et al., 2015) using the primers SSpiSSY_RBSopt_fw and SSpiSSYjrev.
  • the SSpiSSY PCR product was digested with SpeI and Clal and inserted into digested plasmid pfs60b yielding plasmid ppjo01_woM A.
  • Plasmid ppjo01 was constructed by excising the genes SSpiSSY and ERG20 from ppjo01_woMVA with A & a / and EcoRI followed by insertion into the same digested pfs62b.
  • SSpiSSY had the nucleic acid sequence TGTTACACCCACAGAACAAACCCGAGGTAACT (SEQ ID NO: 62) with a TIR of 44,000, the TIR of the RBS of ERG20 had the nucleic acid sequence
  • the codon-optimized gene according to SEQ ID NO 64 was amplified for insertion into pfs62b using primers pj05 and pj06.
  • the RBS of the SanSyn gene had the nucleic acid sequence G AAG AAG G AG GTAGTC AT AAAG AAG GAG GTAACTA (SEQ ID NO 65) with a TIR of 233,000.
  • Plasmid ppjo03 was constructed by inserting the PCR product of SanSyn by Gibson cloning into the Spes and Bsu36l cut vector pfs62b.
  • ERG20 RBS TIR is set to 22,000 and assigned the
  • the SSpiSSY gene (SEQ ID NO: 61) was amplified with the primers SSpiSSY_RBSopt_fw and SSpiSSY_rev, digested with BamHi and EcoRI, and inserted into digested pQ24 8F-ERG20fus plasmid, yielding plasmid ppjo04_woMVA. Plasmid ppjo04 was constructed by excising the ERG20fus gene from ppjo04_woMVA with Asel and EcoRI, followed by insertion into similarly digested pfs62b. In both plasmids, ppjo04 and ppjo04_wo VA, ERG20 indicated the nucleic acid sequence
  • Plasmid ppjo05 was constructed by inserting the PCR products of SSpiSSY and fusERG20 by Gibson cloning into the Spei and XbaI cut vector pfs62b.
  • ppjo06 pQ2148F-SSpiSSY-ERG20_RBSmax
  • the codon-optimized Santal synthase gene SSpiSSY (SEQ ID NO 61) was amplified with the primers pj01 and pj77.
  • the optimized RBS of the SSpiSSY gene had the nucleic acid sequence of SEQ ID NO 68 with a TIR of 402,000.
  • the gene for FPP synthase ERG20 was amplified using primers pj10 and pj78.
  • the TIR of ERG20 was set at 1344,000 and had the nucleic acid sequence
  • Plasmid ppjo06 was constructed by inserting the PCR products of SSpiSSY and ERG20 using
  • the TBS of the Rbs of the mgs gene was maintained at 189 for the plasmids ppjoOi, ppjo03 and ppjo04, analogous to the humin synthesis plasmid pfs62b.
  • the TIR value of the RBS of the hmgs was set at 6345.
  • Methylobacterium extorquens for (Sonntag et synthesis of ⁇ -humulene, without genes coding for al., 2015, proteins of the mevalonatal path Metab Eng,
  • Synthase ERG20 (SSpiSSYfusERG20) ppjooe expression vector for Methylobacterium extorquens
  • ERG20 has been set to a maximum
  • M. extorquens Optional methylotrophic, obligatory aerobic, gram (Peel and AM1 negative, pink pigmented ⁇ -proteobacterium, CmR Quayle
  • Methylobacterium extorquens AM1 having the santalen recovery plasmids, was cultured in methanol minimal medium containing tetracycline-5 hydrochloride (see above). Precultures were inoculated from agar plates in test tubes with 5 ml of medium and shaken for 48 h at 30 ° C and 180 rpm. Main cultures with 12 ml of medium in 100 ml
  • Baffled shake flasks were inoculated with a preculture to an ODeoo of 0.1. After culturing for 16 h at 30X, the major cultures reached the early exponential
  • 1 ml dodecane sample was dried with NaS0. 4
  • 25 ⁇ M of a dodecane solution containing 1 mM Zerumbon was added to 225 ⁇ M dodecane sample.
  • Santalen was analyzed using GC-MS (GC17A with Q5050 mass spectrometer, Shimadzu, Kyoto, Japan) equipped with an Equity 5 column (Supeico, 30 mx 0.25 mm x 0.25 ⁇ ).
  • sandalwood oil was used instead to analyze salen products in the samples. Before the measurement, the sandalwood oil: 500 was diluted in Dodecan. The various substances contained in sandalwood oil eluted between 11 and 12.4 min. 2 results
  • FPP synthase ERG20 for the production of santalen with Methylobacterium extorquens AM1, in addition to the evalonatoperon from Myxococcus xanthus, the FPP synthase ERG20 from Saccharomyces cerevisiae and other genes were expressed. FPP was to be converted to santalen by a Santalen synthase from Santa / um spicatum (SS GeorgSSY) or Clausens lansium (SanSyn). Likewise, fusion proteins from the Santal synthase SSpiSSY and the FPP synthase ERG20 were tested for santalen production. A total of seven plasmid variants (ppjo01, ppjo01_woMVA, ppjo03, ppjo04, ppjo04_woMVA, ppjoOS, ppjo06) were constructed for Santal synthesis.
  • the cultivation was carried out under the conditions described above as aqueous-organic two-phase cultures, with dodecane serving as the organic phase.
  • M. extorquens AM1 having the plasmids ppjo01_woMVA, ppjo03, ppjo04, ppjo04_wo VA or ppjoOS was able to produce santalene as the santalen peak with the same Retention time and mass spectrum compared to substances in sandalwood oil in Figure 1 showed.
  • the chromatogram and mass spectrum of a sample of M. extorquens AM1 containing the plasmid ppjo03 are shown.
  • no santalen was detectable for M. extorquens AM1 with the empty vector control (pQ2148F).
  • Bacterial strains and fermentation conditions can be readily adapted without departing from the scope of the invention.
  • simple adaptations are conceivable for the production of other sesquiterpenes from methanol or ethanol, for example potential biofuels, such as bisabolene, or from flavoring agents, such as santalen or from diterpenes, such as sclareol.
  • the invention enables the bioproduction of terpenes from the non-food competing carbon source Methanoi or ethanol.
  • SEQ ID NO 1 hydroxymethylglutaryl-CoA synthase, Myxococcus xanthus
  • SEQ ID NO 2 Hydroxy-methylglutaryl-CoA reductase, Myxococcus xanthus
  • SEQ ID NO 3 mevalonate kinase, myxococcus xanthus
  • SEQ ID NO 4 phosphomevalonate kinase, myxococcus xanthus
  • SEQ ID NO 5 Pyrophosphome valonate decarboxylase, Myxococcus xanthus
  • SEQ ID NO 6 isopentenyl pyrophosphate isomerase, Myxococcus xanthus
  • SEQ ID NO 7 hmgs gene from Myxococcus xanthus with removed EcoR ⁇ restriction site with insertion of a silent mutation (gaattc to gagttc)
  • SEQ ID NO 8 hmgr gene from Myxococcus xanthus
  • SEQ ID NO 9 mvaK1 gene from Myxococcus xanthus
  • SEQ ID NO 10 mvaK2 gene from Myxococcus xanthus
  • SEQ ID NO 11 mvaD gene from Myxococcus xanthus
  • SEQ ID NO 12 fni gene from Myxococcus xanthus
  • SEQ ID NO 13 FPP synthase ERG20 from Saccharomyces cerevisiae, PRT
  • SEQ ID NO 16 DNA sequence of the alpha-humule synthase zss / zingiber zerumbet
  • SEQ ID NO 40 optimized RBS of ERG20 with a TIR of 36,800
  • SEQ ID NO 41 optimized RBS of zss / with a TIR of 221,625
  • SEQ ID NO 43 GGPP synthase from Pantoea agglomerans
  • SEQ ID NO 44 GGPP synthase from Taxus canadensis
  • SEQ ID NO 45 sesquiterpene synthase from Santalum album
  • SEQ ID NO 46 sesquiterpene synthase Santalum spicatum
  • SEQ ID NO 47 Diterpene synthase optimized from Abies baisameaSEQ ID NO 48
  • SEQ ID NO 49 optimized RBS from hmgs with a TIR of 6,345
  • SEQ ID NO 50 DNA sequence of the cis-abienol synthase AbCAS from Abies balsamea codon-optimized for Methylobacterium extorquens AM1
  • SEQ ID NO 51 optimized RBS from AbCAS with a TIR of 233,000
  • SEQ ID NO 52 DNA sequence of the GGPP synthase ERG20F96C from Saccharomyces cerevisiae
  • SEQ ID NO 53 optimized RBS of ERG20F96C with a TIR of 10,000 in plasmid ppjo16
  • SEQ ID NO 54 DNA sequence of the LPP synthase NtLPPS gene of Abies balsamea codon-optimized for Methylobacterium extorquens A 1
  • SEQ ID NO 55 DNA sequence of the cis-abienol synthase NtABS gene of Abies balsamea codon-optimized for Methylobacterium extorquens AM1
  • SEQ ID NO 56 optimized RBS of NtLPPS with a TIR of 145,000 in plasmid ppjo16
  • SEQ ID NO 57 optimized RBS of NtABS with a TIR of 130,000 in plasmid ppjo 6
  • SEQ ID NO 58 optimized RBS of ERG20F96C with a TIR of 9,500 in plasmid ppjo17
  • SEQ ID NO 59 promoter region of plasmid ppjo16 including RBS AbCAS,
  • SEQ ID NO 60 Promoter region of plasmid ppjo 6 from clone 16s6 including RBS
  • SEQ ID NO 61 DNA sequence of Santal synthase SspiSSY from Santalum spicatum codon-optimized for Methylobacterium extorquens AM1
  • SEQ ID NO 62 optimized RBS of SSpiSSY with a TIR of 44,000 in plasmid ppjo01 and ppjo01_woMVA
  • SEQ ID NO 63 optimized RBS of ERG20 with a TIR of 20,000 in plasmid ppjo01 and ppjo01_woMVA
  • SEQ ID NO 64 DNA sequence of Santalen synthase SanSyn from Clausena lansium codon-optimized for Methylobacterium extorquens AM1
  • SEQ ID NO 65 optimized RBS from SanSyn with a TIR of 233,000 in plasmid ppjo03
  • SEQ ID NO 66 optimized RBS of ERG20 with a TIR of 22,000 in plasmid ppjo03
  • SEQ ID NO 67 optimized RBS of ERG20 with a TIR of 53,000 in plasmid ppjo04 and ppjo04_woMVA SEQ ID NO 68; optimized RBS of SSpiSSY with a TIR of 402,000 in plasmids ppjoOS and ppjo06
  • SEQ ID NO 69 optimized RBS of ERG20 with a TIR of 1344,000 in plasmid ppjo06
  • SEQ ID NO 90 optimized RBS of hmgs with a TIR of

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Die Erfindung betrifft die mikrobielle Terpenproduktion. Bekannte Verfahren zur mikrobiellen Produktion von Terpenen basieren zumeist auf der direkten Umsetzung von Zuckern. Daher waren alternative Substrate, insbesondere alternative Kohlenstoffquellen, für den Einsatz in der mikrobiellen Terpenproduktion erstrebenswert. Die Erfindung betrifft ein methylotrophes Bakterium aufweisend rekombinante DNA kodierend für wenigstens ein Polypeptid mit enzymatischer Aktivität zur heterologen Expression in dem genannten Bakterium, wobei das genannte wenigstens eine Polypeptid mit enzymatischer Aktivität ausgewählt ist aus der Gruppe bestehend einem Enzym eines heterologen Mevalonatweges, einer heterologen Terpensynthase und gegebenenfalls einer heterologen Synthase einer Prenyldiphosphat- Vorstufe. Die Erfindung betrifft weiterhin insbesondere ein Verfahren zur mikrobiellen de novo Synthese von Sesquiterpenen oder Diterpenen aus Methanoi und/oder Ethanol.

Description

Verfahren zur mikrobieilen de novo Synthese von Terpenen
Die Erfindung betrifft ein methylotrophes Bakterium, ein Verfahren zur mikrobieilen de novo Synthese von Sesquiterpenen oder Diterpenen aus Methanol und/oder Ethanol sowie die Verwendung des methylotrophen Bakteriums für die mikrobie!le de novo Synthese von
Terpenen aus Methanol und/oder Ethanol. Die Erfindung betrifft das Gebiet der weißen
Biotechnologie.
Die mikrobielie Synthese von Terpenen als umweltfreundliche Möglichkeit der Produktion von Aroma-, Riech- und Kosmetikstoffen sowie Biokraftstoffen wurde bereits für verschiedene
Mikroorganismen wie Escherichia coli oder Saccharomyces cerevisiae beschrieben (Martin et al., 2003, Nature biotechnology 21 , 796-802; Asadoilahi et al., 2008, Biotechnology and
Bioengineering 99, 666-677; Chandran et al., 2011, Process Biochemistry 46, 1703-1710). Dabei wird der mikrobieilen Terpen Produktion in den nächsten Jahren ein erhebliches
Wachstumspotential zugesprochen, was sich vor allem aus Verknappung fossiler Ressourcen und der wachsenden Weltbevölkerung gekoppelt mit der Notwendigkeit einer
umweltfreundlichen Synthese von chemischen Substanzen ergibt (Peralta-Yahya et al., 2010, Btotechnol J 5, 147-62; Ajikumar et al., 2008, Molecular pharmaceutics 5, 167-90). Bekannte Verfahren zur mikrobieilen Produktion von Terpenen basieren zumeist auf der direkten Umsetzung von Zuckern, insbesondere Glukose, oder von Substraten die in
Konkurrenz zur Nahrungsmittelproduktion stehen, wie Glycerin, oder komplexen Substraten wie Proteinhydrolysaten (Yoon et al., 2009, Journal of Biotechnology, 140, 218-226; Sarria et al., 2014, ACS Synthetic Bioiogy 3 (7), 466-475). Die Nutzung solcher Substanzen als Substrate für die Biotechnologie geht mit diversen Nachteilen einher, die neben der ethischen Komponente vor allem schwankende und ein in Zukunft vermutlich steigendes Preisniveau sowie regionale und saisonale Abhängigkeiten betreffen. Zudem geht die Verwendung von komplexen oder zuckerhaltigen Medien immer mit erhöhtem Aufwand bei der Produktaufarbeitung sowie den Sterilitätsanforderungen einher. Daher sind alternative Substrate, insbesondere alternative Kohlenstoffquellen, für den Einsatz in der Biotechnologie erstrebenswert, die möglichst viele der oben genannten Nachteile kompensieren.
Die mikrobielie Produktion von Terpenen, insbesondere Amorpha-4,1 -diene, oder
Terpengemischen wird in US 2008/0274523 A1 beschrieben. Allerdings wird danach als Kohlenstoffquelle lediglich das Monosaccharid Glukose eingesetzt. Insbesondere wird darin keine alternative Kohlenstoffquelle zur Fermentation vorgeschlagen. Weiterhin ist nach US 2008/0274523 A1 die heterologe Expression einer Acetoacetyl-CoA Synthase (Acetoacetyl-CoA Thiolase) erforderlich. Nach US 2003/0148479 A1 wird eine mikrobielie Biosynthese von Isopentenylpyrophosphat (IPP) in E. coli vorgeschlagen, wobei eine Kultivierung in LB Medien erfolgt. Eine heterologe Expression einer Acetoacetyl-CoA Synthase (Acetoacetyl-CoA Thiolase) ist hierbei erforderlich und weiterhin wurden verschiedene intermediate des Mevalonatweges dem Medium zugegeben. Eine alternative Kohlenstoffquelle zur Fermentation wird nicht vorgeschlagen.
Die US 201 1/0229958 A1 zeigt Mikroorganismen zur Produktion von isoprenverbindungen in E. coli. Eine heterologe Expression einer Acetoacetyl-CoA Synthase (Acetoacetyl-CoA Thiolase) ist wiederum erforderlich und Mevalonat wurde dem Medium zugegeben. Eine kostengünstige alternative Kohlenstoffquelle zur Fermentation wird nicht vorgeschlagen.
Mit der WO 2014/014339 A2 werden rekombinante Rhodobacter Wirtszellen zur
Monoterpensynthese beschrieben. Als Kohlenstoffquelle wird ein nicht näher charakterisierter Zucker vor- geschlagen. Eine alternative Kohlenstoffquelle zur Fermentation wird nicht erwähnt.
Eine de novo Herstellung des Monoterperns Geraniumsäure in Pseudomonas putida wurde vorgeschlagen (Mi et al., 2014, Microbial Cell Factories 13:170). Allerdings wird danach als Kohlenstoffquelle lediglich Glycerin in einem LB enthaltenden Medium eingesetzt. Insbesondere wird darin keine alternative Kohlenstoffquelle zur Fermentation vorgeschlagen.
Die Verwendung komplexer oder in ihrer Zusammensetzung nicht ausreichend charakterisierter Fermentationsmedien erschwert eine einfache und kostengünstige Aufarbeitung des
gewünschten Produktes.
Die Aufgabe der vorliegenden Erfindung bestand nach einem ersten Aspekt somit darin, die Nachteile der bekannten rekombinanten Mikroorganismen in Bezug auf die Biosynthese von Terpenen zu überwinden. Nach einem weiteren Aspekt der vorliegenden Erfindung sollen Bakterien bereitgestellt werden, die eine mikrobielle de novo Synthese von Terpenen aus einer alternativen Kohlenstoffquelle, ermöglichen. Die Bakterien sollten dabei idealerweise auf der alternativen Kohlenstoffquelle als einziger Kohlenstoffquelle wachsen können, insbesondere soll eine Zugabe von kostenintensiven Substratzusätzen, wie Acetoacetat oder D,L-Mevalonat, nicht erforderlich sein. Nach einem weiteren Aspekt soll ein Fermentationsverfahren zur mikrobiellen de novo Synthese von Terpenen aus einer alternativen Kohienstoffquelle, bereitgestellt werden, dass eine einfache downstream-Aufreinigung der gewonnenen Terpenprodukte ermöglicht. Insbesondere sollen Sesquiterpene und Diterpene mit hoher Ausbeute herstellbar sein. Nach einem weiteren Aspekt sollen Umsatz und Ausbeute des Verfahrens sowohl im Schüttelkolben als auch im Fermenter beim Up-Scaling für die biotechnologische Anwendung vielversprechend oder ausreichend sein.
Die Aufgaben werden durch die in den Ansprüchen und hiernach beschrieben
Ausführungsformen gelöst.
Eine erste Ausführung der Erfindung betrifft ein methylotrophes Bakterium aufweisend rekombinante DNA kodierend für wenigstens ein Polypeptid mit enzymatischer Aktivität zur Expression in dem genannten Bakterium, wobei das genannte wenigstens eine Polypeptid mit enzymatischer Aktivität ausgewählt ist aus der Gruppe bestehend aus
wenigstens ein Enzym eines heterologen Mevalonatweges ausgewählt aus der Gruppe bestehend aus Hydroxymethylglutaryl-CoA-Synthase (HMG-CoA-Synthase),
Hydroxymethyl- glutaryl-CoA-Reduktase (HMG-CoA-Reduktase), Mevalonat-Kinase,
Phosphomevalonat- Kinase, Pyrophosphomevalonat-Decarboxylase und
Isopentenylpyrophosphat-Isomerase;
eine heterologe Terpensynthase und
eine Synthase einer Prenyldiphosphat-Vorstufe.
Insbesondere betrifft die Erfindung auch ein methylotrophes Bakterium aufweisend eine heteroSoge Terpensynthase und rekombinante DNA kodierend für wenigstens ein Polypeptid mit enzymatischer Aktivität zur Expression in dem genannten Bakterium, dadurch gekennzeichnet, dass das genannte wenigstens eine Polypeptid mit enzymatischer Aktivität ausgewählt ist aus der Gruppe bestehend aus
wenigstens ein Enzym eines heterologen Mevalonatweges ausgewählt aus der Gruppe bestehend aus Hydroxymethylglutaryl-CoA-Synthase (HMG-CoA-Synthase),
Hydroxymethylglutaryl-CoA-Reduktase (HMG-CoA-Reduktase), Mevalonat-Kinase, Phosphomevalonat-Kinase, Pyrophosphomevalonat-Decarboxylase und
Isopentenylpyrophosphat-Isomerase; und
eine Synthase einer Prenyldiphosphat-Vorstufe.
Ebenso betrifft die Erfindung auch ein methylotrophes Bakterium aufweisend eine heterologe Hydroxymethylglutaryl-CoA-Synthase (HMG-CoA-Synthase) und eine Hydroxymethylglutaryl- CoA-Reduktase (HMG-CoA-Reduktase) als Enzyme eines heterologen Mevalonatweges sowie rekombinante DNA kodierend für wenigstens ein Polypeptid mit enzymatischer Aktivität zur Expression in dem genannten Bakterium, dadurch gekennzeichnet, dass das genannte wenigstens eine Polypeptid mit enzymatischer Aktivität ausgewählt ist aus der Gruppe bestehend aus
wenigstens ein weiteres Enzym eines heterologen Mevalonatweges ausgewählt aus der Gruppe bestehend aus Mevalonat-Kinase, Phosphomevalonat-Kinase,
Pyrophosphomevalonat-Decarboxylase und Isopenteny!pyrophosphat-lsomerase;
eine heterologe Terpensynthase und
eine Synthase einer Prenyldiphosphat-Vorstufe.
Besonders bevorzugt weist das erfindungsgemäße Bakterium mindesten folgende Enzyme auf: heterologe Hydroxymethylglutary!-CoA-Synthase (HMG-CoA-Synthase) und
Hydroxymethyl- glutaryl-CoA-Reduktase (HMG-CoA-Reduktase) sowie mindest ein Enzym ausgewählt aus Mevalonat-Kinase, Phosphomevalonat- Kinase, Pyrophosphomevalonat- Decarboxylase und Isopentenylpyrophosphat-Isomerase und besonders bevorzugt alle diese Enzyme; und
eine heterologe Terpensynthase, Am meisten bevorzugt weist das Bakterium zusätzlich noch eine Synthase einer Prenyldiphosphat-Vorstufe auf. Unter„heterolog" ist im Sinne der Erfindung ein Enzym oder eine Gruppe von Enzymen, beispielsweise die des Mevalonatweges, zu verstehen, das/die natürlicherweise nicht in einem Organismus vorkommen, der das Enzym oder die Gruppe von Enzymen nun erfindungsgemäß aufweisen soll. So sollen also die heteroioge Terpensynthase oder die Enzyme des heterologen Mevalonatweges nicht im erfindungsgemäßen methylotrophen Bakterium vorkommen, sondern aus einer oder mehreren anderen Spezies stammen.
Das erfindungsgemäße Bakterium ermöglicht überraschend eine mikrobielle de novo Synthese von Terpenen aus einer alternativen Kohlenstoffquelle, wie Methanol und/oder Ethanol. Das genannte Bakterium kann bei heterolog exprimierten Enzymen des ansonsten natürlich in diesem Bakterium nicht vorkommenden Mevalonatweges (MVA Weges) auf Methanol und/oder Ethanol als einziger Kohlenstoffqueile wachsen und gewünschte Terpene de novo mit hoher Ausbeute synthetisieren.
Eine Besonderheit des verwendeten methylotrophen Bakteriums besteht in dem Vorhandensein des Moleküls Acetoacetyl-CoA im Primärstoffwechsei, hier dem Ethylmalonyl-CoA Weg
(EMCP). Acetoacetyl-CoA ist das erste Molekül im Meva!onatweg. Die Überlebensfähigkeit des erfindungsgemäßen rekombinanten methylotrophen Bakteriums war keineswegs erwartbar. So kann bei einem Abzug von Metaboliten des Primärstoffwechsels durchaus von erheblichen Flux- Imbaiancen ausgegangen werden. Insofern ist das hier festgestellte Wachstum des
erfindungsgemäßen Bakteriums mit wenigstens einem heterolog exprimierten Enzym des ansonsten natürlich in diesem Bakterium nicht vorkommenden Mevalonatweges auf Methanol und/oder Ethanol überraschend. Weiterhin macht das Vorhandensein des Moleküls Acetoacetyl- CoA im Primärstoffwechsei eine heteroioge Expression einer Acetoacetyl-CoA-Synthase überflüssig. Nach einer weiteren bevorzugten Abwandlung der Erfindung weist das
methylotrophe Bakterium keine rekombinante DNA kodierend für eine heteroioge Expression einer Acetoacetyl-CoA-Synthase (Acetoacetyl-CoA-Thiolase) auf.
Die Synthase einer Prenyldiphosphat-Vorstufe im Sinne der vorliegenden Erfindung setzt insbesondere Isopentenyldiphosphat (IPP) und Dimethylallyldiphosphat (DMAPP) enzymatisch zu einer Prenyldiphosphat-Vorstufe um, wobei die Prenyldiphosphat-Vorstufe vorzugsweise ausgewählt ist aus der Gruppe bestehend aus Farnesyldiphosphat (FPP) (C15) und Geranyl- geranyldiphosphat (GGPP) (C20)-
Die gebildeten azyklischen Prenyldiphosphate (synonym hier zu Isoprenyldiphosphate) - FPP und GGPP - sind die Vorstufen einer Vielzahl von Terpenen. Die Substrate der heterologen Terpensynthase sind vorzugsweise aus den genannten Prenyidiphosphat-Vorstufen
ausgewählt. Gemäß einer bevorzugten Ausführung weist das erfindungsgemäße methy!otrophe Bakterium rekombinante DNA kodierend für Polypeptide mit enzymatischer Aktivität zur heterologen Expression in dem genannten Bakterium auf, wobei die Polypeptide mit enzymatischer Aktivität die folgenden Enzyme umfassen:
die Enzyme eines heterologen Mevaionatweges (MVA-Weges), nämlich Hydroxymethyl- glutaryl-CoA-Synthase (HMG-CoA-Synthase), Hydroxymethylglutaryl-CoA-Reduktase (HMG- CoA-Reduktase), evalonat-Kinase, Phosphomevalonat-Kinase,
Pyrophosphomevalonat- Decarboxylase und Isopentenylpyrophosphat-Isomerase; - eine heterologe Terpensynthase und
eine, insbesondere heteroioge, Synthase einer Prenyldiphosphat-Vorstufe.
Ein bevorzugtes erfindungsgemäßes Bakterium zeichnet sich dadurch aus, dass das wenigstens eine Enzym des heterologen Mevaionatweges - nämlich ein Enzym ausgewählt aus der Gruppe bestehend aus Hydroxymethylglutaryl-CoA-Synthase (HMG-CoA-Synthase), Hydroxy- methylglutaryl-CoA-Reduktase (HMG-CoA-Reduktase), Mevalonat-Kinase,
Phosphomevalonat- Kinase, Pyrophosphomevalonat-Decarboxylase und
Isopentenylpyrophosphat-Isomerase eine Peptidsequenz aufweist mit einer Identität von jeweils wenigstens 60% zur Peptidsequenz nach SEQ ID NO. 1 , SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5 bzw. SEQ ID NO. 6 oder durch Nukleinsäuresequenz kodiert wird, die mit der entsprechenden, für die spezifischen Peptidsequenzen kodierenden Nukleinsäuresequenz in der Lage ist, unter stringenten Hybridisierungsbedingungen zu hybridisieren.
Unter Enzymen, die eine Peptidsequenz aufweist mit einer Identität von jeweils wenigstens 60% zur Peptidsequenz nach SEQ ID NO. 1 , SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ iD NO. 5 bzw. SEQ ID NO. 6 aufweisen ist bevorzugt zu verstehen, dass die Enzyme eine Peptidsequenz aufweisen, die jeweils zumindest 65%, zumindest 70%, zumindest 75%, zumindest 80%, zumindest 85%, zumindest 90%, zumindest 95%, zumindest 96%, zumindest 97%, zumindest 98% oder zumindest 99% identisch ist mit einer der spezifischen
Peptidsequenzen gemäß SEQ ID NO. 1 , SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5 bzw. SEQ ID NO. 6. Es versteht sich, dass solche Varianten der Enzyme mit spezifischer Peptidsequenz ebenfalls bevorzugt im Wesentlichen die biologische Aktivität der zuvor genannten Enzyme mit spezifischer Peptidsequenz aufweisen sollen. Ob dies der Fall ist, kann mit Aktivitätstests für die biologische Aktivität, die im Stand der Technik bekannt sind oder in den Ausführungsbeispielen beschrieben werden, leicht überprüft werden. Die
Peptidsequenzidentität wird hierbei typischerweise mit einem Sequenzvergleichsaigorithmus bestimmt. Hierzu werden zwei Sequenzen miteinander entweder über ihre gesamte Länge oder über die Länge eines zuvor definierten Segmentes verglichen, das mindestens die Hälfte der Aminosäuren einer der beiden Sequenzen ausmacht. Innerhalb des Vergleichsfensters, d.h. des Bereiches der beiden Sequenzen, der verglichen werden soll, wird die Zahl an identischen Aminosäuren an identischen oder vergleichbaren Positionen bestimmt. Hierzu kann es nötig sein, Lücken in eine Sequenz einzuführen. Im Rahmen der Erfindung soll ein Aminsäuresequenz besonders bevorzugt mit einem im Stand der Technik bekannten
Algorithmus durchgeführt werden, insbesondere mit einem der folgenden Algorithmen, die auf der Homepage des NCBi zur Verfügung gestellt werden: BLASTp, PS!-BLAST, PHI-BLAST oder DELTA-BLAST (siehe auch Johnson 2008, Nucleic Acids Res 36 (Web Server issue):W5- 9; Boratyn 2012, Biol Direct. 17(7):12; Ye 2012, BMC Bioinformatics 13:134; Ye 2013, Nucleic Acids Res 41 : (Web Server issue):W34-40; Marchler-Bauer 2009, Nucleic Acids Res 37
(Database issue):D205-10; und Papadopoulos 2007, Bioinformatics 23(9):1073-9.) Bevorzugt sind hierbei die vorgegebenen Standard-Einstellungen zu verwenden. Bevorzugt Varianten der erfindungsgemäß einzusetzenden Enzyme können zudem durch Nukleinsäuresequenzen kodiert werden, die mit den für die spezifischen Peptidsequenzen kodierenden Nukleinsäuresequenzen in der Lage sind, unter stringenten
Hybridisierungsbedingungen zu hybridisieren. Stringente Hybridisierungsbedingungen im Sinne der vorliegen Erfindungen sind beschrieben in Southern 1975, J. Mol. Biol. 98(3): 503-517. Auch hier versteht es sich, dass solche Varianten der Enzyme im Wesentlichen die biologische Aktivität der zuvor genannten Enzyme mit spezifischer Peptidsequenz aufweisen sollen.
Nach einem weiteren Aspekt der Erfindung weist ein methyiotrophes Bakterium rekombinante DNA kodierend für wenigstens ein Polypeptid mit enzymatischer Aktivität zur heterologen Expression in dem genannten Bakterium auf, wobei die Polypeptide mit enzymatischer Aktivität die folgenden Enzyme umfassen:
die Enzyme eines heterologen Mevalonatweges (MVA-Weges), nämlich
Hyd roxymethylg I utaryl-CoA-Synthase (H MG-CoA-Synthase) , Hyd roxymethylg iutaryl- CoA-Reduktase (HMG- CoA Reduktase), Mevalonat-Kinase, Phosphomevalonat-Kinase, Pyrophosphomevalonat- Decarboxylase und Isopentenylpyrophosphat-Isomerase, wobei die Enzyme eine Peptidsequenz mit einer Identität von jeweils wenigstens 60% zur Peptidsequenz nach SEQ ID NO. 1 , SEQ ID NO. 2, SEQ iD NO. 3, SEQ ID NO. 4, SEQ ID NO. 5 bzw. SEQ ID NO. 6 aufweisen oder durch Nukleinsäuresequenzen kodiert werden, die mit den entsprechenden, für die spezifischen Peptidsequenzen kodierenden Nukleinsäuresequenzen in der Lage sind, unter stringenten Hybridisierungsbedingungen zu hybridisieren.
eine heterologe Terpensynthase und
eine, insbesondere heterologe, Synthase einer Prenyldiphosphat- Vorstufe. Nach einer vorteilhaften Ausgestaltung des erfindungsgemäßen Bakteriums weisen die Enzyme des heterologen Mevalonatweges, nämlich Hydroxymethy!g!utaryl-CoA-Synthase (HMG-CoA- Synthase), Hydroxymethylglutaryl-CoA-Reduktase (HMG-CoA-Reduktase), Mevalonat-Kinase, Phosphomevalonat-Kinase, Pyrophosphomevaionat-Decarboxylase und Isopentenylpyrophos- phat-lsomeraseeine, eine Peptidsequenz mit einer Identität von jeweils unabhängig voneinander wenigstens 65%, wenigstens 70%, wenigstens 75%, wahlweise wenigstens 80%, insbesondere wenigstens 85%, weiter insbesondere wenigstens 90%, vorzugsweise wenigstens 95%, weiter bevorzugt wenigstens 98% und besonders bevorzugt wenigstens 99% zur Peptidsequenz nach SEQ ID NO. 1, SEQ !D NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5 bzw. SEQ ID NO. 6 auf.
Gemäß einer bevorzugten Ausgestaltung des erfindungsgemäßen Bakteriums handelt es sich bei den Enzymen des heterologen Mevalonatweges um die Hydroxymethylglutaryl-CoA- Synthase (HMG-CoA-Synthase), die Hydroxymethyiglutaryl-CoA-Reduktase (HMG-CoA-
Reduktase), die Mevalonat-Kinase, die Phosphomevalonat-Kinase, die Pyrophosphomevalonat Decarboxylase und die Isopentenylpyrophosphat-Isomeraseeine aus Myxococcus xanthus, jeweils aufweisend eine Peptidsequenz gemäß SEQ ID NO. 1 , SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5 bzw. SEQ ID NO. 6.
Nach einem weiteren Aspekt eines erfindungsgemäßen Bakteriums umfasst die rekombinante DNA, kodierend für die genannten Enzyme des heterologen Mevalonatweges, die folgenden Polynukleotide mit einer Identität von jeweils unabhängig voneinander wenigstens 60%, wenigstens 65%, wenigstens 70%, wenigstens 75%, wahlweise wenigstens 80%, insbesondere wenigstens 85%, weiter insbesondere wenigstens 90%, vorzugsweise wenigstens 95%, weiter bevorzugt wenigstens 98% und besonders bevorzugt wenigstens 99% zu einer
Nukieotidsequenz gemäß SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 1 bzw. SEQ ID NO. 12. oder Polynukleotide, die Nukleinsäuresequenzen umfassen, die mit einer Nukieotidsequenz gemäß SEQ ID NO. 7, SEQ !D NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11 oder SEQ ID NO. 12 unter stringenten Hybridisierungsbedingungen hybridisieren.
Die Nukleinsäuresequenzidentität wird hierbei typischerwetse mit einem
Sequenzvergleichsalgorithmus bestimmt. Hierzu werden zwei Sequenzen miteinander entweder über ihre gesamte Länge oder über die Länge eines zuvor definierten Segmentes verglichen, das mindestens die Hälfte der Nukleotide einer der beiden Sequenzen ausmacht. Innerhalb des Vergleichsfensters, d.h. des Bereiches der beiden Sequenzen, der verglichen werden soll, wird die Zahl an identischen Nukleotiden an identischen oder vergleichbaren Positionen bestimmt. Hierzu kann es nötig sein, Lücken in eine Sequenz einzuführen. Im Rahmen der Erfindung soll ein Aminosäuresequenz besonders bevorzugt mit einem im Stand der Technik bekannten
Algorithmus durchgeführt werden, insbesondere mit einem der folgenden Algorithmen, die auf der Homepage des NCBI zur Verfügung gestellt werden: BLASTn, megablast oder
discontiguous blast (siehe Johnson 2008, Nucleic Acids Res. 1 ;36(Web Server issue):W5-9). Bevorzugt sind hierbei die vorgegebenen Standard-Einstellungen zu verwenden.
Insbesondere handelt es sich bei den erfindungsgemäß eingesetzten Polynukleotiden um die Gene hmgs (SEQ ID NO. 7), hmgr (SEQ !D NO. 8), mvaK1 (SEQ ID NO. 9), mvaK2 (SEQ !D NO. 10), mvaD (SEQ ID NO. 11 ) und fni (SEQ iD NO.12) aus Myxococcus xanthus. Die Enzyme des heterologen Mevalonatweges eines Bakteriums nach dieser Ausführungsvariante weisen die Pepttdsequenzen gemäß SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5 bzw. SEQ ID NO. 6 auf. Die Verwendung prokaryotischer MVA Gene, insbesondere aus Myxococcus xanthus, ist mit Vorteilen verbunden. Der vergleichbare GC-Gehalt, wie aus Myxococcus xanthus von ca. 70%, resultiert in einem sehr guten Codonanpassungsindex (Codon Adaptation Indices, CAI), beispielsweise zwischen etwa 0,7 und etwa 0,9, für die MVA Gene.
Nach einem weiteren Aspekt der Erfindung ist die rekombinante DNA, kodierend für die genannten Enzyme des heterologen Mevalonatweges, in einem einzigen Operon angeordnet. Dies ermöglicht eine bessere Co-Regulation der Expression mit Hilfe eines einzigen Promotors. Bei Bedarf können weitere heterologe Gene in ein solches Operon mit integriert werden.
Die rekombinante DNA, kodierend für die genannten Enzyme des heterologen
Mevalonatweges, wird hier synonym auch mit MVA Gene bezeichnet.
Nach einer vorteilhaften Weiterentwicklung ist die Ribosomenbindungsstelle (RBS) wenigstens eines der genannten MVA Gene im Hinblick auf die Translationsinitiation für die heterologe Expression in dem Bakterium optimiert.
Nach einer vorteilhaften Ausführung ist die RBS des Gens für die heterologe
Isopentenylpyrophosphat-Isomerase im Hinblick auf die Translationsinitiation optimiert. Eine solche RBS- optimierte Variante des Gens, insbesondere des Gens fni aus Myxococcus xanthus, weist eine TIR (translation Initiation rate nach Salis 2011) von 50 bis 200.000, vorzugsweise von 50 bis 100.000, besonders bevorzugt 50.000 bis 100.000, auf.
Nach einer weiteren vorteilhaften Ausführung ist die RBS des Gens für die heterologe
Hydroxymethylglutaryl-CoA Synthase (HMG-CoA Synthase) im Hinblick auf die
Translationsinitiation optimiert. Eine solche RBS-optimierte Variante des Gens, insbesondere des Gens hmgs aus Myxococcus xanthus, weist eine TIR von 50 bis 100.000, vorzugsweise von 50 bis 50.000, besonders bevorzugt 1.000 bis 50.000, auf. Nach einer weiteren bevorzugten Ausführungsform der Erfindung kodiert die rekombinante DNA des Bakteriums weiterhin für wenigstens eine heterologe Terpensynthase, wobei die
Terpensynthase ausgewählt ist aus der Gruppe bestehend aus einer Sesquiterpen-Synthase und Di- terpen-Synthase. Man erkennt, dass die von den genannten Terpensynthasen gebildeten Sesquiterpene bzw. Diterpene biotechnologisch wertvolle Produkte sind.
Nach einer Abwandlung handelt es sich bei der wenigstens einen heterologen Terpensynthase um eine Sesquiterpen-Synthase. Die Sesquiterpen-Synthase ist vorzugsweise ein Enzym zur Synthese eines zyklischen Sesquiterpens, wobei die Sesquiterpene insbesondere ausgewählt sind aus der Gruppe bestehend aus α-Humulen, verschiedenen Epimeren des Santalens, wie α-Santalen, ß-Santalen, epi-ß-Santalen oder α-exo-Bergamoten, und Bisabolenen, wie ß- Bisabolen. Die Sesquiterpen-Synthase ist weiter vorzugsweise eine α-Humulen-Synthase oder eine Santalen-Synthase. Hierbei ist festzustellen, dass insbesondere die Santalen-Synthase ein sehr breites Produktspektrum besitzt und somit eine große Vielfalt an verschiedenen Sesquiterpen des Santa!en-Typs erhältlich ist.
Die Sesquiterpen-Synthase ist vorzugsweise eine Sesquiterpen-Synthase pflanzlichen
Ursprungs. Vorzugsweise ist die Sesquiterpen-Synthase ein Enzym aus einem Organismus, wobei der Organismus ausgewählt ist aus der Gruppe bestehend aus der Gattung Zingiber und Santaium. Sesquiterpen-Synthasen aus anderen Organismen können bei entsprechender Eignung ebenfalls verwendet werden.
Die Sesquiterpen-Synthase umfasst nach einem weiteren Aspekt eine Peptidsequenz mit einer Identität von wenigstens 60% zu einem Polypeptid ausgewählt aus der Gruppe bestehend aus einem Polypeptid der Peptidsequenz nach SEQ ID NO. 15, einem Polypeptid der
Peptidsequenz nach SEQ ID NO. 45 und einem Polypeptid der Peptidsequenz nach SEQ ID NO. 46.
Sesquiterpen-Synthasen im Sinne der Erfindung können ebenfalls Enzyme mit entsprechender Aktivität sein, die von Polynukleotiden kodiert werden, die Nukleinsäuresequenzen umfassen, die mit einer Nukleottdsequenz, die eines der Polypeptide nach SEQ ID NO: 15, 45 oder 46 kodiert, unter stringenten Hybridisierungsbedingungen hybridisieren.
Die genannte Peptidsequenz einer Sesquiterpen-Synthase besitzt weiter vorzugsweise eine Identität von wenigstens 65%, wenigstens 70%, wenigstens 75%, wahlweise wenigstens 80%, insbesondere wenigstens 85%, weiter insbesondere wenigstens 90%, vorzugsweise wenigstens 95%, weiter bevorzugt wenigstens 98% und besonders bevorzugt wenigstens 99%, zu einem Polypeptid ausgewählt aus der Gruppe bestehend aus einem Polypeptid der Peptidsequenz nach SEQ ID NO. 5, einem Polypeptid der Peptidsequenz nach SEQ ID NO. 45 und einem Polypeptid der Peptidsequenz nach SEQ ID NO. 46.
Vorzugsweise ist die Sesquiterpen-Synthase ein Enzym aufweisend ein Polypeptid mit entsprechender Aktivität aus Zingibe rzerumbet, Santaium album oder Santaium spicatum.
Bei der Sesquiterpen-Synthase handelt es sich insbesondere um die α-Humulen-Synthase aus Zingiber zerumbet, welche ein Polypeptid gemäß der Peptidsequenz nach SEQ ID NO. 15 aufweist. Nach einer Weiterentwicklung wird die α-Humulen-Synthase, die ein Polypeptid gemäß der Peptidsequenz nach SEQ iD NO. 15 aufweist, von einer rekombinanten DNA umfassend eine Polynukleotid mit einer Nukleinsäuresequenz gemäß SEQ ID NO. 16 kodiert. Bei der genannten Nukleinsäuresequenz gemäß SEQ ID NO. 16 handelt es sich um das Gen zssl aus Zingiber zerumbet, welches für die Expression in Methyiobacterium extorquens AM1 Codon-optimiert wurde. Bei der Sesquiterpen-Synthase handelt es sich nach einer alternativen Ausführung insbesondere um die Santalen-Synthase SsaSSy aus Santalum album, welche ein Polypeptid gemäß der Peptidsequenz nach SEQ ID NO. 45 aufweist. Bei der Sesquiterpen-Synthase handelt es sich nach einer weiteren alternativen Ausführung vorzugsweise um die Santalen-Synthase SspiSSy aus Santalum spicatum, weiche ein
Polypeptid gemäß der Peptidsequenz nach SEQ ID NO. 46 aufweist.
Nach einer alternativen Abwandlung handelt es sich bei der wenigstens einen heterologen Ter- pensynthase um eine Diterpen-Synthase. Die Diterpen-Synthase ist vorzugsweise ein Enzym zur Synthese eines Diterpens, wobei das Diterpen ausgewählt ist aus der Gruppe bestehend aus Sclareol, Cis-Abienol, Abitadien, Isopimaradien, Manool und Larixol. Vorzugsweise ist die Diterpen-Synthase pflanzlichen Ursprungs insbesondere aus den Gattungen Salvia oder Abies. Die Diterpen-Synthase umfasst nach einem weiteren Aspekt eine Peptidsequenz mit einer Identität von wenigstens 40% zu einem Polypeptid der Peptidsequenz nach SEQ ID NO. 47.
Diterpen-Synthasen im Sinne der Erfindung können ebenfalls Enzyme mit entsprechender Aktivität sein, die von Polynukleotiden kodiert werden, die Nukleinsäuresequenzen umfassen, die mit einer Nukleotidsequenz, die das Polypeptid nach SEQ ID NO: 47 kodiert, unter stringenten Hybridisierungsbedingungen hybridisieren.
Die genannte Peptidsequenz einer Diterpen-Synthase besitzt weiter vorzugsweise eine Identität von wenigstens 45%, wenigstens 50%, wenigstens 55%, wenigstens 60%, wenigstens 65%, wenigstens 70%, wenigstens 75%, wahlweise wenigstens 80%, insbesondere wenigstens 85%, weiter insbesondere wenigstens 90%, vorzugsweise wenigstens 95%, weiter bevorzugt wenigstens 98% und besonders bevorzugt wenigstens 99%, zu einem Polypeptid der
Peptidsequenz nach SEQ ID NO. 47. Die Diterpen-Synthase ist weiter vorzugsweise ausgewählt aus der Gruppe bestehend aus den beiden monofunktionaien Typ I und Typ II Diterpensynthasen SsLPS, die Salvia sclarea LPP Synthase und SsSCS, die S. sclarea Sclareol Synthase (Caniard et al., BMC Plant Biol 2012 Jul 26;12:119), die co-exprimiert werden, die bifunktionelie TypI/TypII Diterpensynthase cis-Abienol- Synthase AbCAS, aus Abies baisamea (Zerbe et al., J Biol Chem 2012 Apr 6;287(15):12121-31), die LPP-Synthase NtCPS2 und die cis-Abienol-Synthase NtABS aus Nicotiana tabacum
(Sallaud et al., Plant J 2012 Oct;72(1):1 -17)
Bei der Diterpen-Synthase handelt es sich nach einem Aspekt insbesondere um die die bifunktionelle TypI/TypII Diterpensynthase cis-Abienol-Synthase AbCAS aus Abies baisamea, welche ein Polypeptid gemäß der Peptidsequenz nach SEQ ID NO. 47 aufweist.
Besonders bevorzugt wird die cis-Abienol-Synthase von einem für M. extorquens AM1 Codon- optimierten Polynukleotid kodiert, ganz besonders bevorzugt von einem Polynukleotid, das eine Sequenz mit SEQ ID NO: 50 aufweist.
Wie bereits oben ausgeführt, bilden die Prenyldiphosphat- Vorstufen - wie FPP oder GGPP - die jeweiligen Substrate der Terpensynthasen. Somit erkennt der Fachmann, dass bei Auswahl einer bestimmten Terpensynthase die geeignete Synthase für die Bereitstellung der passenden Prenyldiphosphat-Vorstufe ausgewählt werden muss.
Nach einer vorteilhaften Weiterentwicklung ist die RBS des Gens für die Sesquiterpen-Synthase im Hinblick auf die Translationsinitiation optimiert. Eine solche RBS-optimierte Variante des Gens weist eine TIR (translation initiation rate) von mindestens 50.000, insbesondere 50.000 bis 400.000, vorzugsweise von 200.000 bis 300.000, besonders bevorzugt 210.000 bis 250.000, auf.
Das Bakterium nach einer weiteren Ausführungsform weist zusätzlich zur rekombinanten DNA kodierend für wenigstens ein Enzym eines heterologen Mevalonatweges weiterhin bei Bedarf rekombinante DNA kodierend für wenigstens eine Synthase einer Prenyldiphosphat-Vorstufe auf.
Die Synthase einer Prenyldiphosphat-Vorstufe ist entweder ein endogenes oder ein heterologes Enzym. Im Falle einer endogenen Synthase einer Prenyldiphosphat-Vorstufe ist das dafür kodierende Gen vorzugsweise mit Hilfe eines geeigneten Promotors überexprimierbar.
Nach einer bevorzugten Ausführung weist das Bakterium zusätzlich zur rekombinanten DNA kodierend für wenigstens ein Enzym eines heterologen Mevalonatweges weiterhin
rekombinante DNA kodierend für wenigstens eine heterologe Synthase einer Prenyldiphosphat- Vorstufe auf. Bei Bedarf kann eine heterologe Synthase einer Prenyldiphosphat-Vorstufe zusätzlich zu einem entsprechenden endogenen Enzym exprimierbar sein.
Die Synthase der Prenyldiphosphat-Vorstufe ist ein Enzym ausgewählt aus der Gruppe bestehend aus Farnesyldiphosphat-Synthase (FPP-Synthase) und Geranylgeranyldiphosphat- Synthase (GGPP-Synthase). Man erkennt, dass die von den genannten Synthasen gebildeten Prenyldiphosphat-Vorstufen, FPP bzw. GGPP, wichtige Vorläufermoleküle für eine Synthese von biotechnoiogisch wertvollen Sesquiterpenen bzw. Diterpenen sind. Gemäß einer Abwandlung ist die Synthase einer Prenyldiphosphat-Vorstufe eine heterologe FPP-Synthase, wobei es sich um eine eukaryotische oder prokaryotische heterologe FPP- Synthase handeln kann. Die heterologe FPP-Synthase kann beispielsweise bakteriellen Ursprungs sein oder aus einem Pilz stammen. Die heterologe FPP-Synthase ist insbesondere ein Enzym aus einem Pilz, vorzugsweise aus einer Hefe, wie der Gattung Saccharomyces. Die FPP-Synthase umfasst nach einem weiteren Aspekt eine Peptidsequenz mit einer Identität von wenigstens 60% zur Peptidsequenz nach SEQ ID NO. 13. Die FPP-Synthase ist insbesondere eine eukaryotische FPP-Synthase. FPP-Synthasen im Sinne der Erfindung können ebenfalls Enzyme mit entsprechender Aktivität sein, die von Polynukleotiden kodiert werden, die Nukleinsäuresequenzen umfassen, die mit einer Nukleotidsequenz, die das Polypeptid nach SEQ ID NO: 13 kodiert, unter stringenten Hybridisierungsbedingungen hybridisieren. Die genannte Peptidsequenz einer FPP-Synthase besitzt nach einer weiteren Ausführung vorzugsweise eine Identität von wenigstens 65%, wenigstens 70%, wenigstens 75%, wahlweise wenigstens 80%, insbesondere wenigstens 85%, weiter insbesondere wenigstens 90%, vorzugsweise wenigstens 95%, weiter bevorzugt wenigstens 98% und besonders bevorzugt wenigstens 99%, zur SEQ ID NO. 13 auf.
Nach einem weiteren Aspekt eines erfindungsgemäßen Bakteriums umfasst die rekombinante DNA, kodierend für die FPP-Synthase, ein Polynukleotid mit einer Identität von wenigstens 60%, wenigstens 65%, wenigstens 70%, wenigstens 75%, wahlweise wenigstens 80%, insbesondere wenigstens 85%, weiter insbesondere wenigstens 90%, vorzugsweise wenigstens 95%, weiter bevorzugt wenigstens 98% und besonders bevorzugt wenigstens 99% zu einer Nukleotidsequenz gemäß SEQ ID NO 14.
Die FPP-Synthase ist vorzugsweise eine FPP-Synthase aus Saccharomyces cerevisiae. FPP- Synthasen aus anderen Organismen können bei entsprechender Eignung ebenfalls verwendet werden. Bei der FPP-Synthase handelt es sich insbesondere um die FPP-Synthase ERG20 aus Saccharomyces cerevisiae, welche einem Polypeptid nach SEQ ID NO. 13 aufweist.
Gemäß einer Ausführung wird die FPP-Synthase ERG20 aus Saccharomyces cerevisiae aufweisend ein Polypeptid nach SEQ I D NO. 13 insbesondere vom einem Poiynukieotid mit einer Sequenz gemäß SEQ ID NO. 14 kodiert.
Gemäß einer weiteren Abwandlung ist die Synthase einer Prenyldiphosphat-Vorstufe eine heterologe Geranylgeranyldiphosphat-Synthase (GGPP-Synthase). Die heterologe GGPP- Synthase ist insbesondere ein entsprechendes Enzym aus einem Bakterium, einer Pflanze oder einem Pilz. Vorzugsweise ist die GGPP-Synthase ein Enzym aus einem Organismus, wobei der Orga nismus ausgewählt ist aus der Gruppe bestehend aus einem Bakterium der Familie der Enterobacteriaceae, einer Pflanze der Gattung Taxus und einem Pilz der Gattung
Saccharomyces. Geeignete GGPP-Synthasen aus Bakterien der Familie der
Enterobacteriaceae können beispielsweise entsprechende Enzyme aus Bakterien der Gattung Pantoea sein.
Die GGPP-Synthase umfasst nach einem weiteren Aspekt eine Peptidsequenz mit einer Identität von wenigstens 60% zu einem Polypeptid ausgewählt aus der Gruppe bestehend aus einem Polypeptid der Peptidsequenz nach SEQ ID NO. 43, einem Polypeptid der
Peptidsequenz nach SEQ ID NO. 44 und einem Polypeptid der Peptidsequenz nach SEQ ID NO. 42.
GGPP-Synthasen im Sinne der Erfindung können ebenfalls Enzyme mit entsprechender Aktivität sein, die von Polynukleotiden kodiert werden, die Nukleinsäuresequenzen umfassen, die mit einer Nukleotidsequenz, die eines der Polypeptide nach SEQ ID NO: 43, 44 oder 42 kodiert, unter stringenten Hybridisierungsbedingungen hybridisieren.
Die genannte Peptidsequenz einer GGPP-Synthase besitzt weiter vorzugsweise eine Identität von wenigstens 65%, wenigstens 70%, wenigstens 75%, wahlweise wenigstens 80%, insbesondere wenigstens 85%, weiter insbesondere wenigstens 90%, vorzugsweise wenigstens 95%, weiter bevorzugt wenigstens 98% und besonders bevorzugt wenigstens 99%, zu einem Polypeptid ausgewählt aus der Gruppe bestehend aus einem Polypeptid der Peptidsequenz nach SEQ ID NO. 43, einem Polypeptid der Peptidsequenz nach SEQ ID NO. 44 und einem Polypeptid der Peptidsequenz nach SEQ ID NO. 42.
Vorzugsweise ist die GGPP-Synthase ein Enzym aufweisend ein Polypeptid mit entsprechender Aktivität aus Pantoea aggiomerans oder Pantoea ananatis, Taxus canadensis oder
Saccharomyces cerevisiae.
Nach einem weiteren Aspekt ist die GGPP-Synthase ein Enzym ausgewählt aus der Gruppe bestehend aus der GGPP-Synthase crtE aus Pantoea aggiomerans aufweisend eine
Peptidsequenz nach SEQ ID NO. 43, der GGPP-Synthase aus Taxus canadensis aufweisend eine Peptidsequenz nach SEQ ID NO. 44 und der GGPP-Synthase BTS1 aus Saccharomyces cerevisiae aufweisend eine Peptidsequenz nach SEQ ID NO. 42. GGPP-Synthasen aus anderen Organismen können bei entsprechender Eignung ebenfalls verwendet werden. Nach einer vorteilhaften Weiterentwicklung ist die RBS der rekombinanten DNA, also des Gens für die heterologe Synthase einer Prenyldiphosphat-Vorstufe, wie FPP-oder GGPP-Synthase, im Hinblick auf die Transtationsinitiation optimiert. Eine solche RBS-optimierte Variante des Gens weist eine TIR (transiation Initiation rate) von 500 bis 100.000, vorzugsweise von 10.000 bis 50.000, besonders bevorzugt 20.000 bis 40.000, auf.
Nach einer vorteilhaften Ausführung der Erfindung werden die RBS für die Gene kodierend für die heterologe Terpensynthase und die heterologe Synthase einer Prenyldiphosphat-Vorstufe dahingehend angepasst, dass der TIR-Wert für die heterologe Terpensynthase höher ist als der TIR-Wert für die heterologe Synthase einer Prenyldiphosphat-Vorstufe. Damit kann vermieden werden, dass sich Prenyldiphosphat-Vorstufen, mit unter Umständen toxischen Effekten, akkumulieren. Erforderlichenfalls ist die rekombinante DNA Codon-optimiert für eine Expression in dem erfindungsgemäßen Bakterium. Beispielsweise ist das Gen kodierend für die heterologe Terpensynthase Codon-optimiert für das erfindungsgemäße Bakterium. Somit kann die
Expression in dem methylotrophen Bakterium verbessert werden.
Nach einer weiteren Ausführungsvariante des Baktertums kodiert die rekombinante DNA für die FPP-Synthase die ERG20 FPP-Synthase aus Saccharomyces cerevisiae und kodiert die rekombinante DNA für die Sesquiterpen-Synthase die α-Humu!en-Synthase aus Zingiber zerumbet.
Das Bakterium nach einer der Ausführungen ist vorzugsweise dahin weiterentwickelt, dass die rekombinante DNA zur heterologen Expression der genannten Enzyme mit einem
gemeinsamen Promotor oder mehreren unabhängig voneinander tnduzierbaren Promotoren versehen ist. Dies kann für die jeweiligen Gene unterschiedlich ausgestaltet sein. Die induzierbaren Promotoren können dabei unterschiedlicher Natur sein, sodass sie unabhängig voneinander regulierbar sind. Vorzugsweise werden alle Gene zur Expression der hier genannten Enzyme mit dem gleichen gemeinsamen induzierbaren Promotor versehen.
Induzierbare Promotor-Systeme sind dem Fachmann grundsätzlich bekannt. Vorzugsweise wird hier ein sehr„dichtes" Promotor-System genutzt. Auf diese Weise lässt sich die Expression der rekombinannten Gene gezielt erst zu einem gewünschten Zeitpunkt der Kultivierung
einschalten. Insbesondere für die Regulation der Expression der MVA Weg Gene ist ein besonders„dichtes" Promotor- System von Vorteil, da ansonsten wachstumsbeeinflussende Effekte auftreten können. Besonders bevorzugt ist ein Cumat-induzierbares System.
Gemäß einer vorteilhaften Ausgestaltung des Bakteriums ist die rekombinante DNA jeweils plasmidständig oder chromosomal exprimierbar. Auch dies kann für die jeweiligen Gene unterschiedlich ausgestaltet sein. Geeignete chromosomale Stellen und Techniken zur stabilen Integration in das Genom sind dem Fachmann bekannt. Zum Zweck einer plasmidständigen Expression werden geeignete Plasmide mit der rekombinanten DNA in das Bakterium durch Transformation eingebracht. Das erfindungsgemäße Bakterium wird somit vorzugsweise durch Transformation mit einem oder mehreren Plasmid(en), welche(s) die entsprechende
rekombinante DNA trägt bzw. tragen, erhalten.
Nach einer bevorzugten Ausführungsvariante weist das erfindungsgemäße Bakterium wenigstens ein durch Transformation eingebrachtes Plasmid auf, wobei das wenigstens eine Plasmid folgende rekombinante DNA umfasst:
rekombinante DNA kodierend für wenigstens ein wie oben genanntes Enzym eines heterologen Mevalonatweges, wobei das Enzym des Mevalonatweges ausgewählt ist aus der Gruppe bestehend aus Hydroxymethylglutaryl-CoA-Synthase (HMG-CoA- Synthase), Hydroxymethyl- glutaryl-CoA-Reduktase (HMG-CoA-Reduktase), Mevalonat- Kinase, Phosphomevaionat-Kinase, Pyrophosphomevalonat-Decarboxylase und Isopentenyipyrophosphat-Isomerase;
gegebenenfalls rekombinante DNA kodierend für wenigstens eine wie oben genannte heterologe Synthase einer Prenyldiphosphat-Vorstufe; und
- rekombinante DNA kodierend für wenigstens eine wie oben genannte heterologe
Terpensynthase.
Das methy!otrophe Bakterium im Sinne der vorliegenden Erfindung ist insbesondere ein Proteobakterium. Ein bevorzugtes methylotrophes Proteobakterium ist ausgewählt aus den Gattungen Methylobacterium und Methylomonas. Weiter vorzugsweise ist das methylotrophe Prote- obakterium ein Stamm der Gattung Methylobacterium, insbesondere ein Stamm von Methylobacterium extorquens. Besonders bevorzugt ist der Stamm Methylobacterium extorquens AM1 oder der Stamm Methylobacterium extorquens PA1. Weiterhin wird bevorzugt ein Stamm des methylotrophen Bakteriums, insbesondere der Gattungen Methylobacterium und Methylomonas, vorzugsweise von Methylobacterium extorquens AM1 oder PA1 , mit fehlender Carotenoid-Biosynthese Aktivität, vorzugsweise mit einem Defekt im Gen crtNb (Diapolycopin-Oxidase) (Van Dien et al., 2003, Appl Environ Microbiol 69, 7563-6.). Ein solcher Stamm weist keine Carotenoid-Biosynthese Aktivität auf, insbesondere fehlt eine Diapolycopin-Oxidase Aktivität. Dadurch ist eine weitere Verbesserung der Terpensyntheserate möglich.
Ein weiterer Aspekt der vorliegenden Erfindung betrifft ein Verfahren zur mikrobiellen de novo Synthese von Sesquiterpenen oder Diterpenen aus Methanol und/oder Ethanol, umfassend die folgenden Schritte:
Bereitstellen eines Methanol und/oder Ethanol enthaltenden wässrigen Mediums, Kultivierung eines methylotrophen Bakteriums gemäß einem der oben dargestellten Ausführungsvarianten in dem genannten Medium in einem Bioreaktor, wobei Methanol und/oder Ethanol durch das Bakterium zu einem Terpen umgesetzt wird,
Abtrennung des im Bioreaktor gebildeten Sesquiterpens oder Diterpens.
Das eingesetzte wässrige Medium kann Methanol, Ethanol oder eine Mischung aus Methanol und Ethanol aufweisen. Bei Bedarf können weitere Substrate hinzugesetzt sein. Von Vorteil kann es sein, dass ausschließlich Methanol oder Ethanol im wässrigen Medium enthalten ist, also die mikrobielle de novo Synthese von Sesquiterpenen oder Diterpenen entweder aus Methanol oder aus Ethanol erfolgt.
Die Verwendung von Methanol bringt zahlreiche Vorteile mit sich: Methanol kann sowohl petrochemisch als auch aus nachwachsenden Rohstoffen oder zukünftig sogar aus CO2 hergestellt werden. Es gibt weder saisonale (Wetter und Jahreszeit) noch regionale
Abhängigkeiten, was eine langfristige Produktionsplanung ermöglicht. Außerdem ist es wahrscheinlich, dass der Preis von Methanol im Gegensatz zu dem des Zuckers in Zukunft sinkt, aufgrund von vielen geplanten oder in Bau befindlichen Produkttonsanlagen. Es handelt sich bei Methanol um eine Kohlenstoffquelle in Alternative zu den ansonsten häufig
eingesetzten Zuckersubstraten.
Im Methanol, wie auch im Ethanol hat der Kohlenstoff im Vergleich zu Kohlenhydraten/Zuckern eine niedrigere Oxidationsstufe. Damit können in der Oxidation von Methanol zu CO2 mehr Elektronen freigesetzt werden, als im Fall der vollständigen Oxidation von Zucker zu CO2. Für die Synthese von stark reduzierten Verbindungen wie Terpenen ist es deshalb vorteilhaft möglichst Kohlenstoffquellen einzusetzen, die eine niedrige Oxidationsstufe aufweisen.
Methanol und Ethanol erfüllen diese Voraussetzungen besser als Kohlenstoff aus Zuckern. Damit ist der Einsatz von Methanol/Ethanol vorteilhafter für die Herstellung von Terpenen als ausgehend von Kohlenhdyraten. Die Verwendung von Ethanol bringt ebenfalls zahlreiche Vorteile mit sich: Ethanol steht beispielsweise aus Biomassevergärung, also Bio-Ethanol, als„natürliches" Substrat zur Verfügung.
Weiterhin ermöglicht insbesondere der Einsatz von Bio-Ethanol zur mikrobiellen de novo Synthese von Sesquiterpenen oder Diterpenen eine vorteilhafte Deklaration der gebildeten Sesquiterpen- und Diterpen-Produkte als„natürliche Aromastoffe". Es handelt sich bei Ethanol um eine alternative Kohlenstoffquelle zu den ansonsten häufig eingesetzten Zuckersubstraten.
Die erfindungsgemäßen Bakterien wachsen bei Bedarf sowohl auf Methanol als auch auf Ethanol als jeweils einziger Kohlenstoffquelle. Bei einer Weiterentwicklung des Verfahrens ist in dem genannten Medium Methanol und/oder Ethanol als einzige Kohlenstoff-Quelle für die Kultivierung des genannten Bakteriums enthalten. Darunter wird insbesondere verstanden, dass keine weitere Kohienstoffqueile zielgerichtet dem Medium zugesetzt wird bzw. in größeren Anteilen enthalten ist. Es ist ersichtlich, dass Spuren von weiteren Kohlenstoffquellen nicht immer vermeidbar sind und enthalten sein können, ohne den Rahmen der genannten erfindungsgemäßen Weiterentwicklung des Verfahrens zu verlassen.
Gemäß einer vorteilhaften Ausführung des Verfahrens wird eine Methanol- und/oder Ethanol- limitierte Fed-batch Fermentation durchgeführt.
Im Sinne einer bevorzugten Ausführung des Verfahrens erfolgt eine prozessbegleitende Abtrennung des Sesquiterpens oder Diterpens aus dem Bioreaktor, also insbesondere ein in situ-product-removal (ISPR) im Fermenter. Ein wichtiger Aspekt der industriellen
Biotechnologie, ist neben der eigentlichen Produktsynthese auch dessen Aufarbeitung. Eine prozessbegleitende Produktabtrennung (In situ product-removal, ISPR) reduziert sowohl die toxischen Effekte des Produktes auf den Mikroorganismus als auch die Kosten des Prozesses. Das ISPR erfolgt hier insbesondere durch ein Stripping des Terpens. Dabei wird das Terpen vorzugsweise in den Abgasstrom überführt und anschließend in einem organischen Lösungsmittel gelöst. Besonders vorteilhaft ist, dass die genannten methylotrophen Bakterien aufgrund des reduzierten Substrates Methanol oder Ethanol im Gegensatz zu konventionellen Mikroorganismen, die mit Zucker wachsen, mit deutlich höherer Belüftungsrate kultiviert werden und dadurch gleichzeitig das Stripping flüchtiger Fermentationsprodukte, insbesondere der gebildeten Sesquiterpene oder Diterpene, wesentlich begünstigt wird.
Bei einer Weiterentwicklung des Verfahrens erfolgt die Kultivierung in einem wässrig- organischen Zweiphasen System, wobei die organische Phase insbesondere durch eine aliphatische Kohlenwasserstoffverbindung, insbesondere ein Alkan, vorzugsweise Dodekan oder Dekan, ausgebildet ist. Die gebildeten Terpene weisen eine gute Lösüchkeit in der genannten organischen Phase auf.
Gemäß einer vorteilhaften Ausführung des Verfahrens wird die Kultivierung bei im Wesentlichen konstantem pH durchgeführt. Insbesondere wird das Verfahrens bei einem gelösten Sauerstoff Level von > 30% und/oder einer Methanol oder Ethanol Konzentrationen von etwa 1 g/L durchgeführt.
Bei einer Weiterentwicklung des Verfahrens wird eine Terpenkonzentration von mehr als 0,75, 0,8, 0,9, vorzugsweise mehr als ,0 g/l, weiter bevorzugt mehr als ,5 g/l, bezogen jeweils auf das Volumen der wässrigen Phase, erreicht.
Ein weiterer Aspekt der vorliegenden Erfindung betrifft die Verwendung eines Methanol oder Ethanol enthaltenden Mediums zur Kultivierung eines rekombinanten methylotrophen
Bakteriums nach einem der oben beschriebenen Ausführungsformen für die mikrobielie de novo Synthese von Terpenen aus Methanol und/oder Ethanol. Die Verwendung eines Methanol oder Ethanol Minimalmediums reduziert sowohl das Kontaminationsrisiko, da Methanol und Ethanol für viele Mikroorganismen toxisch oder wachstumshemmend ist, als auch den Aufwand bei der Produktaufarbeitung, da keine Komplexbestandteile vom eigentlichen Produkt abgetrennt wer- den müssen.
Zahlreiche Fakten sprechen für eine vorteilhafte Verwendung von Methanol und/oder Ethanol gegenüber Zuckern: i) Zucker ist nicht nur Glukose, deren Aufreinigung zur Gewährleistung der Ausbeuten regelmäßig notwendig ist, wobei eine evaluierte Aufreinigung mit Kosten verbunden ist, ü) es ist mit einem Anstieg der Zuckerpreise in den nächsten Jahren zu rechnen, wohingegen die Methanol- und Ethanol Preise aufgrund wesentlich erweiterter
Produktionskapazitäten voraussichtlich sinken werden, iii) Methanol und Ethanol reduzieren wesentlich Kontaminationsrisiken im Vergleich zu Zucker-basierten Fermentationen, was den Sterilisierungsaufwand reduziert, iv) Methanol oder Ethanol Minimal Medium enthält keine komplexen chemischen Verbindungen im Gegensatz zu Medium mit Glukose oder anderen Zuckerquellen (wie Maisquellwasser oder Lignocellulose) als Kohlenstoffquelle, was
Aufreinigungsprozesse vereinfacht. Ein geeignetes Fermentationsmedium kann beispielsweise folgende Zusammensetzung aufweisen: Wasser, Methanol oder Ethanol sowie weitere Komponenten ausgewählt aus der Gruppe bestehend aus PI PES, NaH2P04, K2HPO4, MgCl2, (NH4)2S04, CaCl2, Natriumeitrat , ZnS04, MnCl2, FeS04, (ΝΗ4)6Μθ7θ24, CuS04 und CoCl2-
Eine weitere Steigerung der Terpen Bildung kann durch Blockierung der Carotenoid-Synthese beim eingesetzten Proteobacterium erreicht werden. Dazu werden vorteiihafterweise die genannten Stämme der Gattung Methyiobacterium oder der Gattung Methytomonas mit fehlender Carotinoid-Biosynthese Aktivität, insbesondere mit fehlender Diapolycopin-Oxidase Aktivität, eingesetzt. Eine maximale Terpen Konzentration von über 1 ,5 g/l, insbesondere von etwa 1 ,65 g/l, bezogen jeweils auf das Volumen der wässrigen Phase, kann somit erreicht werden. Die bereits genannte erfindungsgemäße Mutante von Methyiobacterium extorquens AM1 mit fehlender Carotenoid-Biosynthese Aktivität, insbesondere mit fehlender Diapolycopen Oxidase Aktivität, weist eine gesteigerte Terpen Produktion auf. Insbesondere wurde eine maximale a- Humulen Konzentration von über 1 ,5 g/l, insbesondere etwa 1 ,65 g/l, von einer Mutante von Methyiobacterium extorquens AM1 mit fehlender Carotenoid-Biosynthese Aktivität gebildet.
Bemerkenswert hierbei ist, dass die oben genannten Konzentrationen an Terpenen,
erfindungsgemäß bereits erreicht werden, ohne dass beispielsweise teures Lithiumacetoacetat oder DL-Mevalonat extern zugesetzt werden müssen. Weiterhin sind dazu insbesondere keine weiteren aufwändigen Maßnahmen zur Stammoptimierung zwingend erforderlich. Bereits daraus ergibt sich das erhebliche Potential der erfindungsgemäßen methylotrophen Bakterien sowie des genannten Verfahrens für die biotechnologische Produktion von Terpenen. Vorteilhaft ist weiterhin, dass die oben genannten Konzentrationen bereits unter Einsatz von
preisgünstigem Methanol oder Ethanol Minimal Medium erreicht werden. Im Gegensatz zum Stand der Technik ist kein Fermentationsmedium auf TB oder LB-Basis erforderlich. Daraus ergibt sich ein weiterer Vorteil in der Vereinfachung der Aufreinigung der gewonnenen
Terpen produkte, da ein klar definiertes Minimalmedium verwendet werden kann. Aufwändige Entfernung von Nebenprodukten kann minimiert werden. Darüber hinaus eröffnen die hier beschriebenen Stämme die Verwendung von Methanol oder Ethanol als einziger
Kohlenstoffquelle zum Wachstum.
Ein weiterer Aspekt der vorliegenden Erfindung betrifft die Verwendung eines methylotrophen Bakteriums nach einem der oben beschriebenen Ausführungsformen für die mikrobielie de novo Synthese von Terpenen aus Methanol und/oder Ethanol
Die nach dem erfindungsgemäßen Verfahren gebildeten Terpene sind ausgewählt aus der Gruppe bestehend aus Sesquiterpenen (C 5) und Dtterpenen (C20).
Terpene im Sinne des erfindungsgemäßen Verfahrens sind einerseits Sesquiterpene. Zu den biotechnologisch interessanten Sesquiterpenen gehören demnach beispielsweise
Sesquiterpene ausgewählt aus der Gruppe bestehend aus α-Humulen, verschiedene Epimere des Santalens wie α-Santalen, ß-Santalen, epi-ß-Santalen und α-exo-Bergamoten. Auch Bisabolene, wie das ß-Bisabolen, sind Sesquiterpene, die nach dem erfindungsgemäßen Verfahren erhältlich sind. Geeignete Sesquiterpen-Synthasen sind dem Fachmann
grundsätzlich bekannt. Die oben genannten methylotrophen Bakterien können somit mit den entsprechenden rekombinanten Genen kodierend für die geeigneten Sesquiterpen-Synthasen wahlweise ausgestattet sein. Insbesondere weist das methyiotrophe Bakterium dazu neben den heterolog exprimierten Genen des MVA Weges auch eine FPP-Synthase im oben genannten Sinne auf, Terpene im Sinne des erfindungsgemäßen Verfahrens sind andererseits Diterpene. Zu den biotechnologisch interessanten Diterpenen gehören danach beispielsweise Diterpene ausgewählt aus der Gruppe bestehend aus Sclareol, Cis-Abienol, Abitadien, Isopimaradien, Manooi und Larixol. Geeignete Diterpenen-Synthasen sind dem Fachmann grundsätzlich bekannt. Die oben genannten methylotrophen Bakterien können somit mit den entsprechenden rekombinanten Genen kodierend für die geeigneten Diterpenen-Synthasen wahlweise ausgestattet sein. Insbesondere weist das methyiotrophe Bakterium dazu neben den heterolog exprimierten Genen des MVA Weges auch eine GGPP-Synthase im oben genannten Sinne auf. Nach einer besonders bevorzugten Ausführung des erfindungsgemäßen Verfahrens wird das Sesquiterpen α-Humulen der Formel I
de novo aus Methanol und/oder Ethanol synthetisiert.
Nach weiteren bevorzugten Ausführungen des erfindungsgemäßen Verfahrens werden
Sesquiterpene des Santalen-Typs ausgewählt aus der Gruppe bestehend aus α-Santalen der Formel II, ß-Santalen der Formel Iii, epi-ß-Santalen der Formel IV, und α-exo-Bergamoten der Formel V
de novo aus Methanol und/oder Ethanol synthetisiert. Hierbei ist festzustellen, dass die Santalen-Synthase ein sehr breites Produktspektrum besitzt und somit eine große Vielfalt an verschiedenen Sesquiterpen des Santalen-Typs erhältlich ist.
Nach weiteren bevorzugten Ausführungen des erfindungsgemäßen Verfahrens werden die Diterpene Sclareo! der Formel VI und Cis-Abienoi der Formel VII
de novo aus Methanol und/oder Ethanol synthetisiert. Ein Bioreaktor im Sinne der vorliegenden Erfindung kann jedes geeignete Gefäß zur
Kultivierung von Bakterien sein. Im einfachsten Falle wird darunter ein Schüttelkolben verstanden. Ins- besondere wird darunter ein Fermenter verstanden. Der Bioreaktor kann für den kontinuierlichen Betrieb, den diskontinuierlichen Betrieb, den Fed-Batch-Betrieb oder die Batch Produktion geeignet sein.
Ein weiterer Aspekt der vorliegenden Erfindung betrifft die genannten Sesquiterpene (C15) und Diterpene (C20) erhältlich nach einem Verfahren gemäß einer der dargestellten Ausführungen.
Nachfolgend sind weitere Ausführungsformen der erfindungsgemäßen Bakterien, Verfahren und Verwendungen beschrieben: 1. Ein methylotrophes Bakterium aufweisend rekombinante DNA kodierend für wenigstens ein Polypeptid mit enzymatischer Aktivität zur Expression in dem genannten Bakterium, dadurch gekennzeichnet, dass das genannte wenigstens eine Polypeptid mit enzymatischer Aktivität ausgewählt ist aus der Gruppe bestehend aus
- wenigstens ein Enzym eines heterologen Mevalonatweges ausgewählt aus der Gruppe bestehend aus Hydroxymethy!glutaryl-CoA-Synthase (H G-CoA-Synthase),
Hydroxymethylglutaryl-CoA- eduktase (HMG-CoA-Reduktase), Mevaionat-Kinase,
Phosphomevalonat-Kinase, Pyrophosphomevalonat-Decarboxylase und
Isopentenylpyrophosphat-Isomerase;
- eine heterologe Terpensynthase und
gegebenenfalls eine Synthase einer Prenyldiphosphat-Vorstufe.
2. Das Bakterium nach Ausführungsform 1 , dadurch gekennzeichnet, dass das wenigstens eine Enzym des heterologen Mevalonatweges eine Peptidsequenz aufweist mit einer Identität von jeweils wenigstens 60% zur Peptidsequenz nach SEQ ID NO. 1 , SEQ ID NO, 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5 bzw. SEQ ID NO. 6.
3. Das Bakterium nach Ausführungsform 1 oder 2, dadurch gekennzeichnet, dass die heterologe Terpensynthase ausgewählt ist aus der Gruppe bestehend aus einer Sesquiterpen- Synthase und einer Diterpen-Synthase.
4. Das Bakterium nach Ausführungsform 3, dadurch gekennzeichnet, dass die heterologe Terpensynthase eine Sesquiterpen-Synthase ist, wobei die Sesquiterpen-Synthase ein Enzym zur Synthese eines zyklischen Sesquiterpens ist, das Sesquiterpen insbesondere ausgewählt ist aus der Gruppe bestehend aus a-Humulen und Epimeren des Santalens, wie α-Santalen, ß- Santalen, epi-ß-Santalen oder α-exo-Bergamoten, und Bisabolenen, wie b-Bisaboien.
5. Das Bakterium nach Ausführungsform 3, dadurch gekennzeichnet, dass die heterologe Terpensynthase eine Diterpen-Synthase ist, insbesondere ein Enzym zur Synthese eines Diterpens ist, das Diterpen insbesondere ausgewählt aus der Gruppe bestehend aus Sclareol, Cis-Abienol, Abitadien, Isopimaradien, Manool und Larixol.
6. Das Bakterium nach einer der Ausführungsformen 1 bis 5, dadurch gekennzeichnet, dass die Synthase einer Prenyldiphosphat-Vorstufe ein Enzym ausgewählt aus der Gruppe bestehend aus Farnesyldiphosphat-Synthase (FPP-Synthase) und Geranylgeranyldiphosphat-Synthase (GGPP-Synthase) ist.
7. Das Bakterium nach einer der Ausführungsformen 1 bis 6, dadurch gekennzeichnet, dass die Synthase einer Prenyldiphosphat-Vorstufe eine heterologe FPP-Synthase ist, wobei es sich bei der heterologen FPP-Synthase um eine eukaryotische oder prokaryotische FPP-Synthase handelt. 8. Das Bakterium nach einer der Ausführungsformen 1 bis 6, dadurch gekennzeichnet, dass die Synthase einer Prenyldiphosphat-Vorstufe eine heterologe GGPP-Synthase ist, wobei es sich bei der heterologen GGPP-Synthase um ein Enzym aus einem Organismus handelt, der ausgewählt ist aus der Gruppe bestehend aus Bakterien, Pflanzen und Pilzen.
9. Das Bakterium nach einer der Ausführungsformen 1 bis 8, dadurch gekennzeichnet, dass die rekombinante DNA zur heterologen Expression der genannten Enzyme mit einem
gemeinsamen induzierbaren Promotor oder mehreren unabhängig voneinander induzierbaren Promotoren versehen ist.
10. Das Bakterium nach einer der Ausführungsformen 1 bis 9, dadurch gekennzeichnet, dass die rekombinante DNA jeweils unabhängig voneinander plasmidständig oder chromosomal exphmierbar ist. 1 . Das Bakterium nach einer der Ausführungsformen 1 bis 10, dadurch gekennzeichnet, dass es sich bei dem Bakterium um ein methylotrophes Proteobakterium, insbesondere um ein Bakterium der Gattung Methy!obacterium oder der Gattung Methylomonas, vorzugsweise um das Bakterium Methylobacterium extorquens, handelt. 12. Das Bakterium nach einer der Ausführungsformen 1 bis 11 , dadurch gekennzeichnet, dass das Bakterium ein Stamm mit fehlender Carotinoid-Biosynthese Aktivität, insbesondere mit fehlender Diapolycopin-Oxidase Aktivität, ist.
13. Ein Verfahren zur mikrobiellen de novo Synthese von Sesquiterpenen oder Diterpenen aus Methanol und/oder Ethanol, umfassend die folgenden Schritte:
Bereitstellen eines Methanol und/oder Ethanol enthaltenden wässrigen Mediums, Kultivierung eines methyiotrophen Bakteriums gemäß einer der Ausführungsformen 1 bis 12 in dem genannten Medium in einem Bioreaktor, wobei Methanol und/oder Ethanol durch das Bakterium zu einem Terpen umgesetzt wird,
- Abtrennung des im Bioreaktor gebildeten Sesquiterpens oder Diterpens.
14. Das Verfahren nach Ausführungsform 13, dadurch gekennzeichnet, dass in dem genannten Medium Methanol und/oder Ethanol als einzige Kohlenstoff-Quelle(n) für die Kultivierung des genannten Bakteriums enthalten ist/sind.
15. Das Verfahren nach Ausführungsform 13 oder 14, dadurch gekennzeichnet, dass eine Methanol- und/oder Ethanol-Iimitierte Fed-batch Fermentation durchgeführt wird.
16. Das Verfahren nach einer der Ausführungsformen 13 bis 15, dadurch gekennzeichnet, dass die Kultivierung in einem wässrig-organischen Zweiphasen System erfolgt, wobei die organische Phase insbesondere durch eine aliphatische Kohlenwasserstoffverbindung, vorzugsweise Dodekan oder Dekan, ausgebildet ist. 17. Das Verfahren nach einer der Ausführungsformen 3 bis 16, dadurch gekennzeichnet, dass eine prozessbegleitende Abtrennung des Sesquiterpens oder Diterpensaus dem Bioreaktor erfolgt, also ein in situ product removal (ISPR). 18. Das Verfahren nach einer der Ausführungsformen 13 bis 17, dadurch gekennzeichnet, dass die Kultivierung bei im wesentlichen konstantem pH, gelöstem Sauerstoff Level von > 30% und/oder Methanol oder Ethanol Konzentrationen von etwa 1 g/L durchgeführt wird.
19. Das Verfahren nach einer der Ausführungsformen 13 bis 18, dadurch gekennzeichnet, dass eine Terpenkonzentration von mehr als 1 g/I, vorzugsweise mehr als 1 ,5 g/l, bezogen jeweils auf das Volumen der wässrigen Phase, erreicht wird.
20. Verwendung eines Methanol und/oder Ethanol enthaltenden Mediums zur Kultivierung eines rekombinanten methylotrophen Bakteriums nach einer der Ausführungsformen 1 bis 12 für die mikrobielle de novo Synthese von Sesquiterpenen oder Diterpenen aus Methanol und/oder Ethanol.
21. Verwendung eines methylotrophen Bakteriums nach einer der Ausführungsformen 1 bis 12 für die mikrobielle de novo Synthese von Sesquiterpenen oder Diterpenen aus Methanol und/oder Ethanol.
Die Erfindung ist nicht auf eine der vorbeschriebenen Ausführungsformen beschränkt, sondern in vielfältiger Weise abwandelbar. Der Fachmann erkennt, dass die erfindungsgemäßen Ausführungsvarianten, insbesondere die beschriebenen Bakterienstämme und
Fermentationsbedingungen ohne Weiteres angepasst werden können ohne den Rahmen der Erfindung zu verlassen. So sind einfache Adaptationen denkbar zur Herstellung von beliebigen Sesquiterpenen aus Methanol oder Ethanol. Die Erfindung ermöglicht die Bioproduktion von Terpenen aus der nicht mit Lebensmitteln konkurrierenden Kohlenstoff-Quelle Methanol oder Ethanol. Weitere Merkmale, Einzelheiten und Vorteile der Erfindung ergeben sich aus dem Wortlaut der Ansprüche sowie aus der folgenden Beschreibung von Ausführungsbeispielen anhand der Zeichnungen.
Der Inhalt sämtlicher in dieser Patentanmeldung zitierten Literaturstel!en ist hiermit durch Bezugnahme auf den jeweiligen speziellen Offenbarungsgehalt und in ihrer Gesamtheit aufgenommen. FIGUREN
Fig. 1 zeigt eine schematische Übersicht des zentralen Stoffwechseis von Methylobacterium extorquens A 1 einschließlich der endogenen Terpensynthese über den DesoxyxyIu!ose-5- phosphat Weg (DXP), den heterolog integrierten Mevaionatweg (gekennzeichnet durch die zwei Umrahmungen), eine heterologe α-Humulen-Synthase zssl sowie eine heterologe FPP- Synthase ERG20. M. extorquens besitzt keine IPP-lsomerase (fni). Die heterolog integrierten MVA Gene betreffen eine Hydroxymethylglutaryl-CoA Synthase (hmgs), Hydroxymethylglutaryl- CoA Reduktase (hmgr), Mevalonat Kinase (mvaK), Phosphomevalonat Kinase (mvaK2), Pyrophosphomevalonat Decarboxylase (mvaD) und Isopentenylpyrophosphat-lsomerase (fni). Weitere Gene: dxs: 1-Desoxy-D-xylulose-5-phosphat Synthase, dxr: 1-Desoxy-D-xy!ulose-5- phosphat Reductase, hrd: HMB-PP Reductase, ispA: endogene FPP Synthase;
M iekülabkürzungen: 2PG: 2-Phosphoglycerat, 3PG: 3-Phosphoglycerat, 1,3-DPG: 1 ,3- Bisphosphoglycerat, GA3P: Glycerina!dehyde-3-phosphat, PEP: Phosphoenolpyruvat, H GCoA: Hydroxymethyl- glutaryl-CoA, DXP: 1-Desoxy-D-xylulose-5-phosphat, EP: 2-C-Methyl-D- erythriol-4-phosphat, HMB-PP: (E)-4-Hydroxy-3-mehtyl-but-2-enyl pyrophosphat, !PP:
Isopentenylpyrophposphat, GPP Geranylpyrophosphat, FPP: Farnesylpyrophosphate.
Fig. 2 zeigt einen chromatographischen Vergleich von α-Humu!en Standard (oberes Panel, schwarze Linie) und einer Probe von M. extorquens aufweisend pFS33 (pCM80-zssl, oberes Panel, hellgraue Linie). Der interne Standard Zerumbone eluiert nach 11,5 Minuten. a-Humulen in der pFS33 Probe wurde durch Vergleich der unter dem Chromatogramm dargestellten Massen spektren identifiziert. Fig. 3 zeigt die Toleranz von Methylobacterium extorquens AM1 gegenüber α-Humulen direct in der wässrigen Phase gelöst oder gelöst in der Dodekan-Phase als zweiter organischer Phase. Maximale Wachstumsraten in entsprechendem Medium ohne α-Humulen (Mmax) sind
Wachstums- raten (μ) bei unterschiedlichen α-humulene Konzentrationen gegenübergestellt. Es ist erkenn- bar, dass α-Humulen nur minimale wachstumsinhibierende Effekte auf M.
extorquens aufweist, selbst bei Konzentrationen von 1 g/l., α-Humulen in der Dodekan-Phase hat einen geringfügig geringeren Einfluss als in der wässrigen Phase, da es weniger Kontakt mit den Zellen hat.
Fig. 4 zeigt die α-Humulen Production von M. extorquens AM1 tragend die Plasmide pFS33 (pCM80- zssl), pFS34 (pCM80-zssl-ERG20), pFS45 (pHC1 15-zssi), pFS46 (pHC115-zssl- ERG20), pFS49 (pQ2148F-zssl) and pFS50 (pQ2148F-zssl-ERG20). Schwarze Balkenanteile zeigen die Produktion ohne Induktion, wohingegen die grauen Balkenanteile die Produktion mit Induktion darstellen. pCM80 trägt einen konstitutiven Promotor. Die Konzentrationen wurden 48 Stunden nach Kultivierung (pFS33, 34) bzw. nach Induktion (pFS45, 46, 49 50) verglichen;
Fig. 5 zeigt die α-Humulen Produktion von M. extorquens tragend die Plasmide mit optimierten Ribosomenbindungsstel!en (ribosome binding site) (RBS) für α-Humulenynthase (zssl), FPP- Synthase (ERG20) und IPP-lsomerase (fni) in verschiedenen Kombinationen. Die Translationsinitiations- raten für die Gene sind auf der y-Achse in Klammern angegeben. Die Konzentrationen sind durchschnittliche Produktkonzentrationen von drei 3 Transformanten, wobei jede in zwei ge- trennten Kulturen angezogen wurde. Schwarze Balken: Plasmide (pFS49, pFS57), die nur zssl enthalten, schraffierte Balken: Plasmide (pFS50, pFS58, pFS60a, pFS60b), die zssl und ERG20 enthalten, graue Balken: Plasmide (pFS61b, pFS62a, pFS62b) enthaltend zssl, ERG20 und die sechs Gene des Mevalonatweges.
Fig. 6 A: Chromatogramme (n= 502 nm) nichtverseifter (unsaponified) Carotinoid Extrakt von E. coli exprimierend die Diapophytoen Synthase und Diapophytoen Desaturase aus S. aureus via pACCRT-MN (A1) und von M. extorquens Carotinoid Biosynthese defizientem Stamm CM502 (A2). Die theoretische Retentionszeit von Lycopen ist mit dem Pfeil gekennzeichnet. B: a- Humuien Produktion von M. extorquens AM1 and CM502 tragend Plasmid pFS62b (pQ2148F- zssl225k-ERG2022k-fni65k-MVA) in Schüttelkolben 48 Stunden nach Induktion (n=3).
Fig. 7: Zeiltrockengewicht (cell dry weight) und gebildete α-Humulen Konzentration des Stamms CM502 tragend pFS62b in Fermentation 5(nach Tablle 3). Der Zeitpunkt 0 gibt den
Induktionszeitpunkt mit Cumat an, dargestellt durch die gepunktete vertikale Linie.
Standardabweichungen der α-Humulen Konzentrationen wurden aus der gleichen Probe durch dreimalige Analyse ermittelt. Schwarze Quadrate: α-Humulen Konzentration, graue Kreise: Zelltrockengewicht (cell dry weight).
Fig. 8 zeigt den chromatographischer Vergleich von cis-Abienol Standard (oberes Panel, markierte Linie) und einer Probe von . extorquens aufweisend ppjo16 (pQ2148F-AbCAS- ERG20F96C-MVA, oberes Panel, markierte Linie). Der interne Standard Zerumbon eluiert nach 11 ,3 Minuten. Cis-Abienol in der 6s6 Probe wurde durch Vergleich der unter dem Chromatogramm dargestellten assenspektren identifiziert.
Fig. 9 zeigt einen chromatographischen Vergleich von Sandelholzöl (oberes Panel (a), dunkelgraue Linie) und einer Probe von M. extorquens aufweisend ppjo03 (pQ2148F-SanSyn- ERG20-1V1VA), oberes Panel (a), schwarze Linie). α-Santalen in der ppjo03 Probe wurde durch Vergleich der unter dem Chromatogramm dargestellten Massenspektren identifiziert (b, c). BEISPIELE
Die nachfolgenden Beispiele dienen der Illustration der Erfindung. Sie dürfen im Hinblick auf den Schutzumfang nicht in einschränkender Weise ausgelegt werden.
Beispiel 1 : Rekombinante α -Humulen Herstellung . Material und Methoden 1.1 Chemikalien, Medien und Bakterienstämme
Methylobacterium extorquens AM1 (Peel und Quayle, 1961. Biochem J. 81 , 465-9) wurde kultiviert bei 30°C in Minimalmedien, wobei für die Kultivierung im Schüttelkolben das Medium nach Kiefer et al., 2009 (PLoS ONE. 4, e7831) verwendet wurde. Das Fermentationsmedium enthält eine Endkonzentration von 30 mM PIPES, 1 ,45 mM NaH2P04, 1 ,88 mM K2HP04, 1 ,5 mM MgCI2, 1 ,36 mM (NH4)2S04, 20 μΜ CaCI2, 45,6 μΜ Natriumeitrat (Na3C6H507*2H20), 8,7 μΜ ZnS04 *7H20, 15,2 μΜ MnCI2*4H20, 36 μΜ FeS04*7H20, 1 μΜ (NH4)BMo7024*4H20, 0,3 μΜ CuS04*5H20 und 12,6 μΜ CoCI2*6H20.
Escherichia coli Stamm DH5D (Gibco-BRL, Rockville, USA) wurde in lysogeny broth (LB) medium (Bertani, 1951. J. Bacteriol. 62, 293-300) bei 37 X kultiviert. Tetracyclin-hydrochlorid wurde in Konzentration 0 pg/ml für E. coli und M. extorquens verwendet. Cumat (4- Isopropylbenzoesäure) wurde als Induktor verwendet mit Endkonzentration von 100 μΜ verdünnt von einer 100 mM Stammlösung gelöst in Ethanol (Kultivierung im Schüttelkolben) oder Methanol (Kultivierung im Bioreaktor).
Cumat, Tetracycline-hydrochlorid, α-Humulen, Zerumbon and ( ?S)-Mevalonsäure Lithtumsalz wurden von Sigma-Aldrich (Steinheim, DE) bezogen. Dodekan wurde von VWR (Darmstadt, DE) bezogen. 1.2 Genetische Manipulationen und Plasmidkonstruktion
Die Standard Klonierungstechniken wurden nach der dem Fachmann bekannten
Vorgehensweise ausgeführt. Die Transformation von Plasmiden in M. extorquens AM1 oder CM502 wurde ausgeführt wie in Toyama et al. (Toyama et al., 1998, FEMS Microbiol. Lett. 166, 1-7) beschrieben.
Ribosomen-Bindungsstellen (ribosome binding sites, RBS) wurden mit Hilfe des Ribosomen- Bindungsstellen-Calculators (Salis, 201 1 , Methods in Enzymology, ed. V. Christopher, 19-42. Academic Press) gestaltet. Der Codon Anpassungsindex (Codon adaptation index, CAl) wurde durch den CAI-Calculator (Puigbo et al., 2008, BMC Bioinformatics. 9, 65) bestimmt.
1.3 Klonierung von Mevalonatweg (MVA)-Genen von Myxococcus xanthus Genomische DNA von Myxococcus xanthus DSM 16525 wurde vom DSMZ (Braunschweig, DE) bezogen. Die FcoRI-Restriktionsstelle von hmgs, kodierend für HMG-CoA-Synthase, wurde entfernt durch Overlap extension PCR unter Einfügung einer stillen Mutation (gaattc zu gagttc). Dazu wurde der erste Teil des Gens amplifiziert mit Hilfe der Primer HMGS-fw und HMGS-over- rev; während HMGS-over-fw und HMGS-rev für den zweiten Teii verwendet wurden. Die resultierenden PCR-Produkte wurden als "mega"-Primer zusammen mit HMGS-fw und HMGS- rev für die finale Amplifikation von hmgs (SEQ ID NO 7) ohne die coRI-Restriktionssteiie genutzt. Das Mevalonatweg-Operon von M. xanthus- aufweisend die Gene hmgr (SEQ ID NO 8), mvaKI (SEQ ID NO 9), mvaKZ (SEQ ID NO 10), mvsD (SEQ I D NO 1 1) und fni (SEQ ID NO 12) kodierend für HMG-CoA-Reduktase, Mevalonat-Kinase, Phosphomevalonat-Kinase, Pyrophosphomevalonat-Reduktase bzw. Isopentenyl-pyrophosphat-lsomerase - wurde aus dem Plasmid pUC18-mva-op (Mi et al., 2014, Microbial cel! factories. 13, 170) ausgeschnitten.
1 .4 Klonierung von Plasmiden enthaltend die α-Humuien Synthase
Die multiple Klonierungsstelie (multiple cloning site) von Plasmid pQ2148 (Kaczmarczyk et al., 2013, Appl. Environ. Microbioi. 79, 6795-802) wurde zur erhöhten Klonierungsflexibilität modifiziert. Dazu wurden Primer pQF-MCS-fw und pQF-MCS-rev angelagert {annealed) durch Erhitzen von 100 μΙ Annealing-Puffer (10 mM TRIS pH7,5, 50 mM NaCi, 1 mM EDTA) beinhaltend je 10 μΜ der Primer für 15 min gefolgt von langsamen Abkühlen auf
Raumtemperatur für drei Stunden. Die zusammengelagerten Primer wurden in pQ2148 ligiert, welches mit Spe\ und Xh geschnitten wurde, ergebend Plasmid pQ2148F. Das α -Humulen Synthase Gen zss\, ursprünglich stammend aus Z/ngiberzerumbet(Yu et al. , 2008, Planta. 227, 1291-9) (Accession number AB263736.1 ), wurde Codon-optimiert für M. extorquens AM 1 unter Erhalt der DNA-Sequenz nach SEQ ID NO 16. Das Codon-optimierte Gen gemäß SEQ iD NO 16 wurde ampHfiziert für die Insertion in pCM80 (Marx und Lidstrom, 2001 , Microbiology. 147, 2065-2075) und pHC1 15 (Chou und Marx, 2012, Ceti reports. 1 , 133- 40) unter Verwendung der Primer ZSSi-fw und ZSSI-rev. Eine RBS-optimierte Variante
(translation Initiation rate (TIR) von 221.625) für pQ2148F wurde bei Verwendung der Primer ZSSI-RBS-fw und ZSSI-rev amplifiziert. Die RBS-optimierte Variante von zssl mit einer TIR von 221 .625 weist die Nukleinsäuresequenz AGCTTAAGGATAAAGAAGGAGGTAAAAC (SEQ ID NO 41 ) auf. Das Gen für die FPP-Synthase ERG20 aus Saccharomyces cerevisiae wurde von genomischer DNA amplifiziert mit den Primern ERG20-fw und ERG20-rev. RBS-optimierte Varianten wurden amplifiziert mit Primern ERG20-RBS35k-fw oder ERG20-RBS20k-fw in Kombination mit ERG20-rev-2 resuitierend in zwei ERG20 PCR Produkten, aufweisend je eine RBS mit einer TIR von 36.800 oder 22.000. Die RBS-optimierte Variante von ERG20 mit einer TIR von 22.000 weist die Nukleinsäuresequenz
AC ATC AAAC C AAAG G ACTTT AC AG GTAGTAG AA (SEQ ID NO 39) auf. Die RBS-optimierte Variante von ERG20 mit einer TIR von 36.800 weist die Nukleinsäuresequenz
G AG AAG AG C AG ACTCG ATC ATAAC AG GG G ACTAG (SEQ ID NO 40) auf. Das zssi PCR Produkt wurde mit Sphl und Xba\ verdaut und in gleichverdautes Plasmid pCM80 inseriert, ergebend Plasmid pFS33. Cla\ und SnaB1 verdautes PCR Produkt von ERG20 wurde anschließend in die gleichen Restriktionsstelien von pFS33 kioniert resultierend in pFS34. Das hrngs Gen ohne die EcoRi-Restriktionsstelle (siehe oben) wurde hinter ERG20 inseriert unter Verwendung der Restriktionsschnittstellen Xba\ und Ba W . Das M. xanthus Mevalonat-
Operon wurde mit BamH'l und EcoRI aus pUC18-mva-op ausgeschnitten und wiedereingesetzt in gleichverdautes pFS34-bmgs ergebend pFS44.
Die Plasmide pFS45 (pHC 1 15-zssl), pFS46 (pHC1 5-zssl-ERG20) und pFS47 (pHC1 15-zssl- ERG20- 7möis-MVAop) wurden konstruiert durch Ausschneiden von zssi aus pFS33, von zssl- ERG20 aus pFS34 und von zssl-ERG20-/7/77ö's-MVAop aus pFS44 mit AM und EccR\ gefolgt von deren Insertion in gleich verdautes pHC1 15,
Die Plasmide pFS49 (pQ2148F-zssl) und pFS50 (pQ2148F-zssl-ERG20) wurden konstruiert durch Ausschneiden von zssi und zssl-ERG20 mit A \ und Xba\ aus pFS33 bzw. pFS34 gefolgt von deren Insertion in gleich verdautes pQ2148F. Hrngs und VAop wurden ausgeschnitten aus pFS44 durch Xba\ und EccR\ und anschließende Insertion in die gleichen
Restriktionsstellen von pFS50 resultierend in pFS52 (pQ2148F-zssl-ERG20-ft/77S's-MVAop). Das PCR Produkt des α -Humulen-Synthase-Gens zssi mit optimierter RBS wurde verdaut mit Spä und Xba\ und ligiert in gleich verdautes pQ2148F ergebend pFS57. Das PCR Produkt von ERG20 mit optimierter RBS wurde hinter zssi von pFS57 kioniert mit Cia\ und Xba\ resultierend in pFS58 (pQ2148F-zsslRBS°p>-ERG20). Hmgs-MVAop wurde inseriert in pFS58 wie für pFS52 beschrieben ergebend pFS59. RBS Varianten für ERG20 (TIR = 35000 und 20000) wurden verdaut mit Cla\ und Xbä und in entsprechend geschnittenes pFS57 eingesetzt ergebend pFS60a (zsslRBS°P1-ERG2035k) bzw. pFS60b (zsslRBS°Pt-ERG2020lt). Insertion von hmgs- V Aop in pFS60a und pFS60b resultierte in Plasmiden pFS61 a (zsslRBS°Pt-ERG2035k-/j/775fs-MVAop) bzw. pFS61 b (zsslRBSi:iPt-ERG2035k- 7/77^s-MVAop). Die RBS des IPP-lsomerase Gens /fr/wurde optimiert für pFS61 a und pFS61 b durch Insertion von anfänglich zusammengelagerten Primern fni-RBSopt-fw und fni-RBSopt-rev (Annealing-Methode siehe oben) in Restriktionsstelien Hpa\ und BamM . Die resultierenden Plasmide pFS62a und pFS62b weisen eine TIR von 65.000 für die fh RBS auf. Die optimierte RBS für das Gen fni weist hierbei die Nukleotidsequenz gttctaggaggaataata (SEQ ID NO 48) auf. Die optimierte RBS für das Gen hrngs weist in
Plasmiden pFS61 a und pFS61 b sowie pFS62a und pFS62b die Nukleotidsequenz SEQ ID NO 90 mit einer TIR von 189 auf.
Ein Überblick über die verwendeten Primer, Plasmide und Stämme geht aus Tabelle 1 hervor.
Tabelle : Verwendete Primer, Plasmide und Stämme. Unterstrichene und kursive Sequenzen (alle 5' - > 3') kennzeichnen Erkennungsstellen für Restriktionsenzyme. Fette Buchstaben geben Sequenzen von Ribosomen Bindungsstellen (RBS) an. au: Translationsinitiationsrate (translation initiation rate, TIR) gemäß Salis Lab RBS calculaior; op: Operon, MVA:
Mevafonatweg.
Name Beschreibung Referenz
Primer
HMGS-fw AGTCTAGAGAGGAGCGCAGGATGAAGAAGCGCGTGGGAAT
(SEQ ID NO 17)
HMGS-rev ATCTG GA TCCGTTT AAAC CCTGCA GGACCGGT G TTAA CTC AG
TTCCCTTCGGCGTAC (SEQ ID NO 18)
H GS- GCTGCGCGGCCGAGTTCTACTCCGGCACG (SEQ ID NO 19)
over-fw
HMGS- CGTGCCGGAGTAGAACTCGGCCGCGCAGC (SEQ ID NO 20)
over-rev
MVA1_fw ATCTGGATCCTAGGAGGAATAATATGGGCGACGACATCACTG
(SEQ ID NO 21)
MVA- AACACCATG G CG AGCTCTC (SEQ ID NO 22)
SaclA-rev
MVA- GAGAGCTCGCCATGGTGTT (SEQ ID NO 23)
SaclA-f
MVA- GTGCCCGTTGAGCTCCACCT (SEQ ID NO 24)
SaclB-rev
MVA- AGGTGGAGCTCAACGGGCAC (SEQ ID NO 25)
SaclB_fw
MVA2_rev ATCGAATTCA4GC7TTCAGCTCAGCGCGCGCACC (SEQ ID
NO 26)
pQFJVICS- CTAGTCTG C AGCTTAAGC ATG CTCTAG AAG ATC (SEQ ID NO
fw 27)
pQF_MCS- TC G AG ATCTTCTAG AGC ATGCTTAAG CTG C AG A (SEQ ID NO
rev 28)
ZSSl-f TAGC4 rG< TTAAGAAGGATCAGTCATAATGGAACGCCAGTCG
ATGG (SEQ ID NO 29)
ZSSI-RBS- ATACACTAGTAGCTTAAGGATAAAGAAGGAGGTAAAACATGG
fw AACGCCAGTCGATGG (SEQ ID NO 30)
ZSSI-rev AG TCTAGATACGTAA TCGA 7TCAGATGAGGAACGACTCGA
(SEQ ID NO 31)
ERG20J ATCGTATCGATAGGAGCGCAGGATGGCTTCAGAAAAAGAAAT
TAG (SEQ ID NO 32)
ERG20-RB ATCGTATCGATGAGAAGAGCAGACTCGATCATAACAGGGGA
S(35k)-fw CTAG ATG G CTTC AG AAAAAG AAATTAG (SEQ ID NO 33)
ERG20-RB ATC GTATCG ATACATCAAACC AAAGGACTTTACAG GTAGTAG
S(20k)-fw AAATGG CTTC AG AAAAAG AAATTAG (SEQ ID NO 34)
ERG20 rev atcgtacgtaCTATTTG CTTCTCTTGT AAACT (SEQ ID NO 35) ERG20_rev ACT ATCT AG ATAA AGT AG AG G AG G ATT AATCT ATTTG CTTCTC -2 TTGTAAACT (SEQ ID NO 36)
fni-RBSopt- AACCTAAAATTAACGAGGAAAGAGGGAGGTTACAG (SEQ ID
fw NO 37)
fni-RBSopt- G ATCTGTAAC CTC C CTCTTTC CTC GTT AATTTTAG GTT (SEQ
rev ID NO 38)
Plasmide
pUC18 Expressionsvektor für Escherichia colr, AmpR, lacZ Promotor, Norrander pBR322ori 1983 pACCRT- Plasmid, zur Expression von Diapophytoen Synthase und Sandman MN Desaturase in Escherichia colr, AmpR; enthält Gene für n
Diapophytoen Synthase (crtM) und Diapophytoen Desaturase
(crtN) aus Staphylococcus aureus unter Kontrolle eines lacZ
Promotors
pC 80 Konstitutiver Expressionsvektor für Methyiobacterium Marx extorquens, TetR, pmxaF, oriT, pBR322ori 2001 ,
Microbiolo gy. 147,
2065-
2075. pHC115 Expressionsvektor für Methyiobacterium extorquens mit Cumat Chou induzierbarer pmxaF Promotorvariante; KanR , oriT, pBR322ori 2012, Cell reports. 1 ,
133-40. pQ2148 Expressionsvektor für Methyiobacterium extorquens mit Cumat Kaczmarc induzierbarem Promotor 2148; TetR , oriT, pBR322ori zyk 2013,
Appl.
Environ.
Microbiol.
79, 6795-
802.
PQ2148F pQ2148 mit angepassier MCS
pUC18- pUC18 mit Myxococcus xanthus MVA Operon (hmgr, mvaK,
MVAop mvaK2, vaD, fni)
pCM80- pCM80 mit Hydroxymethylglutaryl-Synthase hmgs
HMGS
pCM80- pCM80 mit vollständigem evalonat (MVA) Weg
MVA
pCM80- pCM80 mit vollständigem Mevalonat Weg und FPP Synthase
MVA- ERG20
ERG20
pFS33 pCM80 mit alpha-Humulen-Synthase zssl pFS34 pCM80 mit a!pha-Humulene Synthase zssl und FPP Synthase
ERG20
pFS44 pFS34-/7/?7öfs-MVAop
pFS45 pHC115 mit afpha-Humulen Synthase zssl
pFS46 pHC1 15 mit aipha-Humulen Synthase zssl und FPP Synthase
ERG20
pFS47 pFS46-/?/77#s-MVAop
pFS49 pQ2148F mit alpha-Humulen Synthase zssl
pFS50 pQ2148F mit alpha-Humulen Synthase zssl und FPP Synthase
ERG20
pFS52 pFS50- hmgs-MVAop
pFS57 pQ2148F mit alpha-Humulen Synthase zssl mit optimierter RBS
pFS58 pFS57-ERG20
pFS59 pFS58- hmgs-MVAop
pFS60a pFS57-ERG2035k (RBS with au von 35000)
pFS60b pFS57-ERG2020k (RBS with au von 35000)
pFS61a pFS60a-/j/77 s-MVAop
pFS61 b pFS60b- 7/77örs- VAop
pFS62a pFS61a mit optimierter RBS der IPP isomerase fni
pFS62b pFS61b mit optimierter RBS der IPP isomerase fni
Stämme
£ coli F , <J>80dlacZAM15, A(lacZYA-argF)U169, deoR, recA1 , endA1 , ATCC
DH5a hsdR1 (rK- mK+), phoA, supE44, A", thi-1
M. Fakultativ methyiotrophes, obligatorisch aerobes, gram-negatives, Peel & extorquens Pink pigmentiertes α-Proteobakterium, CmR Quayle A 1 1961 ,
Biochem
J, 81 , 465-
9.
DSM 1338
M. Carotenoid Biosynthese defizienter Stamm Van Dien extorquens et a!., C 502 2003,
Appl. Environ. Microbiol, 69, 7563- 6.
Saccharom M ATa; ura3-52; trpl -289; leu2-3, 112; his3A ; MAL2-8C; SUC2 Entian & yces Kotier cerevisiae 1998, CEN.PK2- Academic Press Ltd.
San
Diego, pp. 431-449.
1.5 α-Humulen Produktion in wässrig-organischer Zweiphasen Schüttelkolben-Kultivierung Methylobacterium extorquens AM1 oder CM502, aufweisend die a-Humulen
Gewinnungsplasmide, wurden kultiviert in Methanol Minimalmedium beinhaltend Tetracyclin- hydrochlorid (siehe oben). Vorkulturen wurden von Agarplatten in Reagenzgläsern mit 5 ml Medium inokuliert und für 48-72 h bei 30°C und 180 rpm geschüttelt. Hauptkulturen mit 12 mi Medium in 100 ml Schikaneschüttelkolben wurden mit einer Vorkultur inokuliert zu einer D von 0,1. Nach Kultivierung für 16 h bei 30°C und 120 rpm erreichten die Hauptkulturen die frühe exponentielle Wachstumsphase (Οϋβοο 0,3-0,6). Anschließend wurde zur Induktion Cumat hinzugesetzt sowie 3 mi Dodekan als organische Phase zugefügt. Nach 48 h Inkubation wurde ein Gesamtkulturvolumen von 15 ml dekantiert und für 10 min bei 3220 g zentrifugiert. 1 ml der oberen Dodekanschicht wurde für die α-Humu!en-Analyse verwendet. Das Zellpeilet wurde in 1 ml dH20 resuspendiert für intrazelluläre a-Humulen-Analyse. 1.6 Dodekan und α-Humulen Toleranz von M. extorquens AM1
M. extorquens AM1 Vorkulturen wurden kultiviert in Reagenzgläsern mit 5 ml Methanol Minimalmedium (MM) für 48 h. Die Toleranz von M. extorquens AM1 gegenüber 20 % (v/v) Dodekan wurde durch Wachstumsvergleich untersucht (ODeoo) von Kulturen enthaltend 15 ml MM und Kulturen mit 12 ml MM und 3 ml Dodekan. Die Kulturen für den Wachstumsvergleich mit und ohne Dodekan wurden aus einer Vorkultur inokuliert.
Die α -Humuien Toleranz wurde auf zwei Wegen getestet: Toleranz gegenüber direkt in die wässrige Phase zugesetztem α -Humuien und Toleranz gegenüber α -Humuien gelöst in der organischen Dodekanschicht. Für das erstere Experiment wurde reines α -Humuien gelöst in Ethanol zu 100ml Schikaneschüttelkolben beinhaltend 15 ml MM mit Endkonzentrationen an α - Humuien von 1000, 500, 250, 100, 50, 25, 10 und 5 mg/L zugesetzt. Entsprechende Mengen an Ethanol wurden dem MM als Negativkontrollen zugesetzt. Die Kolben mit den unterschiedlichen α -Humuien Konzentrationen und die zugehörigen Negativkontrollen wurden mit einer Vorkultur ohne α -Humuien inokuliert zu einer ODeoo von 0,1. Die Οϋεοο wurde über 30 h aufgezeichnet.
Für das zweitgenannte Experiment wurde reines α -Humu!en in Dodekan gelöst und Lösungen mit 1000, 500, 00, 50 und 0 mg/L α -Humuien hergestellt. Je zwei Kulturen mit 2 ml MM und 3 ml Dodekan für jede α -Humulen-Konzentratton wurden zu einer ODeoo von 0,1 aus einer Vorkultur von M. extorquens AM1 ohne Dodekan inokuliert. Kulturen mit Dodekan ohne α - Humuien dienten als Negativkontrolle. ODeoo wurde über 30 h gemessen.
1.7 α-Humulen Analyse 1 m! Dodekan Probe wurde mit NaS04 getrocknet. Als interner Standard wurden 25 μΙ von 1 mM Zerumbon gelöst in Dodekan zu 225 μΙ Dodekan Probe zugegeben.
Intrazelluläres α -Humulen wurde folgendermaßen extrahiert: resuspendiertes Zelipellet wurde in ein 4 ml GC-Gefaß zusammen mit ca. 300 mg 0,2 mm Glaskügelchen gegeben. Die Zeilen wurden intensive gevortext 3 x 30 s mit zwischenzeitlicher Eiskühlung. Die lysierten Zellen wurden dreimal mit 1 ml Hexan extrahiert gefolgt von einer Volumenreduktion auf 1 ml durch einen Stickstoffstrom. Als interner Standard wurde 25 μΙ von 1 mM Zerumbon gelöst in Hexan zu 225 μΙ Probe zugegeben. α -Humuien wurde analysiert und quantifiziert mit Hilfe GC-MS (GC17A mit Q5050
Massenspektrometer, Shimadzu, Kyoto, Japan) ausgestattet mit einer Equity 5 Säule (Supelco, 30 m x 0,25 mm x 0,25 μΜ). Messungen wurden wie folgt zweifach durchgeführt: Trägergas: Helium; Splitinjektion (8:1) bei 250X; Fiussrate: 2.2 ml/min; Interface Temperatur: 250°C; Programm: 80°C halten für 3 min, 16DC/min auf 240°C, halten für 2 min. Die Retentionszeit war 9,3 min für α -Humulen und 11 ,5 min für Zerumbon. α -Humulen in den Proben wurde identifiziert durch Vergleich von drei Hauptfragmentationen der Massenspektren mit einem käuflich erworbenen α -Humulen Standard (rel. Intensität in Klammem): 93 (15,5), 41 ( 1 ,4), 80 (6,7). Für eine Quantifizierung wurde eine Kalibrierungskurve mit den Konzentrationen 4500, 2250, 900, 675, 450, 225, 90, 67,5, 22,5, 9 und 4,5 μΜ α -Humulen mit je 100 μΜ Zerumbon verwendet.
1.8 Carotinoidextraktion und Analyse
Zur Carotinoid Extraktion wurden Zeilen von M. extorquens AM1 oder E. cc/Zdurch
Zentrifugation pelletiert, gewaschen mit ddH2Ü und im Dunkeln lyophilisiert.
Für nichtverseifte (unsaponified) Extrakte wurden 2 ml Methanol zu 50 mg aufgeschlossenen gefriegetrockneten Zellen gegeben mit anschließender Inkubation bei 65°C für 30 min. Nach Zentrifugation (10 min, 4000g, 4°C) wurde der Überstand mit Stickstoff getrocknet und in 0,5 ml eines Petrolether(40-60°C):Diethylether:Acetone:Methanol (40:10:15:5) Gemisches
resuspendiert. Präzipitierte Proteine wurden durch Zentrifugation abgetrennt (5 min, 16000g, 4°C) und der Überstand wurde in 100 μ( Tetrahydrofurane (THF) für die HPLC Analyse nach seiner Trocknung mit Stickstoff aufgenommen. Für verseifte (saponified) Extrakte wurde der Überstand nach der Proteinentfernung mit 10% KOH Lösung (gelöst in Methanol) für 2 h bei RT inkubiert. Die obere organische Phase wurde anschließend mit Stickstoff getrocknet und in 100 μΙ THF für die HPLC Analyse aufgenommen.
Die HPLC Analyse wurde mit einem Shimadzu SCL10 System ausgeführt (SPD10A UV VIS- Detektor, SPD-M10A Diodenarraydetektor, SIL10A Autosampier, CTO-10AC Säulenofen; je Shimadzu, Kyoto, Japan). Carotinoide wurden an einer Reverse-phase C18 Säule (250 mm x 4,5 mm x 5μ; Alltech, Deerfield, USA) aufgetrennt unter Verwendung eines
Gradientenprogramms von Acetonitril:Methanol:2-Propanol (85:10:5) als Lösungsmittel A und 100% 2-Propanol als Lösungsmittel (LM) B. Bei einer Flussrate von 1 ml/min bei 32°C wurde folgendes Elutionsprogramm gefahren: 100% LM A, 0% LM B 0-31 min, 0% LM A, 00% LM B 31-36 min, 100% LM A und 0% LM B 36-45 min. Ein Wellenlängenbereich von 190-600 nm wurde durch Diodenarraydetektor überwacht. Die Retentionszeit von Lycopen war 25,38 min. Diapolycopen wurde über einen Vergleich mit einem Carotenoidextrakt von E. coli identifiziert, weiches Diapophytoen Synthase und Diapophytoen Desaturase aus Staphylococcus aureus via pACCRT-MN exprimiert (siehe Tabelle 1).
1.9 Fermentation
Fed-batch Kulturen wurden in einem 2,4 ί KLF 2000 Fermenter (Bioengineering AG, Wald, Switzerland) durchgeführt mit einer pH und pC>2 Elektrode von Mettier-Toledo (Greifensee, Switzeriand), zwei Sechs-Blatt-Turbinen Rührern und einem abwärts gerichteten Blattrührer. Filter-steriiisierte Luft oder Sauerstoff wurde mit einer Flussrate von 50 l/h bereitgestellt. Alle Experimente wurden bei 30°C und bei einem pH of 6,75, der durch automatische Zufuhr von NH4OH (30%) reguliert wurde, durchgeführt. Die Konzentration an gelöstem Sauerstoff
(dissolved oxygen, DO) wurde automatisch reguliert durch Anpassung der Rührgeschwindigkeit beginnend mit 700 rpm. Sauerstoff und Kohlendioxid wurden in der Abluft mit einem
BINOS 1001 Gasanalysator (Rosemount Analytical, Hanau, DE) gemessen. Die Methanol Konzentration wurde online überwacht und mit einem ProcessTRACE 1.21 MT System (Trace Analytics, Braunschweig, DE), ausgestattet mit einer Dialysesonde, halbstündig reguliert. Die Methanoizufuhr wurde wie folgt gestaltet: unterhalb einer Konzentration von 1 g/l, 0,79 g (1 ml) und unterhalb von 0,5 g/l, 1 ,42 g (1 ,8 ml) wurde Methanol über eine Watson-Marlow 505Du Peristaltik Pumpe (Cornwali, England) zugeführt. Anti-Schaum B Emulsion (Sigma-Aldrich) wurde manuell hinzugesetzt zur Reduktion des Schäumens, zusätzlich zu einem sechs-Blatt- Tubinenrührer, der direkt über der flüssigen Phase als mechanischer Schaumbrecher angebracht ist.
Nach in situ Sterilisation von 900 ml Fermentationsmedium (siehe oben) wurde der Fermenter mit einer ODeoo von 0,5-1 inokuliert mit einer Vorkultur, die für 72 h in Schüttelkolben
gewachsen ist. Nach Erreichen einer ODeoo von 5-10 wurden 100 μΜ Cumat einer frisch hergestellten Stammlösung in Methanol sowie 15% Dodekan zugeführt. Die Methanolzufuhrrate wurde nach der Induktion verdoppelt. Die induzierte Kultur wurde für 120 h weiterkultiviert.
Proben wurden manuell entnommen, wovon Zelltrockenmasse und ODeoo aus der wässrigen Phase bestimmt und α -Humulen in der organischen Dodekan-Phase wie oben beschrieben gemessen wurden.
2. Ergebnisse
2.1 α -Humulen Produktion unter Verwendung vom Plasmiden mit konstitutivem Promotor (Vergleichsbeispiel)
Methylobacterium extorquens AM1 produziert endogen einen Farnesylpyrophosphat (FPP)-Pool der allerdings zu Menaquinon, Hopanen und Carotinoiden umgewandelt wird (siehe Fig.1 ). Grundsätzlich könnte dieses Bakterium α -Humuten durch Integration einer heterologen α - Humulen Synthase synthetisieren. Plasmid pCM80 trägt den starken pmxaF Promotor und wurde als Vektor für die Expression des α -Humulen Synthase Gens zss\ gewählt. Eine Codon- optimierte Variante des Gens aus Zingiber zerumbetwwöe in pCM80 eingeführt unter Erhalt von pFS33. Zur wetteren Steigerung der α -Humulen Produktion wurde die FPP Synthase aus Saccharomyces cerevisiae (ERG20) hinter das z$s\ Gen in pFS33 kloniert unter Erhalt von pFS34 (pCM80-zssi-ERG20).
Die Kultivierung erfolgte unter den oben beschriebenen Bedingungen als wässrig-organische Zwei phasen kulturen, wobei Dodekan als organische Phase dient. Die starke Hydrophobizität von α -Humulen führt zu einer vollständigen Akkumulation in der Dodekanphase, da
intrazelluläres α -Humulen nicht nachweisbar war.
Daraus ergeben sich insbesondere zwei Vorteile: α -Humulen Konzentrationen können direkt in der Dodekanphase gemessen werden und eine Verflüchtigung von α -Humulen wird vermindert durch den hohen Siedepunkt von Dodekan. Weiterhin verträgt M. extorquens AM1 20%
Dodekan, ohne dass toxische Wirkungen und eine Wachstumsbeeinflussung zu beobachten sind. M. extorquens AM1 (nachfolgend kurz auch: AM1) aufweisend Plasmid pFS33 war in der Lage, α -Humulen zu produzieren wie der Peak mit ähnlicher Retentionszeit und Massenspektrum im Vergleich zum α -Humulen Standard in Fig. 2 zeigt. Hingegen ist für M. extorquens A 1 mit der leeren Vektorkontrolle kein α -Humulen nachweisbar. Sowohl für A 1_pFS33 als auch AM1_pFS34 wurden 2.3 mg/L α -Humulen gemessen. Die FPP-Synthase ERG20 von pFS34 scheint die σ -Humulen Konzentration nicht zu erhöhen. Die näheren Ursachen hierfür sind nicht bekannt.
2.2 Integration des heterologen Mevalonat Weges (MVA)
Überraschend konnte hier jedoch gefunden werden, dass die heterologe Expression
insbesondere von Enzymen des MVA Weges zu einer verbesserten α -Humulen Bildung führt.
Dies ist umso erstaunlicher, da die MVA Vorstufe, Acetoacetyl-CoA, ein Bestandteil des
Primärstoffwechsels von M. extorquens ist (siehe Fig.1). Durch die Entnahme von Acetoacetyl- CoA für den heterolog eingebrachten MVA Weg war eine erhebliche Imbalance im
Primärstoffwechsel von M. extorquens zu erwarten.
Diese Befürchtung wird durch folgendes Vorexperiment zunächst bestätigt. Die Transformation von pFS44 enthaltend zss\, ERG20 und die M. xanthus IN Gene hmgs, fni, hmgr, mvaK, mvaK2 und mvaD r elektrokompetente M. extorquens AM1 ergab kein erkennbares Wachstum, weder auf Methanol Minimal Medium noch auf Succinat Minimal Medium. Die konstitutive Expression des MVA Weges scheint für M. extorquens nicht gut verträglich zu sein. 2.3 Toxizität von α -Humulen auf M. extorquens AM1
Um festzustellen, ob M, extorquens überhaupt als ein Produktionsstamm für Terpene geeignet ist, wurde zunächst geprüft, ob das Bakterium durch Terpene in höheren Konzentrationen im Wachstum inhibiert wird.
Terpene haben häufig toxische Effekte auf Bakterien. Die Toxizität von α -Humulen auf M. extorquens wurde untersucht durch Wachstumsanalysen in Anwesenheit von verschiedenen α - Humulen Konzentrationen. Eine α -Humulen enthaltende Dodekanschicht wurde zu
M. extorquens Kulturen als zweite Phase gegeben. In einem zweiten Ansatz wurde α -Humulen direkt der wässrigen Phase hinzugesetzt. Die in Fig. 3 dargestellten Ergebnisse zeigen, dass M. extorquens als Produktionsplattform für Terpene, insbesondere für das α -Humulen, geeignet ist.
2.4 α-Humulen Produktion bei Verwendung eines Cumat-induzierbaren Promotors
Für die induzierbare Expression der MVA Gene wurde nachfolgend ein geeignetes
Piasmidsystem mit induzierbarem Promotor verwendet. Dazu wurden die Gene für die α - Humulen Synthase allein, in Kombination mit FPP-Synthase ERG20 und in Kombination mit ERG20 und den MVA-Weg Genen in Plasmid pHC115 kloniert, welches einen Cumat induzierbaren Promotor trägt (Chou und Marx, 2012), ergebend die Plasmide pFS45, pFS46 bzw. pFS47.
Nach Transformation wurden für pFS45 und pFS46, aber für pFS47 kaum feststeilbar, Kolonien erhalten. Ohne daran gebunden zu sein, könnten die in Fig. 4 für pFS45 und pFS46 gezeigten Daten dies erklären: mehr als 50% α -Humulen wurde ohne Induktion bereit produziert. Die Genexpression von pHC1 15 ist nicht dicht und verbleibende Expression der MVA Gene wirkt sich negativ auf das Wachstum für M. extorquens. aus.
Plasmid pQ2148 enthält den sehr dichten Cumat induzierbaren 2148 Promotor. Zss\ allein und wiederum in Kombination mit ERG20 sowie mit den MVA Genen wurden in pQ2148F eingeführt unter Erhalt von pFS49 (zsä), pFS50 ( ssl-ERG20) und pFS52 ( ssl -E RG20-M VA) . Kolonien wurden erhalten nach Transformation in M. extorquens für pFS49, pFS50 und auch pFS52, auch wenn die Kolonien für pFS52 auch nach 8 Tagen Wachstum bei 30X sehr klein waren. Die α -Humulen Konzentrationen erreichten 11 mg/L in AM1_pFS49 und 17 mg/L in
AM1_pFS50 (siehe Fig. 4), was eine 6-fache oder 1,6 fache Steigerung des zsst-ERG20 Konstruktes gegenüber pFS34 bzw. pFS46 ist. Im Vergleich zu pHC115 Konstrukten, war die Background-Produktion, also ohne Induktion, nur 5%.
Der Ausgleich von Flux Imbalancen im Stoffwechsel kann durch verschiedenste Maßnahmen erreicht werden. So können beispielsweise die Promotorstärke, die Konzentration des
Induktors, die Plasmidkopienzahl oder deren Kombinationen entscheidend sein. Hier wurde nun überraschend gefunden, dass die Translationsinitiationsrate (translation Initiation rates, TIR) verschiedener Ribosomenbindungsste!len (ribosome binding Sites, RBS) für eine verbesserte Terpensynthese von Bedeutung sind.
Zunächst wurde die TIR der α -Humulen Synthase RBS in den Plasmiden pFS57 (zss 225k), pFS58 (zssi225k-ERG20) und pFS59 (zssl225k-ERG20-MVA) 146-fach erhöht (siehe Tabelle 2).
Tabelle 2: Translationsinitiationsraten (TIR) der nativen und optimierten
Ribosomenbindungsstellen (RBS) der heterologen Mevalonatweg Gene hmgs
(HydroxymethyiglutaryS-CoA-Synthase) und #7/'(IPP-lsomerase) aus Myxococcus xanthus, der FPP-Synthase ERG20 und α-Humulen-Synthase zss\ der verschiedenen Plasmide. Wachstum: Koionie Bildung von AM1 auf Methanol Agar nach Transformation: ++++: wie Leervektor (3-4 Tage), +++: 4-5 Tage, ++: 5-6 Tage, +: 6-7 Tage, -: keine Kolonien erkennbar nach 8 Tagen; wt: native FPP Synthase von M. extorquens AM1 mit unbekannter RBS; Intermediate: AAc-CoA: Acetoacetyl-CoA, HMG-CoA: Hydroxymethylglutaryl-CoA, IPP: Isopentenylpyrophosphat, DMAPP: Dimethylallylpyrophosphat, FPP: Farnesylpyrophosphat:
Plasmide Translationsinitiationsrate (TIR) Wachstum
Gen: hmgs fni ERG20 zss
IPP
Interme- AAc- HMG-
—► $ ^ FPP a-Humulen diat: CoA CoA
DMAPP
pFS49 - - wt 1514 +++
pFS50 - - 558 1514 ++
pFS52 1995 87,3 558 1514 -/+§
pFS57 - - wt 221625 ++
pFS58 - - 558 221625 +++
pFS59 1995 87,3 558 221625 -/+§
pFS60a - - 36800 221625 ++
pFS60b - - 22000 221625 +++
pFS61 b 6345 87,3 22000 221625 +
pFS62a 6345 65000 36800 221625 +
pFS62b 6345 65000 22000 221625 ++
§ verschiedene Koloniegrößen,
Wie in Fig. 5 zu erkennen ist, führt eine Optimierung der RBS von zss\ allein nicht zu erhöhter α -Humulen Produktion ohne zusätzliche Versorgung mit Vorläufern vom MVA Weg (pFS57 und pFS58). Transformanten mit pFS59 (zssl 25k-ERG20-MVA) wuchsen langsam, vergleichbar zu pFS52 enthaltenden Stämmen ohne zss\ RBS Optimierung (siehe Tabelle 2).
Die TIR der ERG20 RBS wurde im Verhältnis von etwa 1 : 10 (pFS61 b) zur TIR der zssl RBS (siehe Tabelle 2) erhöht. Die RBS Optimierung von ERG20 in Kombination mit zssl RBS Optimierung führte nicht zur Erhöhung der α -Humulen Bildung ohne MVA (pFS60a und pFS60b, siehe Fig. 5).
Die Kombination von RBS optimierter α -Humulen synthase, RBS optimierter FPP Synthase und anwesenden MVA Enzymen führte zu dem Plasmid pFS61 b, das ein gutes Wachstum ermöglicht (TiR von ERG20 beträgt 22000). Konzentrationen von bis zu 60 mg/L α -Humulen wurden von einigen AM1 Transformanten mit pFS61 b erreicht (durchschnittliche Produktion war 35 mg/L), auch wenn hohe Schwankungen zu beobachten waren. Optimierungen der RBS der IPP Isomerase führten zu einer weiteren Steigerung der durchschnittlichen α -Humulen Produktion sowie zu einer Verringerung der hohen
Schwankungen der a -Humulen Produktion zwischen den Transformanten. Die TIR der #7 RBS wurde in Plasmiden pFS62a und pFS62b auf 65000 erhöht (siehe Tabelle 2). Die Stämme AM1_pFS62b und AM1 pFS62a zeigen ein weiter verbessertes Wachstum gegenüber
AM1_pFS61 b.
Mit Stamm AM1_pFS62b wurden Konzentrationen von 58 mg/L α -Humulen gebildet mit signifikant reduzierter Varianz zwischen den Transformanten im Vergleich zu AM1_pFS61 b (siehe Fig. 5). Die optische Dichte war bei etwa 3 nach 48 h Induktion, was einem
Zelltrockengewicht von 1 g/l entspricht.
Die heterologen Expression des MVA Weges in M. extorquens erfolgte gemäß der zuletzt beschriebenen Ausführungsform durch Anpassung der RBS der α -Humulen Synthase, der FPP-Synthase sowie der ΙΡΡ-!somerase. Konzentrationen von 58 mg/L α -Humulen wurden durch M. extorquens aufweisend pFS62b (zsslzz0k-ERG2020k-//7/i5k-MVA) erreicht. Dies ist immerhin eine dreifache Steigerung gegenüber einem Stamm mit überexprimierter α -Humulen Synthase und überexprimierter FPP-Synthase in Abwesenheit vom heterologen MVA-Weg.
2.5 α -Humulen Produktion in Carotinoid Biosynthese defizienten M, extorquens Stämmen Die Carotinoid Biosynthese in M. extorquens konkurriert mit der α -Humulen Synthase um den
Präcursor FPP (siehe Fig. 1). Die Verwendung einer Carotinoidsynthese defizienten Mutante könnte nach einem weiteren Ausführungsbeispiel die α -Humulen Produktion noch steigern.
Dazu wurde der farblose M. extorquens AM1 Mutantenstamm CM502 (Van Dien et al. 2003).
Die Carotinoidextraktion und Analyse (siehe oben) von Stamm CM502 zeigten, dass er Diapolycopin produziert, jedoch kein Lycopin, welches ein identisches UV-Spektrum, aber eine andere Retentionszeit besitzt (siehe Fig. 6A). Die Daten deuten darauf hin, dass es sich bei dem Stamm CM502 um eine Diapolycopin-Oxidase Mutante {crtNb) handelt, da sie noch
Diapolycopin herstellt, aber keine veresterten/glykosylierten Derivate. Die α -Humulen Produktion von Stamm AcrtNö mit Plasmid pFS62b war nochmals signifikant erhöht um etwa 30% zu M. extorquens AM1 Wildtyp mit Plasmid pFS62b (siehe Fig. 6B). Ein Produkiionstiter von immerhin 75 mg/i α -Humuien im SchütteSkoiben konnte somit erreicht werden.
Bemerkenswert hierbei ist, dass die oben genannten Konzentrationen, wie beispielsweise 58 mg/L oder 75 mg/L α -Humuien, bereits erreicht werden, ohne dass beispielsweise teures Lithiumacetoacetat oder DL-Mevalonat extern zugesetzt werden müssen. Vorteilhaft ist weiterhin, dass die oben genannten Konzentrationen bereits unter Einsatz von preisgünstigem Methanol Minimal Medium erreicht wurden. Im Gegensatz zum Stand der Technik ist kein Fermentationsmedfum auf TB oder LB-Basis erforderlich. Daraus ergibt sich ein weiterer Vorteil in der Vereinfachung der Aufreinigung der gewonnenen Terpenprodukte, da ein klar definiertes Minimalmedium verwendet werden kann. Aufwändige Entfernung von Nebenprodukten kann minimiert werden. Darüber hinaus eröffnen die hier beschriebenen Stämme die Verwendung von *Methanol als einziger Kohienstoffquelle zum Wachstum. 2.6 α -Humuien Herstellung in Fed-batch Kultivierungen
Um die Leistungsfähigkeit der erfindungsgemäßen M, extorquens basierten α -Humuien Produktion zu testen, wurden Methanol-Iimitierte Fed-batch Fermentationen durchgeführt. Die oben beschriebenen wässrig-organischen Zweiphasen Kultivierungen wurden genutzt. M. extorquens AM1 oder Δο/iNb aufweisend das Plasmid pFS62b wurden bis zu einer ODeoo von 5-10 angezogen bevor die Expression des α -Humuien Synthese Weges mit Cumat induziert wurde und eine Dodekan-Phase zugegeben wurde. Die weitere Kultivierung erfolgte bei konstantem pH, gelöstem Sauerstoff Level von > 30% und Methanol Konzentrationen von etwa 1 g/L. Durchschnittliche ODeoo Werte von 80-90 wurden per Fermentation erreicht (siehe Tabelle 3) entsprechend einer Zelldichte von etwa 30 g/l. Wie in Fig. 7 gezeigt, war die α - Humuien Produktion wachtumsabhängig. Hohe α -Humuien Konzentrationen von 0,73 g/l bis 1 ,02 g/l wurden von Stamm M. extorquens AM1 mit Plasmid pFS62b gebildet. Eine maximale α -Humu!en Konzentration von 1 ,65 g/l wurde von Stamm M. extorquens ΔαίΝο mit Plasmid pFS62b gebildet, eine 57% Steigerung verglichen mit der höchsten Konzentration von 1,02 g/l durch Stamm AM1 mit Plasmid pFS62b (siehe Tabelle 3). Die Maximale Produktkonzentration von 1,65 g/l bedeutet eine 22 fache Steigerung verglichen mit der höchsten Konzentration, die durch Kultivierung im Schüttelkolben erreicht wurde, wobei das α -Humulen/ODeoo Verhältnis bei etwa 20 mg*l VOD6oo gleichbleibend ist. Die maximal theoretisch mögliche Ausbeute von de novo synthetisierbarem α -Humuien pro Methanol ist 0,26 g/g. Der maximale Ertrag von 0,031 go Humuien/gMeOH, erreicht in Fermentation 5 (siehe Tabelle 3), entspricht 12% der maximalen theoretischen Ausbeute.
Tabelle 3: Prozesseigenschaften von Methanol limitierten Fed-batch Fermentationen
durchgeführt mit den Stämmen AM1 und l\crtNb aufweisend Plasmid pFS62b. Cumat Induktion erfolgte nach Erreichen der frühen exponentiellen Wachstumsphase (OD6oo etwa 10). Die gezeigten Werte repräsentieren Messungen bei einem Zeitpunkt nach Induktion, n.b.: nicht bestimmt, cdw: Zelltrockengewicht (cell dry weight), STY: Spezifische Produktleistung (space time yielo):
1 63 0,74 90 30 0,023 1 1 ,7
AM1 2 70,5 1 ,02 148 n.b. 0,024 15
27,
3 93 0,73 84 0,015 7,8
9
28,
4 80 1 ,37 79 0,023 17,1
CM50 4
2
5 104 1 ,65 85 30 0,031 14,6 a: maximaler theorethischer Ertrag (maximum theoretical yield) ist 0,26 g gMeOH
b: durchschnittliche STY nach Induktion (t=0) bis zum Prozessende
Beispiel 2: Rekombinante cis-Abienol Herstellung 1 Matertal und Methoden
1 .1 Chemikalien, Medien und Bakterienstämme
Methylobacterium extorquens AM 1 (Peel and Quayle 1961 , Biochem J, 81 , 465-9) wurde bei 30°C in Minimalmedium nach Kiefer et al. (Kiefer et al. 2009) mit 123 mM Methanol kultiviert. Escherichia coli Stamm DH5a (Gibco-BRL, Rockville, USA) wurde in !ysogeny broth (LB) medium (Bertani 1951 , J Bacterio!, 62, 293) bei 37 °C kultiviert. Tetracyclin-hydrochlorid wurde in einer Konzentration von 10 pg/mi für E. coli und M. extorquens verwendet. Cumat (4- Isopropylbenzoesäure) wurde als Induktor verwendet und ausgehend von einer 100 mM Stammlösung gelöst in Ethanol in einer Endkonzentration von 00 μΜ eingesetzt.
Cumat, Tetracyclin-hydrochlorid und Zerumbon wurden von Sigma-Aldrich (Steinheim, DE) bezogen. Cis-Abienol wurde von Toronto Research Chemicals (Toronto, CA) bezogen.
Dodekan wurde von VWR (Darmstadt, DE) bezogen. .2 Genetische Manipulationen und Plasmidkonstruktion
Die Standard-Klonierungstechniken wurden nach der dem Fachmann bekannten
Vorgehensweise ausgeführt. Die Transformation von M. extorquens AM1 mit Plasmiden wurde ausgeführt wie in Toyama et al. (Toyama, Anthony and Lidstrom 998) beschrieben. Ribosomen-Bindungsstellen (ribosome binding sites, RBS) wurden mit Hilfe des Ribosomen- Bindungsstellen-Calculators (Salis 2011 ) gestaltet.
1.3 Klonierung von Plasmiden zur Produktion von cis-Abienol
Plasmide zur Synthese von cis-Abienol wurden ausgehend von Plasmid pfs62b konstruiert. Zur Konstruktion von ppjo 6 (pQ2148F-AbCAS-ERG20F96C-MVA) wurde das cis-Abienol Synthase Gen AbCAS, ursprünglich stammend aus Abies balsamea (Zerbe et al. 2012, J Biol Chem, 287, 12121-31) (Accession number JN254808.1 ), codon -optimiert für M. extorquens AM unter Erhalt der DNA-Sequenz nach SEQ ID NO 50. Das codon-optimierte Gen gemäß SEQ ID NO 50 wurde ampiifiziert für die Insertion in pfs62b unter Verwendung der Primer pj05 und pj25. Die RBS des AbCAS-Gens weist die Nukleinsäuresequenz
TATT AAT ATT AAG AG GAG GT AAT AA (SEQ ID NO 51) mit einer Translationsinitiationsrate (TIR) von 233.000 auf. Das Gen für die GGPP Synthase ERG20F96C (SEQ ID NO 52) (Ignea et al. 2015, Metabolie Engineering, 27, 65-75) aus Saccharomyces cerevisiae wurde mittels Mutagenese-PCR mit den Primern pj26, pj16, pj17 und pj10 aus ERG20 gewonnen. Die TIR der RBS von ERG20F96C wurde auf 10.000 eingestellt und weist die Nukleinsäuresequenz
CTTAAACTAAC C G AG ATAG G AAC G AATTTT AC AA (SEQ ID NO 53) auf. Plasmid ppjo16 wurde konstruiert durch Insertion der PCR Produkte von AbCAS sowie ERG20F96C mittels Gibsonklonierung in den mit Spei und Xbal geschnittenen Vektor pfs62b. 2
Zur Konstruktion von Plasmid ppjo17 (pQ2148F-Ntl_PPS-NtABS-ERG20F96C-MVA) wurden das LPP Synthase Gen NtLPPS aus Nicotiana tabacum (Sallaud et al. 2012, Plant J, 72, 1-17) (Accession number HE588139.1) sowie das cis-Abienol Synthase Gen NtABS aus Nicotiana tabacum (Sallaud et al. 2012, Plant J, 72, 1-17) (Accession number HE588140.1) codon- optimiert für M. extorquens AM1 unter Erhalt der DNA-Sequenz SEQ ID NO 54
beziehungsweise SEQ ID NO 55. Die entsprechenden RBS weisen für das Gen NtLPPS eine TIR von 145.000 mit der DNA-Sequenz CAACGGCCCTTACAAAAGGAGGTTAATTATT (SEQ ID NO 56) und für das Gen NtABS eine TIR von 130.000 mit der DNA-Sequenz
GATAGAAACCCTTAATTAAGAAGGAGGTCCTTA (SEQ ID NO 57) auf. Das codon-optimierte NtLPPS-Gen gemäß SEQ ID NO 54 wurde mit den Primern pj05 und pj27 ampiifiziert, zur Amplifikation der codon-optimierten NtABS (SEQ ID NO 55) wurden die Primer pj28 und pj29 verwendet. Für Plasmid ppjo17 wurde das Gen ERG20F96C (SEQ ID NO 52) durch
Mutagenese PCR mit den Primern pj30, pj16, pj17 und pj10 gewonnen. Die TIR der RBS von ERG20F96C in ppjo17 wurde auf 9.500 eingestellt und weist die Nukleinsäuresequenz
AACCACTAAGAACACAGACTTATACACAGGAGGAT (SEQ ID NO 58) auf. Plasmid ppjo17 wurde konstruiert durch Insertion der PCR Produkte von NtLPPS, NtABS sowie ERG20F96C mittels Gibsonklonierung in den mit Spei und Xbal geschnittenen Vektor pfs62b.
Ein Überblick über die verwendeten Primer, Plasmide und Stämme geht aus Tabelle 4 hervor.
Tabelle 4:
Verwendete Primer, Beschreibung Referenz Plasmide und Stämme
Name
Primer
pj05 (SEQ ID NO 70) AACAG AC AATCTG GTCTGTTTGT AAC pj10 (SEQ ID NO 71) TCTTCATCCTGCGCTCCTGTCTAGAAA
T ACTCT AATTAATCTATTTG CTTCTCTT GTAAACTTTG
pj16 (SEQ ID NO 72) ATCGGCGACCAAGCAGTAAG
pj17 (SEQ ID NO 73) TT ACTG CTTG GTC G C CG ATG
pj25 (SEQ ID NO 74) CGTTCCTATCTCGGTTAGTTTAAGATC
GATTCAGGTGGC
pj26 (SEQ ID NO 75) CTTAAACTAACCGAGATAGGAACGAAT
TTTACAATATGGCTTCAGAAAAAGAAAT
TAGGAG
pj27 (SEQ ID NO 76) GACCTCCTTCTTAATTAAGGGTTTCTAT
CTACGTATCAGACCTGCTGGAAC
pj28 (SEQ ID NO 77) G AT AG AAAC C CTT AATTAAG AAG G AG G pj29 (SEQ ID NO 78) TATAAGTCTGTGTTCTTAGTGGTTATC
GATTCACGGCGAG
pj30 (SEQ ID NO 79) AACCACTAAGAACACAGACTTATACAC
AGGAGGATATGGCTTCAGAAAAAGAAA
TT AG GAG
Plasmide
PQ2148F Expressionsvektor für Methylobacterium
extorquens mit Cumat induzierbarem
Promotor 2148 und angepasster Multiple Cloning Site (MCS); TetR , oriT,
pBR322ori
pfs62b Expressionsvektor für Methylobacterium
extorquens zur Synthese von a-Humulen ppjo16 Expressionsvektor für Methylobacterium
extorquens zur Synthese von cis-Abienol mit GGPP Synthase ERG20F96C und cis- Abienol Synthase AbCAS
ppjo17 Expressionsvektor für Methylobacterium extorquens zur Synthese von cis-Abienol mit GGPP Synthase ERG20F96C, LPP Synthase NtLPPS und cis-Abienol Synthase NtABS
Stämme
E. coli DH5 F-, O80dlacZAM15, ATCC A(lacZYA-argF)U169, deoR,
recA1 , endA1 , hsdR17(rK- mK+), phoA, supE44, λ-, thi- 1
M. extorquens Fakultativ methyiotrophes, (Peel and Quayle 1961 )
AM1 obligatorisch aerobes, gram- DSMZ133
negatives, Pink
pigmentiertes a-
Proteobakterium, CmR
1.4 cis-Abienol Produktion in wässrig-organischer Zweiphasen Schüttelkolben-Kultivierung Methylobacterium extorquens AM 1 , aufweisend die cis-Abienol Gewinnungsplasmide wurden kultiviert in Methanol Minimalmedium beinhaltend Tetracyclin-5 hydrochlorid (siehe oben).
Vorkulturen wurden von Agarpiatten in Reagenzgläsern mit 5 ml Medium inokuliert und für 48 h bei 30°C und 180 rpm geschüttelt. Hauptkulturen mit 12 ml Medium in 100 ml
Schikaneschüttelkolben wurden mit einer Vorkultur inokuliert zu einer OD600 von 0, 1 . Nach Kultivierung für 16 h bei 30°C erreichten die Hauptkuituren die frühe exponentielle
Wachstumsphase (OD600 0,3-0,6). Anschließend wurde zur Induktion Cumat hinzugesetzt sowie 3 ml Dodekan als organische Phase zugefügt. Nach 48 h Inkubation wurde ein
Gesamtkulturvolumen von 15 ml dekantiert und für 10 min bei 3220 g zentrifugiert. 1 ml der oberen Dodekanschicht wurde für die cis-Abienol-Analyse verwendet. 1 .5 cis-Abienol Analyse
1 ml Dodekan Probe wurde mit NaS04 getrocknet. Als interner Standard wurden 25 μΙ einer Dodekan-Lösung mit 1 mM Zerumbon zu 225 μΙ Dodekan-Probe zugegeben.
Cis-Abienol wurde analysiert und quantifiziert mit Hilfe einer GC-MS (GC17A mit Q5050
Massenspektrometer, Shimadzu, Kyoto, Japan), ausgestattet mit einer Equity 5 Säule (Supeico, 30 m x 0,25 mm x 0,25 μΜ). Messungen wurden wie folgt durchgeführt: Trägergas: Helium; Splitinjektion (2: 1 ) bei 250°C; Flussrate: 2.2 ml/min; Interface Temperatur: 250°5 C; Programm: 80°C halten für 3 min, 16°C/min auf 240°C, halten für 2 min. Die Retentionszeit betrug 14, 1 min für cis-Abienol und 1 1 ,3 min für Zerumbon. Cis-Abienol in den Proben wurde identifiziert durch Vergleich von drei Hauptfragmentionen der Massenspektren mit einem käuflich erworben cis- Abienol Standard (rel. Intensität in Klammern): 1 19 (15,9), 134 (30,3), 191 (6,0). Für eine
Quantifizierung wurde eine Kalibrierungskurve mit den Konzentrationen 100, 50, 20, 10, 5, 2, 1 mg/L cis-Abienol mit je 00 μΜ Zerumbon verwendet
2 Ergebnisse
2.1 Cis-Abienol Produktion unter Verwendung von Plasmiden mit konstitutivem Promotor (Vergleichsbeispiel) Für die Produktion von cis-Abienol mit Methylobacterium extorquens AM1 wurde neben dem Mevalonatoperon aus Myxococcus xanthus die GGPP Synthase ERG20F96C (eine Variante der FPP-Synthase ERG20 aus Saccharomyces cerevisiae) sowie weitere Gene exprimiert. GGPP sollte entweder direkt zu cis-Abienol durch die bifunktionelle cis-Abienol Synthase AbCAS aus Nicotiana tabacum umgesetzt werden oder schrittweise über die Bildung von LPP aus GGPP durch die LPP Synthase NtLPPS aus Nicotiana tabacum, wobei LPP anschließend durch die cis-Abienol Synthase NtABS, ebenfalls stammend aus Nicotiana tabacum, zu cis- Abienol umgesetzt werden soll. Insgesamt wurden zwei Plasmidvarianten (ppjo16 und ppjo17) zur cis-Abienol Synthese konstruiert.
Nach Transformation von Methylobacterium extorquens AM1 mit den Plasmiden ppjo16 oder ppjo17 traten erste Kolonien nach 6 Tagen Inkubation bei 30°C auf. Für AM 1 mit ppjo16 beziehungsweise ppjo17 war zu diesem Zeitpunkt jeweils ein Klon sichtbar; im Vergleich dazu waren weit über 3000 Transformanten mit dem Leervektor pQ2148F erkennbar. Erst nach insgesamt 8 Tagen Inkubation bei 30°C traten auch bei Transformanten mit den cis- Abienoiproduktionsplasmiden weitere, jedoch deutlich kleinere Kolonien auf. Diese
Beobachtungen deuten darauf hin, dass die cis-Abienol Produktionspiasmide, vermutlich durch Akkumulation von für Methylobacterium extorquens toxischen Prenylphosphatintermediaten, das Wachstum des Organismus deutlich beeinträchtigen und es dadurch zur Bildung von Suppressoren kommt.
Die beiden nach 6 Tagen sichtbaren Transformanten von AM 1 mit ppjo16 beziehungsweise ppjo17, sowie jeweils sechs der kleineren Kolonien, wurden auf einer frischen Agarplatte ausgestrichen und für 6 Tage bei 30°C inkubiert. Auch bei den zuvor kleinen Transformanten bildeten sich nach Überstreichen große Kolonien, also Suppressoren. Da somit die selektive Kultivierung von Transformanten mit Plasmid ppjo16 oder ppjo1 ohne Suppressorenbildung nicht möglich war, konnten nur Suppressoren auf Produktbildung untersucht werden. Hierzu wurden die neu aufgetretenen Suppressoren zur Gewinnung von ausreichend Zellmasse auf einer weiteren, frischen Agarplatte ausgestrichen und für 7 Tage bei 30°C inkubiert.
Die Kultivierung erfolgte unter den oben beschriebenen Bedingungen als wässrig-organische Zweiphasenkulturen, wobei Dodekan als organische Phase diente.
Eine Suppressormutante von M. extorquens A 1 aufweisend Plasmid ppjo16 (genannt 16s6) war in der Lage, cis-Abienol zu produzieren wie der Peak mit gleicher Retentionszeit und Massen spektrum im Vergleich zum cis-Abieno! Standard in Abbildung 1 zeigt. Hingegen war für M. extorquens AM1 mit der Leervektorkontrolle (pQ2148F) kein cis-Abienol nachweisbar. Für die Suppressormutante 16s6 von M. extorquens AM1 mit ppjo16 wurden 21 , 1 mg/L cis-Abienol in der Dodekanphase gemessen, was einer Produktkonzentration von 5,3 mg/L cis-Abienol in der Kulturbrühe entspricht. Nach Plasmidisolation von ppjo16 aus der Suppresormutante 16s6 und anschließender Sequenzierung des Plasmids konnte die dem Suppressor zugrunde liegende Mutation identifiziert werden. Im Promotorbereich des Plasmids, genau 1 15 Nukleotide vor dem Startcodon des AbCAS-Gens, wurde eine Sequenz von insgesamt 28 Nukleotiden deletiert. SEQ iD NO 59 repräsentiert die Sequenz des Promotorbereichs im Plasmid ppjo16, während unter SEQ ID NO 60 die mutierte Promotorsequenz in Plasmid ppjo16 aus der Suppressormutante 16s6 hinterlegt ist.
Beispiel 3: Rekombinante Santalen Herstellung
1 Material und Methoden 1 .1 Chemikalien, Medien und Bakterienstämme
Methyiobacterium extorquens A 1 (Peel and Quayie 1961 , Biochem J, 81 , 465-9) wurde bei 30°C in Minimalmedium nach Kiefer et al. (Kiefer et al., PLoS One, e7831) mit 123 mM
Methanol kultiviert.
Escherichia coli Stamm DH5a (Gibco-BRL, Rockville, USA) wurde in lysogeny broth (LB) medium (Bertani 1951 ) bei 37 °C kultiviert. Tetracyclin-hydrochlorid wurde in einer
Konzentration von 10 pg/ml für B. co/i und M. extorquens verwendet. Cumat
(4-lsopropylbenzoesäure) wurde als Induktor verwendet und ausgehend von einer 100 mM Stammlösung gelöst in Ethanol in einer Endkonzentration von 100 μΜ eingesetzt.
Cumat, Tetracyclin-hydrochlo d, Zerumbon und Sandelhoizöl wurden von Sigma-Aldrich (Steinheim, DE) bezogen. Dodekan wurde von VWR (Darmstadt, DE) bezogen.
1 .2 Genetische Manipulationen und Plasmidkonstruktion
Die Standard-Klonierungstechniken wurden nach der dem Fachmann bekannten
Vorgehensweise ausgeführt. Die Transformation von M. extorquens AM1 mit Plasmiden wurde ausgeführt wie in Toyama et a!. (Toyama et al., FEMS Microbiology Letters, 166, 1 -7) beschrieben.
Ribosomen-Bindungsstellen (ribosome binding sites, RBS) wurden mit Hilfe des Ribosomen- Bindungsstellen-Calculators (Salis 201 , Methods in Enzymology, ed. V. Christopher, 19-42. Academic Press) gestaltet.
1 .3 K!onierung von Plasmiden zur Produktion von Santalen
Plasmide zur Synthese von Santalen wurden ausgehend von den Plasmiden pQ2418F, pfs60b und pfs62b konstruiert.
Zur Konstruktion von ppjo01„woMVA (pQ2148F-SSpiSSY-ERG20) und ppjo01 (pQ2148F- SSpiSSY-ERG20-MVA) wurde das Santalen Synthase Gen SSpiSSY, ursprünglich stammend aus Santalum spicatum (Jones et al., 201 1 , Journal of Biological Chemistry, 286, 17445-17454) (Accession number HQ343278.1 ), codon-optimiert für M. extorquens AM 1 unter Erhalt der DNA-Sequenz nach SEQ ID NO 61. Das codon-optimierte Gen gemäß SEQ ID NO 61 wurde amplifiziert für die Insertion in pfsBOb (Sonntag et al. 2015) unter Verwendung der Primer SSpiSSY_RBSopt_fw und SSpiSSYjrev. Das SSpiSSY PCR Produkt wurde mit Spei und Clal verdaut und in g!eichverdautes Plasmid pfs60b inseriert, ergebend Plasmid ppjo01_woM A. Plasmid ppjo01 wurde konstruiert durch Ausschneiden der Gene SSpiSSY und ERG20 aus ppjo01_woMVA mit A&a/und EcoRl, gefolgt von der Insertion in gleich verdautes pfs62b. In beiden Plasmiden, ppjo01 und ppjo01_woMVA, wies SSpiSSY die Nukleinsäuresequenz TGTTACACCCACAGAACAAACCCGAGGTAACT (SEQ ID NO 62) mit einer TIR von 44.000 auf, die TIR der RBS von ERG20 besaß die Nukleinsäuresequenz
ACATCAAACCAAAGGACTTTACAGGTAGTAGAA (SEQ ID NO 63) mit einer TIR von 20.000. Zur Konstruktion von ppjo03 (pQ2148F-SanSyn-ERG20) wurde das Santalen Synthase Gen SanSyn, ursprünglich stammend aus Clausena lansium (Scalcinati et al., 2012, Metabolie Engineering, 14, 91-103; Scalcinati et al., 2012, Microb Cell Fact, 11 , 1 17) (Accession number HQ452480.1), codon-optimiert für M. extorquens AM1 unter Erhalt der DNA-Sequenz nach SEQ ID NO 64. Das codon-optimierte Gen gemäß SEQ ID NO 64 wurde amplifiziert für die Insertion in pfs62b unter Verwendung der Primer pj05 und pj06. Die RBS des SanSyn-Gens wies die Nukleinsäuresequenz G AAG AAG G AG GTAGTC AT AAAG AAG GAG GTAACTA (SEQ ID NO 65) mit einer TIR von 233.000 auf. Plasmid ppjo03 wurde konstruiert durch Insertion des PCR Produktes von SanSyn mittels Gibsonklonierung in den mit Spei und Bsu36l geschnittenen Vektor pfs62b. Die TIR der RBS von ERG20 wird auf 22.000 eingestellt und wies die
Nukleinsäuresequenz TC CCC AG CGCGCCCCC C AATTCAG G AT AAC ATAG (SEQ ID NO 66) auf.
Zur Konstruktion von ppjo04_woMVA (pQ2148F-ERG20fusSSpiSSY) und ppjo04 (pQ2148F- ERG20fusSSpiSSY-MVA) wurde das FPP Synthase Gen ERG20 mit C-terminalem (GGGGS)x2 Linker mit den Primern ERG20-fus_fw und ERG20-fus_rev für die Insertion in pQ2418F
(Sonntag et al., etab Eng, 32, 82-94) amplifiziert. Das Gen SSpiSSY (SEQ ID NO 61) wurde mit den Primern SSpiSSY_RBSopt_fw und SSpiSSY_rev amplifiziert, mit BamHi und EcoRl verdaut und in gieichverdautes Plasmid pQ24 8F-ERG20fus inseriert, ergebend Plasmid ppjo04_woMVA. Plasmid ppjo04 wurde konstruiert durch Ausschneiden des Gens ERG20fus aus ppjo04_woMVA mit Asel und EcoRl, gefolgt von der Insertion in gleich verdautes pfs62b. In beiden Plasmiden, ppjo04 und ppjo04_wo VA, wies ERG20 die Nukleinsäuresequenz
AAAC ATAG C AT ATT AG CAG ATTAAG G ACATACGT (SEQ ID NO 67) mit einer TIR von 53.000 auf. Zur Konstruktion von ppjo05 (pQ2148F-SSpiSSYfusERG20-MVA) wurde das codon-optimierte Santalen Synthase Gen SspiSSY (SEQ ID NO 61) mit den Primern pj01 und pj08 amplifiziert. Das Gen für die FPP Synthase ERG 20 mit N-terminalem (GGGGS)x2 Linker wurde amplifiziert unter Verwendung der Primer pj09 und pj10. Die TIR des Fusionsproteins wurde auf 402.000 eingestellt und wies die Nukleinsäuresequenz
CCCCTTCCCTTATTTAAACCAGAGGAGGTAACAAA (SEQ ID NO 68) auf. Plasmid ppjo05 wurde konstruiert durch Insertion der PCR Produkte von SSpiSSY sowie fusERG20 mittels Gibsonklonierung in den mit Spei und Xbal geschnittenen Vektor pfs62b. Zur Konstruktion von ppjo06 (pQ2148F-SSpiSSY-ERG20_RBSmax) wurde das codon- optimierte Santalen Synthase Gen SSpiSSY (SEQ ID NO 61) mit den Primern pj01 und pj77 amplifiziert. Die optimierte RBS des SSpiSSY-Gens wies die Nukleinsäuresequenz nach SEQ ID NO 68 mit einer TIR von 402.000 auf. Das Gen für die FPP Synthase ERG20 wurde amplifiziert unter Verwendung der Primer pj10 und pj78. Die TIR von ERG20 wurde auf 1.344.000 eingestellt und wies die Nukleinsäuresequenz
AACCAAATAGGATTAGCACAGAAGGGGGTAATA (SEQ ID NO 69) auf. Plasmid ppjo06 wurde konstruiert durch Insertion der PCR Produkte von SSpiSSY sowie ERG20 mittels
Gibsonklonierung in den mit Spei und Xbal geschnittenen Vektor pfs62b.
Die TIR der RBS des mgs-Gens wurde bei den Plasmiden ppjoOi , ppjo03 sowie ppjo04 analog zum Humulensyntheseplasmtd pfs62b bei 189 beibehalten. Für die Plasmide ppjo05 und ppjo06 wurde der TIR-Wert der RBS der hmgs auf 6345 eingestellt.
Ein Überblick über die verwendeten Primer, Plasmide und Stämme geht aus Tabelle 5 hervor. Tabelle 5: Verwendete Primer, Plasmide und Stämme
Name Beschreibung Referenz
Primer
SspiSSY_RBSopt_f ACGAACTAGTTGTTACACCCACAGAACAAACCCGA
w (SEQ ID NO 80) GGTAACTATGGACTCGTCGACCGCC
SspiSSY_rev (SEQ ATCGTATCGATTCACTCCTCGCCGAGCGG
ID N0 81)
pj01 (SEQ ID NO G AC AATCTGGTCTGTTTGTAACTAGTC CC CTTCCCT
82) TATTTAAACCAGAGGAGGTAACAAAATGGACTCGTC
GACCGCCAC
pj05 (SEQ ID NO AACAG AC AAT CTG GTCTGTTTGTAAC
70)
pj06 (SEQ ID NO TGGGCATACCAGTCACATGC
83)
ERG20-fusJw (SEQ ACGAACTAGTAAACATAGCATATTAGCAGATTAAGG
!D NO 84) AC ATAC GTATG G CTTC AG AAAAAG AAATTAG
ERG20-fus_rev ACTAGGATCCGCCGCCACCCGAGCCACCGCCACC
(SEQ ID NO 85) TTTG CTTCTCTTGTAAACTTTG
pjOS (SEQ ID NO TTTCTGAAGCCATGGATCCGCCGCCACCCGAGCCA
86) CCGCCACCCTCCTCGCCGAGCGGGATC
pj09 (SEQ ID NO GGATCCATGGCTTCAGAAAAAGAAATTAGGAG
87)
pj10 (SEQ ID NO TCTTCATCCTGCGCTCCTGTCTAGAAATACTCTAAT
71) T AATCT ATTTG CTTCTCTTGTAAACTTTG CTTCTGTGCTAATCCTATTTGGTTATCGATTCACTC
CTCGCCGAGC
G ATAAC C AAAT AG G ATTAG C AC AG AAGG G G GTAAT AATGGCTTCAGAAAAAGAAATTAGGAG
Expressionsvektor für Methylobacterium extorquens mit (Sonntag et Cumat induzierbarem Promotor 2148 und angepasster al„ 2015, Multiple Cloning Site (MCS); TetR , oriT, pBR322ori Metab Eng,
32, 82-94)
Expressionsvektor für Methylobacterium extorquens zur (Sonntag et Synthese von α-Humulen, ohne Gene kodierend für al., 2015, Proteine des Mevalonatwegs Metab Eng,
32, 82-94)
Expressionsvektor für Methylobacterium extorquens zur (Sonntag et Synthese von a-Humulen al., 2015,
Metab Eng, 32, 82-94)
Expressionsvektor für Methylobacterium extorquens zur
Synthese von Santalen mit FPP Synthase ERG20 und
Santalen Synthase SspiSSY, ohne Gene kodierend für
Proteine des Mevalonatwegs
Expressionsvektor für Methylobacterium extorquens zur
Synthese von Santalen mit FPP Synthase ERG20 und
Santalen Synthase SspiSSY
Expressionsvektor für Methylobacterium extorquens zur
Synthese von Santalen mit FPP Synthase ERG20 und
Santalen Synthase SanSyn
Expressionsvektor für Methylobacterium extorquens zur
Synthese von Santalen mit einem Fusionsprotein aus
der FPP Synthase ERG20 und der Santalen Synthase
SSpiSSY (ERG20fusSSpiSSY), ohne Gene kodierend
für Proteine des Mevalonatwegs
Expressionsvektor für Methylobacterium extorquens zur
Synthese von Santalen mit einem Fusionsprotein aus
der FPP Synthase ERG20 und der Santalen Synthase
SSpiSSY (ERG20fusSSpiSSY)
Expressionsvektor für Methylobacterium extorquens zur
Synthese von Santalen mit einem Fusionsprotein aus
der Santalen Synthase SSpiSSY und der FPP
Synthase ERG20 (SSpiSSYfusERG20) ppjooe Expressionsvektor für Methylobacterium extorquens zur
Synthese von Santaien mit FPP Synthase ERG20 und
Santalen Synthase SspiSSY, wobei die TIR der RBS
von ERG20 maximal hoch eingestellt wurde
Stämme
E. coli DH5a F-, O80dlacZAM15, A(iacZYA-argF)U169, deoR, ATCC
recA1 , endA1, hsdR17(rK-mK+), phoA, supE44, λ-,
M. extorquens Fakultativ methylotrophes, obligatorisch aerobes, gram(Peel and AM1 negatives, Pink pigmentiertes α-Proteobaktehum, CmR Quayle
1961 ,
Biochem J, 81 , 465-9.) DSMZ1338
1.4 Santalen Produktion in wässrig-organischer Zweiphasen Schüttelkolben-Kultivierung
Methylobacterium extorquens AM1 , aufweisend die Santalen Gewinnungsplasmide wurde kultiviert in Methanol Minimalmedium beinhaltend Tetracyclin-5 hydrochlorid (siehe oben). Vorkulturen wurden von Agarplatten in Reagenzgläsern mit 5 ml Medium inokuliert und für 48 h bei 30°C und 180 rpm geschüttelt. Hauptkulturen mit 12 ml Medium in 100 ml
Schikaneschüttelkolben wurden mit einer Vorkultur inokuliert zu einer ODeoo von 0,1. Nach Kultivierung für 16 h bei 30X erreichten die Hauptkulturen die frühe exponentielle
Wachstumsphase (ODeoo 0,3-0,6). Anschließend wurde zur Induktion Cumat hinzugesetzt sowie 3 ml Dodekan als organische Phase zugefügt. Nach 48 h Inkubation wurde ein
Gesamtkulturvolumen von 15 ml dekantiert und für 10 min bei 3220 g zentrifugiert. 1 ml der oberen Dodekanschicht wurde für die Santalen-Analyse verwendet. 1.5 Santalen-Analyse
1 ml Dodekan Probe wurde mit NaS04 getrocknet. Als interner Standard wurden 25 μΙ einer Dodekan-LÖsung mit 1 mM Zerumbon zu 225 μΙ Dodekan-Probe zugegeben. Santalen wurde analysiert mit Hilfe einer GC-MS (GC17A mit Q5050 Massenspektrometer, Shimadzu, Kyoto, Japan), ausgestattet mit einer Equity 5 Säule (Supeico, 30 m x 0,25 mm x 0,25 μΜ). Messungen wurden wie folgt durchgeführt: Trägergas: Helium; Spiitinjektion (8:1) bei 250°C; Flussrate: 2.2 ml/min; Interface Temperatur: 250° C; Programm: 80°C halten für 3 min, 16°C/min auf 240°C, halten für 2 min. Da ein Santalenstandard kommerziell nicht erhältlich ist, wurde stattdessen Sandelholzöl zur Analyse von Santalenprodukten in den Proben eingesetzt. Vor der Messung wurde das Sandelholzöl :500 in Dodekan verdünnt. Die verschiedenen in Sandelholzöl enthaltenen Substanzen eluierten zwischen 11 und 12,4 min. 2 E rgebnisse
2.1 Santa!en Produktion unter Verwendung von Plasmiden mit konstitutivem Promoter
(Vergleichsbeispiel)
Für die Produktion von Santalen mit Methylobacterium extorquens AM1 wurden neben dem evalonatoperon aus Myxococcus xanthus die FPP Synthase ERG20 aus Saccharomyces cerevisiae sowie weitere Gene exprimiert. FPP sollte durch eine Santalen Synthase aus Santa/um spicatum (SSpäSSY) oder Clausens lansium (SanSyn) zu Santalen umgesetzt werden. Ebenso wurden Fusionsproteine aus der Santalen Synthase SSpiSSY und der FPP Synthase ERG20 zur Santalenproduktion getestet. Insgesamt wurden sieben Plasmidvarianten (ppjo01, ppjo01_woMVA, ppjo03, ppjo04, ppjo04_woMVA, ppjoOS, ppjo06) zur Santalen Synthese konstruiert.
Nach Transformation von Methylobacterium extorquens MI mit den Santalen
Gewinnungsplasmiden traten Kolonien nach 5 Tagen Inkubation bei 30°C auf. Für Plasmide ohne Mevalonatweg (pQ2418F, ppjo01„wo VA, ppjo04_woMVA) sowie denjenigen, bei denen die TIR der RBS der hmgs auf 189 eingestellt war, waren weit über 3000 Transformanten sichtbar. Im Vergleich dazu traten bei Plasmiden mit einer TIR der RBS der hmgsvon 6345 (ppjoOS, ppjo06) mit circa 100 sichtbaren Kolonien deutlich weniger Transformanten auf. Nach insgesamt 8 Tagen Inkubation bei 30°C traten bei Transformanten mit ppjo05 beziehungsweise ppjo06 weitere, jedoch deutlich kleinere Kolonien auf. Diese Beobachtungen deuteten darauf hin, dass die Santalen Produktionsplasmide mit einer höher eingestellten TIR der RBS der hmgs, vermutlich durch Akkumulation von für Methylobacterium extorquens toxischen
Prenylphosphatintermediaten, das Wachstum des Organismus deutlich beeinträchtigen und es dadurch zur Bildung von Suppressoren kam.
Die nach 5 Tagen sichtbaren Transformanten von AM1 mit ppjo05 beziehungsweise ppjo06, sowie jeweils sechs der kleineren Kolonien, wurdne auf einer frischen Agarplatte ausgestrichen und für 6 Tage bei 30°C inkubiert. Auch bei den zuvor kleinen Transformanten bildeten sich nach Überstreichen große Kolonien, also Suppressoren. Da somit die selektive Kultivierung von Transformanten mit Plasmid ppjoOS oder ppjo06 ohne Suppressorenbildung nicht möglich war, konnten nur Suppressoren auf Produktbildung untersucht werden. Hierzu wurden die neu aufgetretenen Suppressoren zur Gewinnung von ausreichend Zeilmasse auf einer weiteren, frischen Agarplatte ausgestrichen und für 7 Tage bei 30°C inkubiert. Für die übrigen Stämme von M. extorquens, bei denen es nicht zur Suppressorenbildung kam, wurdne ebenfalls jeweils 3 verschiedene Klone auf einer neuen Agarplatte ausgestrichen und für 7 Tage bei 30°C inkubiert.
Die Kultivierung erfolgte unter den oben beschriebenen Bedingungen als wässrig-organische Zweiphasenkulturen, wobei Dodekan als organische Phase diente.
M. extorquens AM1 aufweisend die Plasmide ppjo01_woMVA, ppjo03, ppjo04, ppjo04_wo VA oder ppjoOS war in der Lage, Santalene zu produzieren wie der -Santalen-Peak mit gleicher Retentionszeit und Massenspektrum im Vergleich zu Substanzen im Sandelholzöl in Abbildung 1 zeigte. Exemplarisch ist das Chromatogramm und Massenspektrum einer Probe von M. extorquens AM1 aufweisend das Plasmid ppjo03 dargestellt. Hingegen war für M. extorquens AM1 mit der Leervektorkontrolle (pQ2148F) kein Santalene nachweisbar.
Der Fachmann erkennt, dass die hier in den Ausführungsbeispielen beschriebenen
Bakterienstämme und Fermentationsbedingungen ohne Weiteres angepasst werden können ohne den Rahmen der Erfindung zu verlassen. So sind einfache Adaptationen denkbar zur Herstellung von anderen Sesquiterpenen aus Methanol oder Ethanol, beispielsweise potentieller Biokraftstoffe, wie Bisabolen, oder von Aromastoffen, wie Santalen oder von Diterpenen wie Sclareol. Die Erfindung ermöglicht die Bioproduktion von Terpenen aus der nicht mit Lebensmitteln konkurrierenden Kohlenstoff-Quelle Methanoi oder Ethanol.
Sämtliche aus den Ansprüchen, der Beschreibung und der Zeichnung hervorgehenden Merkmale und Vorteile, einschließlich konstruktiver Einzelheiten, räumlicher Anordnungen und Verfahrensschritten, können sowohl für sich als auch in den verschiedensten Kombinationen erfindungswesentlich sein.
Zitierte Nicht-Patentliteratur:
Ajikumar, P. K., Tyo, K., Carlsen, S., Mucha, O., Phon, T.H. Siephanopoulos, G., 2008.
Terpenoids: opportunities for biosynthesis of natura! product drugs using engineered
microorganisms. Molecular pharmaceutics. 5, 167-90
Asadollahi, M. A., Maury, J., Müller, K., Nielsen, K. F., Schalk, M„ Clark, A., Nieisen, J., 2008. Production of plant sesquiterpenes in Saccharomyces cerevisiae: Effect of ERG9 repression on sesquiterpene biosynthesis. Biotechnology and Bioengineering. 99, 666-677;
Bertani, G. (1951) STUDIES ON LYSOGENESIS I.: The Mode of Phage Liberation by
Lysogenic Escherichia coli! J Bacteriol, 62, 293.
Caniard, Anne, et al. "Discovery and functionai characterization of two diterpene synthases for sclareol biosynthesis in Salvia sclarea (L.) and their relevance for perfume manufacture." BMC plant biology 12.1 (2012): 1 9.
Chandran, S., Kealey, J., Reeves, C, 2011. Microbial production of isoprenoids. Process Biochemistry. 46, 1703-1710
Chou, H. H., Marx, C. J., 2012. Optimization of gene expression through divergent mutational paths. Cell reports. 1 , 133-40.
Entian, K.-D., Koetter, P., 1998. Yeast mutant and plasmid collections. In: Brown, A. J. P., Tuite, M. F., Eds.). Academic Press Ltd., San Diego, pp. 431-449.
Ignea, C, F. A. Trikka, K. Nikolaidis, P. Georgantea, E. loannou, S. Loupassaki, P. Kefais, A. K. Kaneliis, V. Roussis, A. M. Makris & S. C. Kampranis (2015) Efficient 10 diterpeneproduction in yeast by engineering Erg20p into a geranylgeranyl diphosphate synthase. Metabolie
Engineering, 27, 65-75.
Jones, C. G., J. Moniodis, K. G. Zulak, A. Scaffidi, J. A. Plummer, E. L. Ghisalbertt, E. L.
Barbour & J. Bohlmann (2011) Sandalwood Fragrance Biosynthesis Involves Sesquiterpene Synthases of Both the Terpene Synthase (TPS)-a and TPS-b Subfamilies, including Santalene Synthases. Journal of Biological Chemistry, 286, 17445-17454.
Kaczmarczyk, A., Vorholt, J. A., Francez-Charlot, A., 2013. Cumate-inducibie gene expression System for sphingomonads and other Alphaproteobacteria. Appl. Environ. Microbiol. 79, 6795- 802. Kiefer, P., Buchhaupt, M., Christen, P., Kaup, B., Schräder, J., Vorholt, J. A., 2009. Metabolite Profiling Uncovers Plasmid-induced Cobalt Limitation under Methylotrophic Growth Conditions. PLoS ONE. 4, e7831. Martin, V. J., Pitera, D. J., Withers, S. T., Newman, J. D., Keasling, J. D., 2003. Engineering a mevalonate pathway in Escherichia coli for production of terpenoids. Nature biotechnology. 21, 796-802;
Marx, C. J., Lidstrom, M. E., 2001. Deveiopment of improved versatüe broad-host-range vectors for use in methylotrophs and other Gram-negative bacteria. Microbiology. 147, 2065-2075.
Mi, J-, Becher, D., Lubuta, P., Dany, S., Tusch, K., Schewe, H., Buchhaupt, M., Schräder, J., 2014. De novo production of the monoterpenoid geranic acid by metabolicalfy engineered Pseudomonas putida. Microbial cell factories. 13, 170.
Peel, D. & J. R. Quayle (1961) Microbial growth on C1 Compounds. I. Isolation and
characterization of Pseudomonas AM 1. Biochem J, 81, 465-9.
Peralta-Yahya, P. P., Keasling, J.D., 2010. Advanced biofuel production in microbes. Biotechnol J. 5, 147-62;
Puigbo, P., Bravo, I., Garcia-Vallve, S., 2008. E-CAi: a novel Server to estimate an expected value of Codon Adaptation Index (eCAl). BMC Bioinformatics. 9, 65. Salis, H. M. 201 1. Chapter two - The Ribosome Binding Site Calculator. In Methods in
Enzymology, ed. V. Christopher, 19-42. Academic Press.
Sallaud, C, C. Giacalone, R. Topfer, S. Goepfert, N. Bakaher, S. Rosti & A. Tissier (2012) Characterization of two genes for the biosynthesis of the labdane dtterpene Z-abienol in tobacco (Nicotiana tabacum) glandulär trichomes. Plant J, 72, 1-17.
Sarria, S., Wong, B., Martin, H., Keasling, J.D., Peralta-Yahya, P., 2014. Microbial synthesis of Pinene. ACS Synthetic Biology 3 (7), 466^75 Scalcinati, G., C. Knuf, S. Partow, Y. Chen, J. Maury, M. Schalk, L. Daviet, J. Nielsen & V. Siewers (2012) Dynamic control of gene expression in Saccharomyces cerevisiae engineered for the production of plant sesquitepene α-santalene in a fed-batch mode. Metabolie
Engineering, 14, 91-103. Scalcinati, G., S. Partow, V. Siewers, M. Schalk, L. Daviet & J. Nielsen (2012) Combined metabolic engineering of precursor and co-factor suppiy to increase alpha-santalene production by Saccharomyces cerevisiae. Microb Cell Fact, 11 , 117. Sonntag, F., C. Kroner, P. Lubuta, R. Peyraud, A. Horst, M. Buchhaupt & J. Schräder (2015) Engineering Methyfobacterium extorquens for de novo synthesis of the sesquiterpenoid alpha- humulene from methanoi. Metab Eng, 32, 82-94. Toyama, H., Anthony, C, Lidstrom, M. E,, 1998. Construction of Insertion and deietion mxa mutants of Methyiobacterium extorquens AM1 by electroporation. FEMS Microbiol. Lett. 166, 1- 7.
Van Dien, S. J., Marx, C. J., O'Brien, B. N., Lidstrom, M. E,, 2003. Genetic characterization of the carotenoid biosynthetic pathway in Methylobacterium extorquens AM1 and Isolation of a coloriess mutant. Appi. Environ. Microbio!. 69, 7563-6.
Yoon, S.-H., Lee, S.-H., Das, A., Ryu, H.-K., Jang, H.-J., Kim, J.-Y., Oh, D.-K., Keas!ing, J. D., Kim, S.-W., 2009. Combinatorial expression of bacterial whole mevaionate pathway for the production of ß-carotene in E. coli. Journal of Biotechnology. 140, 218-226;
Yu, F., Okamto, S., Nakasone, K., Adachi, K., Matsuda, S., Harada, H., Misawa, N., Utsumi, R., 2008. Molecuiar cloning and functional characterization of alpha-humulene synthase, a possible key enzyme of zerumbone biosynthesis in Shampoo ginger {Zingiber zerumbet Smith). Planta. 227, 1291-9.
Zerbe, P., A. Chiang, M. Yuen, B. Hamberger, B. Hamberger, J. A. Draper, R. Britton & J.
Bohlmann (2012) Bifunctional cis-abienol synthase from Abies balsamea discovered by transcriptome sequencing and its implications for diterpenoid fragrance production. J Biol Chem, 287, 12121-31.
Sequenzprotokoll - freier Text
SEQ ID NO 1 : Hydroxymethylglutaryl-CoA-Synthase, Myxococcus Xanthus
SEQ ID NO 2: Hydroxy- methylglutaryl-CoA-Reduktase, Myxococcus Xanthus
SEQ ID NO 3: Mevalonat-Kinase, Myxococcus Xanthus
SEQ ID NO 4: Phosphomevalonat- Kinase, Myxococcus Xanthus
SEQ ID NO 5: Pyrophosphomevalonat-Decarboxylase, Myxococcus Xanthus
SEQ ID NO 6: Isopentenylpyrophosphat-Isomerase, Myxococcus Xanthus
SEQ ID NO 7: hmgs Gen aus Myxococcus xanthus mit entfernter EcoR\- Restriktionsstelle unter Einfügung einer stillen Mutation (gaattc zu gagttc)
SEQ ID NO 8: hmgr Gen aus Myxococcus xanthus
SEQ ID NO 9: mvaK1 Gen aus Myxococcus xanthus
SEQ ID NO 10: mvaK2 Gen aus Myxococcus xanthus
SEQ ID NO 11 : mvaD Gen aus Myxococcus xanthus
SEQ ID NO 12: fni Gen aus Myxococcus xanthus
SEQ ID NO 13: FPP-Synthase ERG20 aus Saccharomyces cerevisiae, PRT
SEQ ID NO 14- FPP-Synthase ERG20 aus Saccharomyces cerevisiae, DNA
SEQ ID NO 15. Sesquiterpen-Synthase aus Zingiber zerumbet
SEQ ID NO 16: DNA Sequenz der alpha-Humulen-Synthase zss/von Zingiber zerumbet
Codon-
SEQ ID NO 17 Primer
SEQ ID NO 18 Primer
SEQ ID O 19 Primer
SEQ ID NO 20 Primer
SEQ ID NO 21 Primer
SEQ ID NO 22 Primer
SEQ ID NO 23 Primer
SEQ ID NO 24 Primer
SEQ ID NO 25 Primer
SEQ iD NO 26 Primer
SEQ ID O 27 Primer
SEQ ID NO 28 Primer
SEQ ID NO 29 Primer
SEQ ID NO 30 Primer
SEQ ID NO 31 Primer
SEQ ID NO 32 Primer
SEQ ID NO 33 Primer
SEQ ID NO 34 Primer
SEQ ID NO 35 Primer
SEQ ID NO 36 Primer
SEQ ID NO 37 Primer
SEQ ID NO 38 Primer SEQ ID NO 39 optimierte RBS von ERG20 mit einer TIR von 22.000
SEQ ID NO 40 optimierte RBS von ERG20 mit einer TIR von 36.800
SEQ ID NO 41 optimierte RBS von zss/mit einer TIR von 221.625
SEQ ID NO 42: GGPP-Synthase aus S. cerevisiae
SEQ ID NO 43: GGPP-Synthase aus Pantoea agglomerans
SEQ ID NO 44: GGPP-Synthase aus Taxus canadensis
SEQ ID NO 45: Sesquiterpen-Synthase aus Santalum album
SEQ ID NO 46: Sesquiterpen-Synthase Santalum spicatum
SEQ ID NO 47: Diterpen-Synthase aus Abies baisameaSEQ ID NO 48 optimierte
RBS von fni mit einer TIR von 65.000
SEQ ID NO 49 optimierte RBS von hmgs mit einer TIR von 6.345
SEQ ID NO 50 DNA-Sequenz der cis-Abienol Synthase AbCAS aus Abies balsamea codon-optimiert für Methylobacterium extorquens AM1
SEQ ID NO 51 optimierte RBS von AbCAS mit einer TIR von 233.000
SEQ ID NO 52 DNA-Sequenz der GGPP Synthase ERG20F96C aus Saccharomyces cerevisiae
SEQ ID NO 53 optimierte RBS von ERG20F96C mit einer TIR von 10.000 in Plasmid ppjo16
SEQ ID NO 54 DNA-Sequenz der LPP Synthase NtLPPS Gen aus Abies balsamea codon-optimiert für Methylobacterium extorquens A 1
SEQ ID NO 55 DNA-Sequenz der cis-Abienol Synthase NtABS Gen aus Abies balsamea codon-optimiert für Methylobacterium extorquens AM1
SEQ ID NO 56 optimierte RBS von NtLPPS mit einer TIR von 145.000 in Plasmid ppjo16
SEQ ID NO 57 optimierte RBS von NtABS mit einer TIR von 130.000 in Plasmid ppjo 6
SEQ ID NO 58 optimierte RBS von ERG20F96C mit einer TIR von 9.500 in Plasmid ppjo17
SEQ ID NO 59: Promotorbereich von Plasmid ppjo16 einschließlich RBS AbCAS,
beginnend direkt nach CymR*
SEQ ID NO 60: Promotorbereich von Plasmid ppjo 6 aus Klon 16s6 einschließlich RBS
AbCAS, beginnend direkt nach CymR*
SEQ ID NO 61 : DNA-Sequenz der Santalen Synthase SspiSSY aus Santalum spicatum codon-optimiert für Methylobacterium extorquens AM1
SEQ ID NO 62: optimierte RBS von SSpiSSY mit einer TIR von 44.000 in Plasmid ppjo01 und ppjo01_woMVA
SEQ ID NO 63: optimierte RBS von ERG20 mit einer TIR von 20.000 in Plasmid ppjo01 und ppjo01_woMVA
SEQ ID NO 64: DNA-Sequenz der Santalen Synthase SanSyn aus Clausena lansium codon-optimiert für Methylobacterium extorquens AM1
SEQ ID NO 65: optimierte RBS von SanSyn mit einer TIR von 233.000 in Plasmid ppjo03
SEQ ID NO 66: optimierte RBS von ERG20 mit einer TIR von 22.000 in Plasmid ppjo03
SEQ ID NO 67: optimierte RBS von ERG20 mit einer TIR von 53.000 in Plasmid ppjo04 und ppjo04_woMVA SEQ 1D NO 68; optimierte RBS von SSpiSSY mit einer TIR von 402.000 in Plasmiden ppjoOS und ppjo06
SEQ iD NO 69: optimierte RBS von ERG20 mit einer TIR von 1.344.000 in Plasmid ppjo06
SEQ ID NO 70 Primer pj05
SEQ ID NO 71 Primer pj10
SEQ ID NO 72 Primer pj16
SEQ ID NO 73 Primer pj17
SEQ ID NO 74 Primer pj25
SEQ ID NO 75 Primer pj26
SEQ ID NO 76 Primer pj27
SEQ ID NO 77 Primer pj28
SEQ iD NO 78 Primer pj29
SEQ ID NO 79 Primer pj30
SEQ ID NO 80 Primer SspiSSY_RBSopi_fw
SEQ ID O 81 Primer SspiSSY_rev
SEQ ID NO 82 Primer pj01
SEQ ID NO 83 Primer pj06
SEQ ID NO 84 Primer ERG20-fus_fw
SEQ ID NO 85 Primer ERG20-fus„rev
SEQ ID NO 86 Primer pj08
SEQ ID NO 87 Primer pj09
SEQ ID NO 88 Primer pj77
SEQ ID NO 89 Primer pj78
SEQ ID NO 90 optimierte RBS von hmgs mit einer TIR von

Claims

entansprüche
Ein methylotrophes Bakterium aufweisend eine heteroioge Terpensynthase und rekombinante DNA kodierend für wenigstens ein Polypeptid mit enzymatischer Aktivität zur Expression in dem genannten Bakterium, dadurch gekennzeichnet, dass das genannte wenigstens eine Polypeptid mit enzymatischer Aktivität ausgewählt ist aus der Gruppe bestehend aus
wenigstens ein Enzym eines heterologen Mevalonatweges ausgewählt aus der Gruppe bestehend aus Hydroxymethylgiutaryl-CoA-Synthase (HMG-CoA- Synthase), Hydroxymethylglutaryl-CoA-Reduktase (HMG-CoA- Reduktase), Mevalonat-Kinase, Phosphomevaionat-Kinase, Pyrophosphomevalonat- Decarboxylase und Isopentenyipyrophosphat-Isomerase; und
eine Synthase einer Prenyldiphosphat-Vorstufe.
Ein methylotrophes Bakterium aufweisend eine heteroioge Hydroxymethylgiutaryl-CoA- Synthase (HMG-CoA-Synthase) und eine Hydroxymethylglutaryl-CoA-Reduktase (HMG- CoA-Reduktase) als Enzyme eines heterologen Mevalonatweges sowie rekombinante DNA kodierend für wenigstens ein Polypeptid mit enzymatischer Aktivität zur Expression in dem genannten Bakterium, dadurch gekennzeichnet, dass das genannte wenigstens eine Polypeptid mit enzymatischer Aktivität ausgewählt ist aus der Gruppe bestehend aus
wenigstens ein weiteres Enzym eines heterologen Mevalonatweges ausgewählt aus der Gruppe bestehend aus Mevalonat-Kinase, Phosphomevaionat-Kinase, Pyrophosphomevalonat-Decarboxylase und Isopentenylpyrophosphat- Isomerase;
eine heteroioge Terpensynthase und
eine Synthase einer Prenyldiphosphat-Vorstufe.
Das Bakterium nach Anspruch 1 oder 2, dadurch gekennzeichnet, dass das wenigstens eine Enzym des heterologen Mevalonatweges eine Peptidsequenz aufweist mit einer Identität von jeweils wenigstens 60% zur Peptidsequenz nach SEQ ID NO. 1 , SEQ ID NO.
2, SEQ ID NO.
3, SEQ ID NO.
4, SEQ ID NO.
5 bzw. SEQ ID NO. 6.
Das Bakterium nach einem der Ansprüche 1 bis 3, dadurch gekennzeichnet, dass die heteroioge Terpensynthase ausgewählt ist aus der Gruppe bestehend aus einer Sesquiterpen-Synthase und einer Diterpen-Synthase.
Das Bakterium nach Anspruch 4, dadurch gekennzeichnet, dass die heteroioge
Terpensynthase eine Sesquiterpen-Synthase ist, wobei die Sesquiterpen-Synthase ein Enzym zur Synthese eines zyklischen Sesquiterpens ist, das Sesquiterpen
insbesondere ausgewählt ist aus der Gruppe bestehend aus a-Humulen und Epimeren des Santalens, wie α-Santalen, ß-Santalen, epi-ß-Santalen oder α-exo-Bergamoten, und Bisabolenen, wie b-Bisabolen.
6. Das Bakterium nach Anspruch 4, dadurch gekennzeichnet, dass die heterologe
Terpensynthase eine Diterpen-Synthase ist, insbesondere ein Enzym zur Synthese eines Diterpens ist, das Diterpen insbesondere ausgewählt aus der Gruppe bestehend aus Sclareo!, Cis-Abienol, Abitadien, Isopimaradien, Manool und Larixol.
7. Das Bakterium nach einem der Ansprüche 1 bis 6, dadurch gekennzeichnet, dass die Synthase einer Prenyldiphosphat-Vorstufe ein Enzym ausgewählt aus der Gruppe bestehend aus Farnesyldiphosphat-Synthase (FPP-Synthase) und
Geranylgeranyldiphosphat-Synthase (GGPP-Synthase) ist.
8. Das Bakterium nach einem der Ansprüche 1 bis 7, dadurch gekennzeichnet, dass die Synthase einer Prenyldiphosphat-Vorstufe eine heterologe FPP-Synthase ist, wobei es sich bei der heterologen FPP-Synthase um eine eukaryotische oder prokaryotische
FPP-Synthase handelt.
9. Das Bakterium nach einem der Ansprüche 1 bis 7, dadurch gekennzeichnet, dass die Synthase einer Prenyldiphosphat-Vorstufe eine heterologe GGPP-Synthase ist, wobei es sich bei der heterologen GGPP-Synthase um ein Enzym aus einem Organismus handelt, der ausgewählt ist aus der Gruppe bestehend aus Bakterien, Pflanzen und Pilzen.
10. Das Bakterium nach einem der Ansprüche 1 bis 9, dadurch gekennzeichnet, dass die rekombinante DNA zur heterologen Expression der genannten Enzyme mit einem gemeinsamen induzierbaren Promotor oder mehreren unabhängig voneinander induzierbaren Promotoren versehen ist.
11. Das Bakterium nach einem der Ansprüche 1 bis 10, dadurch gekennzeichnet, dass die rekombinante DNA jeweils unabhängig voneinander plasmidständig oder chromosomal exprimierbar ist.
12. Das Bakterium nach einem der Ansprüche 1 bis 11 , dadurch gekennzeichnet, dass es sich bei dem Bakterium um ein methylotrophes Proteobakterium, insbesondere um ein Bakterium der Gattung Methylobacterium oder der Gattung Methylomonas,
vorzugsweise um das Bakterium Methylobacterium extorquens, handelt.
13. Das Bakterium nach einem der Ansprüche 1 bis 12, dadurch gekennzeichnet, dass das Bakterium ein Stamm mit fehlender Carotinoid-Biosynthese Aktivität, insbesondere mit fehlender Diapoiycopin-Oxidase Aktivität, ist.
14. Ein Verfahren zur mikrobiellen de novo Synthese von Sesquiterpenen oder Diterpenen aus Methanol und/oder Ethanol, umfassend die folgenden Schritte:
Bereitstellen eines Methanoi und/oder Ethanol enthaltenden wässrigen Mediums, Kultivierung eines methylotrophen Bakteriums gemäß einem der Ansprüche 1 bis 13 in dem genannten Medium in einem Bioreaktor, wobei Methanol und/oder Ethanol durch das Bakterium zu einem Terpen umgesetzt wird,
Abtrennung des im Bioreaktor gebildeten Sesquiterpens oder Diterpens.
Das Verfahren nach Anspruch 14, dadurch gekennzeichnet, dass in dem genannten Medium Methanol und/oder Ethanol als einzige Kohlenstoff-Quelle(n) für die Kultivierung des genannten Bakteriums enthalten ist/sind.
Verwendung eines Methanol und/oder Ethanol enthaltenden Mediums zur Kultivierung eines rekombinanten methylotrophen Bakteriums nach einem der Ansprüche 1 bis 13 für die mikrobielle de novo Synthese von Sesquiterpenen oder Diterpenen aus Methanol und/oder Ethanol.
Verwendung eines methylotrophen Bakteriums nach einem der Ansprüche 1 bis 13 für die mikrobielle de novo Synthese von Sesquiterpenen oder Diterpenen aus Methanol und/oder Ethanol.
EP16710137.7A 2015-03-11 2016-03-11 Verfahren zur mikrobiellen de novo synthese von terpenen Withdrawn EP3268467A1 (de)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE102015103608.8A DE102015103608A1 (de) 2015-03-11 2015-03-11 Verfahren zur mikrobiellen de novo Synthese von Terpenen
PCT/EP2016/055239 WO2016142503A1 (de) 2015-03-11 2016-03-11 Verfahren zur mikrobiellen de novo synthese von terpenen

Publications (1)

Publication Number Publication Date
EP3268467A1 true EP3268467A1 (de) 2018-01-17

Family

ID=55538208

Family Applications (1)

Application Number Title Priority Date Filing Date
EP16710137.7A Withdrawn EP3268467A1 (de) 2015-03-11 2016-03-11 Verfahren zur mikrobiellen de novo synthese von terpenen

Country Status (7)

Country Link
US (1) US20180105838A1 (de)
EP (1) EP3268467A1 (de)
JP (1) JP2018507698A (de)
CN (1) CN107429223A (de)
DE (1) DE102015103608A1 (de)
MX (1) MX2017011681A (de)
WO (1) WO2016142503A1 (de)

Families Citing this family (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10202324B2 (en) 2015-05-04 2019-02-12 Basf Se Process for the preparation of melonal
CN108367931B (zh) 2015-12-08 2022-01-18 巴斯夫欧洲公司 具有bea框架结构的含锡沸石材料
EP3816297A1 (de) 2016-02-19 2021-05-05 Basf Se Biokatalytische zyklisierung von mehrfach ungesättigten carbonsäuren-verbindungen
EP3464258A1 (de) 2016-05-31 2019-04-10 Basf Se Tetrahydropyranylniederalkylester und deren herstellung mittels einer ketenverbindung
CN108949788B (zh) * 2018-07-10 2020-07-14 广东省微生物研究所（广东省微生物分析检测中心） 番茄红素合成相关基因及其应用
CN109852600B (zh) * 2018-12-25 2021-12-31 天津大学 一种小萼苔倍半萜合成酶MTb及其基因序列
CN109777815B (zh) * 2019-03-28 2021-10-29 昆明理工大学 HMG-CoA合成酶基因RKHMGCS及其应用
CN112175891B (zh) * 2019-11-12 2023-04-21 中国科学院青岛生物能源与过程研究所 一种生产海藻糖的基因工程菌及其构建方法与应用
CN112852650B (zh) * 2019-11-27 2023-04-14 暨南大学 一种高产檀香烯和檀香醇的酿酒酵母工程菌及其构建方法与应用
CN112592843B (zh) * 2020-12-25 2022-06-14 南京师范大学 一种生产α-蛇麻烯的重组解脂耶氏酵母菌及其构建方法和应用
CN112941063B (zh) * 2021-04-22 2022-08-05 杭州师范大学 一种α-檀香烯合成酶、基因及应用
CN114181964B (zh) * 2021-11-02 2023-06-09 云南大学 一种表达盒组合、重组载体和重组酿酒酵母及其应用
CN117165502A (zh) * 2022-05-26 2023-12-05 牛津大学(苏州)科技有限公司 一种合成萜类化合物的共培养系统和方法

Family Cites Families (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7172886B2 (en) 2001-12-06 2007-02-06 The Regents Of The University Of California Biosynthesis of isopentenyl pyrophosphate
MX284139B (es) 2006-05-26 2011-02-18 Amyris Biotechnologies Inc Produccion de isoprenoides.
BRPI0716954A2 (pt) * 2006-09-26 2013-10-29 Univ California Produção de isoprenóides e precursores de isoprenóides
AU2012249389A1 (en) * 2011-04-29 2013-11-14 Danisco Us Inc. Production of mevalonate, isoprene, and isoprenoids using genes encoding polypeptides having thiolase, HMG-CoA synthase and HMG-CoA reductase enzymatic activities
BR112014010750B1 (pt) * 2011-11-09 2021-09-21 Amyris, Inc Produção de isoprenoides derivados de acetil-coenzima a
US20130323820A1 (en) * 2012-06-01 2013-12-05 Lanzatech New Zealand Limited Recombinant microorganisms and uses therefor
EP2875136B1 (de) 2012-07-18 2017-04-12 Isobionics B.V. Rhodobacter zur herstellung von terpenoiden
US20150315599A1 (en) * 2012-12-07 2015-11-05 Ginkgo Bioworks, Inc Methods and Systems for Methylotrophic Production of Organic Compounds
EP2940123B1 (de) * 2012-12-27 2018-04-25 Sekisui Chemical Co., Ltd. Rekombinante zelle und verfahren zur herstellung von isopren
AU2014225631A1 (en) * 2013-03-07 2015-08-13 Calysta, Inc. Compositions and methods for biological production of isoprene
CN104120141A (zh) * 2014-07-14 2014-10-29 青岛农业大学 一种微生物催化合成β-石竹烯的方法及能够合成β-石竹烯的重组细胞

Also Published As

Publication number Publication date
CN107429223A (zh) 2017-12-01
WO2016142503A1 (de) 2016-09-15
JP2018507698A (ja) 2018-03-22
MX2017011681A (es) 2017-11-10
US20180105838A1 (en) 2018-04-19
DE102015103608A1 (de) 2016-09-15

Similar Documents

Publication Publication Date Title
WO2016142503A1 (de) Verfahren zur mikrobiellen de novo synthese von terpenen
US10392635B2 (en) Production of tetrahydrocannabinolic acid in yeast
Tashiro et al. Bacterial production of pinene by a laboratory-evolved pinene-synthase
EP3418388B1 (de) Zellen und verfahren zur herstellung von rhamnolipiden
US11299717B2 (en) Production of citronellal and citronellol in recombinant hosts
DE102007052463A1 (de) Fermentative Gewinnung von Aceton aus erneuerbaren Rohstoffen mittels neuen Stoffwechselweges
Li et al. Biological functions of ilvC in branched-chain fatty acid synthesis and diffusible signal factor family production in Xanthomonas campestris
US10954534B2 (en) Production of cannabigerolic acid in yeast
EP3341490B1 (de) Verfahren zur fermentativen alpha-ionon produktion
DE60038032T2 (de) Technische handhabung der metabolischen kontrolle
CN103898037A (zh) 一种联产香叶醇和橙花醇的基因工程菌及其构建方法和应用
Yuan et al. High production of pyoluteorin and 2, 4-diacetylphloroglucinol by Pseudomonas fluorescens S272 grown on ethanol as a sole carbon source
Tang et al. Recent advances in the biosynthesis of farnesene using metabolic engineering
JP6181972B2 (ja) 芳香族化合物の製造方法
JP6399315B2 (ja) テルペン合成酵素遺伝子、アセト酢酸エステル加水分解酵素遺伝子、及びテルペンの製造方法
CN114774297B (zh) 产t-杜松醇的重组酿酒酵母及其应用
US20220340949A1 (en) Methods of Isoprenoid Synthesis Using a Genetically Engineered Hydrocarbonoclastic Organism in a Biofilm Bioreactor
CN110669713A (zh) 一种合成d-柠檬烯的基因工程菌及其构建方法与应用
DE112019005312T5 (de) Verfahren zur biologischen herstellung einer acetinverbindung
US20090142816A1 (en) Gliocladium isolate c-13 and methods of its use for producing volatile compounds and hydrocarbons
JP6754930B2 (ja) テルペン合成酵素遺伝子、アセト酢酸エステル加水分解酵素遺伝子、及びテルペンの製造方法
CA3166532A1 (en) Engineered bacteria and methods of producing sustainable biomolecules
Ghezelbash et al. Study of polyols production by Yarrowia lipolytica in batch culture and optimization of growth condition for maximum production
Park et al. Microbial conversion of (+)-limonene by an Enterobacter agglomerans isolate
Kennedy-Mendez Characterization of Pinitol Catabolism in Sinorhizobium Meliloti and its Role in Nodule Occupancy

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20171011

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

17Q First examination report despatched

Effective date: 20181017

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: GRANT OF PATENT IS INTENDED

RIC1 Information provided on ipc code assigned before grant

Ipc: C12N 9/12 20060101ALI20200604BHEP

Ipc: C12P 5/00 20060101ALI20200604BHEP

Ipc: C12N 9/10 20060101ALI20200604BHEP

Ipc: C12N 1/21 20060101ALI20200604BHEP

Ipc: C12N 9/88 20060101ALI20200604BHEP

Ipc: C12N 9/04 20060101AFI20200604BHEP

INTG Intention to grant announced

Effective date: 20200622

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20201103