EP2363501A1 - Nanocomposites dotés d'une homogénéité améliorée - Google Patents
Nanocomposites dotés d'une homogénéité améliorée Download PDFInfo
- Publication number
- EP2363501A1 EP2363501A1 EP10155178A EP10155178A EP2363501A1 EP 2363501 A1 EP2363501 A1 EP 2363501A1 EP 10155178 A EP10155178 A EP 10155178A EP 10155178 A EP10155178 A EP 10155178A EP 2363501 A1 EP2363501 A1 EP 2363501A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- cells
- sample
- antibody
- target cells
- filter element
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56966—Animal cells
Definitions
- the present invention relates to a method for the enrichment and/or isolation of target cells in a sample, which sample comprises red blood cells and/or platelets, said method comprising (a) filtering the sample through a filter element having a pore or mesh size of between 0.5 and 5 ⁇ m, (b) contacting the cells retained by the filter element in step (a) with a separation surface, wherein said separation surface comprises affinity molecules which selectively bind to the target cells, (c) incubating the cells and the separation surface under conditions which allow for the binding of the affinity molecules to the target cells; and (d) separating the separation surface from any unbound cells and material.
- DTC Disseminated tumor cells
- i.e. tumor cells which are detectable in the peripheral blood or in the bone marrow of a cancer patient have been shown in clinical studies to provide informative value in terms of prognosis of a cancer patient as well as the evaluation of therapeutic outcome. Apart from this, these cells in many cases have the capability to indicate the occurrence of a tumor at an early phase of the disease.
- the detection and isolation of disseminated tumor cells is routinely performed by use of magnetic beads which comprise antibodies that bind to defined surface antigens of the tumor cells. These modified beads are incubated with a blood sample of an individual to specifically bind tumor cells which are present in the sample.
- the current available techniques are associated with a high degree of unspecific cell adhesion to the beads as well as a low detection rate of tumor cells. It is known that due to the high number of non-target cells - in particular red blood cells - in the sample, it cannot be ensured in the routinely used methods that each tumor cell in a sample can interact with the antibody-presenting surface of a bead for a sufficiently long time so that binding between the immobilized antibody and the target cell occurs. In contrast, a significant number of tumor cells in a sample will not get in contact with their corresponding capture molecules.
- density gradient media also requires several washing steps of the tumor cells which are associated with several adverse effects, such as shear stress and unspecific adsorption of the cells to the wall of the reaction tubes, both of which may result in a loss of target cells. It has been demonstrated that the enrichment of tumor cells by density gradient centrifugation regularly results in a loss of almost two-third of the tumor cells present in the sample (Choesmel et al. (2004), 101, 693-703). Furthermore, density gradient centrifugation does not allow the processing of larger sample volumes, which is a clear disadvantage when considering that disseminated tumor cells are present in the blood or bone marrow in extremely low concentrations.
- red blood cells are lysed by the addition of lysis buffer, such as ammonium chloride, to the blood sample.
- lysis buffer such as ammonium chloride
- the membranes of the red blood cells are disrupted which results in cell death and release of intracellular components.
- lysis buffers regularly also disrupts a considerable portion of the disseminated tumor cells present in the sample.
- the use of these buffers will adversely affect the metabolism of the target cells, which could be disadvantageous for further processing steps (e.g. culturing the isolated cells).
- the process should not impose extensive mechanical or chemical stress on the target cells.
- leukocytes which have been separated by the filtering step according to the invention show a factor 2 lower non-specific binding affinity to the separation surface when compared to a leukocyte in a reference sample in which red blood cells were depleted by density gradient centrifugation (see Figure 2 ). Accordingly, the recovery of target cells by the separation surface (also referred to as panning) is much higher than that achievable by the methods in the prior art.
- the present invention discloses a method for the enrichment and/or isolation of target cells in a sample, which sample comprises red blood cells and/or platelets, comprising
- the method of the invention can be applied to any sample that comprises red blood cells and/or platelets.
- the sample comprises a body fluid or a tissue extract from an individual.
- the individual from which the sample is derived is a vertebrate, and more preferably, a mammal.
- the sample is derived from a human.
- the sample will normally be a cell suspension.
- the sample can comprise or consist of blood (e.g. whole blood) or blood components, urine, pleural effusions, ascites, bronchoalveolar lavage, nipple aspirate of the glandular of the female breast or bone marrow.
- the sample comprising the target cells is a blood or bone marrow sample, e.g. a sample from a human individual comprising or mainly consisting of blood or bone marrow, respectively.
- the sample can be taken by any suitable method known in the prior art. For example, if the sample is a human blood sample, it can be taken by vein puncture. Methods for obtaining bone marrow, e.g. human bone marrow, are also well known in the art. For example, red bone marrow in admixture with blood can be harvested from the crest of the ilium or from the sternum, an intervention which is generally performed by minimal invasive surgery.
- the biological sample can be ascites, i.e. peritoneal cavity fluid, pleural effusion, aspirates from the female breast nipples, urine and other body fluids.
- any physiologically acceptable buffer may be used which does not interfere with the subsequent binding of the target cells to the affinity separation surface.
- Suitable buffers for the dilution of the samples are iso-osmolaric buffers which buffer within physiological pH, for example, phosphate buffered saline (PBS), Hank's balanced salt solution, Tris-buffered saline, HEPES-buffered saline, MES buffer and the like.
- the pH of the physiological buffer is preferably within the range of from about pH 6.0 to about 9.0, more preferably between about pH 6.5 to about 8.0, and most preferably between about pH 7.0 to about 7.5, for example 7.4.
- a sample volume of at least 5 ml or more e.g. 8 ml, 10 ml, 15 ml, 20 ml, 25 ml, 30 ml, 35 ml, 40 ml, 45 ml, 50 ml, 60 ml, 70 ml, 80 ml, 90 ml or even 100 ml, 150 ml, 200 ml, 500 ml, 1000 ml or more can be subjected to the filtration step before the retentate is then contacted with the separation surface.
- the filtration step can be used to concentrate the retentate, leading to reduced sample processing time and increased overall performance of the method.
- currently available methods rely on the use of magnetic beads which are added to a sample that is suspected to comprise target cells. In these methods, only small volumes of between 2-5 ml sample fluid can be incubated with the magnetic beads, because otherwise the likelihood of a contact between the target cells and the antibodies on the surface of the particles significantly decreases, thereby leading to low recovery rates.
- the initial filtration step enriches the target cells and, at the same time, removes a considerable number of red blood cells and/or platelets, which would otherwise interfere with the subsequent binding of the target cells to the affinity molecules on the separation surface.
- the sample is filtered through a filter element having pores, holes or apertures with a size of between 0.5 and 5 ⁇ m.
- red blood cells and/or platelets are removed from the sample which could otherwise interfere with binding of the target cells, e.g. disseminated tumor cells, to their corresponding affinity molecules on the separation surface.
- Red blood cells erythrocytes
- erythrocytes are non-nucleated blood cells having a mean diameter of 5-8 ⁇ m which are responsible for the oxygen transport in the blood. It has been found that due to the high deformability of these cells, filter elements with a pore size of as little as 0.5 ⁇ m can effectively be used for the removal of the vast majority of these cells.
- Red blood cells have a flattened shape and can form tubular structures that are able to pass through apertures having a size which is significantly below the average diameter of the red blood cells in their relaxed, flattened state.
- platelets are cells without a nucleus that usually have a mean diameter of between 1-2 ⁇ m and some degree of deformability which means that they are also capable of passing through the pores of the filter elements having the above-mentioned pore size.
- nucleated cells such as leukocytes or tumor cells are generally larger than 5 ⁇ m and have a limited ability to deform. Those cells will be retained by the filter element contemplated for use in the method of the invention. As shown in the below example 6, it was readily possible by selection of the appropriate filter element to separate tumor cells and leukocytes from the majority of red blood cells and platelets in a human whole blood sample, without any considerable loss of tumor cells.
- the filtration in step (a) of the above method removes a considerable portion of the red blood cells present in the sample.
- the filtration process removes about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95% or even up to about 96%, about 97%, about 98%, about 99% or more of the erythrocytes which are present in the sample.
- the filtration process in step (a) is likewise suitable to remove a considerable portion of the platelets present in the sample.
- the filtration process removes about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95% or even up to about 96%, about 97%, about 98%, about 99% or more of the platelets present in the sample.
- Nucleated cells such as leukocytes or tumor cells are retained by the filter element, so that the filtration can be used to enrich the fraction of these cells relative to red blood cells or platelets, respectively.
- the term "filter element” refers to a medium or material comprising regularly or irregularly distributed pores that allow for the passage through the filter element of cells or compounds below a certain threshold size or diameter, while retaining other cells, aggregates or compounds having a size or diameter exceeding the threshold size or diameter.
- the filter element for use in the practise of the present method can include all kinds of commonly used filter media or materials and can have any shape and size.
- the filter element of the invention which is preferably sheet-shaped, may consist of or comprise one or more woven or non-woven fabrics, one or more perforated sheets, one or more screens or meshes, one or more microporous materials, one or more membranes or a combination of two or more of such materials.
- the term "pore” denotes holes, openings and apertures provided in all of the above materials.
- the pores are the individual meshes or mesh apertures with the pore size being the mesh size, and in the case of a screen the pores are the individual screen apertures.
- the filter element comprises or consists of a single layer of one of these materials or comprises or consists of at least two layers of these materials.
- the filter element may comprise or consist of one or more membranes or membrane filters, such as those which are commonly used for filtering particulate matter from a liquid or gaseous fluid.
- the pore size of the filter element is between 0.5 and 5 ⁇ m, e.g. 0.5, 1, 2, 3, 4 or 5 ⁇ m.
- the pore size of the filter element is between 1 and 2 ⁇ m.
- the size of a particular pore is understood herein as the minimum diameter across that pore.
- the pore size as used herein is identical to the diameter of the largest spherical body that is still able to pass through the pore.
- the filter element may comprise or consist of a woven or non-woven fabric.
- non-woven fabric refers to a web-like structure, wherein randomly orientated fibers, filaments or threads are interlaid in a non-aligned or random manner.
- the non-woven filters may be comprised of any material that does not substantially interfere with the object of separating red blood cells and platelets from the target cells. In particular, the material should not be such that any substantial adhesion of the red blood cells or platelets occurs which would prevent an effective passage of those cells through the filter element.
- the material should also not allow for any substantial unspecific adhesion of target cells, for example, disseminated tumor cells, to the filter material, which would impede the subsequent transfer of the target cells to the separation surface.
- Filter elements made of non-woven fabrics which allow for cell separation are well known in the art, and they may consist of various materials, such as cellulose or cellulose derivatives, including, cellulose acetate, cellulose nitrate, hydroxypropyl cellulose (HPC), hydroxyethyl cellulose (HEC), hydroxybutylmethyl cellulose, hydroxypropylmethyl cellulose.
- Non-woven filter materials include, polycarbonate, hydroxyethyl starch, polysulphones, polyether-sulphones, polyamides, polyether ketones, polyetherimides, polyarylenes, polyphenylene ethers, polyvinylidene fluoride (PVDF), polytetrafluorethylene (PTFE) and the like as well as glass.
- Non-woven filter materials can be made by various known processes, for example, meltblowing, spunbonding, air-laying, wet-forming and bonded carded web methods. The production of non-woven fabrics is described, for example, in US Patent Nos. 4,340,563 and 3,849,241 . Suitable non-woven filters are also available from several different suppliers, for example, from Carl Roth (Karlsruhe, Germany), Schleicher & Schuell (Dassel, Germany) and Satorius (Göttingen, Germany).
- the filter element used in the methods of the invention comprises or consists of a woven fabric.
- a "woven fabric” refers to a material which has been prepared by a weaving process, i.e. by interlacing of warp and weft fibers, filaments or threads. The warp and weft fibers, filaments or threads cross, preferably at essentially right angles, in turns above or below each other. This preferably results in a textile with square or rectangular mesh openings having a defined mesh size which can be used for separating particles with a defined size.
- the pore or mesh size of the woven filter element is between 0.5 and 5 ⁇ m, e.g.
- Woven fabrics suitable for use in the present methods include screening fabrics, as those commonly used in silk screen or offset printing methods.
- the woven fabric for use in the present method may in particular comprise or consist of polyamide, aromatic polyamides, polyethylene, polypropylene, polyester, polyfluorocarbon, polyacrylonitrile, polyurethane, polyacrylate, nylon, polyphenylene sulfide, polytetrafluoroethylene, polybenzimidazole, and the like.
- Suitable woven filters are purchasable from different suppliers, for example, the monofilament textile polyamid 6.6 monofil from Schwegmann Filtrations-Technik GmbH, Gelsdorf, Germany; PA1/1-PA 5/1 from Franz-Eckert GmbH, Waldkirch, Germany; Sefar Nitex 03-1/1 or Sefar Nitex 03-5/1 or Sefar Petex 07-5/1 from Sefar AG, Heiden, Switzerland.
- the woven or non-woven filter elements may additionally be coated with bioinert layers which suppress any interaction with the cells present in the sample.
- bioinert layers can comprise, for example, suitable blocker proteins such as BSA or casein or a hydrophilic coating such as a hydrogel, or a hydrophilic oxidized layer which may be prepared by (plasma) oxidation of organic filter elements.
- the sieves are prepared by advanced semiconductor methods which provide a very thin separation layer and uniformly sized pores. By use of this technology pores and apertures having a diameter of 0.35 ⁇ m can be prepared.
- Suitable filter elements can be purchased, for example, by fluXXion B.V., (Eindhoven, The Netherlands) or by Aquamarijn Micro Filtration B.V. (Zutphen, The Netherlands) under the tradename microsieve ® .
- Suitable filter elements include polymer structures prepared by a phase separation moulding process. This technology uses a mixture of a polymer in a solvent/non-solvent system to form a three-dimensional structure over a mould. By selecting the right blend of polymer and solvent/non-solvent, micro porous structure with pore sizes in the range of 0.5 ⁇ m to 1 ⁇ m can be produced. Moulded filter elements which are based on this technology include those provided by Aquamarijn Micro Filtration B.V. (Zutphen, The Netherlands).
- the sample or the diluted sample can be filtered through the filter element simply by providing a pressure difference between the two sides of the filter element, with the pressure being higher at the side to which the sample is provided and at which the retentate is formed.
- pressure difference may advantageously be created by suitably utilising gravity or by suitably utilising differences in hydrostatic pressure.
- the skilled person will be able to adjust the pressure to be applied for conducting the sample through the filter element.
- the pressure should be sufficiently high to effectively remove red blood cells and/or platelets which are present in the sample by forcing them to traverse the filter element.
- the pressure should be low enough so that the target cells are not damaged or pushed through the filter element.
- the filter element can be used in various forms, provided that the selected filter element can be fitted into the specific filtration process. For example, if a two-chamber assembly as defined below and exemplified in figures 8-9 is used, a filter element comprising one or more flat sheets is preferably used between the two chambers. Other forms of the filter element may be used as well, for example, funnel-shaped elements or v-shaped troughs.
- the filtering step of the method of the invention can also be achieved merely on the basis of diffusion.
- a set-up can be chosen where the sample comprising the platelets and/or red blood cells is separated by the filter element from a buffer solution which is devoid of platelets and/or red blood cells.
- the buffer can be, for example, any of the buffers mentioned above in the context of sample dilution. If incubated for a sufficient time period, the platelets and/or red blood cells present in the sample will pass the filter element to create equilibrium between the different concentrations in the sample and the buffer. This directed diffusion process can be maintained and supported by continuously removing any platelets and/or red blood cells which penetrate the filter element from said buffer (e.g. by replacing the buffer).
- filter elements in the form of sealed bags which include the sample with the target cells.
- the sealed filter elements can be submerged into a suitable buffer medium (e.g. PBS) which is devoid of red blood cells and platelets.
- PBS buffer medium
- the red blood cells and/or platelets in the bag-like filter element will gradually penetrate into the surrounding medium.
- the cells entering the medium are removed from, for example, by repeatedly or continuously substituting the medium containing the blood cells with fresh medium. This can be achieved, for example, by use of a peristaltic pump at a flow rate of 5 ml/ min.
- a filter element having a pore size of 10-30 ⁇ m can be used in the filtering process according to the invention, in particular if the biological sample is a blood sample.
- the filter element for pre-filtration is used to remove cell aggregates which may form by aggregation of leukocytes and platelets or by interaction of fibrin, fibrinogen and other blood components.
- the methods of the present invention can include a step which precedes step (a) of the above method, in which the sample is filtered through a pre-filter element having a pore or mesh size of between 10 and 30 ⁇ m.
- the pre-filter element may comprise or consist of the materials mentioned above in connection with the filter element.
- the target cells which the present method seeks to enrich and/or isolate are preferably cells that occur in low concentrations in the sample.
- the target cells are tumor cells, preferably disseminated tumor cells, and more preferably human disseminated tumor cells.
- Disseminated tumor cells are cancerous cells which have detached from the primary tumor and circulate in the peripheral blood or become enriched in the bone marrow. These cells are present in the blood or bone marrow in very low concentrations, so that their detection and isolation is generally complicated.
- tumor cells circulating in the blood are normally present in a concentration of about 1 in 10 -6 to 10 -8 leucocytes.
- red blood cells In contrast, the concentration of red blood cells is in the range of 4-6 x 10 9 cells per ml human blood. Platelets are present in the blood in a concentration of about 1,5-3,0 x 10 6 cells per ml blood.
- the high number of red blood cells and platelets in the blood has the adverse effect that the binding of target cells, such as tumor cells floating in the blood stream, via specific binding molecules (e.g. antibodies) on a separation surface, for example, a magnetic particle or a coated support surface, is often inefficient, because most of the target cells do not sufficiently interact with their corresponding binding molecules to provide for a binding to the separation matrix.
- the disseminated tumor cells to be detected by the method of the present invention can originate from a primary tumor of any cancer type, for example, from the following primary tumors: prostate cancer, cervical cancer, pancreatic cancer, breast cancer, colon cancer, brain cancer, lung cancer, bronchial cancer, liver cancer, bladder cancer, skin cancer, head and neck cancer, hematological cancers, cervical cancer, ovarian cancer, stomach cancer, kidney cancer, uterine cancer, bone cancer, esophageal cancer, laryngeal cancer, naso-pharyngeal cancer, oropharyngeal cancer, testicular cancer, vulvar cancer, hepatoma, salivary gland carcinoma, thyroid cancer, parathyroid cancer, lymphomas, sarcomas, gallbladder cancer, germ cell cancer, multiple myeloma, small intestine cancer, thymus cancer, and the like.
- the cancer type from which the disseminated tumor cells are derived is a carcinoma, i.e. a tumor
- tumor cells other cell types which are rarely present in the blood or bone marrow can be target cells in the sense of the present invention, such as plasma cells, rare subtypes of lymphocytes, e.g. memory cells, blastocystic cells, fetal cells, placenta cells, and the like.
- plasma cells rare subtypes of lymphocytes, e.g. memory cells, blastocystic cells, fetal cells, placenta cells, and the like.
- the cells which have been retained by the filter element are transferred to or brought into contact with a separation surface.
- a separation surface Any method which is suitable to establish a contact between the cells in the retentate and the separation surface may be used.
- the separation surface is a coated slide
- the target cells can be resuspended in a small volume of buffer (if necessary) and transferred by pipetting them onto the slide surface.
- the buffer can be, for example, any of the buffers mentioned above in the context of sample dilution.
- the aliquot containing the retentate will normally have a volume of between 0.5 and 8 ml, e.g. about 1, 2, 3, 4, 5, 6, or 7 ml.
- the aliquot may be diluted with the above discussed buffers to give volumes of 10, 20, 20, 30, 40 or 50 ml.
- the affinity separation surface is a small particle, such as a magnetic bead with antibodies immobilized thereon
- the target cells can be resuspended in buffer and the beads are subsequently added to the cell suspension for further incubation.
- the separation surface may be in the form of particles, for example glass particles or particles of a resin, so that the target cells which have been resuspended in a small volume of buffer can be conducted through a chromatography column filled with said particles.
- the separation surface can have the form of a capillary through which a suspension comprising the target cells is conducted.
- the term "separation surface” broadly refers to any surface that carries at least one type of affinity molecule suitable to selectively bind a predetermined structure on the target cell.
- the separation surface can be a particle surface, for example, the surface of a bead, such as a magnetic bead or glass bead, which is modified by the immobilization of affinity molecules, such as antibodies, which are directed to defined antigenic structures of the target cells.
- the separation surface can be the surface of a substantially flat support, such as the surface of a slide, e.g. a glass or plastic slide.
- the separation surface is part of a biochip, preferably made of glass or transparent plastic.
- the separation surface may also be present as a chromatography resin material.
- the above-mentioned support materials can be provided with a coating to render the separation surface bioinert. This means that cells are prevented from being adsorbed non-specifically to the surface.
- the separation surface is coated with a natural or synthetic hydrophilic polymer layer.
- the hydrophilic polymers form a three-dimensional structure on the support material which is highly hydrated. Accordingly, such polymer network is often referred to as "hydrogel".
- a hydrogel can contain up to 99% or more water, whereas the polymer content can be 1 % or even lower.
- hydrophilic polymers can be used for the hydrogel coating.
- the coating may comprise or consist of polysaccharides, polyalcohols, polyethers, polyamides, polycarboxylic acids, polysulfates, polysulfonates, polyphosphates, polyphosphonates and/or combinations or functionalized derivatives thereof.
- Such functionalizations include, for example, isothiocyanates, isocyanates, carboxylic acid azides, N-hydroxysuccinimides, N-acylimidazoles, sulfonylchloride derivatives, aldehyde, keto, glyoxal, oxirane, carbonate, arylhalogenide, imidoesters, anhydrides, halo-genalkyls, halogenacyls, maleimides, aziridines, acryloyls, sulfhydryls, disulfides, diazoalkanes, dia-zoacetyls, imidazolylcarbamates, hydrazides, diazo, arylazides, benzophenones, diazopyruvates or diazirines.
- a further preferred functionalization involves nitrilotriacetic acid (NTA) derivates, so that ligands or antibodies can be immobilized by means of a metal chelate.
- NTA nitrilotriacetic acid
- Steptavidin and/or biotin derivatives are also suitable for functionalization.
- the hydrogel coating comprises or consists of polycarboxylate polymers.
- the hydrogel coating has a slightly negative charge, as measured, for example, by Zeta potential determination.
- the hydrogel coating can be of any thickness which allows for the capture of the target cells on the surface of the hydrogel.
- the hydrogel coating has a thickness of between about 100 nm and about 5000 nm, preferably between about 500 nm and about 3000 nm, for example, about 600 nm, about 700 nm, about 800 nm, about 900 nm, about 1000 nm, about 1100 nm, about 1200 nm, about 1300 nm, about 1400 nm, about 1500 nm, about 1600 nm, about 1700 nm, about 1800 nm, or about 1900 nm.
- the thickness of the coating can be determined by routine methods available in the prior art, for example, by atomic force microscopy or ellipsometry.
- the coating preferably provides a three-dimensional surface structure in which the chains of the hydrophilic polymer are aligned at least partly vertical to the substrate surface, i.e. brush-like. Due to their increased surface compared to planar structures, such brush-like hydrogel surfaces show a particularly enhanced immobilization capacity for biomolecules, such as antibodies and other affinity molecules which are capable of binding the target cells. It has been found that brush-like structured hydrogel coatings, in particular those which comprise or consist of certain polycarboxylate polymers, provide an excellent surface for selectively attaching cells to a solid support for subsequent detection and/or quantification. Preferred hydrogel surfaces for use in the present invention are available, for example, as HC or HCX coated slides from XanTec bioanalytics GmbH, Dusseldorf, Germany.
- the separation surface comprises one or more different types of affinity molecules which selectively bind to the target cells in the sample, thereby allowing the separation of the target cells from any other cell present in the retentate after removal of the red blood cells and/or platelets.
- the "affinity molecules” are broadly understood as molecules which bind to pre-determined structures of the cells, preferably to protein or saccharide structures which are present on the surface of the target cells.
- the affinity molecules are preferably protein molecules, such as receptors, lectins, ligands, antibodies, antibody fragments, nucleic acids (such as aptamers), saccharide structures, or combinations thereof.
- antibody molecules or antigen-binding fragments thereof is particularly preferred for target cell binding.
- antibody includes monoclonal antibodies, polyclonal antibodies, multi-specific antibodies (for example, bispecific antibodies), anti-idiotypic antibodies, chimeric antibodies, and humanized antibodies, as long as they exhibit the desired immunological activity, i.e. specific binding to the target cells.
- the term is to be understood as comprising any kind of artificial antibody molecule that was prepared by grafting techniques and the like.
- the antibodies for use in the present method may be of any isotype class, such as IgG, IgM, IgA, IgE, and IgD as well as their subclasses, e.g., IgG1, IgG2 and the like.
- an antigen-binding fragment of an antibody is a fragment which retains at least a part of the specific binding activity of the whole antibody molecule for the particular antigenic structure of the target cell, e.g. a disseminated tumor cell.
- Antigen-binding fragments of the invention may comprise Fv, Fab, F(ab') and F(ab') 2 fragments. Further included by the term "antigen-binding fragment" are single chain Fv antibody fragments and disulfide-linked Fv fragments (dsFv).
- Methods for the recombinant production of antibody fragments have been described in the prior art and comprise, for example, techniques such as phage display or ribosome display.
- the recombinant antibody fragments produced by these methods may be purified and tested for binding affinity and specificity to the target cells, for example, tumor cells.
- the immobilization of specific affinity molecules to a hydrogel-coated separation surface can be done in different ways.
- the standard method which is suitable for most applications, involves covalent coupling of the affinity molecules via amino or hydroxyl functionalities to a hydrogel preactivated with N-hydroxysuccinimide (NHS).
- NHS N-hydroxysuccinimide
- the immobilization process is equally well suited for all kinds of affinity molecules, for example, antibodies, proteins, peptides, low MW compounds, nucleic acids, and the like, as long as these affinity molecules bear suitable reactive groups, such as amino, (di)sulphide or aldehyde moieties.
- the buffers containing the affinity molecule can be either applied to the entire separation surface or spotted onto defined regions of said surface. It is readily possible to combine different affinity molecules on one substrate.
- the hydrogel-coated separation surface comprises 2 or more affinity molecules having different binding specificities, such as 2, 3, 4, or 5 different antibodies.
- the separation surfaces of the invention can of course also comprise different types of affinity molecules, such as different antibodies or antibody fragments which are directed against the same or different antigenic structures of the same target cell.
- the separation surfaces can also comprise different antibodies or antibody fragments which are directed against different target cells.
- the overall density of affinity molecules on the separation surfaces of the invention is in the range of about 0.1 to about 100 ng/mm 2 , for example, about 0.5 ng/ mm 2 , about 1 ng/ mm 2 , about 5 ng/ mm 2 , about 8 ng/ mm 2 , about 10 ng/ mm 2 , about 15 ng/ mm 2 , about 20 ng/mm 2 , about 30 ng/mm 2 , about 40 ng/mm 2 , about 50 ng/mm 2 , about 60 ng/mm 2 , about 70 ng/mm 2 , about 80 ng/mm 2 , about 90 ng/mm 2 , about 100 ng/mm 2 or even higher densities.
- the above densities refer to affinity molecules which are antibodies or antibody fragments. It is also preferred that the binding capacities of the affinity molecules which are immobilized on the separation surface are not substantially affected by the coupling process. After immobilization to the separation surface, the affinity molecules, e.g. the antibodies or antibody fragments, retain more than 50%, preferably more than 60%, more than 70%, more than 80%, more than 90%, and more preferably more than 95% of their original binding capacity for the target molecule, i.e. the binding capacity for the target without immobilization.
- the affinity molecules of the present invention are selected based on their capacity to exhibit selective binding to the target cells, e.g. to tumor cells.
- selective binding means that the affinity molecule binds to the target cell at least about 4-fold stronger, usually more than about 5-fold stronger, more than about 6-fold, more than about 8-fold, more than about 10-fold, more than about 15-fold, more than about 20-fold, more than about 50-fold, or even more than about 100-fold stronger relative to the binding to a non-target cell in the sample, as reflected, for example, by the K D value of the affinity molecule/target ligand pair.
- the affinity molecule should not exhibit any substantial binding to leukocytes which are present in the filtrate obtained in step (a) of the method.
- the affinity molecules on the separation surfaces can be receptors, lectins, ligands or functional portions thereof.
- affinity molecules with a low affinity to structures on the target cells can be employed.
- the target cells to be enriched and/or isolated are disseminated tumor cells which are bound to a separation surface, for example, a hydrogel-coated support surface, via antibodies or fragments thereof which have a specific binding affinity for cell surface marker of these tumor cells.
- Suitable surface marker of disseminated tumor cells are well known in the art and include the epidermal growth factor receptor (EGFR), the epithelial cell adhesion molecule (EpCAM or CD326), the insulin growth factor-1 receptor (IGF-1R), the epidermal growth factor receptor 2 (Her2), cytokeratin 19 (CK19), cytokeratin 20 (CK20), mucin 1 (MUC1), mucin 2 (MUC2), human Epithelial Membrane Antigen (EMA), epithelial antigen (Ber-EP4), folate receptor alpha (FRalpha).
- EGFR epidermal growth factor receptor
- EpCAM or CD326 the epidermal growth factor receptor
- IGF-1R insulin growth factor-1 receptor
- CK19 cytokeratin 19
- CK20 cytokeratin 20
- mucin 1 MUC1
- MUC2 mucin 2
- EMA human Epithelial Membrane Antigen
- Ber-EP4 folate receptor alpha
- antibodies for use as affinity molecules in the method of the invention comprise an anti-EpCAM antibody, such as antibody clone 323A3 (available from Kamiya Biomedical Company, Seattle, USA), antibody clone MK-1-25 (available from Acris, Herford, Germany), antibody clone AUA1 (available from Novus Biologicals, Littleton, USA), antibody clone 158206 (available from R'n'D Systems GmbH, Wiesbaden, Germany), antibody clone 528 (available from Santa Cruz Biotechnology Inc., Heidelberg, Germany), an anti-IGF-1R antibody, such as CP-751,871 (available from Pfizer Pharma AG, Berlin, Germany), an anti-CD19 antibody, such as those available from Santa Cruz Biotechnology Inc., Heidelberg, Germany referred to as catalogue numbers sc-70563, sc-18895, sc-70560, sc-70559, sc-70561, sc-21714, sc-65295, sc-52311
- antibodies are, for example, antibody VU-1 D9 from Novocastra für, Berlin, Germany; antibody Ks5+8.22/C22 from Progen Biotechnik GmbH, Heidelberg Germany; antibody A45-BB3-Cy3 from Micromet, Kunststoff, Germany; antibody Mov18/Zel from Enzo Life Sciences GmbH, Lörrach, Germany.
- the invention also contemplates the use of antigen-binding fragments of the above antibodies.
- the target cells in the sample can be pre-incubated with a suitable affinity molecule, e.g. the above mentioned antibodies or antibody fragments, prior to contacting the target cells with the separation surface.
- a suitable affinity molecule e.g. the above mentioned antibodies or antibody fragments
- the target cells can be pre-incubated in an initial step with one or more antibodies or antibody fragments which are directed to certain surface markers of the target cell.
- the separation surface comprises immobilized affinity molecules which are in turn directed to the affinity molecules used for the pre-incubation.
- a suitable separation surface would comprise anti-mouse antibodies or fragments thereof which capture the mouse antibodies which have been attached to the target cells in the pre-incubation step.
- biotinylated antibodies such as biotinylated IgG antibodies, which are directed to specific surface antigens of the respective target cells.
- biotinylated antibodies such as biotinylated IgG antibodies
- These labelled antibodies can be captured by use of separation surfaces which are modified to comprise affinity molecules which selectively bind to the biotin residue of the antibodies, such as streptavidin.
- affinity molecules which selectively bind to the biotin residue of the antibodies, such as streptavidin.
- any unbound biotinylated antibody is removed from the sample after the pre-incubation step, e.g. by the filtration step of the method of the invention.
- the cells After contacting the cells obtained from the retentate with the separation surface, the cells are incubated with the surface under conditions suitable to allow for the binding of the cells to their corresponding affinity molecules.
- the incubation conditions can vary. The skilled person will readily be able to identify the optimum parameters to be applied for a given separation surface. For example, the incubation times can vary from about 5 min to about 10 hours, but will normally in the range of between about 30 min and about 8 hours, preferably between about 2 and about 6 hours, e.g. 3, 4, or 5 hours.
- the temperature will be in the range of about 10°C to about 40°C, preferably from about 20°C to about 40°C, more preferably from about 32°C to about 36°C.
- the incubation of the sample containing the target cells will be performed at ambient temperature, e.g. at 22°C to 25°C.
- a liquid aliquot containing the retentate from the filtering step is transferred onto the separation surface, e.g. by pipetting, and subsequently incubated.
- the aliquot containing the retentate will normally have a volume of between 0.5 and 8 ml, e.g. about 1, 2, 3, 4, 5, 6, or 7 ml. If necessary, the aliquot may be diluted with the above discussed buffers to give volumes of 10, 20, 20, 30, 40 or 50 ml.
- the incubation does not necessarily have to involve agitation of the separation surface. However, agitation of the separation surface is preferred for an improved binding of the target cells to the surface.
- the incubation can be performed by placing the slide in a Petri dish or a cytospin tube which is agitated on a rocking platform shaker with rotation speed between 0.2 to 60 rpm, preferably 10 to 20 rpm, e.g. 15 rpm.
- the separation surface may slowly rotate in the liquid aliquot containing the retentate from the filtering step or may be placed in a rotating tube filled with said aliquot.
- a flat, optionally tilted (e.g. about 30° to 40°, preferably about 35°) separation surface e.g. a coated slide.
- the surface of the slide can be partially or completely submerged in a suitable physiological buffer (see, for example, the buffers defined above in the context with sample dilution). As the as the cells in the sample have a higher specific gravity than the buffer, they will flow along the tilted separation surface into the direction of the bottom of the device.
- the incubation is carried out in a flow-through device, for example, a device as depicted in figure 10 .
- the particle suspension is mixed with the purified sample and gently agitated, as for example in a closed tube on a rotation incubator at low speed.
- any unbound cells and unbound materials are removed. This is achieved by separating the separation surface from such unbound cells and materials.
- this step also includes washing the separation surface with a suitable washing buffer, such as the iso-osmolaric buffers mentioned above in the context with sample dilution.
- the cells isolated by the method described above can be cultured in standard cell culturing media. This is, for example, a particular advantage with tumor cells which can be further characterized after isolation.
- the cells obtained by the method disclosed herein show an unimpaired cell morphology compared to cells isolated according to methods known in the prior art. As shown in figure 7 , cells isolated with common magnetic particle-based systems (e.g. Veridex) tend to lose their spherical shape.
- the spherical morphology of tumor cells captured by the method of the invention is not altered due to the fact that the cells are not coupled to any sharp-edged particles and are bound to a soft surface floating on the top of macromolecules.
- the invention relates to a method for the detection and/or quantification of target cells in a sample, which sample comprises red blood cells and/or platelets.
- the method comprises
- Methods for detecting target cells that have been captured are well known in the prior art. For example, these methods can be based on the detection of marker molecules, e.g. surface protein or saccharide structures or nucleotide sequences, which are highly specific for the target cells to be detected and/or quantified.
- marker molecules e.g. surface protein or saccharide structures or nucleotide sequences
- the choice of suitable marker molecules will depend on the particular target cell, and the skilled person will have no problems to select appropriate marker molecules and corresponding affinity molecules which specifically bind to these marker molecules.
- the detection and/or quantification of the target cells can be performed by use of detectably labelled affinity molecules, such as detectably labelled antibodies or antibody fragments.
- the affinity molecules to be used in the detection and/or quantification step can be, for example, the same molecules that have been described elsewhere herein for immobilization on the separation surfaces.
- antibodies or fragments of antibodies can be used which are either labelled or which can be detected themselves by labelled secondary antibodies.
- the detection and/or quantification of the target cells involves detectably labelled DNA probes. More preferably, the detection and/or quantification comprise fluorescent in-situ hybridization (FISH).
- FISH fluorescent in-situ hybridization
- Various protocols for conducting a FISH analysis using labelled probes of different length in intact target cells are available in the art (for example, detection of egfr amplification using specific DNA probes).
- the target cells to be detected and/or quantified are typically permeabilized and the DNA of the cells is melted partially. The DNA is then contacted with a hybridization solution at a moderate temperature to permit annealing of fluorescently labelled probes specific for the particular nucleic acid sequence selected for detecting the target cells.
- a labelled nucleic acid probe directed to egfr, HER2, P13-kinase, c-myc, akt, and the like may be used.
- the probe which has been hybridized to the DNA of tumor cells shows a number of egfr spots greater than 2, for example 3, 4, 5, 6, 7, 8, 10 or more and can be distinguished from DNA of leukocytes that may have adsorbed to the separation surface (2 spots at most).
- FISH probes are typically labelled with one or more fluorescent reporters. After hybridization with the probe, the target cells are washed at a predetermined stringency or at an increasing stringency until an appropriate signal to noise ratio is obtained.
- the hybridized probes are then monitored, e.g. by fluorescence microscope.
- a multicolored analysis i.e., for different sequences
- the nucleic acid probes used in FISH assays are usually longer than those used, for example, in Southern-blotting.
- FISH probes may have a size of about 1, 5, 10, 20, 30, 40, 50, 60 or up to 100 kb, or even of 200, 300 or 400 kb.
- FISH probes may be directly labelled (e.g. by use of fluorescent dyes) or indirectly labelled (e.g. by a hapten, such as digoxigenin or biotin).
- fluorescent labels it is preferred to use fluorescent labels, so that the result of the hybridization to the genomic DNA of the test sample (e.g. cells of tissue derived from biopsy) can directly be observed.
- Labeling kits for fluorescence labeling may be obtained from different manufacturers, such as the labeling kits SpectrumOrange, SpectrumGreen, and SpectrumRed purchasable by Vysis Inc., Downer's Grove, Illinois, USA.
- the detection and/or quantification can be based on a combined method of fluorescent in-situ hybridization and antibody-based detection, as described below in the examples.
- the detection and/or quantification of the target cells involve a PCR, preferably a real-time PCR.
- primers directed to marker genes which are common for the respective target cells, are used to amplify products that indicate the abundance of these cells in a sample.
- the target cell is a tumor cell, such as a dissiminated tumor cell
- one or more genes encoding the specific cell surface marker discussed above can be used as templates for PCR amplification.
- suitable genes encoding surface markers are those which encode, for example, the epidermal growth factor receptor (EGFR), the epithelial cell adhesion molecule (EpCAM or CD326), the insulin growth factor-1 receptor (IGF-1R), the epidermal growth factor receptor 2 (Her2), cytokeratin 19 (CK19), cytokeratin 20 (CK20), mucin 1 (MUC1), mucin 2 (MUC2), and the like.
- EGFR epidermal growth factor receptor
- EpCAM or CD326 epithelial cell adhesion molecule
- IGF-1R insulin growth factor-1 receptor
- CK19 cytokeratin 19
- CK20 cytokeratin 20
- mucin 1 MUC1
- MUC2 mucin 2
- an arrangement for performing the filtration step comprises a sample reservoir 1 for receiving and containing the diluted or undiluted sample possibly including the target cells.
- the reservoir 1 has an outlet aperture 2 through which, in operation, the sample exits the reservoir 1 and enters a conduit 3.
- the outlet aperture 2 is preferably disposed in the bottom of the reservoir 1 and the reservoir 1 and the conduit 3 are preferably arranged such that the delivery of the sample from the reservoir 1 to the conduit 3 and the movement of the sample within the conduit 3 are effected or at least assisted by gravity.
- a further reservoir 4 may optionally be provided for receiving and containing a solution or buffer that may serve to dilute the sample.
- the reservoir 4 has an outlet aperture 5 through which, in operation, the solution exits the reservoir 4 and enters a conduit 6.
- the outlet aperture 5 is preferably disposed in the bottom of the reservoir 4 and the reservoir 4 and the conduit 6 are preferably arranged such that the delivery of the sample from the reservoir 4 to the conduit 6 and the movement of the sample within the conduit 6 are effected or at least assisted by gravity.
- the conduit 6 is connected to the conduit 3 such that the sample and the solution may be mixed.
- the delivery end 7 of the conduit 3 is arranged such that the sample, optionally mixed with the solution from the reservoir 4, can be supplied continuously, discontinuously or intermittently to a generally cylindrical filter component 8 that is disposed within a container 9.
- the filter component 8 comprises at its bottom longitudinal end a plate 10 and at its upper longitudinal end a ring 11.
- the plate 10 and the ring 11 are interconnected by a plurality of longitudinal rods (not shown in the figures).
- a sheet-shaped filter element 12 is disposed annularly closed around the arrangement of rods such that it forms the circumferential surface of the cylindrical filter component 8.
- the sheet-shaped filter element 12 is disposed annularly closed inside the space defined by the rods by attaching it to the radial inner face of each of the rods.
- the plate 10 and the ring 11 may have e.g. a circular, oval, square, rectangular, hexagonal or other shape, with the cylindrical filter component 8 having a corresponding cross-sectional shape.
- the sample fed from the delivery end 7 of the conduit 3 can enter the filter component 8 through the opening of the ring 11, and filtrate exits the filter component 8 through the filter element 12 and is collected within the container 9.
- a further conduit 13 is provided, e.g. connected to the bottom of the container 9, through which conduit 13 the filtrate may be removed from the container 9, e.g. by draining under the influence of gravity or by utilising suitable pumps or suction devices.
- a further container 14 is provided for collecting the filtrate removed from the container 9.
- the flow of sample into the filter component 8 and/or the rate of removal of filtrate from the container 9 are controlled such that the absolute level of the surface 15 of the liquid within the filter component 8 is higher than the level of the surface 16 of the liquid within the container 9. In this manner, a difference in hydrostatic pressure is advantageously maintained on both sides of the filter element 12 that forces the filtrate through the filter element 12.
- a gas conduit 17 may optionally be provided for introducing gas into the filtrate for advantageously generating a movement within the liquid.
- an arrangement for performing the filtration step is a cross-flow filtration arrangement 20.
- it comprises two conduits 21, 22 that are extending parallel to and in contact with each other, and a filter element 23 is arranged in aligned openings in the side walls of the conduits 21, 22 such that liquid is able to pass via the filter element 23 between the two conduits 21, 22.
- a flow 24 of the diluted or undiluted sample is introduced into one end of conduit 21 such that it is passed tangentially across the filter element 23.
- An oppositely directed flow 25 of a physiological medium is introduced into the opposite end of the conduit 22 such that it is passed tangentially across the opposite face of the filter element 23.
- FIG. 8 A further alternative embodiment of an arrangement for performing the filtration step is schematically shown in Figure 8 .
- This arrangement 30 comprises two bodies 31 and 32 which, in the illustrated embodiment, have a cuboidal shape.
- the bodies 31 and 32 are disposed such that surfaces 38a and 38b of the body 31 and the body 32, respectively, extended parallel to and at a distance from each other. In this manner, a gap or spacing 39 is present between the two bodies 31 and 32.
- a recess 31a and 32a is formed in the respective body 31 and 32, respectively.
- the recesses 31a and 32a are likewise of a cuboidal shape.
- the openings of the recesses 31a and 32a, which face each other, are closed by a common filter element 33 suitably disposed in the spacing 39 between the bodies 31 and 32.
- the filter element 33 may be carried in a frame 33a having an annular construction and being provided with suitable sealing elements, which sealing elements sealingly engage the surfaces 38a and 38b and surround the openings of the recesses 31a and 32a.
- Two conduits 34 and 36 extend from the recess 31 a and project from the surface 40a opposite the surface 38a, and two conduits 35 and 37 extend from the recess 32a and project from the surface 40b opposite the surface 38b, and these conduits 34, 35, 36 and 37 allow to introduce fluids into and remove them from the interior of the recesses 31a and 32a.
- this arrangement 30 it is in principle possible by means of this arrangement 30 to perform a cross-flow filtration similar to the case described with reference to Figure 5 by suitably introducing a flow of the diluted or undiluted sample through e.g. the conduit 34 and a flow of a physiological medium through e.g. the conduit 37.
- the arrangement 30 shown Figure 8 is particularly advantageous for performing two different methods of filtration.
- FIG. 9a The first method, in which the arrangement 30 is not moved and is oriented such that the filter element 33 and the spacing 39 extend in a vertical plane, is illustrated in Figure 9a .
- both recesses 31 a and 32a are at first filled with buffer to a level of about 50% of the interior recess volume.
- the diluted or undiluted sample is introduced through e.g. the conduit 35 into the recess 32a, thereby raising the level of liquid within the recess 32a as compared to the level of liquid within the recess 31a.
- a difference in hydrostatic pressure is created on both sides of the filter element 33 that forces the filtrate through the filter element 33.
- FIG. 9b and 9c The second method, in which the arrangement 30 performs a rocking motion and is initially oriented such that the filter element 33 and the spacing 39 extend in a horizontal plane, is illustrated in Figures 9b and 9c .
- both recesses 31a and 32a are again filled with buffer to a level of about 50% of the interior recess volume.
- the diluted or undiluted sample is introduced through e.g. the conduit 35 into the recess 32a.
- the arrangement 30 is put into a, preferably slow, rocking motion by alternately tilting the arrangement 30 in two opposite directions, as illustrated in Figure 9c .
- the preferred maximum tilt angle is 25°.
- the liquid volumes in the two recesses 31 a and 32a contact each other through portions of the filter element 33. Due to the rocking motion, the area of contact travels across the entire surface area of the filter element 33.
- the rocking motion may advantageously be effected by means of a rocking shaker.
- Figure 10 shows a cross-sectional view of an arrangement 50 for contacting the retentate produced by means of the filtration step with a separation surface.
- the arrangement 50 comprises a, preferably rectangular, slide 51 having the separation surface 52.
- the arrangement 50 comprises two bodies 53 and 54 which, in the illustrated embodiment, have a cuboidal shape.
- a recess 56 is provided which is shaped and sized to receive the slide 51 together with an annular sealing element 59 and such that at least the sealing element 59 slightly projects from the surface 55.
- a corresponding recess 57 is provided in the lower surface 58 of the upper body 53. The latter recess 57 is sized and shaped to matingly receive the portion of the sealing element 59 projecting from the surface 55 of the lower body 54 when the two bodies 53 and 54 are attached to each other with the two surfaces 55 and 58 being adjacent and extending parallel to each other as will be explained in more detail below.
- the slide 51 is positioned within the recess 56, and the annular sealing element 59 is positioned on top of the slide 51.
- This sealing element 59 is dimensioned and shaped such that it circumferentially engages the upper separation surface 52 of the slide 51 in an edge region thereof.
- the body 53 is placed on top of the body 54 in such a manner that the annular sealing element 59 is received within the recess 57, and the two bodies 53 and 54 are fixedly secured to each other by means of e.g. screws that are introduced through a plurality of corresponding bores 60 and 61 in the bodies 53 and 54, respectively.
- the recesses 56 and 57 are dimensioned such that in this position the separation surface 52 of the slide 51 is spaced 3 to 500 ⁇ m from the interior wall 62 of the recess 57.
- two through bores are provided having large diameter sections 63a and 63b, respectively, and small diameter section 64a and 64b, respectively.
- the small diameter sections 64a and 64b open into the recess 57.
- DAPI 4',6-Diamidino-2-phenylindol
- Pierce/ThermoScientific 4',6-Diamidino-2-phenylindol
- DAPI is a cationic fluorescent dye which binds to adenine-thymine-rich DNA.
- the stained cells can be counted by visual inspection or by suitable automated devices. The cells were washed twice with Dulbecco's modified Eagle Medium (DMEM) to remove excessive dye. Each suspension of pre-stained cells was controlled for fluorescence emission.
- DMEM Dulbecco's modified Eagle Medium
- the filter of a blood administration set (Sarstedt AG & Co; 74.4255) was separated and the woven filter removed.
- a sheet of a woven fabric (Sefar AG, Sefar Nitex 03-5/1, Sefar Petex 07-5/1) having a mesh size of 1 ⁇ m was fixed on the filter rack by use of an adhesive. After fixing the woven fabric to the filter rack, any remaining solvent deriving from the adhesive was removed in a vacuum for 30 min.
- a leak test was carried out with a cell suspension of monocytes from buffy coat obtained by centrifugation of 500 ml blood over the whole volume of the filter rack.
- the so prepared filter rack was fixed in the middle of a beaker by using a double-faced medical adhesive (50 ⁇ m thick) so that the closed bottom of the filter rack was in contact with the bottom of the beaker.
- a pre-wetting of the filter rack prepared in example 2 is preferred to prevent initial unspecific adhesion of cells to the filter unit.
- a volume of 10-15 ml of a physiological and iso-osmolaric buffer e.g. PBS
- the filtering was performed in an assembly as depicted in Figure 4 .
- the buffer was applied to the center of the cylindrical filter rack by a conduit which is located 1-2 cm above the opening of the filter rack.
- a flow rate of 1 ml/min was set with a peristaltic pump.
- a blood sample as prepared in example 1 (stored for 24 h under agitation at room temperature) containing between 10 and 120 MDA-468 cells per ml in spike-in experiments was applied to the filter rack by a second conduit with a flow rate of 100-200 ⁇ l/min. In this way, dilutions of the blood samples of in a ratio of about 1:5 to 1:10 could be obtained.
- the liquid volume in the filter element likewise decreased.
- the drain off was stopped at a volume of about 1-3 ml cell suspension that was left in the filter element.
- the retentate cell suspension was then pipetted into a reaction tube.
- the inner face of the filter element was washed five times with 2 ml PBS and then pipetted into the tube.
- the tube was spun down at 800 rpm for 2 min. The supernatant of 9 ml was discarded and the cell pellet with the residual volume was resuspended in 1 ml PBS for subsequent transfer to a hydrogel slide.
- a pre-activated polycarboxylate hydrogel slide (SL-HCX-5, XanTec Bioanalytics GmbH, Dusseldorf, Germany) was covered with 20 ⁇ l of a 250 ⁇ g/ml anti-EpCAM/Trop-1-antibody solution (AF960; RnD Systems, Minneapolis, USA). Prior to coupling, the antibody was dialyzed against a 5 mM sodium acetate solution (pH 5.0). The antibody solution was dried at ambient conditions (room temperature and relative humidity of 50-75%), and the solution was further incubated for additional 20 min at said conditions after drying. In the next step, the whole slide was placed in a Petri dish and covered with 1 M ethanolamine solution, pH 8.5, under gentle shaking for 20 min.
- a hydrogel slide (SL-HC-5, XanTec Bioanalytics GmbH, Dusseldorf, Germany) was placed in a Petri dish or an appropriate slide rack.
- the hydrogel slides were covered with this solution and incubated for 5 min with gently shaking followed by an incubation in 2 mM acetic acid for at least 30 sec. Then the slides were rinsed with distilled water and either dried in a sharp stream of nitrogen or by centrifugation.
- Incubation was carried out on a rocking platform shaker (Heidolph Duomax 1030) at a speed of 2 cycles per minute at room temperature.
- Cell counts were determined after 30, 60, 120, 180, 240, 300, and 360 min incubation on the hydrogel surface by manual cell counting in a fluorescence microscope (Leica DMLB, Leica Microsystems GmbH, Wetzlar, Germany) for DAPI pre-stained MDA-468 cells.
- the cell counts as measured in parallel samples are depicted in the below table 2.
- a time course of recovery rates is shown in fig. 6 .
- MDA-468 cells which have been isolated by use of a hydrogel slide as described in example 5 were detected by a combined protocol for FISH and immunocytochemistry. This approach was focussed on the detection of chromosomal aberrations and tumor-specific gene expression.
- probes complementary to the sequence of the egfr gene were prepared from BAC DNA (clones RP5-10191 E12) with the usage of Large DNA Construct Isolation Kit (Qiagen, Germany) and BioPrime® Total Genomic Labelling System (Gibcolnvitrogen, UK) according to the manufacturers' protocols.
- the MDA-468 cells were fixed on hydrogel slides in the incubation chamber of a cyto-system (Hettich AG, Germany) (in ice-cold 75% ethanol for 2 min and pre-treated with 100 ⁇ g/ml RNase A for 40 min at room temperature. Cells were then treated in 1x citrate buffer (pH 6.0, Dako, Denmark) for 3 min at 120°C. The cells were again fixed in 1% formaldehyde in 1 x PBS for 10 min and dehydrated in a series of alcohols. Air-dried cells were denatured in denaturation buffer (70% formamide, 0.6 x SSC, pH 7.4) for 5 min at 73°C and dehydrated in a series of alcohols.
- denaturation buffer 70% formamide, 0.6 x SSC, pH 7.4
- the slide was washed 3 times for 10 min in 50% formamide/2 x SSC buffer, 2 times for 10 min in 2 x SSC buffer and 5 min in 0.1 x SSC/0.1% Tween-20 buffer at 46°C.
- the cells were permeabilized 3 times for 3 min in 1 x TBST.
- the non-specific binding was reduced by 20 min incubation in Blocking Serum (Dako, Denmark).
- the primary mouse monoclonal antibodies against pan-cytokeratin (A45, Mikromet, Germany) or vimentin (DB PharmingenTM) diluted 1:100 or 1:200, respectively, in DakoREALTM Antibody diluent (Dako, Denmark) were incubated with the cells for 45 min at room temperature.
- the specimen was then incubated with a secondary Alexa-488-labelled anti-mouse antibody (MiBioTech) diluted 1:200 for 45 min at room temperature.
- the slide was washed 2 times for 3 min with 1xTBST and once for 3 min with 1xPBS, and counterstained with Vectashield® Mounting Medium with DAPI (Vector Laboratories Inc.).
- the cytokeratin- or vimentin-positive cells showing no apoptotic or necrotic morphology, were analysed for their egfr gene dosage. Additionally, a total of 500 cytokeratin-positive and vimentin-positive cells were scored for the frequency of egfr gains and compared to the score obtained in 3 healthy volunteers. The specimens were analysed under a fluorescence microscope (MetaSystem GmbH, Zeiss, Germany). For each cell, the ratio between target and reference probe was counted and the mean counts from 20 cells was taken for evaluation, containing minimum 2 signals for reference the CEP7 probe. It could be shown that MDA-468 cells harboured from 3 to 7 spots for the fluorophor-labelled EGFR probe and simultaneously 2 spots for the CEP7 reference probe.
- MDA-468 cells on a hydrogel surface were detected by PCR.
- the MDA-468 cells on the hydrogel surface were cooled to 0°C on ice, overlaid with chilled 9 ⁇ l of the Genomiphi sample buffer (GE Healthcare).
- Single-cell transfer to PCR reaction tubes was performed by using the micromanipulator CellTram vario equipped with the custom-made capillary Kappa MFKII coupled with a TransferMan NK 2 (Eppendorf) attached to the inverted microscope Axiovert 200 (Zeiss). The tubes were kept at -80°C for a minimum time of 15 min.
- allelic imbalance is based on the detection of length polymorphic sequences comprising simple sequence repeats of cytidin and adenosine (microsatellite). An allelic imbalance is determined if the ratio of peak areas in a capillary electrophoretic evaluation between allele 1 and allele 2, differing in the number of CA repeats, exceeds 1.3 or undercuts 0.7.
- PCR reactions were performed on a Mastercycler Gradient (Eppendorf) in a total reaction volume of 10 ⁇ l, containing 20 ng of template DNA from MDA-468 tumor cells (genomic DNA or WGA product from example 9), the primers depicted in SEQ ID NO:1 and SEQ ID NO:2 (SEQ ID NO:1, CA-SSR1_For: [6-FAM]GTTTGAAGAATTTGAGCCAACC; SEQ ID NO:2, CA-SSR1_Rev: TTCTGTCTGCACACTTGGCAC), deoxynucleotide triphosphate, AmpliTaq Gold (Applied Biosystems), TMAC, MgCl 2 in AmpliTaq Gold buffer (for concentrations see table 3.
- PCR products were diluted 5-fold in PCR-grade water (Merck), and 1 ⁇ l of each diluted sample was mixed with 0.15 ⁇ l of GeneScan-500-Rox size standard (Applied Biosystems) and 20 ⁇ l HIDI formamide. The mixtures were denatured at 95°C for 2 min and snap-cooled on ice. The fragments were separated by capillary electrophoresis (CE) and detected by laser-induced fluorescence on an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems). Two fragments were detected in the case heterocygocity, the informative case, differing in length from 2 to 10 base pairs. The Al status was determined by the ratio between allele 1 and 2. In the case of homocygocity only 1 fragment was measured and no information about the Al status of the cell could be obtained.
- CE capillary electrophoresis
- a real time PCR assay with SYBR green as a reporter was used to detect MDA-468 tumor cells via their increased gene doses for EGFR (epidermal growth factor receptor).
- EGFR epidermal growth factor receptor
- SOD2 superoxid dismutase 2
- For the standard-concentration-curve for measuring the concentrations of the PCR products leukocyte-DNA pre-amplified by WGSA was used as a template. All samples were measured in triplets.
- the Mastercycler epgrandient S-realplex (Eppendorf) was used. All reactions were carried out in twintec PCR plates 96 (Eppendorf) in a total volume of 15 ⁇ l and sealed with optical adhesive covers (Applied Biosystems).
- the QuantiTect SYBR green Kit (Qiagen) was used with 1 ⁇ M of each of the primers provided in SEQ ID NO:3-6.
- the standard amplification protocol consists of an initial denaturation step at 95°C for 15 min, followed by 45 cycles of 95°C for 15 s, 58°C for 30 s and 68°C for 30 s. Fluorescence measurements were taken at the end of the elongation phases at 68°C. A melting curve step was added as the final step in each run to confirm specificity of PCR reaction. For each sample 10 ng DNA (2 ⁇ l, 5 ng/ ⁇ l) were used as starting template. All samples and controls were measured in triplets. During the evaluation phase each amplification reaction of both assay types was checked for the absence of nonspecific PCR products by a native polyacrylamide gel electrophoresis.
- Raw data were analyzed with the Realplex software Ver.2. For each primer pair a standard-concentration-curve was performed in each run using template amount of 10 ng, 2.5 ng, 0.625 ng and 0.156 ng. Leukocyte DNA or WGA product was used depending on the type of samples which were to be measured. The points of interception of the amplication-curves and the threshold (CT-value) were dependent on the amount of given template-DNA in their exponential regions. Using the assays with known amount of template-DNA calibration-lines (CT vs. Log2 of the amount of given template-DNA) were generated and their linear equations were calculated. To determine the amounts of DNA for the unknown samples the average for each triplicate of CT-values was calculated.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Biomedical Technology (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Food Science & Technology (AREA)
- Wood Science & Technology (AREA)
- Pathology (AREA)
- General Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Oncology (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- Hospice & Palliative Care (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Apparatus Associated With Microorganisms And Enzymes (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Priority Applications (7)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP10155178A EP2363501A1 (fr) | 2010-03-02 | 2010-03-02 | Nanocomposites dotés d'une homogénéité améliorée |
US13/581,937 US20130059288A1 (en) | 2010-03-02 | 2011-03-01 | Method for isolating target cells |
CN201180012177.8A CN102892900B (zh) | 2010-03-02 | 2011-03-01 | 用于分离靶细胞的方法 |
EP11705620.0A EP2542689B1 (fr) | 2010-03-02 | 2011-03-01 | Nanocomposites dotés d'une homogénéité améliorée |
ES11705620.0T ES2546837T3 (es) | 2010-03-02 | 2011-03-01 | Procedimiento de aislamiento de células diana |
DK11705620.0T DK2542689T3 (en) | 2010-03-02 | 2011-03-01 | Method for isolating target cells |
PCT/EP2011/053052 WO2011107489A1 (fr) | 2010-03-02 | 2011-03-01 | Procédé pour isoler des cellules cibles |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP10155178A EP2363501A1 (fr) | 2010-03-02 | 2010-03-02 | Nanocomposites dotés d'une homogénéité améliorée |
Publications (1)
Publication Number | Publication Date |
---|---|
EP2363501A1 true EP2363501A1 (fr) | 2011-09-07 |
Family
ID=42269532
Family Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP10155178A Withdrawn EP2363501A1 (fr) | 2010-03-02 | 2010-03-02 | Nanocomposites dotés d'une homogénéité améliorée |
EP11705620.0A Active EP2542689B1 (fr) | 2010-03-02 | 2011-03-01 | Nanocomposites dotés d'une homogénéité améliorée |
Family Applications After (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP11705620.0A Active EP2542689B1 (fr) | 2010-03-02 | 2011-03-01 | Nanocomposites dotés d'une homogénéité améliorée |
Country Status (6)
Country | Link |
---|---|
US (1) | US20130059288A1 (fr) |
EP (2) | EP2363501A1 (fr) |
CN (1) | CN102892900B (fr) |
DK (1) | DK2542689T3 (fr) |
ES (1) | ES2546837T3 (fr) |
WO (1) | WO2011107489A1 (fr) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP3214166A4 (fr) * | 2014-10-31 | 2018-07-04 | National University Corporation Tokyo University of Agriculture and Technology | Procédé d'isolement de cellules et filtre de piégeage de cellules |
WO2018141349A1 (fr) * | 2017-02-02 | 2018-08-09 | Sartorius Stedim Biotech Gmbh | Séparation de populations de cellules par identification de marqueur et vitesse de sédimentation |
Families Citing this family (21)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP2817625A2 (fr) * | 2012-02-23 | 2014-12-31 | Stage Cell Therapeutics GmbH | Isolement chromatographique des cellules et d'autres materiaux biologiques complexes |
US10107729B2 (en) * | 2013-02-15 | 2018-10-23 | Douglas T. Gjerde | Isolation, detection and use of biological cells |
KR20150014781A (ko) * | 2013-07-30 | 2015-02-09 | 삼성전자주식회사 | 유체를 여과하기 위한 장치 및 그를 이용한 입자를 분리하는 방법 |
PL3132247T3 (pl) | 2014-04-16 | 2022-01-03 | Juno Therapeutics Gmbh | Sposoby, zestawy i urządzenie do namnażania populacji komórek |
AU2016341527B2 (en) | 2015-10-22 | 2023-04-27 | Juno Therapeutics Gmbh | Methods, kits, agents and apparatuses for transduction |
MA45488A (fr) | 2015-10-22 | 2018-08-29 | Juno Therapeutics Gmbh | Procédés, kits et appareil de culture de cellules |
MA45489A (fr) | 2015-10-22 | 2018-08-29 | Juno Therapeutics Gmbh | Procédés de culture de cellules, kits et appareil associés |
CN105223061A (zh) * | 2015-11-06 | 2016-01-06 | 长春市博坤生物科技有限公司 | 一种生物液体样本采集富集方法及装置 |
JP6779483B2 (ja) | 2016-09-29 | 2020-11-04 | 住友ゴム工業株式会社 | 医療用検査装置及び細胞検査方法 |
TW201842335A (zh) | 2017-04-27 | 2018-12-01 | 德商朱諾醫療公司 | 寡聚粒子試劑及其使用方法 |
WO2018207565A1 (fr) * | 2017-05-12 | 2018-11-15 | 富士フイルム株式会社 | Substrat de séparation, filtre de séparation de cellules et procédé de production de plaquettes |
EP3444034A1 (fr) | 2017-08-18 | 2019-02-20 | XanTec bioanalytics GmbH | Cellule d'écoulement pour enrichissement sélectif de particules ou de cellules cibles |
CN107843731B (zh) * | 2017-09-14 | 2020-01-03 | 北京牛牛基因技术有限公司 | 一种检测外周血中胰腺癌细胞标志物的试剂盒 |
US11448641B2 (en) * | 2017-11-28 | 2022-09-20 | Canon Virginia, Inc. | Methods and devices for separation of blood components |
JP7158671B2 (ja) | 2018-02-14 | 2022-10-24 | 住友ゴム工業株式会社 | 特定細胞捕捉方法 |
JP7109719B2 (ja) | 2018-02-14 | 2022-08-01 | 住友ゴム工業株式会社 | 特定細胞捕捉方法 |
US11614440B2 (en) | 2019-01-24 | 2023-03-28 | Sumitomo Rubber Industries, Ltd. | Specific cell fractionating and capturing methods |
CN110672862B (zh) * | 2019-09-29 | 2023-03-31 | 迈克生物股份有限公司 | 一种血型检测卡及其制备方法 |
CN115485361A (zh) * | 2020-05-12 | 2022-12-16 | Pbs生物技术公司 | 材料转移装置和相关的系统和方法 |
CN114752476B (zh) * | 2022-04-08 | 2024-07-19 | 厦门大学 | 一种用于单细胞捕获以及离心液滴生成的装置及其应用 |
WO2024124132A1 (fr) | 2022-12-09 | 2024-06-13 | Juno Therapeutics, Inc. | Procédés d'apprentissage automatique pour prédire un phénotype cellulaire au moyen d'une imagerie holographique |
Citations (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US3849241A (en) | 1968-12-23 | 1974-11-19 | Exxon Research Engineering Co | Non-woven mats by melt blowing |
US4340563A (en) | 1980-05-05 | 1982-07-20 | Kimberly-Clark Corporation | Method for forming nonwoven webs |
EP0630675A1 (fr) * | 1993-06-27 | 1994-12-28 | Terumo Kabushiki Kaisha | Dispositif pour la séparation de leukocytes ou leukocytes et plaquettes et filtre pour cela |
WO1998045413A1 (fr) * | 1997-04-08 | 1998-10-15 | Pall Corporation | Procede de prelevement de cellules rares dans des produits sanguins |
EP1018346A2 (fr) * | 1999-01-07 | 2000-07-12 | Terumo Kabushiki Kaisha | Filtre de leucocytes et son procédé de fabrication |
WO2002010759A2 (fr) | 2000-07-28 | 2002-02-07 | Institut für Chemo- und Biosensorik Münster E.V. | Revetement pour divers substrats et procede de fabrication dudit revetement |
EP1484390A1 (fr) * | 2003-06-02 | 2004-12-08 | Blutspendedienst des Bayerischen Roten Kreuzes | Méthode de préparation de cellules-souches périphériques à partir de filtres de réduction des leucocytes |
Family Cites Families (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
NO180658C (no) * | 1994-03-10 | 1997-05-21 | Oeystein Fodstad | Fremgangsmåte og anordning for deteksjon av spesifikke målceller i spesialiserte eller blandede cellepopulasjoner og opplösninger som inneholder blandede cellepopulasjoner |
US7166443B2 (en) * | 2001-10-11 | 2007-01-23 | Aviva Biosciences Corporation | Methods, compositions, and automated systems for separating rare cells from fluid samples |
EP1706720A4 (fr) * | 2003-10-31 | 2007-02-28 | Vitatex Inc | Prototypes d'analyses sanguines et methodes de detection de cellules tumorales et endotheliales |
US7695956B2 (en) * | 2006-01-12 | 2010-04-13 | Biocept, Inc. | Device for cell separation and analysis and method of using |
WO2008008515A2 (fr) * | 2006-07-14 | 2008-01-17 | Aviva Biosciences Corporation | Procédés et compositions servant à détecter des cellules rares dans un échantillon biologique |
-
2010
- 2010-03-02 EP EP10155178A patent/EP2363501A1/fr not_active Withdrawn
-
2011
- 2011-03-01 EP EP11705620.0A patent/EP2542689B1/fr active Active
- 2011-03-01 US US13/581,937 patent/US20130059288A1/en not_active Abandoned
- 2011-03-01 DK DK11705620.0T patent/DK2542689T3/en active
- 2011-03-01 ES ES11705620.0T patent/ES2546837T3/es active Active
- 2011-03-01 CN CN201180012177.8A patent/CN102892900B/zh active Active
- 2011-03-01 WO PCT/EP2011/053052 patent/WO2011107489A1/fr active Application Filing
Patent Citations (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US3849241A (en) | 1968-12-23 | 1974-11-19 | Exxon Research Engineering Co | Non-woven mats by melt blowing |
US4340563A (en) | 1980-05-05 | 1982-07-20 | Kimberly-Clark Corporation | Method for forming nonwoven webs |
EP0630675A1 (fr) * | 1993-06-27 | 1994-12-28 | Terumo Kabushiki Kaisha | Dispositif pour la séparation de leukocytes ou leukocytes et plaquettes et filtre pour cela |
WO1998045413A1 (fr) * | 1997-04-08 | 1998-10-15 | Pall Corporation | Procede de prelevement de cellules rares dans des produits sanguins |
EP1018346A2 (fr) * | 1999-01-07 | 2000-07-12 | Terumo Kabushiki Kaisha | Filtre de leucocytes et son procédé de fabrication |
WO2002010759A2 (fr) | 2000-07-28 | 2002-02-07 | Institut für Chemo- und Biosensorik Münster E.V. | Revetement pour divers substrats et procede de fabrication dudit revetement |
EP1484390A1 (fr) * | 2003-06-02 | 2004-12-08 | Blutspendedienst des Bayerischen Roten Kreuzes | Méthode de préparation de cellules-souches périphériques à partir de filtres de réduction des leucocytes |
Non-Patent Citations (15)
Title |
---|
ECCLES S.A.; WELCH D.R., LANCET, vol. 369, 2007, pages 1742 - 1757 |
GAFORIO ET AL., INT. J. CANCER, vol. 107, no. 6, 2003, pages 984 - 90 |
GALANZHA EKATERINA I ET AL: "In vivo magnetic enrichment and multiplex photoacoustic detection of circulating tumour cells.", NATURE NANOTECHNOLOGY DEC 2009 LNKD- PUBMED:19915570, vol. 4, no. 12, December 2009 (2009-12-01), pages 855 - 860, XP002594057, ISSN: 1748-3395 * |
GALANZHA ET AL., NAT. NANOTECHNOL., vol. 4, 2009, pages 855 |
KINELE ET AL., ANN. SURG., vol. 238, no. 3, 2003, pages 324 - 30 |
KOCH ET AL., ANN. SURG., vol. 241, no. 2, 2005, pages 199 - 205 |
MICHAEL WALTER PFAFFL: "Real-time RT-PCR: Neue Ansatze zur exakten mRNA Quantifizierung", BIOSPEKTRUM BIOSPEKTRUM, vol. 1/04, 2004, pages 10 |
NAGARSHETH NIMESH P ET AL: "Blood salvage use in gynecologic oncology.", TRANSFUSION OCT 2009 LNKD- PUBMED:19555419, vol. 49, no. 10, October 2009 (2009-10-01), pages 2048 - 2053, XP002594060, ISSN: 1537-2995 * |
NÉRON SONIA ET AL: "Whole-blood leukoreduction filters are a source for cryopreserved cells for phenotypic and functional investigations on peripheral blood lymphocytes.", TRANSFUSION APR 2006 LNKD- PUBMED:16584429, vol. 46, no. 4, April 2006 (2006-04-01), pages 537 - 544, XP002594059, ISSN: 0041-1132 * |
PANTEL ET AL., NAT REV CLIN ONCOL., vol. 6, no. 6, 2009, pages 339 - 51 |
PANTEL ET AL., NATURE REVIEWS, vol. 8, 2008, pages 1 - 12 |
STATHO- POULOU ET AL., J. CLIN. ONCOL., vol. 20, no. 16, 2002, pages 3404 - 12 |
SUEOKA A: "Present status of apheresis technologies: part 4. Leukocyte filter.", THERAPEUTIC APHERESIS : OFFICIAL JOURNAL OF THE INTERNATIONAL SOCIETY FOR APHERESIS AND THE JAPANESE SOCIETY FOR APHERESIS FEB 1998 LNKD- PUBMED:10227794, vol. 2, no. 1, February 1998 (1998-02-01), pages 78 - 86, XP002594058, ISSN: 1091-6660 * |
WIESEL M ET AL: "[Separation of urologic tumors cells from Cell Saver blood using a membrane filter. A new method in autotransfusion?]", DER UROLOGE. AUSG. A MAY 1992 LNKD- PUBMED:1615592, vol. 31, no. 3, May 1992 (1992-05-01), pages 182 - 185, XP008124870, ISSN: 0340-2592 * |
YAMADA TAKASHI ET AL: "Removal of malignant cells through a leukocyte-depletion filer for autologous blood transfusion", INTERNATIONAL JOURNAL OF CLINICAL ONCOLOGY, vol. 2, no. 3, September 1997 (1997-09-01), pages 143 - 146, XP002594056, ISSN: 1341-9625 * |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP3214166A4 (fr) * | 2014-10-31 | 2018-07-04 | National University Corporation Tokyo University of Agriculture and Technology | Procédé d'isolement de cellules et filtre de piégeage de cellules |
US10538732B2 (en) | 2014-10-31 | 2020-01-21 | National University Corporation Tokyo University Of Agriculture And Technology | Cell isolation method and cell trapping filter |
WO2018141349A1 (fr) * | 2017-02-02 | 2018-08-09 | Sartorius Stedim Biotech Gmbh | Séparation de populations de cellules par identification de marqueur et vitesse de sédimentation |
Also Published As
Publication number | Publication date |
---|---|
EP2542689A1 (fr) | 2013-01-09 |
ES2546837T3 (es) | 2015-09-29 |
DK2542689T3 (en) | 2015-09-14 |
EP2542689B1 (fr) | 2015-06-10 |
US20130059288A1 (en) | 2013-03-07 |
WO2011107489A1 (fr) | 2011-09-09 |
CN102892900B (zh) | 2017-10-31 |
CN102892900A (zh) | 2013-01-23 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP2542689B1 (fr) | Nanocomposites dotés d'une homogénéité améliorée | |
Zou et al. | Advances in isolation and detection of circulating tumor cells based on microfluidics | |
US20200122146A1 (en) | Platelet-Targeted Microfluidic Isolation of Cells | |
EP3458854B1 (fr) | Procédé et kit permettant de capturer des vésicules extracellulaires sur une surface solide | |
KR101878749B1 (ko) | 표적 세포의 분리 방법 및 키트 | |
CN110456034B (zh) | 一种循环肿瘤细胞的检测方法 | |
JP2008538509A (ja) | パリレンメンブレンフィルターの使用 | |
US20140315295A1 (en) | Polymer microfilters, devices comprising the same, methods of manufacturing the same, and uses thereof | |
EP2838581A1 (fr) | Appareil et procédé pour séparer une entité biologique d'un volume d'échantillon | |
JP2008529541A (ja) | 腫瘍細胞の分離用容器 | |
TW201312117A (zh) | 用以診斷與漿液相關之腫瘤細胞的症狀及特性的方法及試劑 | |
US11602748B2 (en) | Flow cell for the selective enrichment of target particles or cells | |
US10717082B2 (en) | Method and device for selective, specific and simultaneous sorting of rare target cells in a biological sample | |
CZ2013456A3 (cs) | Způsob separace sporadických buněk z tělních tekutin a zařízení pro provádění tohoto způsobu | |
US20220001385A1 (en) | Column-based device and method for retrieval of rare cells based on size, and uses thereof | |
KR101533230B1 (ko) | 다단 미세유체 칩 및 이를 이용한 시료의 선택적 분리방법 | |
CN111812071A (zh) | 一种新型循环肿瘤细胞的鉴定技术 | |
Pugia et al. | Enrichment and detection of circulating tumor cells and other rare cell populations by microfluidic filtration | |
CN111751543A (zh) | 一种稀有肿瘤细胞富集方法及试剂盒 | |
Belov et al. | Surface profiling of extracellular vesicles from plasma or ascites fluid using DotScan antibody microarrays | |
WO2021010369A1 (fr) | Procédé de détection de cellules tumorales circulantes à l'aide d'un virus | |
JP2018157812A (ja) | 試料中に含まれる細胞の検出方法 | |
Harouaka | A flexible micro spring array for viable enrichment of circulating tumor cells |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO SE SI SK SM TR |
|
AX | Request for extension of the european patent |
Extension state: AL BA RS |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
18D | Application deemed to be withdrawn |
Effective date: 20120308 |