EP2044118A2 - Il-17- und il-23-antagonisten sowie verwendungsverfahren - Google Patents
Il-17- und il-23-antagonisten sowie verwendungsverfahrenInfo
- Publication number
- EP2044118A2 EP2044118A2 EP07798524A EP07798524A EP2044118A2 EP 2044118 A2 EP2044118 A2 EP 2044118A2 EP 07798524 A EP07798524 A EP 07798524A EP 07798524 A EP07798524 A EP 07798524A EP 2044118 A2 EP2044118 A2 EP 2044118A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- seq
- antibody
- heavy chain
- light chain
- binds
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/24—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
- C07K16/244—Interleukins [IL]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/06—Antiasthmatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/06—Antipsoriatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
- A61K2039/507—Comprising a combination of two or more separate antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/55—Fab or Fab'
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/565—Complementarity determining region [CDR]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/567—Framework region [FR]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
- C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
- C07K2317/622—Single chain antibody (scFv)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
- C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
Definitions
- the present invention relates generally to the identification and isolation of antagonists to IL- 17 and IL-23 (via pi 9) and methods of using the same.
- the immune system protects individuals from infective agents (e.g. viruses, bacteria, and multi-cellular organisms), as well as from cancer and neoplasms.
- the immune system includes many lymphoid and myeloid cell types such as neutrophils, monocytes, macrophages, dendritic cells (DCs), eosinophils, T cells, and B cells. These cells are capable of producing signaling proteins known as cytokines. Cytokines are soluble, small proteins that mediate a variety of biological effects, including the induction of immune cell proliferation, development, differentiation, and/or migration, as well as the regulation of the growth and differentiation of many cell types (see, for example, Arai et al., Annu. Rev. Biochem.
- Cytokine-induced immune functions can also include an inflammatory response, characterized by a systemic or local accumulation of immune cells. Although they do have host-protective effects, these immune responses can produce pathological consequences when the response involves excessive and/or chronic inflammation, as in autoimmune disorders (such as multiple sclerosis) and cancer/neoplastic diseases (Oppenheim and Feldmann (eds.) Cytokine Reference, Academic Press, San Diego, CA (2001); von Andrian and Mackay New Engl. J. Med. 343: 1020 (2000); Davidson and Diamond, New Engl. J. Med. 345:340 (2001); Lu et al, MoI. Cancer Res. 4:221(2006); Dalgleish and O'Byrne, Cancer Treat Res. 130:1 (2006)).
- Proteins that constitute the cytokine group include interleukins, interferons, colony stimulating factors, tumor necrosis factors, and other regulatory molecules.
- human interleukin-17A also known as "IL- 17" is a cytokine which stimulates, for example, the expression of interleukin-6 (IL-6), intracellular adhesion molecule 1 (ICAM-I), interleukin-8 (IL-8), granulocyte macrophage colony-stimulating factor (GM-CSF), and prostaglandin E2, and plays a role in the preferential maturation of CD34+ hematopoietic precursors into neutrophils (Yao et al., J. Immunol.
- human interleukin-23 (also known as "IL-23”) is a cytokine which has been reported to promote the proliferation of T cells, in particular memory T cells and can contribute to the differentiation and/or maintenance of ThI 7 cells.
- the demonstrated in vivo activities of cytokines and their receptors illustrate the clinical potential of, and need for, other cytokines, cytokine receptors, cytokine agonists, and cytokine antagonists.
- demonstrated in vivo activities of the proinflammatory cytokine family illustrates the enormous clinical potential of, and need for antagonists of pro-inflammatory molecules such as IL- 17A and IL-23.
- the present invention addresses these needs by providing antagonists to proinflammatory cytokines IL- 17 (also interchangeably referred to as "IL- 17 A” herein) (SEQ ID NOS :1 & 2) and the pl9 subunit (SEQ ID NOS :3 & 4) of IL-23 (SEQ ID NOS :5 & 6).
- IL- 17 is a cytokine which stimulates the expression of IL-6, ICAM-I, IL-8, GM- CSF, and prostaglandin E2, among others, and plays a role in the preferential maturation of CD34+ hematopoietic precursors into neutrophils (Y ao et ah, J. Immunol. 755:5483 (1995); Fossiez et al, J. Exp. Med. 183:2593 (1996)).
- IL-23 is a heterodimeric cytokine composed of a unique subunit, pl9 (herein referred to interchangeably as “IL-23", “pi 9” and “IL23/pl9”), and the p40 subunit, which is shared with interleukin-12 (IL-12) (Oppmann, Immunity 13:115 (2000)).
- IL-23 has been found to stimulate the production and/or maintenence of IL- 17 A and F from activated CD4+ T cells in what has now been termed as a "new" T-helper (Th) subset, designated ThI 7.
- ThI 7 A review of IL-23 cytokine and receptor biology is reviewed in Holscher, Curr. Opin. Invest.
- Thl7 cells Similar to ThI and Th2 lineages, Thl7 cells have most likely evolved to provide adaptive immunity to specific classes of pathogens, such as extracellular bacteria. However, inappropriate Th 17 responses have been strongly implicated in a growing list of autoimmune disorders, including multiple sclerosis, rheumatoid arthritis, inflammatory bowel disease, and psoriasis.
- both IL- 17 and IL-23 have also been reported to play important roles in many autoimmune diseases, such as multiple sclerosis, rheumatoid arthritis, Crohn's disease, and psoriasis.
- Both IL-23 and IL- 17 are overexpressed in the central nervous system of humans with multiple sclerosis and in mice undergoing an animal model of multiple sclerosis, experimental autoimmune encephalomyelitis (EAE). The overexpression is observed in mice when the EAE is induced by either myelin oligodendrocyte glycoprotein (MOG) 35-55 peptide- or proteolipid peptide (PLP).
- MOG myelin oligodendrocyte glycoprotein
- PGP proteolipid peptide
- IL- 17 and ThI 7 cells can be produced from IL- 23 -independent sources, and the in vivo development of an IL- 17 effector response has been shown to be IL-23 -independent (Mangan et al, Nature 441:231 (2006)). Neutralization of IL-23 would theoretically eliminate existing IL- 17 producing cells, but would not completely prevent the development of new Thl7 cells.
- TGF-b transforming growth factor-beta
- TGF-bl appears to have both anti- and pro-inflammatory roles may be due in part to the fact that it can induce the expression of the pro-inflammatory cytokine IL- 17 and Foxp3 (the transcription factor for the CD4+CD25+ regulatory T cell population), but by distinct CD4+ T cell subpopulations (Mangan et al, Nature. 441:231 (2006)).
- Receptors that bind cytokines are typically composed of one or more integral membrane proteins that bind the cytokine with high affinity and transduce this binding event to the cell through the cytoplasmic portions of the certain receptor subunits.
- Cytokine receptors have been grouped into several classes on the basis of similarities in their extracellular ligand binding domains.
- IL- 17 mediates its effects through interaction with its cognate receptor, the IL- 17 receptor (IL- 17R) as well as IL- 17RC.
- the IL-23 and IL- 12 receptors share a subunit, IL- 12Rb-I that pairs with unique, inducible components, IL-23R and IL-12Rb-2, respectively, which in turn is responsible for receptor responsiveness.
- TGF-b One of the actions of TGF-b in this respect is to upregulate IL-23R expression, which in turn, induces responsiveness to IL-23.
- the present invention concerns the inhibition of both of these proinflammatory cytokines, IL- 17 and IL-23/pl9.
- the present invention is based on the surprising discovery that antagonizing both IL-23 (via pi 9) and IL- 17 is more effective therapeutically than neutralization of IL-23 alone (either via pl9 or p40) or IL- 17 alone and thus, necessary for the effective treatment of inflammatory diseases (including cancers). More specifically, the present invention concerns the inhibition or neutralization of both IL- 17 and IL-23 (via pi 9) with a single antagonistic molecule or neutralizing entity.
- the antagonistic molecule or neutralizing entity inhibits the activity of both IL- 17 and IL-23 (via pi 9), and thus, inhibits the production, maintenance, and activity of new and existing IL- 17 and IL-17-producing T cells (Th 17).
- TH 17 cells include IL- 17A and IL- 17F.
- the invention further concerns the use of IL- 17 and IL-23/pl9 antagonists or neutralizing entities in the treatment of inflammatory diseases characterized by the presence of elevated levels of IL- 17 and/or IL-23.
- the invention also concerns the use of IL- 17 and IL-23/pl9 antagonists in the treatment of cancers characterized by the presence of elevated levels of IL- 17 and/or IL-23.
- the present invention is directed to antagonizing both IL- 17 and IL- 23/pl9, either singly or together. Since either IL- 17, IL-23/pl9, or IL-23/p40 intervention has been proposed as an effective therapy for several inflammatory diseases and various cancers, using antagonists of the present invention, which may block, inhibit, reduce, antagonize or neutralize the activity of IL- 17, IL-23, IL-23/pl9 or both IL- 17A and IL-23 (via pi 9), will have advantages over therapies that target only one of these two cytokines.
- the invention further provides uses therefore in inflammatory disease and cancer, as well as related compositions and methods.
- Immune related and inflammatory diseases are the manifestation or consequence of fairly complex, often multiple interconnected biological pathways which in normal physiology are critical to respond to insult or injury, initiate repair from insult or injury, and mount innate and acquired defense against foreign organisms. Disease or pathology occurs when these normal physiological pathways cause additional insult or injury either as directly related to the intensity of the response, as a consequence of abnormal regulation or excessive stimulation, as a reaction to self, or as a combination of these.
- T lymphocytes are an important component of a mammalian immune response.
- T cells recognize antigens which are associated with a self-molecule encoded by genes within the major histocompatibility complex (MHC).
- MHC major histocompatibility complex
- the antigen may be displayed together with MHC molecules on the surface of antigen-presenting cells, virus-infected cells, cancer cells, grafts, etc.
- the T cell system eliminates these altered cells which pose a health threat to the host mammal.
- T cells include helper T cells and cytotoxic T cells. Helper T cells proliferate extensively following recognition of an antigen-MHC complex on an antigen presenting cell. Helper T cells also secrete a variety of cytokines, i.e., lymphokines, which play a central role in the activation of B cells, cytotoxic T cells and a variety of other cells which participate in the immune response.
- cytokines i.e., lymphokines
- helper T cell activation is initiated by the interaction of the T cell receptor (TCR)-CD3 complex with an antigen-MHC on the surface of an antigen-presenting cell. This interaction mediates a cascade of biochemical events that induce the resting helper T cell to enter a cell cycle (the GO to Gl transition) and results in the expression of a high affinity receptor for IL-2 and sometimes IL-4.
- TCR T cell receptor
- the activated T cell progresses through the cycle proliferating and differentiating into memory cells or effector cells.
- T cells In addition to the signals mediated through the TCR, activation of T cells involves additional costimulation induced by cytokines released by the antigen presenting cell or through interactions with membrane bound molecules on the antigen presenting cell and the T cell.
- the cytokines IL-I and IL-6 have been shown to provide a costimulatory signal.
- the interaction between the B7 molecule expressed on the surface of an antigen presenting cell and CD28 and CTLA-4 molecules expressed on the T cell surface effect T cell activation.
- Activated T cells express an increased number of cellular adhesion molecules, such as ICAM-I, integrins, VLA-4, LFA-I, CD56, etc.
- T-cell proliferation in a mixed lymphocyte culture or mixed lymphocyte reaction is an established indication of the ability of a compound to stimulate the immune system.
- MLR mixed lymphocyte reaction
- inflammatory cells infiltrate the site of injury or infection.
- the migrating cells may be neutrophilic, eosinophilic, monocytic or lymphocytic as can be determined by histologic examination of the affected tissues.
- Current Protocols in Immunology ed. John E. Coligan, 1994, John Wiley & Sons, Inc.
- Immune related diseases could be treated by suppressing the immune response.
- Using the antagonists of the present invention i.e. anti-IL-17 and/or anti-IL-23/pl9 antibodies
- molecules having immune stimulatory activity would be beneficial in the treatment of immune-mediated and inflammatory diseases.
- Molecules which inhibit the immune response can be utilized (proteins directly or via the use of antibody agonists) to inhibit the immune response and thus ameliorate immune related disease.
- IL- 17 has been identified as a cellular ortholog of a protein encoded by the T lymphotropic Herpes virus Saimiri (HSV) [see, Rouvier et al, J. Immunol, 750(12): 5445-5456 (1993); Yao et al, J. Immunol, 722(12):5483-5486 (1995) and Yao et al, Immunity, 5(6):811- 821 (1995)]. Subsequent characterization has shown that this protein is a potent cytokine that acts to induce proinflammatory responses in a wide variety of peripheral tissues.
- HSV T lymphotropic Herpes virus Saimiri
- IL- 17 is a disulf ⁇ de-linked homodimeric cytokine of about 32 kDa which is synthesized and secreted primarily by CD4+activated memory T cells (reviewed in Fossiez et al, Int. Rev. Immunol, 16: 541-551 [1998]). Specifically, IL- 17 is synthesized as a precursor polypeptide of 155 amino acids with an N-terminal signal sequence of 19-23 residues and is secreted as a disulfide-linked homodimeric glycoprotein. IL-17 is disclosed in WO9518826 (1995), WO9715320 (1997) and WO9704097 (1997), as well as US Patent No. 6,063,372.
- IL- 17 exhibits pleitropic biological activities on various types of cells.
- IL- 17 has been found to stimulate the production of many cytokines. For example, it induces the secretion of IL-6, IL-8, IL-12, leukemia inhibitory factor (LIF), prostaglandin E2, MCP-I and G-CSF by adherent cells like fibroblasts, keratinocytes, epithelial and endothelial cells.
- LIF leukemia inhibitory factor
- IL- 17 also has the ability to induce ICAM-I surface expression, proliferation of T cells, and growth and differentiation of CD34.sup.+ human progenitors into neutrophils.
- IL- 17 is also believed to play a key role in certain other autoimmune disorders such as multiple sclerosis (Matusevicius et al, Mult. Scler. 5:101 (1999); Park et al, Nat Immunol. ⁇ 5/ 1133 (2005)). IL-17 has further been shown, by intracellular signalling, to stimulate Ca.sup.2+ influx and a reduction in [cAMP], in human macrophages (Jovanovic et al, J. Immunol. 160:3513 (1998)).
- Fibroblasts treated with IL-17 induce the activation of NF-kappa.B, (Yao et al., Immunity, 3:811 (1995), Jovanovic et al., supra), while macrophages treated with it activate NF- kappa.B and mitogen-activated protein kinases (Shalom-Barek et al, J. Biol. Chem. 273:27467 (1998)).
- IL-17 the cell surface receptor for IL-17 has been found to be widely expressed in many tissues and cell types (Yao et al, Cytokine, 9:794 (1997)). While the amino acid sequence of the human IL-17 receptor (IL- 17R) (866 amino acids) predicts a protein with a single transmembrane domain and a long, 525 amino acid intracellular domain, the receptor sequence is unique and is not similar to that of any of the receptors from the cytokine/growth factor receptor family. This coupled with the lack of similarity of IL-17 itself to other known proteins indicates that IL- 17 and its receptor may be part of a novel family of signalling proteins and receptors.
- IL- 17R human IL-17 receptor
- IL- 17 activity is mediated through binding to its unique cell surface receptor, wherein previous studies have shown that contacting T cells with a soluble form of the IL- 17 receptor polypeptide inhibited T cell proliferation and IL-2 production induced by PHA, concanavalin A and anti-TCR monoclonal antibody (Yao et al, J. Immunol, 755:5483 (1995)).
- IL- 17 and IL-23 appear to represent a unique signaling system within the cytokine network that will offer innovative approaches to the manipulation of immune and inflammatory responses.
- antagonists to IL- 17 and IL-23 activity are useful in therapeutic treatment of inflammatory diseases, particularly as antagonists to both IL- 17 and IL-23/pl9, either singly or together in the treatment of inflammatory diseases, particularly as antagonists to both IL- 17 and IL-23/pl9 in the treatment of multiple sclerosis, inflammatory bowel disease (IBD), rheumatoid arthritis, psoriasis, and cancer.
- antagonists to IL- 17 and IL-23/pl9 activity such as the antagonists of the present invention (i.e.
- anti-IL-17 and/or anti-IL-23/pl9 antibodies are useful in therapeutic treatment of other inflammatory diseases.
- These antagonists are capable of binding, blocking, inhibiting, reducing, antagonizing or neutralizing IL- 17 and IL-23 (via pi 9) (either individually or together) in the treatment of atopic and contact dermatitis, colitis, endotoxemia, arthritis, rheumatoid arthritis, psoriatic arthritis, autoimmune ocular diseases (uveitis, scleritis), adult respiratory disease (ARD), demyelinating diseases, septic shock, multiple organ failure, inflammatory lung injury such as asthma, chronic obstructive pulmonary disease (COPD), airway hyper-responsiveness, chronic bronchitis, allergic asthma, psoriasis, eczema, IBS and inflammatory bowel disease (IBD) such as ulcerative colitis and Crohn's disease, diabetes, Helicobacter pylori infection, intraabdominal adhesion
- systemic lupus erythematosus SLE
- multiple sclerosis systemic sclerosis
- systemic sclerosis nephrotic syndrome
- organ allograft rejection graft vs. host disease (GVHD)
- kidney, lung, heart, etc. transplant rejection streptococcal cell wall (SCW)-induced arthritis
- osteoarthritis graft vs. host disease
- GVHD graft vs. host disease
- SCW streptococcal cell wall
- SCW streptococcal cell wall
- IL- 17 and/or IL-23 expression including but not limited to prostate, renal, colon, ovarian and cervical cancer, and leukemias (Tartour et al, Cancer Res.
- the present invention provides novel antagonists of IL- 17 and IL-23/pl9 and their uses in the treatment of inflammatory diseases and autoimmune diseases.
- the IL- 17 and IL-23/pl9 antagonists of the present invention can be used to block, inhibit, reduce, antagonize or neutralize the activity of either IL- 17 or IL-23 (via pi 9), or both IL- 17 and IL-23 (via pi 9) in the treatment of inflammation and inflammatory dieases such as multiple sclerosis, cancer (as characterized by the expression of IL- 17 and/or IL-23), psoriasis, psoriatic arthritis, rheumatoid arthritis, autoimmune ocular diseases, endotoxemia, IBS, and inflammatory bowel disease (IBD), colitis, asthma, allograft rejection, immune mediated renal diseases, hepatobiliary diseases, atherosclerosis, promotion of tumor growth, or degenerative joint disease and other inflammatory conditions disclosed herein.
- inflammation and inflammatory dieases such as multiple sclerosis, cancer (as characterized by the expression of IL- 17 and/or IL-23), psori
- the present invention provides isolated polypeptides that bind IL- 17 (e.g., human IL- 17 polypeptide sequence as shown in SEQ ID NO:2).
- the present invention also provides isolated polypeptides as disclosed above that bind IL-23 (e.g., human IL-23 polypeptide sequence as shown in SEQ ID NO: 6). More specifically, the present invention provides polypeptides that bind to the pl9 subunit of IL-23 (e.g. human pl9 polypeptide sequence as shown in SEQ ID NO:4).
- the present invention also provides isolated polypeptides and epitopes comprising at least 15 contiguous amino acid residues of an amino acid sequence of SEQ ID NO:2 or 4.
- Illustrative polypeptides include polypeptides that either comprise, or consist of SEQ ID NO:2 or 4, an antigenic epitope thereof.
- the present invention also provides isolated polypeptides as disclosed above that bind to, block, inhibit, reduce, antagonize or neutralize the activity of IL- 17 or IL-23.
- Preferred embodiments of the invention include binding peptides, antibodies, and any fragments or permutations thereof that bind to IL- 17 or IL-23/pl9 (herein refered to interchangeably as “IL-17/IL-23 antagonists", “IL- 17 antagonists", “IL-23 antagonists”, “pi 9 antagonists”, "IL-17/IL-23 antibodies”, “IL-17/pl9 antibodies”, “IL- 17 antibodies”, “IL-23 antibodies”, “pi 9 antibodies”, “IL-17/IL-23/pl9 antibodies”, IL- 17A neutralizing entities, IL- 23pl9 neturalizing entities, etc.).
- binding peptides or antibodies are capable of specifically binding to both human IL- 17 and IL-23 (via pi 9) and/or are capable of modulating biological activities associated with either or both IL- 17 and IL-23, and thus are useful in the treatment of various diseases and pathological conditions such as inflammation and immune-related diseases.
- the present invention provides antibodies and antibody fragments that specifically bind with IL- 17 and/or IL-23 (via pi 9).
- Exemplary antibodies include neutralizing antibodies, polyclonal antibodies, murine monoclonal antibodies, chimeric antibodies, humanized antibodies derived from murine monoclonal antibodies, and human monoclonal antibodies.
- Illustrative antibody fragments include F(ab')2, F(ab)2, Fab', Fab, Fv, scFv, and minimal recognition units.
- Neutralizing antibodies preferably bind IL- 17 or IL-23/pl9 such that the interaction of IL-17 and IL-23 with their respective receptors (i.e. IL-17RA or IL-17RC for IL- 17; IL-12b 1 and IL-23R for IL-23) is blocked, inhibited, reduced, antagonized or neutralized.
- the neutralizing IL-17 and IL-23/pl9 antibodies of the present invention can either either bind, block, inhibit, reduce, antagonize or neutralize each of IL-17 or IL-23 singly, or bind, block, inhibit, reduce, antagonize or neutralize IL-17 and IL-23 together.
- the present invention further includes compositions comprising a carrier and a peptide, polypeptide, or antibody described herein.
- the present invention further includes pharmaceutical compositions, comprising a pharmaceutically acceptable carrier and a polypeptide or antibody described herein.
- the present invention also contemplates anti-idiotype antibodies, or anti-idiotype antibody fragments, that specifically bind an antibody or antibody fragment that specifically binds a polypeptide comprising the amino acid sequence of SEQ ID NO:2, 4 or any fragment thereof.
- An exemplary anti-idiotype antibody binds with an antibody that specifically binds a polypeptide consisting of SEQ ID NOS:2 or 4.
- the present invention also provides fusion proteins, comprising an antagonist of the present invention and an immunoglobulin moiety.
- the immunoglobulin moiety may be an immunoglobulin heavy chain constant region, such as a human F c fragment.
- the present invention further includes isolated nucleic acid molecules that encode such fusion proteins.
- the present invention provides bispecific antibodies or binding proteins that bind both IL-17 and IL-23.
- Bispecific antibodies are antibodies that have two different antigen binding sites, such that the antibody specifically binds to two different antigens.
- Antibodies having higher valencies i.e., the ability to bind to more than two antigens can also be prepared; they are referred to as multispecific antibodies.
- the bispecific antibody can be a monoclonal antibody (MAb) with respect to each target.
- the antibody is chimeric, or humanized, or fully human.
- Fully human antibodies may be generated by procedures that involve immunizing transgenic mice, wherein human immunoglobulin genes have been introduced into the mice, as discussed below.
- Bispecific antibodies of the invention which bind IL- 17 and IL-23 (via pi 9), are referred to herein as bispecific IL-17/IL-23 antibodies or bispecific IL-17/pl9 MAbs.
- the hybridoma cell line which produces monoclonal antibodies of the present invention.
- the IL- 17/IL-23 antibodies are linked to one or more non-proteinaceous polymers selected from the group consisting of polyethylene glycol, polypropylene glycol, and polyoxyalkylene, or to a cytotoxic agent or enzyme, or to a radioisotope, fluorescent compound or chemiluminescent compound.
- Typical methods of the invention include methods to treat pathological conditions or diseases in mammals associated with or resulting from increased or enhanced IL- 17 and/ or IL-23 expression and/or activity.
- the antibodies of the present invention may be administered which preferably block or reduce the respective receptor binding or activation to their receptor(s).
- the antibodies employed in the methods will be capable of blocking or neutralizing the activity of both IL- 17 and IL-23(pl9), e.g., a dual antagonist which blocks or neutralizes activity of IL-17 A or IL-23.
- the methods contemplate the use of a single bispecific binding peptide or antibody or a combination of two or more antibodies (each of which specifically binds to either IL- 17 or IL-23 via pi 9).
- compositions which comprise IL-17/IL-23 antibodies are provided.
- the compositions of the invention will include pharmaceutically acceptable carriers or diluents.
- the compositions will include one or more IL-17/IL-23 antibodies in an amount which is therapeutically effective to treat a pathological condition or disease.
- the present invention concerns compositions and methods useful for the diagnosis and treatment of inflammation or immune-related disease in mammals, including humans.
- the present invention is based on the identification of the synergistic effect of neutralizing both IL- 17 and IL-23 as compared with neutralization of one alone.
- Immune related diseases can be treated by suppressing or enhancing the immune response.
- Antibodies that enhance the immune response stimulate or potentiate the immune response to an antigen.
- Antibodies which stimulate the immune response can be used therapeutically where enhancement of the immune response would be beneficial.
- antibodies that suppress the immune response attenuate or reduce the immune response to an antigen e.g., neutralizing antibodies
- antagonists of the present invention are also useful to prepare medicines and medicaments for the treatment of immune-related and inflammatory diseases, including for example, systemic lupus erythematosis, arthritis, rheumatoid arthritis, osteoarthritis, psoriasis, demyelinating diseases of the central and peripheral nervous systems such as multiple sclerosis, idiopathic demyelinating polyneuropathy or Guillain-Barre syndrome, inflammatory bowel disease, colitis, ulcerative colitis, Crohn's disease, gluten-sensitive enteropathy, autoimmune ocular diseases, cancer, neoplastic diseases, and angiogenesis.
- immune-related and inflammatory diseases including for example, systemic lupus erythematosis, arthritis, rheumatoid arthritis, osteoarthritis, psoriasis, demyelinating diseases of the central and peripheral nervous systems such as multiple sclerosis, idiopathic demyelinating polyneuropathy or Guillain-Bar
- such medicines and medicaments comprise a therapeutically effective amount of an IL- 17/IL-23 antibody with a pharmaceutically acceptable carrier.
- a pharmaceutically acceptable carrier Preferably, the admixture is sterile.
- the invention concerns a method of identifying antagonist antibodies of IL- 17 and IL-23/pl9, said method comprising contacting both IL- 17 and pl9 with a candidate molecule and monitoring a biological activity mediated by IL- 17 and/or IL- 23.
- the invention concerns a composition of matter comprising an IL- 17/IL-23 antagonist antibody which binds both IL- 17 and IL-23 in admixture with a carrier or excipient.
- the composition comprises a therapeutically effective amount of the IL- 17/IL-23 antibody.
- composition is useful for: (a) reducing infiltration of inflammatory cells into a tissue of a mammal in need thereof, (b) inhibiting or reducing an immune response in a mammal in need thereof, (c) decreasing the proliferation of T-lymphocytes in a mammal in need thereof in response to an antigen, (d) inhibiting the activity of T-lymphocytes, (e) decreasing the vascular permeability, or (f) reducing systemic and/or local concentrations of IL- 17 and/or IL-23.
- the invention concerns a method of treating an immune related disorder in a mammal in need thereof, comprising administering to the mammal a therapeutically effective amount of an IL-17/IL-23 antagonist.
- the antibody is a monoclonal antibody, humanized antibody, antibody fragment or single-chain antibody.
- the invention provides an antibody which specifically binds to both IL- 17 and IL-23.
- the antibody may be labeled and may be immobilized on a solid support.
- the antibody is an antibody fragment, a monoclonal antibody, a single-chain antibody, or an anti-idiotypic antibody.
- the invention concerns an isolated polynucleotide that encodes a polypeptide of the present invention, wherein said polypeptide is capable of binding to both IL- 17 and IL-23.
- the invention concerns an isolated polypeptide of the present invention, wherein said polypeptide is capable of binding to both IL- 17 and IL-23.
- the invention concerns a method for inhibiting IL- 17 production and/or maintenance by treating the T cells with an antagonist of IL-23/pl9 (IL-23).
- the invention concerns a method for the treatment of an inflammatory disease characterized by elevated expression of IL- 17 and IL-23 in a mammalian subject, comprising administering to the subject an effective amount of an antagonist of IL- 17 and IL-23
- the invention concerns a method for identifying an antiinflammatory agent comprising the steps of: (a) incubating a culture of T cells with IL-23, in the presence and absence of a candidate molecule; (b) monitoring the level of IL- 17 in the culture; and (c) identifying the candidate molecule as an anti-inflammatory agent if the level of IL- 17 is lower in the presence than in the absence of such candidate molecule.
- Processes for producing the same are also herein described, wherein those processes comprise culturing a host cell comprising a vector which comprises the appropriate encoding nucleic acid molecule under conditions suitable for expression of said antibody and recovering said antibody from the cell culture.
- the present invention provides a composition comprising an IL-17/IL-23 antibody in admixture with a pharmaceutically acceptable carrier.
- the composition comprises a therapeutically effective amount of the antibody.
- the composition is sterile.
- the composition may be administered in the form of a liquid pharmaceutical formulation, which may be preserved to achieve extended storage stability.
- the antibody is a monoclonal antibody, an antibody fragment, a humanized antibody, or a single-chain antibody.
- the invention concerns an article of manufacture, comprising: (a) a composition of matter comprising an IL-17/IL-23 antibody, or an antibody that specifically binds to both IL- 17 and IL-23 (via pi 9); (b) a container containing said composition; and (c) a label affixed to said container, or a package insert included in said container referring to the use of said IL-17/IL-23 antibody thereof in the treatment of an immune related disease.
- the composition may comprise a therapeutically effective amount of the IL-17/IL-23 antibody.
- the present invention concerns a method of diagnosing an immune related disease in a mammal, comprising detecting the level of expression of a gene encoding either or both IL- 17 and/or IL-23 (a) in a test sample of tissue cells obtained from the mammal, and (b) in a control sample of known normal tissue cells of the same cell type, wherein a higher or lower expression level in the test sample as compared to the control sample indicates the presence of immune related disease in the mammal from which the test tissue cells were obtained.
- the present invention concerns a method of diagnosing an immune disease in a mammal, comprising (a) contacting an IL-17/IL-23 antibody with a test sample of tissue cells obtained from the mammal, and (b) detecting the formation of a complex between the antibody and either or both IL- 17 and IL-23 in the test sample; wherein the formation of said complex is indicative of the presence or absence of said disease.
- the detection may be qualitative or quantitative, and may be performed in comparison with monitoring the complex formation in a control sample of known normal tissue cells of the same cell type.
- a larger quantity of complexes formed in the test sample indicates the presence or absence of an immune disease in the mammal from which the test tissue cells were obtained.
- the antibody preferably carries a detectable label. Complex formation can be monitored, for example, by light microscopy, flow cytometry, fluorimetry, or other techniques known in the art.
- the test sample is usually obtained from an individual suspected of having a deficiency or abnormality of the immune system.
- the invention provides a method of diagnosing an immune-related disease in a mammal which comprises detecting the presence or absence of both IL- 17 and IL-23 in a test sample of tissue cells obtained from said mammal, wherein the presence or absence of both IL- 17 and IL-23 in said test sample is indicative of the presence of an immune-related disease in said mammal.
- the invention provides a method of decreasing the activity of T-lymphocytes in a mammal comprising administering to said mammal an IL-17/IL- 23 antagonist, such as an IL-17/IL-23pl9 antibody, wherein the activity of T-lymphocytes in the mammal is decreased.
- an IL-17/IL- 23 antagonist such as an IL-17/IL-23pl9 antibody
- the invention provides a method of decreasing the proliferation of T-lymphocytes in a mammal comprising administering to said mammal (a) an IL- 17/IL-23 antagonist, such as an IL-17/IL-23pl9 antibody, wherein the proliferation of T- lymphocytes in the mammal is decreased.
- an IL- 17/IL-23 antagonist such as an IL-17/IL-23pl9 antibody
- the invention also provides articles of manufacture and kits which include one or more IL- 17, IL-23 or IL-17/IL-23 antibodies.
- Antibodies are glycoproteins having the same structural characteristics. While antibodies exhibit binding specificity to a specific antigen, immunoglobulins include both antibodies and other antibody-like molecules that lack antigen specificity. Polypeptides of the latter kind are, for example, produced at low levels by the lymph system and at increased levels by myelomas.
- antibody or “antibody peptide(s)” refers to an intact antibody, or a binding fragment thereof that competes with the intact antibody for specific binding and includes chimeric, humanized, fully human, and bispecific antibodies. In certain embodiments, binding fragments are produced by recombinant DNA techniques.
- binding fragments are produced by enzymatic or chemical cleavage of intact antibodies. Binding fragments include, but are not limited to, Fab, Fab', F(ab).sub.2, F(ab').sub.2, Fv, and single-chain antibodies.
- "Native antibodies and immunoglobulins" are usually heterotetrameric glycoproteins of about 150,000 daltons, composed of two identical light (L) chains and two identical heavy (H) chains. Each light chain is linked to a heavy chain by one covalent disulfide bond, while the number of disulfide-linkages varies between the heavy chains of different immunoglobulin isotypes. Each heavy and light chain also has regularly spaced intrachain disulfide bridges.
- Each heavy chain has at one end a variable domain (VH) followed by a number of constant domains.
- Each light chain has a variable domain at one end (VL) and a constant domain at its other end; the constant domain of the light chain is aligned with the first constant domain of the heavy chain, and the light chain variable domain is aligned with the variable domain of the heavy chain.
- Particular amino acid residues are believed to form an interface between the light- and heavy-chain variable domains (Clothia et al, J. MoI. Biol. 186:651 (1985); Novotny and Haber, Proc. Natl. Acad. Sci. U.S.A. 82:4592 (1985)).
- isolated antibody refers to an antibody that has been identified and separated and/or recovered from a component of its natural environment. Contaminant components of its natural environment are materials which would interfere with diagnostic or therapeutic uses for the antibody, and may include enzymes, hormones, and other proteinaceous or nonproteinaceous solutes.
- the antibody will be purified (1) to greater than 95% by weight of antibody as determined by the Lowry method, and most preferably more than 99% by weight, (2) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence by use of a spinning cup sequenator, or (3) to homogeneity by SDS-PAGE under reducing or nonreducing conditions using Coomassie blue or, preferably, silver stain.
- Isolated antibody includes the antibody in situ within recombinant cells since at least one component of the antibody's natural environment will not be present. Ordinarily, however, isolated antibody will be prepared by at least one purification step.
- a “variant" anti-IL-17 and IL-23 antibody, and/or IL-17/IL-23 antibody refers herein to a molecule which differs in amino acid sequence from a "parent" antibody amino acid sequence by virtue of addition, deletion and/or substitution of one or more amino acid residue(s) in the parent antibody sequence.
- the variant comprises one or more amino acid substitution(s) in one or more hypervariable region(s) of the parent antibody.
- the variant may comprise at least one, e.g. from about one to about ten, and preferably from about two to about five, substitutions in one or more hypervariable regions of the parent antibody.
- the variant will have an amino acid sequence having at least 75% amino acid sequence identity with the parent antibody heavy or light chain variable domain sequences, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, and most preferably at least 95%.
- Identity or homology with respect to this sequence is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with the parent antibody residues, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. None of N-terminal, C-terminal, or internal extensions, deletions, or insertions into the antibody sequence shall be construed as affecting sequence identity or homology.
- the variant retains the ability to bind human IL- 17 and/or IL-23 (via p 19) and preferably has properties which are superior to those of the parent antibody.
- the variant may have a stronger binding affinity, enhanced ability to inhibit IL- 17A and/or IL-23 -induced inflammation.
- a Fab form of the variant to a Fab form of the parent antibody or a full length form of the variant to a full length form of the parent antibody, for example, since it has been found that the format of the anti-IL-17/IL-23 antibody impacts its activity in the biological activity assays disclosed herein.
- the variant antibody of particular interest herein is one which displays at least about 10-fold, preferably at least about 20-fold, and most preferably at least about 50-fold, enhancement in biological activity when compared to the parent antibody.
- parent antibody refers to an antibody which is encoded by an amino acid sequence used for the preparation of the variant.
- the parent antibody has a human framework region and, if present, has human antibody constant region(s).
- the parent antibody may be a humanized or human antibody.
- agonist refers to any compound including a protein, polypeptide, peptide, antibody, antibody fragment, large molecule, or small molecule (less than 10 kD), that increases the activity, activation or function of another molecule.
- antagonist refers to any compound including a protein, polypeptide, peptide, antibody, antibody fragment, large molecule, or small molecule (less than 10 kD), that decreases the activity, activation or function of another molecule.
- binding of a polypeptide of the invention to a ligand includes, but is not limited to, the binding of a ligand polypeptide of the present invention to a receptor; the binding of a receptor polypeptide of the present invention to a ligand; the binding of an antibody of the present invention to an antigen or epitope; the binding of an antigen or epitope of the present invention to an antibody; the binding of an antibody of the present invention to an anti- idiotypic antibody; the binding of an anti-idiotypic antibody of the present invention to a ligand; the binding of an anti-idiotypic antibody of the present invention to a receptor; the binding of an anti-anti-idiotypic antibody of the present invention to a ligand, receptor or antibody, etc.
- a "bivalent antibody” other than a “multispecific” or “multifunctional” antibody in certain embodiments, is understood to comprise binding sites having identical antigenic specificity.
- a "bispecific” or “bifunctional” antibody is a hybrid antibody having two different heavy/light chain pairs and two different binding sites.
- Bispecific antibodies may be produced by a variety of methods including, but not limited to, fusion of hybridomas or linking of Fab' fragments. See, e.g., Songsivilai & Lachmann (1990), Clin. Exp. Immunol. 7P:315-321; Kostelny et al. (1992), J. Immunol. 745:1547-1553.
- chimeric antibody refers to antibodies whose light and heavy chain genes have been constructed, typically by genetic engineering, from immunoglobulin variable and constant region genes belonging to different species.
- variable segments of the genes from a mouse monoclonal antibody may be joined to human constant segments, such as gamma 1 and gamma 3.
- a typical therapeutic chimeric antibody is thus a hybrid protein composed of the variable or antigen-binding domain from a mouse antibody and the constant domain from a human antibody, although other mammalian species may be used.
- a chimeric antibody is produced by recombinant DNA technology in which all or part of the hinge and constant regions of an immunoglobulin light chain, heavy chain, or both, have been substituted for the corresponding regions from another animal's immunoglobulin light chain or heavy chain.
- the antigen-binding portion of the parent monoclonal antibody is grafted onto the backbone of another species' antibody.
- One approach described in EP 0239400 to Winter et al. describes the substitution of one species' complementarity determining regions (CDRs) for those of another species, such as substituting the CDRs from human heavy and light chain immunoglobulin variable region domains with CDRs from mouse variable region domains.
- the term "effective neutralizing titer" as used herein refers to the amount of antibody which corresponds to the amount present in the serum of animals (human or cotton rat) that has been shown to be either clinically efficacious (in humans) or to reduce virus by 99% in, for example, cotton rats.
- the 99% reduction is defined by a specific challenge of, e.g., 10 pfu, 10 4 pfu, 10 5 pfu, 10 6 pfu, 10 7 pfu, 10 8 pfu, or 10 9 pfu) of RSV.
- epitope refers to the portion of an antigen to which a monoclonal antibody specifically binds.
- epitopic determinants usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and usually have specific three dimensional structural characteristics, as well as specific charge characteristics.
- IL- 17 epitope refers to a portion of the corresponding polypeptide having antigenic or immunogenic activity in an animal, preferably in a mammal, and most preferably in a mouse or a human.
- An epitope having immunogenic activity is a portion of an IL- 17 and/or IL-23/pl9 polypeptide that elicits an antibody response in an animal.
- An epitope having antigenic activity is a portion of an IL- 17 and/or IL-23/pl9 polypeptide to which an antibody immunospecifically binds as determined by any method well known in the art, for example, by immunoassays.
- Antigenic epitopes need not necessarily be immunogenic.
- Such epitopes can be linear in nature or can be a discontinuous epitope.
- the term "conformational epitope” refers to a discontinuous epitope formed by a spatial relationship between amino acids of an antigen other than an unbroken series of amino acids.
- epitope tag polypeptide has enough residues to provide an epitope against which an antibody can be made, yet is short enough such that it does not interfere with activity of antibodies of the present invention.
- the epitope tag preferably is sufficiently unique so that the antibody thereagainst does not substantially cross-react with other epitopes.
- Suitable tag polypeptides generally have at least 6 amino acid residues and usually between about 8-50 amino acid residues (preferably between about 9-30 residues). Examples include the flu HA tag polypeptide and its antibody 12CA5 (Field et al MoI Cell. Biol.
- the epitope tag is a "salvage receptor binding epitope".
- the term "salvage receptor binding epitope” refers to an epitope of the Fc region of an IgG molecule (e.g., IgG.sub.l, IgG. sub.2, IgG. sub.3, or IgG.sub.4) that is responsible for increasing the in vivo serum half- life of the IgG molecule.
- fragment refers to a peptide or polypeptide comprising an amino acid sequence of at least 5 contiguous amino acid residues, at least 10 contiguous amino acid residues, at least 15 contiguous amino acid residues, at least 20 contiguous amino acid residues, at least 25 contiguous amino acid residues, at least 40 contiguous amino acid residues, at least 50 contiguous amino acid residues, at least 60 contiguous amino residues, at least 70 contiguous amino acid residues, at least contiguous 80 amino acid residues, at least contiguous 90 amino acid residues, at least contiguous 100 amino acid residues, at least contiguous 125 amino acid residues, at least 150 contiguous amino acid residues, at least contiguous 175 amino acid residues, at least contiguous 200 amino acid residues, or at least contiguous 250 amino acid residues of the amino acid sequence of a IL- 17 or IL-23/pl9 polypeptide or an antibody that immunospecif ⁇ cally
- immunoglobulin refers to a protein consisting of one or more polypeptides substantially encoded by immunoglobulin genes.
- One form of immunoglobulin constitutes the basic structural unit of an antibody. This form is a tetramer and consists of two identical pairs of immunoglobulin chains, each pair having one light and one heavy chain. In each pair, the light and heavy chain variable regions are together responsible for binding to an antigen, and the constant regions are responsible for the antibody effector functions.
- Full-length immunoglobulin "light chains” (about 25 Kd or 214 amino acids) are encoded by a variable region gene at the NH2 -terminus (about 110 amino acids) and a kappa or lambda constant region gene at the COOH-- terminus.
- Full-length immunoglobulin "heavy chains” (about 50 Kd or 446 amino acids), are similarly encoded by a variable region gene (about 116 amino acids) and one of the other aforementioned constant region genes (about 330 amino acids).
- Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, and define the antibody's isotype as IgG, IgM, IgA, IgD and IgE, respectively.
- variable and constant regions are joined by a "J" region of about 12 or more amino acids, with the heavy chain also including a "D” region of about 10 more amino acids.
- An immunoglobulin light or heavy chain variable region consists of a "framework" region interrupted by three hypervariable regions.
- hypervariable region refers to the amino acid residues of an antibody which are responsible for antigen binding.
- the hypervariable region comprises amino acid residues from a "Complementarity Determining Region” or "CDR" (i.e., residues 24-34 (Ll), 50-56 (L2) and 89-97 (L3) in the light chain variable domain and 31-35 (Hl), 50-65 (H2) and 95-102 (H3) in the heavy chain variable domain (Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed.
- a "human framework region” is a framework region that is substantially identical (about 85% or more, usually 90-95% or more) to the framework region of a naturally occurring human immunoglobulin.
- the framework region of an antibody that is the combined framework regions of the constituent light and heavy chains, serves to position and align the CDRs.
- the CDR's are primarily responsible for binding to an epitope of an antigen.
- the term "humanized” immunoglobulin refers to an immunoglobulin comprising a human framework region and one or more CDR's from a non-human (usually a mouse or rat) immunoglobulin.
- the non-human immunoglobulin providing the CDR's is called the "donor” and the human immunoglobulin providing the framework is called the "acceptor”.
- Constant regions need not be present, but if they are, they must be substantially identical to human immunoglobulin constant regions, i.e., at least about 85-90%, preferably about 95% or more identical.
- all parts of a humanized immunoglobulin, except possibly the CDR's are substantially identical to corresponding parts of natural human immunoglobulin sequences.
- a “humanized antibody” is an antibody comprising a humanized light chain and a humanized heavy chain immunoglobulin.
- a humanized antibody would not encompass a typical chimeric antibody as defined above, e.g., because the entire variable region of a chimeric antibody is non-human.
- human antibody includes and antibody that has an amino acid sequence of a human immunoglobulin and includes antibodies isolated from human immunoglobulin libraries or from animals transgenic for one or more human immunoglobulin and that do not express endogenous immunoglobulins, as described, for example, by Kucherlapati et al. in U.S. Patent No. 5,939,598.
- the term "genetically altered antibodies” means antibodies wherein the amino acid sequence has been varied from that of a native antibody. Because of the relevance of recombinant DNA techniques in the generation of antibodies, one need not be confined to the sequences of amino acids found in natural antibodies; antibodies can be redesigned to obtain desired characteristics. The possible variations are many and range from the changing of just one or a few amino acids to the complete redesign of, for example, the variable or constant region. Changes in the constant region will, in general, be made in order to improve or alter characteristics, such as complement fixation, interaction with membranes and other effector functions. Changes in the variable region will be made in order to improve the antigen binding characteristics.
- immunoglobulins may exist in a variety of other forms including, for example, single-chain or Fv, Fab, and (Fab'). sub.2, as well as diabodies, linear antibodies, multivalent or multispecific hybrid antibodies (as described above and in detail in: Lanzavecchia et al, Eur. J. Immunol. 17, 105 (1987)) and in single chains (e.g., Huston et al, Proc. Natl. Acad. Sci. U.S.A., 85, 5879-5883 (1988) and Bird et al, Science, 242, 423-426 (1988), which are incorporated herein by reference).
- Hood et al. "Immunology", Benjamin, N.Y., 2nd ed. (1984), and Hunkapiller and Hood, Nature, 323, 15-16 (1986), which are incorporated herein by reference).
- single-chain Fv refers to antibody fragments that comprises the variable regions from both the heavy and light chains, but lacks the constant regions, but within a single polypeptide chain.
- a single-chain antibody further comprises a polypeptide linker between the VH and VL domains which enables it to form the desired structure which would allow for antigen binding.
- Single chain antibodies are discussed in detail by Pluckthun in The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds. Springer- Verlag, New York, pp. 269-315 (1994).
- single-chain antibodies can also be bi-specific and/or humanized.
- a "Fab fragment” is comprised of one light chain and the C. sub. Hl and variable regions of one heavy chain.
- the heavy chain of a Fab molecule cannot form a disulfide bond with another heavy chain molecule.
- a "Fab' fragment” contains one light chain and one heavy chain that contains more of the constant region, between the C. sub. Hl and C.sub.H2 domains, such that an interchain disulfide bond can be formed between two heavy chains to form a F(ab').sub.2 molecule.
- a "F(ab').sub.2 fragment” contains two light chains and two heavy chains containing a portion of the constant region between the C.sub.Hl and C.sub.H2 domains, such that an interchain disulfide bond is formed between two heavy chains.
- diabodies refers to small antibody fragments with two antigen-binding sites, which fragments comprise a heavy chain variable domain (V.sub.H) connected to a light chain variable domain (V.sub.L) in the same polypeptide chain (V. sub. H-V. sub. L).
- V.sub.H heavy chain variable domain
- V.sub.L light chain variable domain
- linker that is too short to allow pairing between the two domains on the same chain, the domains are forced to pair with the complementary domains of another chain and create two antigen- binding sites.
- Diabodies are described more fully in, for example, EP 404,097; WO 93/11161; and Hollinger et al, Proc. Natl Acad. Sci. USA £0:6444-6448 (1993).
- linear antibodies refers to the antibodies described in Zapata et al Protein Eng. 8(10): 1057-1062 (1995). Briefly, these antibodies comprise a pair of tandem Fd segments (V H -C H1 -V H -C H1 ) which form a pair of antigen binding regions. Linear antibodies can be bispecif ⁇ c or monospecific.
- immunologically functional immunoglobulin fragment refers to a polypeptide fragment that contains at least the variable domains of the immunoglobulin heavy and light chains.
- An immunologically functional immunoglobulin fragment of the invention is capable of binding to a ligand, preventing binding of the ligand to its receptor, interrupting the biological response resulting from ligand binding to the receptor, or any combination thereof.
- an immunologically functional immunoglobulin fragment of the invention binds specifically to either IL- 17 or IL-23/pl9 or to both IL- 17 and IL-23/pl9.
- the term “monoclonal antibody” as used herein is not limited to antibodies produced through hybridoma technology.
- the term “monoclonal antibody” refers to an antibody that is derived from a single clone, including any eukaryotic, prokaryotic, or phage clone, and not the method by which it is produced.
- nucleic acid or “nucleic acid molecule” refers to polynucleotides, such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), oligonucleotides, fragments generated by the polymerase chain reaction (PCR), and fragments generated by any of ligation, scission, endonuclease action, and exonuclease action.
- DNA deoxyribonucleic acid
- RNA ribonucleic acid
- PCR polymerase chain reaction
- Nucleic acid molecules can be composed of monomers that are naturally -occurring nucleotides (such as DNA and RNA), or analogs of naturally-occurring nucleotides (e.g., ⁇ -enantiomeric forms of naturally-occurring nucleotides), or a combination of both.
- Modified nucleotides can have alterations in sugar moieties and/or in pyrimidine or purine base moieties.
- Sugar modifications include, for example, replacement of one or more hydroxyl groups with halogens, alkyl groups, amines, and azido groups, or sugars can be functionalized as ethers or esters.
- the entire sugar moiety can be replaced with sterically and electronically similar structures, such as aza-sugars and carbocyclic sugar analogs.
- modifications in a base moiety include alkylated purines and pyrimidines, acylated purines or pyrimidines, or other well-known heterocyclic substitutes.
- Nucleic acid monomers can be linked by phosphodiester bonds or analogs of such linkages. Analogs of phosphodiester linkages include phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoranilidate, phosphoramidate, and the like.
- nucleic acid molecule also includes so-called “peptide nucleic acids,” which comprise naturally-occurring or modified nucleic acid bases attached to a polyamide backbone. Nucleic acids can be either single stranded or double stranded.
- nucleic acid molecule refers to a nucleic acid molecule having a complementary nucleotide sequence and reverse orientation as compared to a reference nucleotide sequence.
- sequence 5' ATGCACGGG 3' is complementary to 5' CCCGTGCAT 3'.
- degenerate nucleotide sequence denotes a sequence of nucleotides that includes one or more degenerate codons as compared to a reference nucleic acid molecule that encodes a polypeptide. Degenerate codons contain different triplets of nucleotides, but encode the same amino acid residue (i.e., GAU and GAC triplets each encode Asp).
- structural gene refers to a nucleic acid molecule that is transcribed into messenger RNA (mRNA), which is then translated into a sequence of amino acids characteristic of a specific polypeptide.
- An "isolated nucleic acid molecule” is a nucleic acid molecule that is not integrated in the genomic DNA of an organism.
- a DNA molecule that encodes a growth factor that has been separated from the genomic DNA of a cell is an isolated DNA molecule.
- Another example of an isolated nucleic acid molecule is a chemically-synthesized nucleic acid molecule that is not integrated in the genome of an organism.
- a nucleic acid molecule that has been isolated from a particular species is smaller than the complete DNA molecule of a chromosome from that species.
- nucleic acid molecule construct is a nucleic acid molecule, either single- or double-stranded, that has been modified through human intervention to contain segments of nucleic acid combined and juxtaposed in an arrangement not existing in nature.
- Linear DNA denotes non-circular DNA molecules having free 5' and 3' ends.
- Linear DNA can be prepared from closed circular DNA molecules, such as plasmids, by enzymatic digestion or physical disruption.
- cDNA complementary DNA
- cDNA complementary DNA
- cDNA double-stranded DNA molecule consisting of such a single- stranded DNA molecule and its complementary DNA strand.
- cDNA also refers to a clone of a cDNA molecule synthesized from an RNA template.
- a "promoter” is a nucleotide sequence that directs the transcription of a structural gene.
- a promoter is located in the 5' non-coding region of a gene, proximal to the transcriptional start site of a structural gene.
- Sequence elements within promoters that function in the initiation of transcription are often characterized by consensus nucleotide sequences. These promoter elements include RNA polymerase binding sites, TATA sequences, CAAT sequences, differentiation-specific elements (DSEs; McGehee et al., MoI. Endocrinol. 7:551 (1993)), cyclic AMP response elements (CREs), serum response elements (SREs; Treisman, Seminars in Cancer Biol.
- GREs glucocorticoid response elements
- binding sites for other transcription factors such as CRE/ATF (O'Reilly et al, J. Biol. Chem. 267:19938 (1992)), AP2 (Ye et al., J. Biol. Chem. 269:25728 (1994)), SPl, cAMP response element binding protein (CREB; Loeken, Gene Expr. 5:253 (1993)) and octamer factors (see, in general, Watson et al., eds., Molecular Biology of the Gene, 4th ed. (The Benjamin/Cummings Publishing Company, Inc. 1987), and Lemaigre and Rousseau, Biochem.
- a promoter is an inducible promoter, then the rate of transcription increases in response to an inducing agent. In contrast, the rate of transcription is not regulated by an inducing agent if the promoter is a constitutive promoter.
- Repressible promoters are also known.
- a “core promoter” contains essential nucleotide sequences for promoter function, including the TATA box and start of transcription. By this definition, a core promoter may or may not have detectable activity in the absence of specific sequences that may enhance the activity or confer tissue specific activity.
- a "regulatory element” is a nucleotide sequence that modulates the activity of a core promoter.
- a regulatory element may contain a nucleotide sequence that binds with cellular factors enabling transcription exclusively or preferentially in particular cells, tissues, or organelles. These types of regulatory elements are normally associated with genes that are expressed in a "cell-specific,” “tissue-specific,” or “organelle-specif ⁇ c” manner.
- An “enhancer” is a type of regulatory element that can increase the efficiency of transcription, regardless of the distance or orientation of the enhancer relative to the start site of transcription.
- Heterologous DNA refers to a DNA molecule, or a population of DNA molecules, that does not exist naturally within a given host cell.
- DNA molecules heterologous to a particular host cell may contain DNA derived from the host cell species (i.e., endogenous DNA) so long as that host DNA is combined with non-host DNA (i.e., exogenous DNA).
- a DNA molecule containing a non-host DNA segment encoding a polypeptide operably linked to a host DNA segment comprising a transcription promoter is considered to be a heterologous DNA molecule.
- a heterologous DNA molecule can comprise an endogenous gene operably linked with an exogenous promoter.
- a DNA molecule comprising a gene derived from a wild-type cell is considered to be heterologous DNA if that DNA molecule is introduced into a mutant cell that lacks the wild-type gene.
- a "polypeptide” is a polymer of amino acid residues joined by peptide bonds, whether produced naturally or synthetically. Polypeptides of less than about 10 amino acid residues are commonly referred to as “peptides.”
- a "protein” is a macromolecule comprising one or more polypeptide chains.
- a protein may also comprise non-peptidic components, such as carbohydrate groups. Carbohydrates and other non-peptidic substituents may be added to a protein by the cell in which the protein is produced, and will vary with the type of cell. Proteins are defined herein in terms of their amino acid backbone structures; substituents such as carbohydrate groups are generally not specified, but may be present nonetheless.
- a peptide or polypeptide encoded by a non-host DNA molecule is a "heterologous" peptide or polypeptide.
- a "cloning vector” is a nucleic acid molecule, such as a plasmid, cosmid, or bacteriophage, that has the capability of replicating autonomously in a host cell.
- Cloning vectors typically contain one or a small number of restriction endonuclease recognition sites that allow insertion of a nucleic acid molecule in a determinable fashion without loss of an essential biological function of the vector, as well as nucleotide sequences encoding a marker gene that is suitable for use in the identification and selection of cells transformed with the cloning vector. Marker genes typically include genes that provide tetracycline resistance or ampicillin resistance.
- An "expression vector” is a nucleic acid molecule encoding a gene that is expressed in a host cell.
- an expression vector comprises a transcription promoter, a gene, and a transcription terminator. Gene expression is usually placed under the control of a promoter, and such a gene is said to be “operably linked to” the promoter.
- a regulatory element and a core promoter are operably linked if the regulatory element modulates the activity of the core promoter.
- a "recombinant host” is a cell that contains a heterologous nucleic acid molecule, such as a cloning vector or expression vector.
- a recombinant host is a cell that produces an antagonist of the present invention from an expression vector.
- an antagonist can be produced by a cell that is a "natural source" of said antagonist, and that lacks an expression vector.
- a "fusion protein” is a hybrid protein expressed by a nucleic acid molecule comprising nucleotide sequences of at least two genes.
- a fusion protein can comprise at least part of a IL- 17RA polypeptide fused with a polypeptide that binds an affinity matrix.
- Such a fusion protein provides a means to isolate large quantities of IL- 17RA using affinity chromatography.
- Receptor denotes a cell-associated protein that binds to a bioactive molecule termed a "ligand.” This interaction mediates the effect of the ligand on the cell.
- Receptors can be membrane bound, cytosolic or nuclear; monomeric (e.g., thyroid stimulating hormone receptor, beta-adrenergic receptor) or multimeric (e.g., PDGF receptor, growth hormone receptor, IL-3 receptor, GM-CSF receptor, G-CSF receptor, erythropoietin receptor and IL-6 receptor).
- Membrane-bound receptors are characterized by a multi-domain structure comprising an extracellular ligand-binding domain and an intracellular effector domain that is typically involved in signal transduction. In certain membrane -bound receptors, the extracellular ligand-binding domain and the intracellular effector domain are located in separate polypeptides that comprise the complete functional receptor.
- secretory signal sequence denotes a DNA sequence that encodes a peptide (a "secretory peptide") that, as a component of a larger polypeptide, directs the larger polypeptide through a secretory pathway of a cell in which it is synthesized.
- secretory peptide a DNA sequence that encodes a peptide that, as a component of a larger polypeptide, directs the larger polypeptide through a secretory pathway of a cell in which it is synthesized.
- the larger polypeptide is commonly cleaved to remove the secretory peptide during transit through the secretory pathway.
- isolated polypeptide is a polypeptide that is essentially free from contaminating cellular components, such as carbohydrate, lipid, or other proteinaceous impurities associated with the polypeptide in nature.
- a preparation of isolated polypeptide contains the polypeptide in a highly purified form, i.e., at least about 80% pure, at least about 90% pure, at least about 95% pure, greater than 95% pure, such as 96%, 97%, or 98% or more pure, or greater than 99% pure.
- isolated polypeptide is by the appearance of a single band following sodium dodecyl sulfate (SDS)- polyacrylamide gel electrophoresis of the protein preparation and Coomassie Brilliant Blue staining of the gel.
- SDS sodium dodecyl sulfate
- isolated does not exclude the presence of the same polypeptide in alternative physical forms, such as dimers or alternatively glycosylated or derivatized forms.
- amino-terminal and “carboxyl-terminal” are used herein to denote positions within polypeptides. Where the context allows, these terms are used with reference to a particular sequence or portion of a polypeptide to denote proximity or relative position. For example, a certain sequence positioned carboxyl-terminal to a reference sequence within a polypeptide is located proximal to the carboxyl terminus of the reference sequence, but is not necessarily at the carboxyl terminus of the complete polypeptide.
- expression refers to the biosynthesis of a gene product.
- expression involves transcription of the structural gene into mRNA and the translation of mRNA into one or more polypeptides.
- immunomodulator includes cytokines, stem cell growth factors, lymphotoxins, co-stimulatory molecules, hematopoietic factors, and the like, and synthetic analogs of these molecules.
- complement/anti-complement pair denotes non-identical moieties that form a non-covalently associated, stable pair under appropriate conditions.
- biotin and avidin are prototypical members of a complement/anti-complement pair.
- Other exemplary complement/anti-complement pairs include receptor/ligand pairs, antibody/antigen (or hapten or epitope) pairs, sense/antisense polynucleotide pairs, and the like.
- the complement/anti-complement pair preferably has a binding affinity of less than 10 9 M "1 .
- a "therapeutic agent” is a molecule or atom which is conjugated to an antibody moiety to produce a conjugate which is useful for therapy.
- therapeutic agents include drugs, toxins, immunomodulators, chelators, boron compounds, photoactive agents or dyes, and radioisotopes.
- a "detectable label” is a molecule or atom which can be conjugated to an antibody moiety to produce a molecule useful for diagnosis.
- detectable labels include chelators, photoactive agents, radioisotopes, fluorescent agents, paramagnetic ions, or other marker moieties.
- affinity tag is used herein to denote a polypeptide segment that can be attached to a second polypeptide to provide for purification or detection of the second polypeptide or provide sites for attachment of the second polypeptide to a substrate.
- affinity tag any peptide or protein for which an antibody or other specific binding agent is available can be used as an affinity tag.
- Affinity tags include a poly-histidine tract, protein A (Nilsson et al., EMBO J.
- a "target polypeptide” or a “target peptide” is an amino acid sequence that comprises at least one epitope, and that is expressed on a target cell, such as a tumor cell, or a cell that carries an infectious agent antigen.
- T cells recognize peptide epitopes presented by a major histocompatibility complex molecule to a target polypeptide or target peptide and typically lyse the target cell or recruit other immune cells to the site of the target cell, thereby killing the target cell.
- RNA polymerase II catalyzes the transcription of a structural gene to produce mRNA.
- a nucleic acid molecule can be designed to contain an RNA polymerase II template in which the RNA transcript has a sequence that is complementary to that of a specific mRNA.
- the RNA transcript is termed an "anti-sense RNA" and a nucleic acid molecule that encodes the anti-sense RNA is termed an "anti-sense gene.”
- Anti-sense RNA molecules are capable of binding to mRNA molecules, resulting in an inhibition of mRNA translation.
- An "anti-sense oligonucleotide specific for IL- 17A or IL-23" is an oligonucleotide having a sequence (a) capable of forming a stable triplex with a portion of the IL- 17A or IL-23 gene, or (b) capable of forming a stable duplex with a portion of an mRNA transcript of the IL- 17A or IL-23 gene.
- a "ribozyme” is a nucleic acid molecule that contains a catalytic center.
- the term includes RNA enzymes, self-splicing RNAs, self-cleaving RNAs, and nucleic acid molecules that perform these catalytic functions.
- a nucleic acid molecule that encodes a ribozyme is termed a "ribozyme gene.”
- an "external guide sequence” is a nucleic acid molecule that directs the endogenous ribozyme, RNase P, to a particular species of intracellular mRNA, resulting in the cleavage of the mRNA by RNase P.
- a nucleic acid molecule that encodes an external guide sequence is termed an "external guide sequence gene.”
- allelic variant is used herein to denote any of two or more alternative forms of a gene occupying the same chromosomal locus. Allelic variation arises naturally through mutation, and may result in phenotypic polymorphism within populations. Gene mutations can be silent (no change in the encoded polypeptide) or may encode polypeptides having altered amino acid sequence.
- allelic variant is also used herein to denote a protein encoded by an allelic variant of a gene.
- ortholog denotes a polypeptide or protein obtained from one species that is the functional counterpart of a polypeptide or protein from a different species. Sequence differences among orthologs are the result of speciation.
- the antibodies of the invention specifically bind to IL- 17 and IL-23 (via pi 9). In some embodiments, the antibodies of the invention specifically bind a monomeric form of both IL- 17 and IL-23. In some embodiments, the antibodies of the invention bind a homodimeric form of either IL- 17 or IL-23. In still other embodiments, the antibodies of the invention specifically bind a multimeric form of IL-17 or IL-23 (e.g., a heterodimeric form). For instance, IL- 17 can form a heterodimer with any other member of the IL-17 family of ligands, such as IL- 17B, IL- 17C, or IL- 17F. Preferred antibodies of the invention block the biological activities of IL-17 and IL-23, either singly or together.
- Preferred antibodies, and antibodies suitable for use in the method of the invention include, for example, fully human antibodies, human antibody homologs, humanized antibody homologs, chimeric antibody homologs, Fab, Fab', F(ab).sub.2, F(ab').sub.2 and F(v) antibody fragments, single chain antibodies, and monomers or dimers of antibody heavy or light chains or mixtures thereof.
- Antibodies of the invention are preferably monoclonal antibodies.
- the antibodies of the invention may include intact immunoglobulins of any isotype including types IgA, IgG, IgE, IgD, IgM (as well as subtypes thereof).
- the antibodies preferably include intact IgG and more preferably IgGl.
- the light chains of the immunoglobulin may be kappa or lambda. The light chains are preferably kappa.
- the antibodies of the invention comprise or consist of portions of intact antibodies that retain antigen-binding specificity, for example, Fab fragments, Fab' fragments, F(ab').sub.2 fragments, F(v) fragments, heavy chain monomers or dimers, light chain monomers or dimers, dimers consisting of one heavy and one light chain, and the like.
- antigen binding fragments, as well as full-length dimeric or trimeric polypeptides derived from the above- described antibodies are themselves useful.
- HSA human anti-rodent antibody
- HAMA human anti-mouse antibody
- Humanized antibodies are produced by recombinant DNA technology, in which at least one of the amino acids of a human immunoglobulin light or heavy chain that is not required for antigen binding has been substituted for the corresponding amino acid from a nonhuman mammalian immunoglobulin light or heavy chain.
- the immunoglobulin is a mouse monoclonal antibody
- at least one amino acid that is not required for antigen binding is substituted using the amino acid that is present on a corresponding human antibody in that position.
- the "humanization" of the monoclonal antibody inhibits human immunological reactivity against the foreign immunoglobulin molecule.
- a method of performing complementarity determining region (CDR) grafting may be performed by sequencing the mouse heavy and light chains of the antibody of interest that binds to the target antigen (e.g., IL- 17 and/or IL-23/pl9) and genetically engineering the CDR DNA sequences and imposing these amino acid sequences to corresponding human V regions by site directed mutagenesis.
- Human constant region gene segments of the desired isotype are added, and the "humanized" heavy and light chain genes are co-expressed in mammalian cells to produce soluble humanized antibody.
- a typical expression cell is a Chinese Hamster Ovary (CHO) cell.
- Suitable methods for creating the chimeric antibodies may be found, for example, in Jones et al. (1986) Nature 321:522-525; Riechmann (1988) Nature 552:323-327; Queen et al. (1989) Proc. Nat. Acad. Sci. USA 86: 10029; and Orlandi et al. (1989) Proc. Natl. Acad. Sci. USA 56:3833.
- the antibodies of the invention may be used alone or as immunoconjugates with a cytotoxic agent.
- the agent is a chemotherapeutic agent.
- the agent is a radioisotope, including, but not limited to Lead-212, Bismuth-212, Astatine-211, Iodine-131, Scandium-47, Rhenium-186, Rhenium-188, Yttrium-90, Iodine-123, Iodine- 125, Bromine-77, Indium-I l l, and fissionable nuclides such as Boron- 10 or an Actinide.
- the agent is a toxin or cytotoxic drug, including but not limited to ricin, modified Pseudomonas enterotoxin A, calicheamicin, adriamycin, 5-fluorouracil, and the like. Methods of conjugation of antibodies and antibody fragments to such agents are known in the literature.
- the antibodies of the invention include derivatives that are modified, e.g., by the covalent attachment of any type of molecule to the antibody such that covalent attachment does not prevent the antibody from binding to its epitope.
- suitable derivatives include, but are not limited to fucosylated antibodies and fragments, glycosylated antibodies and fragments, acetylated antibodies and fragments, pegylated antibodies and fragments, phosphorylated antibodies and fragments, and amidated antibodies and fragments.
- the antibodies and derivatives thereof of the invention may themselves by derivatized by known protecting/blocking groups, proteolytic cleavage, linkage to a cellular ligand or other proteins, and the like.
- At least one heavy chain of the antibody is fucosylated.
- the fucosylation is N-linked.
- at least one heavy chain of the antibody comprises a fucosylated, N-linked oligosaccharide.
- the antibodies of the invention include variants having single or multiple amino acid substitutions, deletions, additions, or replacements that retain the biological properties (e.g., block the binding of IL- 17 and/or IL-23 to their respective receptors, block the biological activity of IL- 17 and IL-23, binding affinity) of the antibodies of the invention.
- the skilled person can produce variants having single or multiple amino acid substitutions, deletions, additions or replacements.
- variants may include, inter alia: (a) variants in which one or more amino acid residues are substituted with conservative or nonconservative amino acids, (b) variants in which one or more amino acids are added to or deleted from the polypeptide, (c) variants in which one or more amino acids include a substituent group, and (d) variants in which the polypeptide is fused with another peptide or polypeptide such as a fusion partner, a protein tag or other chemical moiety, that may confer useful properties to the polypeptide, such as, for example, an epitope for an antibody, a polyhistidine sequence, a biotin moiety and the like.
- Antibodies of the invention may include variants in which amino acid residues from one species are substituted for the corresponding residue in another species, either at the conserved or nonconserved positions. In another embodiment, amino acid residues at nonconserved positions are substituted with conservative or nonconservative residues.
- the techniques for obtaining these variants, including genetic (suppressions, deletions, mutations, etc.), chemical, and enzymatic techniques, are known to the person having ordinary skill in the art.
- Antibodies of the invention also include antibody fragments.
- a “fragment” refers to polypeptide sequences which are at least about 40, at least to about 50, at least about 60, at least about 70, at least about 80, at least about 90, and at least about 100 amino acids in length, and which retain some biological activity or immunological activity of the full-length sequence, such as, for example, the ability to block the binding of IL- 17 and/or IL-23 to their respective receptors, block the biological activity of IL- 17 and IL-23, and affect binding affinity.
- the invention also encompasses fully human antibodies such as those derived from peripheral blood mononuclear cells of ovarian, breast, renal, colorectal, lung, endometrial, or brain cancer patients. Such cells may be fused with myeloma cells, for example, to form hybridoma cells producing fully human antibodies against both IL- 17 and IL-23/pl9.
- the invention also encompasses bispecif ⁇ c antibodies that bind to both IL- 17 and IL-23 (via p 19).
- Antibodies that bind to IL- 17A and IL-23pl9 have been identified by screening a phage display library. Methods of screening by phage display are described in detail in standard reference texts, such as Babas, Phage Display: A Laboratory Manual Cold Spring Harbor Lab Press, 2001 and Lo, Benny K.C., A., Antibody Engineering, 2004. Such phage display libraries can be used to display expressed proteins on the surface of a cell or other substance such that the complementary binding entity can be functionally isolated.
- variable light and heavy chain fragments of antibodies can be isolated in a Fab format.
- variable regions can then be manipulated to generate antibodies, including antigen-binding fragments, such as scFvs, bispecif ⁇ c scFvs and multispecific, multifunctional antagonists to IL- 17A or IL-23pl9.
- variable regions of Fabs have been identified for their charactaristics of binding and or neutralizing either IL- 17A or IL-23pl9 in the plate-based assays described in Examples 15 through 18 herein. These variable regions were manipulated to generate various binding entities, including scFvs that bind and/or neutralize IL- 17A or IL- 23pl9.
- Table 1 shows a list of the Fabs or scFvs that bind IL- 17A.
- Table 2 shows a list of the Fabs or scFvs that bind IL-23pl9
- the scFv entities that bind IL- 17A or IL-23pl9 can be oriented with the variable light region either amino terminal to the variable heavy region or carboxylterminal to it.
- tandem scFvs can be prepared in a number of configurations, such that each target, i.e, IL- 17A and IL-23pl9 can be bound by its respective variable regions.
- the construct for a tandem scFV molecule can be prepared such that the variable light region and variable heavy region of one antibody can be interspersed with the variable light and variable heavy regions of the other antibody as long as the variable regions are able to bind the targets.
- Tandem scFv molecules that bind both targets can be prepared with a linker between the scFv entites, including a GIy- Ser linker comprising a series of glycine and serine residues and can also include additional amino acids. Tandem bispecific scFv molecules with the variable regions of cluster numbers clO3 and c87 exhibited an IC50 (nM) of 4.3 in the assay described in Example 5 herein.
- the antibodies and derivatives thereof of the invention have binding affinities that include a dissociation constant (Ka) of less than 1 X 10 ⁇ 2 .
- the IQ is less than 1 X 10 ⁇ 3 .
- the IQ is less than IX 10 ⁇ 4 .
- the IQ is less than IX 10 ⁇ 5 .
- the IQ is less than IX 10 ⁇ 6 .
- the IQ is less than IX 10 ⁇ 7 .
- the IQ is less than IX 10 ⁇ 8 .
- the IQ is less than IX 10 ⁇ 9 .
- the IQ is less than IX 10 ⁇ 10 . In still other embodiments, the IQ is less than IX 10 ⁇ . In some embodiments, the IQ is less than IX 10 ⁇ 12 . In other embodiments, the IQ is less than IX 10 ⁇ 13 . In other embodiments, the IQ is less than IX 10 ⁇ 14 . In still other embodiments, the IQ is less than IX 10 ⁇ 15 .
- anti-IL-17A and anti-IL23pl9 antibodies isolated and described herein have been grouped into families of consensus CDRs, which are shown in SEQ ID NOs: 31 to 77 for anti-IL-17A and SEQ ID NOs: 326 to 491 for anti-IL-23pl9. Table 4, below correlates the SEQ ID NOs: with the anti-IL-17A consensus CDRs.
- the invention provides an antibody that binds a polypeptide comprising IL- 17A (SEQ ID NO:2), wherein the antibody comprises: a light chain variable region comprising: i) a light chain CDRl selected from the group consisting of: 1) SEQ ID NO: 31; 2) SEQ ID NO: 38; 3) SEQ ID NO: 44; 4) SEQ ID NO: 51; 5) SEQ ID NO: 62; and 6) SEQ ID NO: 68; and ii) a light chain CDR2 selected from the group consisting of: 1) SEQ ID NO: 32; 2) SEQ ID NO: 39; 3) SEQ ID NO: 45; 4) SEQ ID NO:52; 5) SEQ ID NO: 63; and 6) SEQ ID NO: 69; and iii) a light chain CDR3 selected from the group consisting of: 1) SEQ ID NO: 33; 2) SEQ ID NO: 40; 3) SEQ ID NO: 46; 4) SEQ ID NO: 53; 5) SEQ ID NO:
- the antibody is an antibody fragment.
- the antibody is selected from the groups consisting of: Fv, Fab, Fab', F(ab) 2 , F(ab') 2, scFv, and diabody.
- the antibody is a bispecif ⁇ c molecule.
- the antibody also binds IL-23pl9 (SEQ ID NO: 4).
- the invention provides an antibody that binds a polypeptide comprising SEQ ID NO:2, wherein the antibody is selected from the group consisting of: a) the antibody comprising the light chain CDRl of SEQ ID NO: 31, the light chain CDR2 of SEQ ID NO: 32, the light chain CDR3 of SEQ ID NO: 33, the heavy chain CDRl of SEQ ID NO:34, the heavy chain CDR2 of SEQ ID NO: 35, and wherein the heavy chain CDR3 is selected from SEQ ID NOs: 36- 37; b)the antibody comprising the light chain CDRl of SEQ ID NO: 38, the light chain CDR2 of SEQ ID NO: 39, the light chain CDR3 of SEQ ID NO: 40, the heavy chain CDRl of SEQ ID NO: 41, the heavy chain CDR2 of SEQ ID NO: 42, and wherein the heavy chain CDR3 is SEQ
- the antibody comprising the light chain CDRl of SEQ ID NO: 44, the light chain CDR2 of SEQ ID NO: 45, the light chain CDR3 of SEQ ID NO:46, the heavy chain CDRl of SEQ ID NO: 47, the heavy chain CDR2 of SEQ ID NO: 48, and wherein the heavy chain CDR3 is selected from SEQ ID NOs: 49-50; d) the antibody comprising the light chain CDRl of SEQ ID NO: 51, the light chain CDR2 of SEQ ID NO: 52, the light chain CDR3 of SEQ ID NO: 53, the heavy chain CDRl of SEQ ID NO: 54, the heavy chain CDR2 of SEQ ID NO: 55, and wherein the heavy chain CDR3 is selected from SEQ ID NOs: 56-61; e) the antibody comprising the light chain CDRl of SEQ ID NO: 62, the light chain CDR2 of SEQ ID NO: 63, the light chain CDR3 of SEQ ID NO: 64, the
- the invention provides an antibody that binds a polypeptide comprising IL-23 (SEQ ID N0:4), wherein the antibody comprises: i) a light chain CDRl selected from the group consisting of: 1) SEQ ID NO: 326; 2) SEQ ID NO: 341; 3) SEQ ID NO: 353; 4) SEQ ID NO: 365; 5) SEQ ID NO: 373: 6) SEQ ID NO: 405; 7) SEQ ID NO: 412; 8) SEQ ID NO: 421; 9) SEQ ID NO: 430; 10) SEQ ID NO: 451; 11) SEQ ID NO: 459; 12) SEQ ID NO: 467; and 13) SEQ ID NO: 476; and ii) a light chain CDR2 selected from the group consisting of: 1) SEQ ID NO: 327; 2) SEQ ID NO: 342; 3) SEQ ID NO: 354; 4) SEQ ID NO: 366; 5) SEQ ID NO: 374; 6)
- the antibody is an antibody fragment, Fv, Fab, Fab', F(ab) 2 , F(ab') 2, scFv, and diabody, and as bispecific molecule that binds IL- 17A (SEQ ID NO: 2).
- the invention provides an antibody selected from the group consisting of: a) the antibody comprising the light chain CDRl of SEQ ID NO: 326, the light chain CDR2 of SEQ ID NO: 327, the light chain CDR3 of SEQ ID NO: 328, the heavy chain CDRl of SEQ ID NO:329, the heavy chain CDR2 of SEQ ID NO: 330, and wherein the heavy chain CDR3 is selected from SEQ ID NOs: 331-340; b) the antibody comprising the light chain CDRl of SEQ ID NO: 341, the light chain CDR2 of SEQ ID NO: 342, the light chain CDR3 of SEQ ID NO: 343, the heavy chain CDRl of SEQ ID NO: 344, the heavy chain CDR2 of SEQ ID NO: 345 and wherein the heavy chain CDR3 is SEQ ID NOs: 331, and 346-352; c) the antibody comprising the light chain CDRl of SEQ ID NO: 353, the light chain CDR2 of SEQ ID NO: 35
- the antibody is an antibody fragment, Fv, Fab, Fab', F(ab) 2 , F(ab') 2 , scFv, and diabody, and as bispecific molecule that binds IL- 17A (SEQ ID NO: 2).
- the invention provides antibodies that binds polypeptide comprising SEQ ID NO:2, wherein the portion of SEQ ID NO: 2 where the antibody binds is amino acid residues 77 to 85 of SEQ ID NO: 2.
- Antibodies to epitopes from other mammalian species of IL-17 can also be useful.
- the invention provides antibodies that bind to binds a polypeptide comprising 1) SEQ ID NO: 1022 (cynomolgus monkey), wherein the portion of SEQ ID NO: 1022 where the antibody binds is selected from the group consisting of: a) amino acid residues 77 to 85 of SEQ ID NO: 1022; and b) amino acid residues 123 to 128 of SEQ ID NO: 1022; 2) SEQ ID NO:1023 (murine), wherein the portion of SEQ ID NO: 1023 where the antibody binds is selected from the group consisting of: a) amino acid residues 80 to 88 of SEQ ID NO: 1023; and b) amino acid residues 125 to 131 of SEQ ID NO: 1023; and c) SEQ ID NO: 1024 (rat), wherein the portion of SEQ ID NO: 1024 where the antibody binds is selected from the group consisting of: a) amino acid residues 72 to 80 of SEQ ID NO: 1024; and b) amino acid
- SEQ ID NO:2 wherein the portion of SEQ ID NO: 2 where the antibody binds is selected from the group consisting of: a) amino acid residues 34 to 41 of SEQ ID NO: 2; and b) amino acid residues 52 to 64 of SEQ ID NO: 2.
- Antibodies to epitopes from other mammalian species of IL- 17 can also be useful.
- the invention provides antibodies that bind to binds a polypeptide comprising 1) SEQ ID NO: 1022 (cynomologus monkey) where the antibody binds is selected from the group consisting of: a) amino acid residues 34 to 41 of SEQ ID NO: 1022; and b) amino acid residues 52 to 64 of SEQ ID NO: 1022; 2) SEQ ID NO: 1023 (murine) where the antibody binds is selected from the group consisting of:a) amino acid residues 36 to 43 of SEQ ID NO: 1023; and b) amino acid residues 60 to 67 of SEQ ID NO: 1023; 3) SEQ ID NO: 1024 (rat) where the antibody binds is amino acid residues 49 to 59 of SEQ ID NO: 1024.
- the invention provides antibodies that binds a polypeptide comprising SEQ ID NO:4, wherein the portion of SEQ ID NO: 4 where the antibody binds is selected from the group consisting of: a) amino acid residues 55 to 66 of SEQ ID NO: 4; and b) amino acid residues 74 to 85 of SEQ ID NO: 4.
- Antibodies to epitopes from other mammalian species of IL-17 can also be useful.
- the invention provides antibodies that bind to binds a polypeptide comprising 1) SEQ ID NO: 1025 (cyno) where the antibody binds is selected from the group consisting of: a) amino acid residues 55 to 66 of SEQ ID NO: 1025; and b) amino acid residues 74 to 85 of SEQ ID NO: 1025; 2) SEQ ID NO: 1026 (murine) where the antibody binds is selected from the group consisting of: a) amino acid residues 56 to 67 of SEQ ID NO: 1026; and b) amino acid residues 73-86 of SEQ ID NO: 1026; and 3) SEQ ID NO: 1027 (rat) where the antibody binds is selected from the group consisting of: a) amino acid residues 55 to 68 of SEQ ID NO: 1027; and b) amino acid residues 73 to 86 of SEQ ID NO: 1027.
- the invention provides antibodies that neutralize the polypeptide comprising SEQ ID NO:2, wherein the portion of SEQ ID NO: 4 where the antibody binds is selected from the group consisting of: a) amino acid residues 137 to 146 of SEQ ID NO: 4; and b) amino acid residues 155 to 164 of SEQ ID NO: 4.
- Antibodies to epitopes from other mammalian species of IL-17 can also be useful.
- the invention provides antibodies that bind to binds a polypeptide comprising 1) SEQ ID NO: 1025 (cyno) where the antibody binds is selected from the group consisting of: a) amino acid residues 137 to 146 of SEQ ID NO: 1025; and b) amino acid residues 155 to 164 of SEQ ID NO: 1025; 2) SEQ ID NO: 1026 (murine) where the antibody binds is selected from the group consisting of: a) amino acid residues 137 to 146 of SEQ ID NO: 1026; and b) amino acid residues 155 to 165 of SEQ ID NO: 1026; and 3) where the antibody binds is selected from the group consisting of: a) amino acid residues 137 to 147 of
- the invention provides an antibody that binds a polypeptide comprising IL- 17A (SEQ ID NO: 2) comprising a light chain variable region selected from the group consisting of: SEQ ID NO: 80, 84, 88, 92, 96, 100, 104, 108, 112, 116, 120, 124, 128, 132, 136, 140, 144, 148, 152, 156, 160, 164, 168, 172, 176, 180, 184, 188, , 192, 196, 200, 204, 208, 212, 216, 220, 224, 228, 232, 236, 240, 244, 248, 252, 256, 260, 264, 268, 272, 276, 280, 284, 288, 292, 296, 300, 304, 308, 312, 316, 320, and 325.
- SEQ ID NO: 2 comprising a light chain variable region selected from the group consisting of: SEQ ID NO: 80, 84, 88, 92,
- the antibody further comprising a heavy chain variable region selected from the group consisting of: SEQ ID NO: 81, 85, 89, 93, 97, 101, 105, 109, 113, 117, 121, 125, 129, 133, 137, 141, 145, 149, 153, 157, 161, 165, 169, 173, 177, 181, 185, 189, 193, 197, 201, 205, 209, 213, 217, 221, 225, 229, 233, 237, 241, 245, 249, 253, 257, 261, 265, 269, 273, 277, 281, 285, 289, 293, 297, 301, 305, 309, 313, 317, 321, and 323.
- a heavy chain variable region selected from the group consisting of: SEQ ID NO: 81, 85, 89, 93, 97, 101, 105, 109, 113, 117, 121, 125, 129, 133, 137
- the light chain variable region is amino terminus to the heavy chain variable region or the heavy chain variable region is amino terminal to the light chain variable region.
- the antibody is an antibody fragment.
- the antibody is selected from the group consisting of: Fv, Fab, Fab', F(ab) 2 , F(ab') 2, scFv, and diabody.
- the antibody is a bispecific molecule.
- the bispecific molecule also binds IL-23pl9 (SEQ ID NO: 4).
- the invention provides an antibody that binds a polypeptide comprising SEQ ID NO: 2 comprising a heavy chain variable region selected from the group consisting of: SEQ ID NO: 81, 85, 89, 93, 97, 101, 105, 109, 113, 117, 121, 125, 129, 133, 137, 141, 145, 149, 153, 157, 161, 165, 169, 173, 177, 181, 185, 189, 193, 197, 201, 205, 209, 213, 217, 221, 225, 229, 233, 237, 241, 245, 249, 253, 257, 261, 265, 269, 273, 277, 281, 285, 289, 293, 297, 301, 305, 309, 313, 317, 321, and 323.
- the antibody further comprising a light chain variable region selected from the group consisting of: SEQ ID NO: 80, 84, 88, 92, 96, 100, 104, 108, 112, 116, 120, 124, 128, 132, 136, 140, 144, 148, 152, 156, 160, 164, 168, 172, 176, 180, 184, 188, , 192, 196, 200, 204, 208, 212, 216, 220, 224, 228, 232, 236, 240, 244, 248, 252, 256, 260, 264, 268, 272, 276, 280, 284, 288, 292, 296, 300, 304, 308, 312, 316, 320, and 325.
- the light chain variable region is amino terminus to the heavy chain variable region or the heavy chain variable region is amino terminal to the light chain variable region.
- the antibody is an antibody fragment.
- the antibody is selected from the groups consisting of: Fv, Fab, Fab', F(ab) 2 , F(ab') 2 , scFv, and diabody.
- the antibody is a bispecific molecule.
- the bispecific molecule also binds IL-23pl9 (SEQ ID NO: 4).
- the antibody is an antibody fragment.
- antibody is selected from the groups consisting of: Fv, Fab, Fab', F(ab) 2 , F(ab') 2, scFv, and diabody.
- bispecific molecule also binds IL-23pl9 (SEQ ID NO: 4).
- the invention provides an antibody that binds a polypeptide comprising SEQ ID NO: 2, wherein the antibody comprises a light chain and a heavy chain selected from the group consisting of: a) a light chain comprising SEQ ID NO: 92 and a heavy chain comprising SEQ ID NO: 93; b) a light chain comprising SEQ ID NO: 80 and a heavy chain comprising SEQ ID NO: 81; c) a light chain comprising SEQ ID NO: 128 and a heavy chain comprising SEQ ID NO: 129; d) a light chain comprising SEQ ID NO: 144 and a heavy chain comprising SEQ ID NO: 145; e) a light chain comprising SEQ ID NO: 136 and a heavy chain comprising SEQ ID NO: 137; f) a light chain comprising SEQ ID NO: 148 and a heavy chain comprising SEQ ID NO: 149; g) a light chain comprising SEQ ID NO: 140 and a heavy chain comprising SEQ ID
- the antibody is an antibody fragment.
- the antibody is selected from the groups consisting of: Fv, Fab, Fab', F(ab) 2 , F(ab') 2 , scFv, and diabody.
- the antibody is a bispecific molecule, that also binds IL-23pl9 (SEQ ID NO: 4).
- the light chain variable region is amino terminal or carboxyl terminal to the heavy chain variable region.
- the invention provides an antibody that binds a polypeptide comprising SEQ ID NO: 2, wherein the antibody competes for binding with an antibody comprising a light chain and a heavy chain selected from the group consisting of: a) a light chain comprising SEQ ID NO: 92 and a heavy chain comprising SEQ ID NO: 93; b) a light chain comprising SEQ ID NO: 80 and a heavy chain comprising SEQ ID NO: 81; c) a light chain comprising SEQ ID NO: 128 and a heavy chain comprising SEQ ID NO: 129;d) a light chain comprising SEQ ID NO: 144 and a heavy chain comprising SEQ ID NO: 145; e) a light chain comprising SEQ ID NO: 136 and a heavy chain comprising SEQ ID NO: 137; f) a light chain comprising SEQ ID NO: 96 and a heavy chain comprising SEQ ID NO: 97; g) a light chain comprising SEQ ID NO: 100 and
- the antibody is an antibody fragment, Fv, Fab, Fab', F(ab)2, F(ab') 2, scFv, and diabody, a bispecif ⁇ c molecule that also binds IL-23pl9 (SEQ ID NO: 4).
- the invention provides an antibody that binds a polypeptide comprising SEQ ID NO: 2, wherein the antibody competes for binding with an antibody comprising a light chain comprising SEQ ID NO: 148 and a heavy chain comprising SEQ ID NO: 149.
- the antibody is an antibody fragment, Fv, Fab, Fab', F(ab) 2 , F(ab') 2 , scFv, and diabody, a bispecif ⁇ c molecule that also binds IL-23pl9 (SEQ ID NO: 4).
- the invention provides an antibody that binds a polypeptide comprising SEQ ID NO: 4 comprising a light chain variable region selected from the group consisting of: SEQ ID NO: 754, 756, 758, 460, 762, 764, 766, 768, 770, 772, 774, 776, 778, 780, 782, 784, 786, 788, 790, 792, 794, 796, 798, 800, 802, 804, 806, 808, 810, 812, 814, 816, 818, 820, 822, 824, 826, 828, 830, 832, 834, 836, 838, 840, 842, 844, 846, 848, 850, 825, 854, 856, 858, 860, 862, 864, 866, 868, 870, 872, 874, 876, 878, 880, 882, 884, 886, 888, 890, 892, 894, 896, 8
- the antibody further comprising a heavy chain variable region selected form the group consisting of:755, 757, 759, 761, 763, 765, 767, 769, 771, 773, 775, 777, 779, 781, 783, 785, 787, 789, 791, 793, 795, 797, 799, 801, 803, 805, 807, 809, 811, 813, 815, 817, 819, 820, 823, 825, 827, 829, 831, 833, 835, 837, 839, 841, 843, 845, 847, 849, 851, 853, 855, 857, 859, 861, 863, 865, 867, 869, 871, 873, 875, 877, 879, 881, 883, 885, 887, 889, 891, 893, 895, 897, 899, 903, 905, 907, 909, 911, 913, 915, 9
- the antibody is an antibody fragment, is selected from the groups consisting of: Fv, Fab, Fab', F(ab) 2 , F(ab') 2 , scFv, and diabody, is a bispecific molecule that binds IL- 17A (SEQ ID NO: 2).
- the invention provides an antibody that binds a polypeptide comprising SEQ ID NO: 2.
- the antibody is an antibody fragment, is selected from the groups consisting of: Fv, Fab, Fab', F(ab)2, F(ab') 2, scFv, and diabody, is a bispecif ⁇ c molecule that binds IL- 17A (SEQ ID NO: 2).
- the invention provides an antibody that binds a polypeptide comprising SEQ ID NO: 4 comprising a light chain variable region selected from the group consisting of: SEQ ID NO: 774 and 776 and comprising a heavy chain variable region selected from the group consisting of: SEQ ID NO: 775 and 777.
- the antibody is an antibody fragment, is selected from the groups consisting of: Fv, Fab, Fab', F(ab)2, F(ab') 2, scFv, and diabody, is a bispecif ⁇ c molecule that binds IL- 17A (SEQ ID NO: 2).
- the invention provides methods of treating autoimmune diseases including multiple sclerosis, IBD, and demyelinating diseases.
- the invention provides, a method for inhibiting interleukin-17 (IL- 17) production by T cells comprising treating said T cells with an antagonist of IL- 17 and IL-23, wherein said IL-23 antagonist binds the pl9 subunit of IL-23.
- the T cells may be activated and may be memory cells.
- the invention provides methods of treating diseases characterized by elevated expression of IL- 17 or IL-23 in a mammalian subject, comprising administering to said subject an effective amount of an antagonist of IL- 17 and IL-23, including diseases such as multiple sclerosis (MS), chronic inflammation, autoimmune diabetes, rheumatoid arthritis (RA) and other arthritic conditions, asthma, systhemic lupus erythrematosus, psoriasis, Crohn's Disease, ulcerative colitis, irritable bowel syndrome (IBS) and inflammatory bowel disease (IBD).
- MS multiple sclerosis
- RA rheumatoid arthritis
- asthma systhemic lupus erythrematosus
- psoriasis Crohn's Disease
- ulcerative colitis irritable bowel syndrome
- IBS irritable bowel syndrome
- IBD inflammatory bowel disease
- the antibody is an antibody fragment, is selected from the groups consisting of: Fv, Fab, Fab', F(ab)2, F(ab') 2, scFv, and diabody, is a bispecific molecule that binds IL-17A (SEQ ID NO: 2) and IL-23pl9 (SEQ ID NO: 4).
- the invention provides a method for preventing, inhibiting, or reducing relapse in multiple sclerosis comprising administering a combination of an antagonist to IL- 17A and an antagonist to IL-23pl9.
- the antagonist to IL- 17A and the antagonist to IL- 23pl9 are co-administered.
- the antagonist to IL- 17A is a scFv molecule and the antagonist to IL-23pl9 is a scFv molecule.
- the antagonist to IL- 17A and an antagonist to IL-23pl9 are administered in one entity.
- the entity is a bispecif ⁇ c molecule.
- the antagonist to IL- 17A comprises a light chain selected from the group consisting of: SEQ ID NO: 80, 84, 88, 92, 96, 100, 104, 108, 112, 116, 120, 124, 128, 132, 136, 140, 144, 148, 152, 156, 160, 164, 168, 172, 176, 180, 184,
- the antagonist to IL-23pl9 comprises a light chain selected from the group consisting of: SEQ ID NO: SEQ ID NO: 754, 756, 758, 460, 762, 764, 766, 768, 770, 772, 774, 776, 778, 780, 782, 784, 786, 788, 790, 792, 794, 796, 798, 800, 802, 804, 806, 808, 810, 812, 814, 816, 818, 820, 822, 824, 826, 828, 830, 832, 834, 836, 838, 840, 842, 844, 846, 848, 850, 825, 854, 856, 858, 860, 862, 864, 866, 868, 870, 872, 874, 876, 878, 880, 882, 884, 886, 888, 890, 892, 894, 896, 898, 902, 904, 906, 90
- the invention provides an isolated antibody that binds both IL- 17A (SEQ ID NO: 2) and IL-23pl9 (SEQ ID NO: 4) comprising at least one of the following: a) a light chain variable region selected from the group consisting of: SEQ ID NO: 80, 84, 88, 92, 96, 100, 104, 108, 112, 116, 120, 124, 128, 132, 136, 140, 144, 148, 152, 156, 160, 164, 168, 172, 176, 180, 184, 188, , 192, 196, 200, 204, 208, 212, 216, 220, 224, 228, 232, 236, 240, 244, 248, 252, 256, 260, 264, 268, 272, 276, 280, 284, 288, 292, 296, 300, 304, 308, 312, 316, 320, and 325; b) a heavy chain variable region selected from the group consisting of
- a light chain variable region selected from the group consisting of: SEQ ID NO: 754, 756, 758, 460, 762, 764, 766, 768, 770, 772, 774, 776, 778, 780, 782, 784, 786, 788, 790, 792, 794, 796, 798, 800, 802, 804, 806, 808, 810, 812, 814, 816, 818, 820, 822, 824, 826, 828, 830, 832, 834, 836, 838, 840, 842, 844,
- the invention also includes nucleic acids encoding the heavy chain and/or light chain of the antibodies of the invention.
- Nucleic acids of the invention include nucleic acids having at least 80%, more preferably at least about 90%, more preferably at least about 95%, and most preferably at least about 98% homology to nucleic acids of the invention.
- the terms "percent similarity", “percent identity” and “percent homology” when referring to a particular sequence are used as set forth in the University of Wisconsin GCG software program.
- Nucleic acids of the invention also include complementary nucleic acids. In some instances, the sequences will be fully complementary (no mismatches) when aligned. In other instances, there may be up to about a 20% mismatch in the sequences.
- nucleic acids encoding both a heavy chain and a light chain of an antibody of the invention.
- nucleic acid sequences provided herein can be exploited using codon optimization, degereate sequence, silent mutations, and other DNA techniques to optimize expression in a particular hosts.
- the invention encompasses such sequence modifications.
- the present invention provides polynucleotide molecules, including DNA and RNA molecules, that encode the anti-IL-17A and anti-IL-23pl9 antibodies disclosed herein. Those skilled in the art will readily recognize that, in view of the degeneracy of the genetic code, considerable sequence variation is possible among these polynucleotide molecules.
- Nucleic acids of the invention can be cloned into a vector, such as a plasmid, cosmid, bacmid, phage, artificial chromosome (BAC, YAC) or virus, into which another genetic sequence or element (either DNA or RNA) may be inserted so as to bring about the replication of the attached sequence or element.
- the expression vector contains a constitutively active promoter segment (such as but not limited to CMV, SV40, Elongation Factor or LTR sequences) or an inducible promoter sequence such as the steroid inducible pIND vector (Invitrogen), where the expression of the nucleic acid can be regulated.
- Expression vectors of the invention may further comprise regulatory sequences, for example, an internal ribosomal entry site.
- the expression vector can be introduced into a cell by transfection, for example.
- the invention also provides methods of producing monoclonal antibodies that specifically bind to IL- 17 and IL-23, either singly or together.
- Antibodies of the invention may be produced in vivo or in vitro.
- One strategy for generating antibodies against both IL- 17 and IL- 23 involves immunizing animals with both IL- 17 and IL-23.
- animals are immunized with the monomeric or multimeric form of oth IL- 17 and IL-23. Animals so immunized will produce antibodies against both IL- 17 and IL-23.
- Standard methods are known for creating monoclonal antibodies including, but are not limited to, the hybridoma technique (see Kohler & Milstein, (1975) Nature 256:495-497); the trioma technique; the human B-cell hybridoma technique (see Kozbor et al. (1983) Immunol. Today 4:72) and the EBV hybridoma technique to produce human monoclonal antibodies (see Cole, et al. in MONOCLONAL ANTIBODIES AND CANCER THERAPY, Alan R. Liss, Inc., 1985, pp. 77-96).
- Both IL- 17 and IL-23 may be purified from cells or from recombinant systems using a variety of well-known techniques for isolating and purifying proteins.
- both IL- 17 and IL-23 may be isolated based on the apparent molecular weight of the protein by running the protein on an SDS-PAGE gel and blotting the proteins onto a membrane. Thereafter, the appropriate size band corresponding to either protein may be cut from the membrane and used as an immunogen in animals directly, or by first extracting or eluting the protein from the membrane.
- the protein may be isolated by size-exclusion chromatography alone or in combination with other means of isolation and purification.
- the invention also provides methods of producing monoclonal antibodies that specifically bind to homodimeric, heterodimeric, and/or multimeric forms of both IL- 17 and IL- 23/pl9.
- These different forms may be purified from cells or from recombinant systems using a variety of well-known techniques for isolating and purifying proteins.
- both IL- 17 and IL-23/pl9 may be isolated based on the apparent molecular weight of the protein by running the protein on an SDS-PAGE gel and blotting the proteins onto a membrane. Thereafter, the appropriate size band corresponding to each may be cut from the membrane and used as an immunogen in animals directly, or by first extracting or eluting the protein from the membrane.
- the protein may be isolated by size- exclusion chromatography alone or in combination with other means of isolation and purification.
- animals are generally immunized with either IL- 17 or IL-23 or an immunogenic portion of either.
- the antigen is generally combined with an adjuvant to promote immunogenicity.
- Adjuvants vary according to the species used for immunization.
- adjuvants include, but are not limited to: Complete Freund's Adjuvant (“CFA”), Incomplete Freund's Adjuvant (“IFA”), mineral gels (e.g., aluminum hydroxide), surface active substances (e.g., lysolecithin, pluronic polyols, polyanions), peptides, oil emulsions, keyhole limpet hemocyanin (“KLH”), dinitrophenol (“DNP”), and potentially useful human adjuvants such as Bacille Calmette-Guerin (“BCG”) and corynebacterium parvum.
- CFA Complete Freund's Adjuvant
- IFA Incomplete Freund's Adjuvant
- mineral gels e.g., aluminum hydroxide
- surface active substances e.g., lysolecithin, pluronic polyols, polyanions
- peptides e.g., oil emulsions
- KLH keyhole limpet hemocyanin
- DNP dinitrophenol
- the dose and immunization regimen will depend on the species of mammal immunized, its immune status, body weight, and/or calculated surface area, etc.
- blood serum is sampled from the immunized mammals and assayed for anti-IL-17 and IL-23/pl9 antibodies using appropriate screening assays as described below, for example.
- a common method for producing humanized antibodies is to graft CDR sequences from a MAb (produced by immunizing a rodent host) onto a human Ig backbone, and transfection of the chimeric genes into Chinese Hamster Ovary (CHO) cells which in turn produce a functional Ab that is secreted by the CHO cells (Shields, R. L., et al. (1995) Int Arch. Allergy Immunol. 107:412-413).
- the methods described within this application are also useful for generating genetic alterations within Ig genes or chimeric Igs transfected within host cells such as rodent cell lines, plants, yeast and prokaryotes (Frigerio L, et al. (2000) Plant Physiol. 725:1483-1494).
- Splenocytes from immunized animals may be immortalized by fusing the splenocytes (containing the antibody-producing B cells) with an immortal cell line such as a myeloma line.
- myeloma cell line is from the same species as the splenocyte donor.
- the immortal cell line is sensitive to culture medium containing hypoxanthine, aminopterin and thymidine ("HAT medium").
- HAT medium hypoxanthine, aminopterin and thymidine
- the myeloma cells are negative for Epstein-Barr virus (EBV) infection.
- EBV Epstein-Barr virus
- the myeloma cells are HAT-sensitive, EBV negative and Ig expression negative. Any suitable myeloma may be used.
- Murine hybridomas may be generated using mouse myeloma cell lines (e.g., the P3-NS1/1- Ag4-1, P3-x63-Ag8.653 or Sp2/O-Agl4 myeloma lines). These murine myeloma lines are available from the ATCC. These myeloma cells are fused to the donor splenocytes polyethylene glycol ("PEG”), preferably 1500 molecular weight polyethylene glycol (“PEG 1500"). Hybridoma cells resulting from the fusion are selected in HAT medium which kills unfused and unproductively fused myeloma cells. Unfused splenocytes die over a short period of time in culture. In some embodiments, the myeloma cells do not express immunoglobulin genes.
- PEG polyethylene glycol
- PEG 1500 1500 molecular weight polyethylene glycol
- HAT medium kills unfused and unproductively fused myeloma cells. Un
- Hybridomas producing a desired antibody which are detected by screening assays such as those described below may be used to produce antibodies in culture or in animals.
- the hybridoma cells may be cultured in a nutrient medium under conditions and for a time sufficient to allow the hybridoma cells to secrete the monoclonal antibodies into the culture medium. These techniques and culture media are well known by those skilled in the art.
- the hybridoma cells may be injected into the peritoneum of an unimmunized animal. The cells proliferate in the peritoneal cavity and secrete the antibody, which accumulates as ascites fluid. The ascites fluid may be withdrawn from the peritoneal cavity with a syringe as a rich source of the monoclonal antibody.
- the antibodies of the present invention may also be prepared in vitro using a variety of techniques known in the art.
- fully human monoclonal antibodies against IL- 17 and IL-23/pl9 may be prepared by using in vzYro-primed human splenocytes (Boerner et ⁇ l. (1991) J. Immunol. 747:86-95).
- the antibodies of the invention may be prepared by "repertoire cloning" (Persson et ⁇ l. (1991) Proc. Nat. Acad. ScL USA 55:2432-2436; and Huang and Stollar (1991) J. Immunol. Methods 141:227-236).
- U.S. Pat. No. 5,798,230 describes preparation of human monoclonal antibodies from human B antibody-producing B cells that are immortalized by infection with an Epstein-Barr virus that expresses Epstein-Barr virus nuclear antigen 2 (EBNA2).
- EBNA2 Epstein-Barr virus nuclear antigen 2
- antibodies of the invention are formed by in vitro immunization of peripheral blood mononuclear cells ("PBMCs"). This may be accomplished by any means known in the art, such as, for example, using methods described in the literature (Zafiropoulos et al. (1997) J. Immunological Methods 200:181-190).
- PBMCs peripheral blood mononuclear cells
- bispecific and single chain antibodies that bind both IL- 17 and IL-23 are made.
- One method of the present invention is a method for producing a bispecific IL-17/IL-23 antibody. The method comprises fusing hybridoma cells that secrete a monoclonal antibody that binds IL- 17, with hybridoma cells that secrete a monoclonal antibody that binds IL-23/pl9, thereby preparing a hybrid hybridoma that secretes a bispecific IL-17/IL-23 monclonal antibody.
- the method comprises fusing hybridoma cells that secrete an antagonistic (or agonistic) IL- 17 MAb, with hybridoma cells that secrete an antagonistic (or agonistic) IL-23/pl9 MAb.
- Conventional techniques for conducting such a fusion, and for isolating the desired hybrid hybridoma include those described elsewhere herein, and those illustrated in the examples below.
- U.S. Pat. No. 6,060,285 discloses a process for the production of bispecific antibodies, in which at least the genes for the light chain and the variable portion of the heavy chain of an antibody having a first specificity are transfected into a hybridoma cell secreting an antibody having a second specificity.
- bispecific antibodies are produced, and may be isolated by various means known in the art.
- Single chain antibodies may be formed by linking heavy and light chain variable region (Fv region) fragments via an amino acid bridge (short peptide linker), resulting in a single polypeptide chain.
- Fv region heavy and light chain variable region
- Such single-chain Fvs (scFvs) have been prepared by fusing DNA encoding a peptide linker between DNAs encoding the two variable region polypeptides (V.sub.L and V. sub. H).
- the resulting antibody fragments can form dimers or higher oligomers, depending on such factors as the length of a flexible linker between the two variable domains (Kortt et al., Protein Engineering 10:423, 1997).
- two or more scFvs are joined by use of a chemical cross-linking agent.
- Single chain antibodies against IL- 17 and IL-23 may be concatamerized in either order (i.e., anti-IL-17-anti-IL-23 or anti-IL-23-anti-IL-17).
- starting materials for preparing a bispecific IL-17/IL-23 antibody include an antagonistic (or agonistic) single chain antibody directed against IL- 17 and an antagonistic (or agonistic) single chain antibody directed against IL-23/pl9.
- U.S. Pat. No. 5,582,996 discloses the use of complementary interactive domains (such as leucine zipper moieties or other lock and key interactive domain structures) to facilitate heterodimer formation in the production of bispecific antibodies.
- the complementary interactive domain(s) may be inserted between an Fab fragment and another portion of a heavy chain (i.e., C. sub. Hl or C.sub.H2 regions of the heavy chain).
- the use of two different Fab fragments and complementary interactive domains that preferentially heterodimerize will result in bispecific antibody molecules. Cysteine residues may be introduced into the complementary interactive domains to allow disulphide bonding between the complementary interactive domains and stabilize the resulting bispecific antibodies.
- Tetravalent, bispecific molecules can be prepared by fusion of DNA encoding the heavy chain of an F(ab').sub.2 fragment of an antibody with either DNA encoding the heavy chain of a second F(ab').sub.2 molecule (in which the CHl domain is replaced by a CH3 domain), or with DNA encoding a single chain Fv fragment of an antibody, as described in U.S. Pat. No. 5,959,083. Expression of the resultant fusion genes in mammalian cells, together with the genes for the corresponding light chains, yields tetravalent bispecific molecules having specificity for selected antigens.
- Bispecific antibodies can also be produced as described in U.S. Pat. No. 5,807,706, which is incorporated by reference herein.
- the method involves introducing a protuberance in a first polypeptide and a corresponding cavity in a second polypeptide, polypeptides interface.
- the protuberance and cavity are positioned so as to promote heteromultimer formation and hinder homomultimer formation.
- the protuberance is created by replacing amino acids having small side chains with amino acids having larger side chains.
- the cavity is created by the opposite approach, i.e., replacing amino acids having relatively large side chains with amino acids having smaller side chains.
- the protuberance and cavity can be generated by conventional methods for making amino acid substitutions in polypeptides.
- a nucleic acid encoding a polypeptide may be altered by conventional in vitro mutagenesis techniques.
- a polypeptide incorporating a desired amino acid substitution may be prepared by peptide synthesis. Amino acids chosen for substitution are located at the interface between the first and second polypeptides.
- IL- 17 and/or IL-23/pl9 Screening for antibodies that specifically bind to IL- 17 and/or IL-23/pl9 may be accomplished using the procedures ans assays known in the art and those described herein.
- an enzyme-linked immunosorbent assay ELISA
- ELISA enzyme-linked immunosorbent assay
- microtiter plates are coated with either or both IL- 17 and IL-23 (or pl9 alone).
- antibodies that bind both IL- 17 and IL-23/pl9 from positively reacting clones can be further screened for reactivity in an ELISA-based assay using microtiter plates coated with the other forms IL- 17 and IL-23/pl9, or other IL- 17 family members.
- Clones that produce antibodies that are reactive to another forms or family members are eliminated, and clones that produce antibodies that are reactive to both IL- 17 and IL-23/pl9 may be selected for further expansion and development.
- Confirmation of reactivity of the antibodies to both IL- 17 and IL-23/pl9 may be accomplished, for example, using a Western Blot assay in which protein from ovarian, breast, renal, colorectal, lung, endometrial, or brain cancer cells and purified FR-. alpha, and other folate receptor isoforms are run on an SDS-PAGE gel, and subsequently are blotted onto a membrane. The membrane may then be probed with the putative anti-FR-. alpha, antibodies. Reactivity with both IL- 17 and IL-23/pl9 and not another family member confirms specificity of reactivity for both IL-17 and IL-23/pl9.
- the binding affinity of the antibodies of the present invention antibodies is determined.
- Antibodies of the invention preferably have a binding affinity to IL-17 and IL-23/pl9 (either singly or together as with a bispecific antibody or scFV) of at least about 1. times.10. sup. -7 M, more preferably at least about 1. times.10. sup. -8 M, more preferably at least about 1. times.10. sup. -9 M, and most preferably at least about 1. times.10. sup. - 10 M.
- Preferred antibody-producing cells of the invention produce substantially only antibodies having a binding affinity to IL-17 and IL-23/pl9 (either singly or together as with a bispecific antibody or scFV) of at least about 1. times.10. sup. -7 M, more preferably at least about 1. times.10. sup. -8 M, more preferably at least about 1. times.10. sup. -9 M, and most preferably at least about l.times.l ⁇ .sup.-l ⁇ M.
- Preferred compositions of the invention comprise substantially only antibodies having a binding affinity to both IL-17 and IL-23/pl9 (either singly or together as with a bispecific antibody or scFV) of at least about 1. times.10. sup. -7 M, more preferably at least about l.times.l0.sup.-8 M, more preferably at least about 1. times.10. sup. -9 M, and most preferably at least about 1. times.10. sup.- 10 M
- Antibody-producing cells of the invention include any insect expression cell line known, such as for example, Spodoptera frugiperda cells.
- the expression cell lines may also be yeast cell lines, such as, for example, Saccharomyces cerevisiae and Schizosaccharomyces pombe cells.
- the expression cells may also be mammalian cells such as, for example, hybridoma cells (e.g., NSO cells), Chinese hamster ovary cells, baby hamster kidney cells, human embryonic kidney line 293, normal dog kidney cell lines, normal cat kidney cell lines, monkey kidney cells, African green monkey kidney cells, COS cells, and non-tumorigenic mouse myoblast G8 cells, fibroblast cell lines, myeloma cell lines, mouse NIH/3T3 cells, LMTK31 cells, mouse Sertoli cells, human cervical carcinoma cells, buffalo rat liver cells, human lung cells, human liver cells, mouse mammary tumor cells, TRI cells, MRC 5 cells, and FS4 cells.
- hybridoma cells e.g., NSO cells
- Chinese hamster ovary cells e.g., baby hamster kidney cells
- human embryonic kidney line 293 normal dog kidney cell lines
- normal cat kidney cell lines monkey kidney cells
- African green monkey kidney cells African green monkey kidney cells
- COS cells and non
- the antibody-producing cells of the invention produce antibodies that specifically bind to IL- 17 and IL-23/pl9 (either singly or together as with a bispecific antibody or scFV).
- the cells preferably are substantially free of both IL-17 and IL-23 binding competitors.
- the antibody-producing cells comprise less than about 10%, preferably less than about 5%, more preferably less than about 1%, more preferably less than about 0.5%, more preferably less than about 0.1%, and most preferably 0% by weight both IL-17 and IL-23 binding competitors.
- the antibodies produced by the antibody-producing cells are substantially free of both IL-17 and IL-23 competitors.
- antibodies produced by the antibody-producing cells comprise less than about 10%, preferably less than about 5%, more preferably less than about 1%, more preferably less than about 0.5%, more preferably less than about 0.1%, and most preferably 0% by weight both IL-17 and IL-23 binding competitors.
- Preferred antibody- producing cells of the invention produce substantially only antibodies having a binding affinity to IL-17 and IL-23/pl9 (either singly or together as with a bispecific antibody or scFV) of at least about 1. times.10. sup. -7 M, more preferably at least about 1. times.10. sup. -8 M, more preferably at least about 1. times.10. sup. -9 M, and most preferably at least about 1. times.10. sup. - 1O M.
- methods for antibody purification include filtration, affinity column chromatography, cation exchange chromatography, anion exchange chromatography, and concentration.
- the filtration step preferably comprises ultrafiltration, and more preferably ultrafiltration and diafiltration. Filtration is preferably performed at least about 5-50 times, more preferably 10 to 30 times, and most preferably 14 to 27 times.
- Affinity column chromatography may be performed using, for example, PROSEP Affinity Chromatography (Millipore, Billerica, Mass.).
- the affinity chromatography step comprises PROSEP-VA column chromatography. Eluate may be washed in a solvent detergent.
- Cation exchange chromatography may include, for example, SP-Sepharose Cation Exchange Chromatography.
- Anion exchange chromatography may include, for example but not limited to, Q-Sepharose Fast Flow Anion Exchange.
- the anion exchange step is preferably non-binding, thereby allowing removal of contaminants including DNA and BSA.
- the antibody product is preferably nanofiltered, for example, using a Pall DV 20 Nanofilter.
- the antibody product may be concentrated, for example, using ultrafiltration and diafiltration.
- the method may further comprise a step of size exclusion chromatography to remove aggregates.
- Antibodies that bind to both IL- 17 and IL-23 can be used to modulate the immune system by binding IL- 17 and IL-23/pl9 (either singly or together as with a bispecif ⁇ c antibody or scFV), and thus, preventing the binding of IL- 17 with either IL- 17RA and/or IL- 17RC and IL-23 with its receptor (IL-12RBl/IL-23R)or any other receptor that they may bind, especially an IL-17 receptor family member.
- the antibodies of the invention can also be used to modulate the immune system by inhibiting the binding of both IL-17 with the endogenous IL- 17RA and/or IL- 17RC receptor and IL-23 with its endogenous receptor (IL-12RB1/IL-23R).
- the antibodies of the invention can be also used to treat a subject which produces an excess of either IL-17 and/or IL-23. Suitable subjects include mammals, such as humans.
- the antibodies of the invention are useful in binding, blocking, inhibiting, reducing, antagonizing or neutralizing of both IL-17 and IL-23 (either singly or together as with a bispecif ⁇ c antibody or scFV), in the treatment of inflammation and inflammatory diseases such as multiple sclerosis, demyelinating diseases, autoimmune ocular disease, uveitis, scleritis, cancer (characterized by IL-17 and IL-23 expression), psoriasis, IBS, inflammatory bowel disease (IBD), colitis, promotion of tumor growth, arthritis, or degenerative joint disease and other inflammatory conditions disclosed herein.
- inflammation and inflammatory diseases such as multiple sclerosis, demyelinating diseases, autoimmune ocular disease, uveitis, scleritis, cancer (characterized by IL-17 and IL-23 expression), psoriasis, IBS, inflammatory bowel disease (IBD), colitis, promotion of tumor growth, arthritis, or degenerative joint disease and other inflammatory conditions disclosed
- the antibodies of the invention bind to, blocks, inhibits, reduces, antagonizes or neutralizes IL-23 (via pi 9) and IL-17 either singly or together (as with a bispecif ⁇ c antibody or scFV), in vivo.
- the antibodies of the invention are useful to: (1) Block, inhibit, reduce, antagonize or neutralize signaling via IL- 17 and IL-23 in the treatment of cancer, acute inflammation, and chronic inflammatory diseases such as inflammatory bowel disease (IBD), IBS, chronic colitis, splenomegaly, rheumatoid arthritis, and other diseases associated with the induction of acute-phase response.
- IBD inflammatory bowel disease
- IBS chronic colitis
- splenomegaly splenomegaly
- rheumatoid arthritis and other diseases associated with the induction of acute-phase response.
- Blocking, inhibiting, reducing, or antagonizing signaling via IL- 17RA and IL- 17RC, using the antibodies of the present invention may also benefit diseases of the pancreas, kidney, pituitary and neuronal cells.
- IDDM non-insulin dependent diabetes mellitus (NIDDM), pancreatitis, and pancreatic carcinoma may benefit.
- the antibodies described herein can be used to bind, block, inhibit, reduce, antagonize or neutralize IL-23 and IL- 17 activity, either singly or together as with a bispecific antibody or scFV, in the treatment of multiple sclerosis, cancer, autoimmune disease, atopic disease, NIDDM, pancreatitis and kidney dysfunction as described above.
- the antibodies of the present invention are useful as antagonists of IL- 17 or IL-23. Such antagonistic effects can be achieved by direct neutralization or binding of IL- 17 and IL-23 (via pi 9).
- Antibodies herein can also be directly or indirectly conjugated to drugs, toxins, radionuclides and the like, and these conjugates used for in vivo diagnostic or therapeutic applications.
- antibodies or binding polypeptides which recognize IL- 17 or IL-23 can be used to identify or treat tissues or organs that express a corresponding anti-complementary molecule.
- antibodies to IL- 17 or IL-23 or bioactive fragments or portions thereof can be coupled to detectable or cytotoxic molecules and delivered to a mammal having cells, tissues or organs that express these cytokines IL- 17 or IL-23 -expressing cancers.
- Suitable detectable molecules may be directly or indirectly attached to the antagonists of the present invention, such as "binding polypeptides,” (including binding peptides disclosed above), antibodies, or bioactive fragments or portions thereof.
- Suitable detectable molecules include radionuclides, enzymes, substrates, cofactors, inhibitors, fluorescent markers, chemiluminescent markers, magnetic particles and the like.
- Suitable cytotoxic molecules may be directly or indirectly attached to the polypeptide or antibody, and include bacterial or plant toxins (for instance, diphtheria toxin, Pseudomonas exotoxin, ricin, abrin and the like), as well as therapeutic radionuclides, such as iodine-131, rhenium- 188 or yttrium-90 (either directly attached to the polypeptide or antibody, or indirectly attached through means of a chelating moiety, for instance). Binding polypeptides or antibodies may also be conjugated to cytotoxic drugs, such as adriamycin.
- the detectable or cytotoxic molecule can be conjugated with a member of a complementary/ anticomplementary pair, where the other member is bound to the binding polypeptide or antibody portion.
- biotin/streptavidin is an exemplary complementary/ anticomplementary pair.
- binding polypeptide-toxin fusion proteins or antibody- toxin fusion proteins can be used for targeted cell or tissue inhibition or ablation (for instance, to treat cancer cells or tissues).
- a fusion protein including only the targeting domain may be suitable for directing a detectable molecule, a cytotoxic molecule or a complementary molecule to a cell or tissue type of interest.
- the anti-complementary molecule can be conjugated to a detectable or cytotoxic molecule.
- Such domain-complementary molecule fusion proteins thus represent a generic targeting vehicle for cell/tissue-specific delivery of generic anti-complementary-detectable/ cytotoxic molecule conjugates.
- Inflammation is a protective response by an organism to fend off an invading agent. Inflammation is a cascading event that involves many cellular and humoral mediators. On one hand, suppression of inflammatory responses can leave a host immunocompromised; however, if left unchecked, inflammation can lead to serious complications including chronic inflammatory diseases (e.g., asthma, psoriasis, arthritis, rheumatoid arthritis, multiple sclerosis, inflammatory bowel disease and the like), septic shock and multiple organ failure. Importantly, these diverse disease states share common inflammatory mediators. The collective diseases that are characterized by inflammation have a large impact on human morbidity and mortality.
- anti-inflammatory proteins such as antagonists to IL- 17 and IL-23/pl9, such as IL- 17 and IL-23/pl9 antibodies, could have crucial therapeutic potential for a vast number of human and animal diseases, from asthma and allergy to autoimmunity, cancers, and septic shock.
- rheumatoid arthritis is a systemic disease that affects the entire body and is one of the most common forms of arthritis. It is characterized by the inflammation of the membrane lining the joint, which causes pain, stiffness, warmth, redness and swelling. Inflammatory cells release enzymes that may digest bone and cartilage.
- the inflamed joint lining can invade and damage bone and cartilage leading to joint deterioration and severe pain amongst other physiologic effects.
- the involved joint can lose its shape and alignment, resulting in pain and loss of movement.
- Rheumatoid arthritis is an immune-mediated disease particularly characterized by inflammation and subsequent tissue damage leading to severe disability and increased mortality.
- a variety of cytokines are produced locally in the rheumatoid joints.
- Numerous studies have demonstrated that IL-I and TNF-alpha, two prototypic pro-inflammatory cytokines, play an important role in the mechanisms involved in synovial inflammation and in progressive joint destruction. Indeed, the administration of TNF-alpha and IL-I inhibitors in patients with RA has led to a dramatic improvement of clinical and biological signs of inflammation and a reduction of radiological signs of bone erosion and cartilage destruction.
- IL-17 and IL-23/pl9 are overexpressed in the synovium and synovial fibroblasts of patients with rheumatoid arthritis compared to individuals without rheumatoid arthritis.
- IL-17 and IL-23/pl9 have been demonstrated to promote matrix degradation and enhance the expression of inflammatory, matrix-destructive cytokines when added to synovium/synoviocyte cultures.
- a molecule that binds or inhibits IL-17 or IL-23 activity such as the antagonists of the present invention, could serve as a valuable therapeutic to reduce inflammation in rheumatoid arthritis, and other arthritic diseases.
- mice develop chronic inflammatory arthritis that closely resembles human rheumatoid arthritis. Since CIA shares similar immunological and pathological features with RA, this makes it an ideal model for screening potential human anti-inflammatory compounds.
- the CIA model is a well-known model in mice that depends on both an immune response, and an inflammatory response, in order to occur.
- the immune response comprises the interaction of B-cells and CD4+ T-cells in response to collagen, which is given as antigen, and leads to the production of anti-collagen antibodies.
- the inflammatory phase is the result of tissue responses from mediators of inflammation, as a consequence of some of these antibodies cross-reacting to the mouse's native collagen and activating the complement cascade.
- An advantage in using the CIA model is that the basic mechanisms of pathogenesis are known.
- the relevant T-cell and B-cell epitopes on type II collagen have been identified, and various immunological (e.g., delayed-type hypersensitivity and anti-collagen antibody) and inflammatory (e.g., cytokines, chemokines, and matrix- degrading enzymes) parameters relating to immune-mediated arthritis have been determined, and can thus be used to assess test compound efficacy in the CIA model (Wooley, Curr. Opin. Rheum.
- antagonists of the present invention can be used to neutralize IL- 17 and/or IL-23 (via pi 9) in the treatment of specific human diseases such as arthritis, psoriasis, psoriatic arthritis, endotoxemia, inflammatory bowel disease (IBD), IBS, colitis, and other inflammatory conditions disclosed herein.
- specific human diseases such as arthritis, psoriasis, psoriatic arthritis, endotoxemia, inflammatory bowel disease (IBD), IBS, colitis, and other inflammatory conditions disclosed herein.
- the injection of 10 - 200 ug of an anti-IL-17 and anti-IL- 23/pl9 per mouse can significantly reduce the disease score (paw score, incident of inflammation, or disease).
- the disease score paw score, incident of inflammation, or disease.
- antagonists of the present invention can be efficacious in preventing rheumatoid arthritis, as well as preventing its progression.
- Interleukin (IL)-12 and, possibly, IL-23 govern the ThI cell differentiation, but optimal induction and stabilization of polarized ThI cells would require additional cytokines, such as IL- 15, IL- 18 and IL-21.
- cytokines such as IL- 15, IL- 18 and IL-21.
- the local immune response is less polarized, but it is characterized by CDl -reactive natural killer T cell production of IL-13. Beyond these differences, Crohn's disease and ulcerative colitis share important end-stage effector pathways of intestinal injury, which are mediated by an active cross-talk between immune and non-immune mucosal cells.
- IL- 17 and IL-23 are both overexpressed in intestines and/or serum from humans with IBD and in mouse models of IBD.
- IL-17 and/or IL-23/pl9 reduces disease symptoms and pathology in animals models of IBD (Yen et al, J. Clin. Invest. 116:1310 (2006); Zhang et al, Inflamm Bowel Dis. 12:382 (2006)).
- both IL-17 and IL-23/pl9 expression are increased in the DSS colitis model and in the T cell transfer colitis model, and treatment wth a combination of an anti-IL-17A antibody and an anti-IL23pl9 antibody is more efficacious in the oxazalone IBD model than treatment with either antibody alone.
- antagonists of the present invention could serve as a valuable therapeutic to reduce inflammation and pathological effects in IBD and related diseases.
- Crohn's disease is a chronic, relapsing -remitting inflammatory disease of the intestinal tract. It is a chronic disease that often occurs at an early age, thus requiring patients to be treated for decades. In contrast to the more limited tissue layer involvement of ulcerative colitis (i.e. mucosa and submucosa of the colon), Crohn's disease can extend through all layers of the intestinal wall of both the large and small intestine. Symptoms of Crohn's disease include diarrhea, weight loss, blood, and abdominal pain. Complications are very serious and include intestinal fistulas, abscesses, and obstructions.
- Ulcerative colitis is an inflammatory disease of the large intestine, commonly called the colon, characterized by inflammation and ulceration of the mucosa or innermost lining of the colon. This inflammation causes the colon to empty frequently, resulting in diarrhea. Symptoms include loosening of the stool and associated abdominal cramping, fever and weight loss.
- TNBS 2,4,6-trinitrobenesulfonic acid/ethanol
- oxazalone a model that induce chronic inflammation and ulceration in the colon.
- TNBS or oxazalone is introduced into the colon of susceptible mice via intra-rectal instillation, it induces T-cell mediated immune response in the colonic mucosa, in this case leading to a massive mucosal inflammation characterized by the dense infiltration of T-cells and macrophages throughout the entire wall of the large bowel.
- DSS dextran sulfate sodium
- Another colitis model uses dextran sulfate sodium (DSS), which induces an acute colitis manifested by bloody diarrhea, weight loss, shortening of the colon and mucosal ulceration with neutrophil infiltration.
- DSS-induced colitis is characterized histologically by infiltration of inflammatory cells into the lamina intestinal, with lymphoid hyperplasia, focal crypt damage, and epithelial ulceration. These changes are thought to develop due to a toxic effect of DSS on the epithelium and by phagocytosis of lamina limba cells and production of TNF-alpha and IFN-gamma.
- DSS is regarded as a T cell-independent model because it is observed in T cell-deficient animals such as SCID mice.
- Psoriasis is a chronic skin condition that affects more than seven million Americans. Psoriasis occurs when new skin cells grow abnormally, resulting in inflamed, swollen, and scaly patches of skin where the old skin has not shed quickly enough. Plaque psoriasis, the most common form, is characterized by inflamed patches of skin ("lesions") topped with silvery white scales. Psoriasis may be limited to a few plaques or involve moderate to extensive areas of skin, appearing most commonly on the scalp, knees, elbows and trunk. Although it is highly visible, psoriasis is not a contagious disease. The pathogenesis of the diseases involves chronic inflammation of the affected tissues.
- IL- 17 and IL-23 are both overexpressed in psoriatic skin compared to non-psoriatic skin (Li et al, J Huazhong Univ Sci Technolog Med Sci. 24:294 (2004); Piskin et al, J Immunol. 776:1908 (2006)). Therefore, antagonists of the present invention could serve as a valuable therapeutic to reduce inflammation and pathological effects in psoriasis, other inflammatory skin diseases, skin and mucosal allergies, and related diseases.
- Psoriasis is a T-cell mediated inflammatory disorder of the skin that can cause considerable discomfort. It is a disease for which there is no cure and affects people of all ages. Psoriasis affects approximately two percent of the populations of European and North America. Although individuals with mild psoriasis can often control their disease with topical agents, more than one million patients worldwide require ultraviolet or systemic immunosuppressive therapy. Unfortunately, the inconvenience and risks of ultraviolet radiation and the toxicities of many therapies limit their long-term use. Moreover, patients usually have recurrence of psoriasis, and in some cases rebound, shortly after stopping immunosuppressive therapy.
- the activity of antagonists of the present invention on inflammatory tissue derived from human psoriatic lesions can be measured in vivo using a severe combined immune deficient (SCID) mouse model.
- SCID severe combined immune deficient
- xenograft models Several mouse models have been developed in which human cells are implanted into immunodeficient mice (collectively referred to as xenograft models); see, for example, Cattan AR, Douglas E, Leuk. Res. 18:513-22 (1994) and Flavell, DJ, Hematological Oncology 14:67-82 (1996).
- xenograft models see, for example, Cattan AR, Douglas E, Leuk. Res. 18:513-22 (1994) and Flavell, DJ, Hematological Oncology 14:67-82 (1996).
- human psoriatic skin tissue is implanted into the SCID mouse model, and challenged with an appropriate antagonist.
- psoriasis animal models in ther art may be used to evaluate the present antagonists, such as human psoriatic skin grafts implanted into AGR129 mouse model, and challenged with an appropriate antagonist (e.g., see, Boyman, O. et al., J. Exp. Med. 199:731 (2004), incorporated herein by reference).
- IL- 17/IL-23 antibodies or binding peptides that bind, block, inhibit, reduce, antagonize or neutralize the activity of IL- 17, IL-23 or both IL- 17 and IL-23 are preferred antagonists.
- tissues or cells derived from human colitis, IBD, arthritis, or other inflammatory lestions can be used in the SCID model to assess the anti-inflammatory properties of the IL- 17 and IL-23 antagonists described herein.
- Efficacy of treatment is measured and statistically evaluated as increased antiinflammatory effect within the treated population over time using methods well known in the art.
- Some exemplary methods include, but are not limited to measuring for example, in a psoriasis model, epidermal thickness, the number of inflammatory cells in the upper dermis, and the grades of parakeratosis.
- Such methods are known in the art and described herein. For example, see Zeigler, M. et al. Lab Invest 81: 1253 (2001); Zollner, T. M. et al. J. Clin. Invest. 109:611 (2002); Yamanaka, N. et al. Microbio. I Immunol. 45:507 (2001); Raychaudhuri, S.
- Inflammation may also be monitored over time using well-known methods such as flow cytometry (or PCR) to quantitate the number of inflammatory or lesional cells present in a sample, score (weight loss, diarrhea, rectal bleeding, colon length) for IBD.
- therapeutic strategies appropriate for testing in such a model include direct treatment using IL- 17 and IL-23 antagonists (singly or together), or related conjugates or antagonists based on the disrupting interaction of IL- 17 and IL-23 with their receptors.
- AD is a common chronic inflammatory disease that is characterized by hyperactivated cytokines of the helper T cell subset 2 (Th2). Although the exact etiology of AD is unknown, multiple factors have been implicated, including hyperactive Th2 immune responses, autoimmunity, infection, allergens, and genetic predisposition. Key features of the disease include xerosis (dryness of the skin), pruritus (itchiness of the skin), conjunctivitis, inflammatory skin lesions, Staphylococcus aureus infection, elevated blood eosinophilia, elevation of serum IgE and IgGl, and chronic dermatitis with T cell, mast cell, macrophage and eosinophil infiltration. Colonization or infection with S. aureus has been recognized to exacerbate AD and perpetuate chronicity of this skin disease.
- Th2 helper T cell subset 2
- AD is often found in patients with asthma and allergic rhinitis, and is frequently the initial manifestation of allergic disease. About 20% of the population in Western countries suffer from these allergic diseases, and the incidence of AD in developed countries is rising for unknown reasons. AD typically begins in childhood and can often persist through adolescence into adulthood. Current treatments for AD include topical corticosteroids, oral cyclosporin A, non-corticosteroid immunosuppressants such as tacrolimus (FK506 in ointment form), and interferon-gamma. Despite the variety of treatments for AD, many patients' symptoms do not improve, or they have adverse reactions to medications, requiring the search for other, more effective therapeutic agents.
- the antagonists of the present invention can be used to neutralize IL- 17 and IL-23 (via pi 9) in the treatment of specific human diseases such as atoptic dermatitis, inflammatory skin conditions, and other inflammatory conditions disclosed herein.
- IL- 17 plays an important role in allergen-induced T cell activation and neutrophilic influx in the airways.
- the receptor for IL- 17 is expressed in the airways (Y ao, et al. Immunity 5:811 (1995)) and IL- 17 mediated neutrophil recruitment in allergic asthma is largely induced by the chemoattractant IL-8, GRO-alpha and macrophage inflammatory protein-2 (MIP- 2) produced by IL- 17 stimulated human bronchial epithelial cells (HBECs) and human bronichial fibroblasts ( Yao, et al. J Immunol 155:5483 (1995)); Molet, et al.
- IL-17 also stimulates HBECs to release IL-6, a neutrophil-activating factor ( Fossiez, et al, J Exp Med 183:2593 (1996), and Linden, et al. Int Arch Allergy Immunol 126:179 (2001)) and has been shown to synergize with TNF-alpha to prolong the survival of human neutrophils in vitro (Laan, et al. Eur Respir J 21:387 (2003)).
- IL-17 is capable of amplifying the inflammatory responses in asthma by its ability to enhance the secretion of cytokines implicated in airway remodeling such as the profibrotic cytokines, IL-6 and IL-11 and inflammatory mediators granulocyte colony-stimulating factor (G-CSF) and granulocyte macrophage colony-stimulating factor (GM-CSF) (Molet, et al. J Allergy CHn Immunol 108:430 (2001)).
- G-CSF granulocyte colony-stimulating factor
- GM-CSF granulocyte macrophage colony-stimulating factor
- IL-17 is likely to play a significant role in asthma.
- IL-23 is important in the maintenance and differentiation of IL-17 producing cells (e.g. Thl7 cells), IL-23 is also likely to play a role in asthma.
- Patients with mild asthma display a detectable increase in the local concentration of free, soluble IL-17 protein (Molet, et al.
- Anti-IL-17 monoclonal antibodies strongly reduced bronchial neutrophilic influx but significantly enhanced IL-5 levels in both bronchoalveolar lavage fluid and serum, and aggravated allergen-induced bronchial eosinophilic influx, suggesting that IL- 17 may be involved in determining the balance between neutrophil and eosinophil accumulation following antigen insult Id..
- COPD chronic obstructive pulmonary disease
- An anti-IL-17 and/or anti- IL-23 therapeutic molecule could be demonstrated to be efficacious for chronic inflammatory airway disease in an in vitro model of inflammation.
- the ability of antagonists to IL- 17 and/or IL-23 activity to inhibit IL- 17 or and/or IL-23 signalling to induce cytokine and chemokine production from cultured HBECs or bronchial fibroblasts could be used as a measure of efficacy for such antagonists in the prevention of the production of inflammatory mediators directly resulting from IL- 17 and/or IL-23 stimulation. If the addition of antagonists to IL- 17 and/or IL- 23 activity markedly reduces the production and expression of inflammatory mediators, it would be expected to be efficacious in inflammatory aspects associated with chronic airway inflammation.
- Multiple sclerosis is a relatively commonly occurring autoimmune disease characterized by demyelination and chronic inflammation of the central nervous system (CNS). Although the mechanisms underlying disease initiation are not clearly understood, the disease processes that contribute to clinical progression of multiple sclerosis are inflammation, demyelination, and axonal loss, or neurodegeneration. Macrophages and microglia are the main immune cells of the CNS. These cells, as well as T cells, neutrophils, astrocytes, and microglia, can contribute to the immune-related pathology of, e.g., multiple sclerosis.
- T cell reactivity/autoimmunity to several myelin proteins have been implicated in the induction and perpetuation of disease state and pathology of multiple sclerosis.
- myelin basic protein MBP
- proteolipid protein PBP
- myelin oligodendrocyte protein MAG
- This interaction of autoreactive T cells and myelin proteins can result in the release of proinflammatory cytokines, including TNF-a, IFN-g, and IL- 17, among others.
- Additional consequences are the proliferation of T cells, activation of B cells and macrophages, upregulation of chemokines and adhesion molecules, and the disruption of the blood-brain barrier.
- the ensuing pathology is a loss of oligodendrocytes and axons, and the formation of a demyelinated "plaque".
- the plaque consists of a lesion in which the myelin sheath is now absent and the demyelinated axons are embedded within glial scar tissue. Demyelination can also occur as the result of specific recognition and opsinization of myelin antigens by autoantibodies, followed by complement- and/or activated macrophage-mediated destruction. It is this axonal loss and neurodegeneration that is thought to be primarily responsible for the irreversible neurological impairment that is observed in progressive multiple sclerosis.
- This worsening of disease in these cases is classified as secondary-progressive multiple sclerosis, and occurs in approximately 10 - 15% of multiple sclerosis patients. Another 10 - 15% of patients are diagnosed with primary-progressive multiple sclerosis, in which disease symptoms and physical impairment progress at a steady rate throughout the disease process.
- IL-23 and IL- 17 are overexpressed in the central nervous system of humans with multiple sclerosis and in mice undergoing an animal model of multiple sclerosis, experimental autoimmune encephalomyelitis (EAE). (See Example 11). The overexpression is observed in mice when the EAE is induced by either myelin oligodendrocyte glycoprotein (MOG) 35-55 peptide- or proteolipid peptide (PLP). Furthermore, neutralization of either IL- 23/pl9 or IL- 17 results in amelioration of EAE symptoms in mice (Park et al, Nat Immunol. 5:1133 (2005); ); Chen et al. J Clin Invest. 116:1317 (2006)). [242] The ability of antagonists to IL- 17 and/or IL-23 activity to inhibit IL- 17 or and/or
- IL-23 signalling-induced cytokine and chemokine production could be used as a measure of efficacy for such antagonists in the treatment of multiple sclerosis.
- the addition of antagonists to IL- 17 and/or IL-23 activity markedly reduces the production and expression of inflammatory mediators (i.e. CNS-infiltrating immune cells; CNS expression of inflammatory cytokines/chemokines, etc.) and symptoms of multiple sclerosis (e.g. paralysis; ataxia; weight loss, etc). See Example 8. These results indicate that antagonists to IL- 17 and/or IL-23 activity would be efficacious in the treatment of humans.
- IL-23 and IL- 17 have been published to be upregulated in several human tumors and cancers, including but not limited to those of the colon, breast, ovarian, cervical, prostate, lung, and stomach, as well as melanoma and T cell lymphoma (Tartour et al, Cancer Res. 5P:3698 (1999); Kato et al, Biochem. Biophys. Re. s Commun. 282:735 (2001); Steiner et al, Prostate. 56:111 (2003); Langowksi et al, Nature, 442:461-5, (2006)).
- neutralization of both IL-17 and a key upstream regulator of IL-17, IL-23 is a potent and effective means of treating cancer and other neoplastic diseases. Therefore, neutralizing both IL-17 and IL-23 with antagonists of the present invention (i.e. a single neutralizing entity or antibody to IL-17 and IL-23 or an antagonistic molecule that will neutralize both together, such as a bispecific antibody or bispecific scFv) will have better efficacy in these diseases than antagonists directed toward either of IL-17 or IL-23 alone.
- antagonists of the present invention i.e. a single neutralizing entity or antibody to IL-17 and IL-23 or an antagonistic molecule that will neutralize both together, such as a bispecific antibody or bispecific scFv
- Angiogenesis refers to the formation of new capillaries from preexisting vessels. There are several reports that angiogenesis plays important roles in hematological malignancies and solid tumors. The initiation of angiogenesis and the switch to the angiogenic phenotype requires a change between proangiogenic factors and angiogenic inhibitors (Folkman, Nat. Med. ⁇ :21 (1995)). IL-17 acts as a stimulatory hematopoietic cytokine by initiating proliferation of mature neutrophils and by expanding myeloid progenitors. It has been well documented that
- IL- 17 has pro-angiogenic activities and stimulates the migration of vascular endothelial cells, which are associated with tumor promotion (Numasaki et al, Blood, 101 :2620 (2003); Yang et al, J. Biol. Chem., 278:33232 (2003); Fujino et al, Gut, 52:65 (2003)).
- In vitro angiogenic activity can be suppressed by neutralizing IL- 17 with a neutralizing anti-IL-17 monoclonal antibody, further supporting the role of IL- 17 in this action.
- IL- 17 may also promote bFGF-, HGF- and VEGF- mediated angiogenesis via bFGF-, HGF- and VEGF-induced growth of vascular endothelial cells (Takahashi et al, Immunol Lett. 98:189 (2005)).
- IL- 17 has been reported to augment the secretion of several angiogenic CXC chemokines (e.g. CXCLl, CXCL5, CXCL6, and CXCL8) in non-small cell lung cancer (NSCLC) lines.
- CXC chemokines e.g. CXCLl, CXCL5, CXCL6, and CXCL8
- Endothelial cell chemotactic activity (a measure of net angiogenic potential) is increased in response to conditioned medium from NSCLC stimulated with recombinant IL- 17.
- NSCLC lines transfected with IL- 17 grew more rapidly versus controls when transplanted in SCID mice (Numasaki et al, J Immunol. ⁇ 15:6 ⁇ 11 (2005)).
- IL- 17 has been reported to be associated with increased IL-6 at the site of tumors and is well reported to increase MMP-9 expression.
- MMP-9 is an important modulator in diseases of inflammation, autoimmunity, and cancer.
- antagonists of the present invention i.e. a single neutralizing entity or antibody to IL- 17 and IL-23 or an antagonistic molecule that will neutralize both together, such as a bispecific antibody or bispecific scFv
- a bispecific antibody or bispecific scFv will have better efficacy than antagonists directed toward either of IL- 17 or IL-23 alone.
- IL-23 promotes inflammatory responses including upregulation of MMP-9, and is also reported to increase angiogenesis and reduce CD8+ T-cell infiltration. Taken together, these actions can lead to enhanced initiation, progression, and/or maintenance of tumors, cancers, and other transformed growths. That IL-23 plays an important role in cancerous diseases is supported by the observation that neutralization of IL-23 with a monoclonal antibody or with genetic deletion in mice reduces tumor growth in several murine tumor models (Langowksi et al. Nature, 442: 461-5 (2006)).
- Efficacy is associated with reduced IL-17 expression and reductions in IL-17-related tumorogenic biomarkers, such as granulocyte infiltration, G-CSF and MMP-9. Therefore, neutralizing both IL-17 and IL-23 with antagonists of the present invention (i.e. a single neutralizing entity or antibody to IL-17 and IL-23 or an antagonistic molecule that will neutralize both together, such as a bispecific antibody or bispecific scFv) will have better efficacy in these diseases than antagonists directed toward either of IL- 17 or IL-23 alone.
- antagonists of the present invention i.e. a single neutralizing entity or antibody to IL-17 and IL-23 or an antagonistic molecule that will neutralize both together, such as a bispecific antibody or bispecific scFv
- IBS Irritable Bowel Syndrome
- IBS Irritable bowel syndrome
- IBS patients can be characterized into three main groups based on bowel habits: those with predominantly loose or frequent stools, those with predominantly hard or infrequent stools, and those with variable or normal stools (Talley et al, Expert Opin. Emerg. Drugs 7:91-8 (2002)).
- Altered intestinal motility, abnormalities in epithelial function, abnormal transit of stool and gas, and stress, may contribute to symptoms, while visceral hypersensitivity is a key feature in most patients. Genetic factors affecting pain- signaling and disturbances in central processing of afferent signals are postulated to predispose individuals to IBS following specific environmental exposures.
- IBS significantly affects a very large number of individuals (U.S. prevalence in 2000, approximately 16 million individuals), resulting in a total cost burden of 1.7 billion dollars (year 2000).
- IBS is second only to gastroesophageal reflux disease (GERD).
- GERD gastroesophageal reflux disease
- treatment for IBS remains unsatisfactory ((Talley et al, Expert Opin. Emerg. Drugs 7:91-8 (2002)); Farhadi et al, Expert Opin. Investig. Drugs 70:1211-22 (2001); Collins et al, Can. J. Gastroenterol. 15 Suppl. 5: 14B- 16B (2001)), demonstrating that IBS clearly represents an unmet medical need.
- IBS including a role for molecules that stimulate neurons and those that are involved in initiation of inflammatory process, including IL- 17A and IL-23pl9.
- Efficacy of inhibitors of these molecules could be tested in vivo in animal models of disease.
- Several animal models have been proposed that mimic key features of IBS and involve centrally targeted stimuli (stress) or peripherally targeted stimuli (infection, inflammation).
- Stress models Two examples of in vivo animal models that can be used to determine the effectiveness of inhibitors in the treatment of IBS are (i) models focusing on primary CNS- directed pathogeneisis of IBS (stress models), and (ii) models focusing on gut-directed inducers of stress (i.e. gut inflammation, infection or physical stress).
- stress models models focusing on primary CNS- directed pathogeneisis of IBS
- gut-directed inducers of stress i.e. gut inflammation, infection or physical stress.
- IL- 17 and IL-23 there are several molecules and pathogenic pathways that are shared by IL- 17 and IL-23 which play important roles in the devopment, progression, and maintenance of both autoimmune diseases and cancerous diseases. These include the pro- angiogenic roles of IL- 17 and IL-23; enhanced MMP-9 levels and activity by IL- 17 and IL-23; IL-23, TGF-b and IL-6-mediated production and/or maintenance of Thl7 cells; roles of TGF-b and IL-6 in the generation of Foxp3+ regulatory T cells; and additional pathways and molecules.
- the IL-17/IL-23 axis represents an important link to the inappropriate and pathogenic T cell responses associated with autoimmune diseases, tumour-promoting pro-inflammatory processes, and the failure of the adaptive immune surveillance to infiltrate tumours. Therefore, neutralizing both IL- 17 and IL-23 with antagonists of the present invention (i.e. a single neutralizing entity or antibody to IL- 17 and IL-23 or an antagonistic molecule that will neutralize both together, such as a bispecific antibody or bispecific scFv) will have better efficacy in these diseases than antagonists directed toward either of IL- 17 or IL-23 alone.
- antagonists of the present invention i.e. a single neutralizing entity or antibody to IL- 17 and IL-23 or an antagonistic molecule that will neutralize both together, such as a bispecific antibody or bispecific scFv
- the antibodies of the present invention are formulated for parenteral, particularly intravenous or subcutaneous, delivery according to conventional methods.
- Intravenous administration will be by bolus injection, controlled release, e.g, using mini-pumps or other appropriate technology, or by infusion over a typical period of one to several hours.
- pharmaceutical formulations will include a hematopoietic protein in combination with a pharmaceutically acceptable vehicle, such as saline, buffered saline, 5% dextrose in water or the like.
- Formulations may further include one or more excipients, preservatives, solubilizers, buffering agents, albumin to provent protein loss on vial surfaces, etc.
- the cytokines When utilizing such a combination therapy, the cytokines may be combined in a single formulation or may be administered in separate formulations. Methods of formulation are well known in the art and are disclosed, for example, in Remington's Pharmaceutical Sciences, Gennaro, ed., Mack Publishing Co., Easton PA, 1990, which is incorporated herein by reference.
- Therapeutic doses will generally be in the range of 0.1 to 100 mg/kg of patient weight per day, preferably 0.5-20 mg/kg per day, with the exact dose determined by the clinician according to accepted standards, taking into account the nature and severity of the condition to be treated, patient traits, etc. Determination of dose is within the level of ordinary skill in the art.
- the proteins will commonly be administered over a period of up to 28 days following chemotherapy or bone-marrow transplant or until a platelet count of >20,000/mm3, preferably >50,000/mm ⁇ , is achieved. More commonly, the proteins will be administered over one week or less, often over a period of one to three days.
- a therapeutically effective amount of antibodies of the present invention is an amount sufficient to produce a clinically significant increase in the proliferation and/or differentiation of lymphoid or myeloid progenitor cells, which will be manifested as an increase in circulating levels of mature cells (e.g. platelets or neutrophils). Treatment of platelet disorders will thus be continued until a platelet count of at least 20,000/mm3, preferably 50,000/mm3, is reached.
- the antibodies of the present invention can also be administered in combination with other cytokines such as IL-3, -6 and -11; stem cell factor; erythropoietin; G-CSF and GM-CSF.
- cytokines such as IL-3, -6 and -11; stem cell factor; erythropoietin; G-CSF and GM-CSF.
- daily doses of other cytokines are commonly known by one skilled in the art, or can be determined without undue experimentation.
- Combination therapy with EPO for example, is indicated in anemic patients with low EPO levels.
- the dosage of administered antibodies will vary depending upon such factors as the patient's age, weight, height, sex, general medical condition and previous medical history. Typically, it is desirable to provide the recipient with a dosage of antibodies which is in the range of from about 1 pg/kg to 10 mg/kg (amount of agent/body weight of patient), although a lower or higher dosage also may be administered as circumstances dictate.
- Administration of antibodies of the invention to a subject can be intravenous, intraarterial, intraperitoneal, intramuscular, subcutaneous, intrapleural, intrathecal, by perfusion through a regional catheter, or by direct intralesional injection.
- the administration may be by continuous infusion or by single or multiple boluses.
- Additional routes of administration include oral, mucosal-membrane, pulmonary, and transcutaneous.
- Oral delivery is suitable for polyester microspheres, zein microspheres, proteinoid microspheres, polycyanoacrylate microspheres, and lipid-based systems (see, for example, DiBase and Morrel, "Oral Delivery of Microencapsulated Proteins," in Protein Delivery: Physical Systems, Sanders and Hendren (eds.), pages 255-288 (Plenum Press 1997)).
- the feasibility of an intranasal delivery is exemplified by such a mode of insulin administration (see, for example, Hinchcliffe and Ilium, Adv. Drug Deliv. Rev. 55:199 (1999)).
- Dry or liquid particles comprising antibodies of the invention can be prepared and inhaled with the aid of dry- powder dispersers, liquid aerosol generators, or nebulizers ⁇ e.g., Pettit and Gombotz, TIBTECH 16:343 (1998); Patton et al., Adv. Drug Deliv. Rev. 55:235 (1999)).
- This approach is illustrated by the AEPvX diabetes management system, which is a hand-held electronic inhaler that delivers aerosolized insulin into the lungs.
- proteins as large as 48,000 kDa have been delivered across skin at therapeutic concentrations with the aid of low-frequency ultrasound, which illustrates the feasibility of trascutaneous administration (Mitragotri et al., Science 269:850 (1995)).
- Transdermal delivery using electroporation provides another means to administer a molecule having IL- 17 and IL-23/pl9 binding activity (Potts et al., Pharm. Biotechnol. 10:213 (1997)).
- a pharmaceutical composition comprising one or more antibodies of the invention can be formulated according to known methods to prepare pharmaceutically useful compositions, whereby the therapeutic proteins are combined in a mixture with a pharmaceutically acceptable carrier.
- a composition is said to be a "pharmaceutically acceptable carrier” if its administration can be tolerated by a recipient patient.
- Sterile phosphate-buffered saline is one example of a pharmaceutically acceptable carrier.
- Other suitable carriers are well-known to those in the art. See, for example, Gennaro (ed.), Remington's Pharmaceutical Sciences, 19th Edition (Mack Publishing Company 1995).
- antibodies of the invention and a pharmaceutically acceptable carrier are administered to a patient in a therapeutically effective amount.
- a combination of a therapeutic molecule of the present invention and a pharmaceutically acceptable carrier is said to be administered in a "therapeutically effective amount" if the amount administered is physiologically significant.
- An agent is physiologically significant if its presence results in a detectable change in the physiology of a recipient patient.
- an agent used to treat inflammation is physiologically significant if its presence alleviates the inflammatory response.
- Effective treatment may be assessed in a variety of ways. In one embodiment, effective treatment is determined by reduced inflammation. In other embodiments, effective treatment is marked by inhibition of inflammation. In still other embodiments, effective therapy is measured by increased well-being of the patient including such signs as weight gain, regained strength, decreased pain, thriving, and subjective indications from the patient of better health.
- a pharmaceutical composition comprising antibodies of the invention can be furnished in liquid form, in an aerosol, or in solid form.
- Liquid forms are illustrated by injectable solutions and oral suspensions.
- Exemplary solid forms include capsules, tablets, and controlled-release forms. The latter form is illustrated by miniosmotic pumps and implants (Bremer et al, Pharm. Biotechnol.
- Liposomes provide one means to deliver therapeutic polypeptides to a subject intravenously, intraperitoneally, intrathecally, intramuscularly, subcutaneously, or via oral administration, inhalation, or intranasal administration.
- Liposomes are microscopic vesicles that consist of one or more lipid bilayers surrounding aqueous compartments (see, generally, Bakker- Woudenberg et al, Eur. J. Clin. Microbiol. Infect. Dis.
- Liposomes are similar in composition to cellular membranes and as a result, liposomes can be administered safely and are biodegradable. Depending on the method of preparation, liposomes may be unilamellar or multilamellar, and liposomes can vary in size with diameters ranging from 0.02 ⁇ m to greater than 10 ⁇ m.
- a variety of agents can be encapsulated in liposomes: hydrophobic agents partition in the bilayers and hydrophilic agents partition within the inner aqueous space(s) (see, for example, Machy et al, Liposomes In Cell Biology And Pharmacology (John Libbey 1987), and Ostro et al, American J. Hosp. Pharm. 46:1576 (1989)). Moreover, it is possible to control the therapeutic availability of the encapsulated agent by varying liposome size, the number of bilayers, lipid composition, as well as the charge and surface characteristics of the liposomes.
- Liposomes can adsorb to virtually any type of cell and then slowly release the encapsulated agent.
- an absorbed liposome may be endocytosed by cells that are phagocytic. Endocytosis is followed by intralysosomal degradation of liposomal lipids and release of the encapsulated agents (Scherphof et al., Ann. N.Y. Acad. Sci. 446:36% (1985)).
- small liposomes (0.1 to 1.0 ⁇ m) are typically taken up by cells of the reticuloendothelial system, located principally in the liver and spleen, whereas liposomes larger than 3.0 ⁇ m are deposited in the lung. This preferential uptake of smaller liposomes by the cells of the reticuloendothelial system has been used to deliver chemotherapeutic agents to macrophages and to tumors of the liver.
- the reticuloendothelial system can be circumvented by several methods including saturation with large doses of liposome particles, or selective macrophage inactivation by pharmacological means (Claassen et al., Biochim. Biophys. Acta 802:42% (1984)).
- incorporation of glycolipid- or polyethelene glycol-derivatized phospholipids into liposome membranes has been shown to result in a significantly reduced uptake by the reticuloendothelial system (Allen et al., Biochim. Biophys. Acta 1068:133 (1991); Allen et al., Biochim. Biophys. Acta 1150:9 (1993)).
- Liposomes can also be prepared to target particular cells or organs by varying phospholipid composition or by inserting receptors or ligands into the liposomes.
- liposomes prepared with a high content of a nonionic surfactant, have been used to target the liver (Hayakawa et al., Japanese Patent 04-244,018; Kato et al., Biol. Pharm. Bull. 16:960 (1993)).
- These formulations were prepared by mixing soybean phospatidylcholine, ⁇ - tocopherol, and ethoxylated hydrogenated castor oil (HCO-60) in methanol, concentrating the mixture under vacuum, and then reconstituting the mixture with water.
- DPPC dipalmitoylphosphatidylcholine
- SG soybean-derived sterylglucoside mixture
- Cho cholesterol
- liposomes can be modified with branched type galactosyllipid derivatives to target asialoglycoprotein (galactose) receptors, which are exclusively expressed on the surface of liver cells (Kato and Sugiyama, Crit. Rev. Ther. Drug Carrier Sy st. 14:2%1 (1997); Murahashi et al, Biol. Pharm. Bull.20:259 (1997)).
- galactose asialoglycoprotein
- target cells are prelabeled with biotinylated antibodies specific for a ligand expressed by the target cell (Harasym et al, Adv. Drug Deliv. Rev. 32:99 (1998)). After plasma elimination of free antibody, streptavidin- conjugated liposomes are administered. In another approach, targeting antibodies are directly attached to liposomes (Harasym et al, Adv. Drug Deliv. Rev. 32:99 (1998)).
- Polypeptides and antibodies can be encapsulated within liposomes using standard techniques of protein microencapsulation (see, for example, Anderson et al, Infect. Immun. 57:1099 (1981), Anderson et al, Cancer Res. 50:1853 (1990), and Cohen et al, Biochim. Biophys. Acta 1063:95 (1991), Alving et al "Preparation and Use of Liposomes in Immunological Studies," in Liposome Technology, 2nd Edition, Vol. Ill, Gregoriadis (ed.), page 317 (CRC Press 1993), Wassef et al, Meth. Enzymol 149:124 (1987)).
- therapeutically useful liposomes may contain a variety of components.
- liposomes may comprise lipid derivatives of poly(ethylene glycol) (Allen et al, Biochim. Biophys. Acta 1150:9 (1993)).
- Degradable polymer microspheres have been designed to maintain high systemic levels of therapeutic proteins. Microspheres are prepared from degradable polymers such as poly(lactide-co-glycolide) (PLG), polyanhydrides, poly (ortho esters), nonbiodegradable ethylvinyl acetate polymers, in which proteins are entrapped in the polymer (Gombotz and Pettit, Bioconjugate Chem.
- PLA poly(lactide-co-glycolide)
- PEG polyanhydrides
- poly (ortho esters) nonbiodegradable ethylvinyl acetate polymers
- the antibody fragments described herein, including scFvs, Fabs, diabodies, etc. can be fused to an entity to extend their half-life. See, for example, Kubetzko S. et al J Biol Chem 257:35186 (2006) [Modified pl85Her2 (Her2)-specif ⁇ c scFv 4D5 and measured binding affinity, functional affinity, tumor distribution, and PK. In tumor-bearing mice, 2OkD PEGylation of the scFv monomer and dimer extended serum half- life and tumor distribution.]; Yang K et al.
- HSA human serum albumin
- CEA carcinoembryonic antigen
- CD3 compared activity and pharmacokinetics.
- scFv2, scDb, and taFv (constructs shown in paper) fused to HSA retained full binding capacity and activity.
- Half-life in serum of the HSA constructs increased 5-11 -fold and the AUC increased 6-7-fold compared to their respective unmodified parent molecule]; and Kipriyanov SM et al. J MoI Biol 293:41 (1999).
- Anti- CD3/CD-19 tandem diabody molecule demonstrated to have higher affinity, slower dissociation, higher stability in serum, higher in vivo stability, and longer in vivo half-life as compared to a single chain Fv fragments and diabodies.
- the present invention also contemplates chemically modified polypeptides having binding IL- 17 and IL-23 activity such as anti-IL-17A and IL-23/pl9 antibodies, which a polypeptide is linked with a polymer, as discussed above.
- compositions may be supplied as a kit comprising a container that comprises an antibody of the invention.
- Antibodies of the invention can be provided in the form of an injectable solution for single or multiple doses, or as a sterile powder that will be reconstituted before injection.
- a kit can include a dry- powder disperser, liquid aerosol generator, or nebulizer for administration of a therapeutic polypeptide.
- Such a kit may further comprise written information on indications and usage of the pharmaceutical composition.
- such information may include a statement that the antibody composition is contraindicated in patients with known hypersensitivity to IL- 17 and IL- 23.
- a pharmaceutical composition comprising antibodies of the invention can be furnished in liquid form, in an aerosol, or in solid form.
- Liquid forms are illustrated by injectable solutions, aerosols, droplets, topological solutions and oral suspensions.
- Exemplary solid forms include capsules, tablets, and controlled-release forms. The latter form is illustrated by miniosmotic pumps and implants (Bremer et ah, Pharm. Biotechnol.
- Liposomes provide one means to deliver therapeutic polypeptides to a subject intravenously, intraperitoneally, intrathecally, intramuscularly, subcutaneously, or via oral administration, inhalation, or intranasal administration.
- Liposomes are microscopic vesicles that consist of one or more lipid bilayers surrounding aqueous compartments (see, generally, Bakker- Woudenberg et ah, Eur. J. Clin. Microbiol. Infect. Dis. 12 (Suppl.
- Liposomes are similar in composition to cellular membranes and as a result, liposomes can be administered safely and are biodegradable. Depending on the method of preparation, liposomes may be unilamellar or multilamellar, and liposomes can vary in size with diameters ranging from 0.02 ⁇ m to greater than 10 ⁇ m.
- a variety of agents can be encapsulated in liposomes: hydrophobic agents partition in the bilayers and hydrophilic agents partition within the inner aqueous space(s) (see, for example, Machy et ah, Liposomes In Cell Biology And Pharmacology (John Libbey 1987), and Ostro et ah, American J. Hosp. Pharm. 46:1576 (1989)). Moreover, it is possible to control the therapeutic availability of the encapsulated agent by varying liposome size, the number of bilayers, lipid composition, as well as the charge and surface characteristics of the liposomes. [273] Liposomes can adsorb to virtually any type of cell and then slowly release the encapsulated agent.
- an absorbed liposome may be endocytosed by cells that are phagocytic. Endocytosis is followed by intralysosomal degradation of liposomal lipids and release of the encapsulated agents (Scherphof et al, Ann. N.Y. Acad. Sci. 446:36% (1985)).
- small liposomes 0.1 to 1.0 ⁇ m
- liposomes larger than 3.0 ⁇ m are deposited in the lung. This preferential uptake of smaller liposomes by the cells of the reticuloendothelial system has been used to deliver chemotherapeutic agents to macrophages and to tumors of the liver.
- the reticuloendothelial system can be circumvented by several methods including saturation with large doses of liposome particles, or selective macrophage inactivation by pharmacological means (Claassen et al, Biochim. Biophys. Acta 802:42% (1984)).
- incorporation of glycolipid- or polyethelene glycol-derivatized phospholipids into liposome membranes has been shown to result in a significantly reduced uptake by the reticuloendothelial system (Allen et al., Biochim. Biophys. Acta 1068:133 (1991); Allen et al., Biochim. Biophys. Acta 1150:9 (1993)).
- Liposomes can also be prepared to target particular cells or organs by varying phospholipid composition or by inserting receptors or ligands into the liposomes.
- liposomes prepared with a high content of a nonionic surfactant, have been used to target the liver (Hayakawa et al, Japanese Patent 04-244,018; Kato et al, Biol. Pharm. Bull. 16:960 (1993)).
- These formulations were prepared by mixing soybean phospatidylcholine, ⁇ - tocopherol, and ethoxylated hydrogenated castor oil (HCO-60) in methanol, concentrating the mixture under vacuum, and then reconstituting the mixture with water.
- DPPC dipalmitoylphosphatidylcholine
- SG soybean-derived sterylglucoside mixture
- Cho cholesterol
- liposomes can be modified with branched type galactosyllipid derivatives to target asialoglycoprotein (galactose) receptors, which are exclusively expressed on the surface of liver cells (Kato and Sugiyama, Crit. Rev. Ther. Drug Carrier Syst. 74:287 (1997); Murahashi et al, Biol. Pharm. Bull. 20:259 (1997)).
- galactose asialoglycoprotein
- target cells are prelabeled with biotinylated antibodies specific for a ligand expressed by the target cell (Harasym et al., Adv. Drug Deliv. Rev. 32:99 (1998)). After plasma elimination of free antibody, streptavidin- conjugated liposomes are administered. In another approach, targeting antibodies are directly attached to liposomes (Harasym et al., Adv. Drug Deliv. Rev. 32:99 (1998)).
- the antibodies of the invention can be encapsulated within liposomes using standard techniques of protein microencapsulation (see, for example, Anderson et al., Infect. Immun. 57:1099 (1981), Anderson et al, Cancer Res. 50:1853 (1990), and Cohen et al, Biochim. Biophys. Acta 1063:95 (1991), Alving et al "Preparation and Use of Liposomes in Immunological Studies," in Liposome Technology, 2nd Edition, Vol. Ill, Gregoriadis (ed.), page 317 (CRC Press 1993), Wassef et al, Meth. Enzymol 149:124 (1987)).
- therapeutically useful liposomes may contain a variety of components.
- liposomes may comprise lipid derivatives of poly(ethylene glycol) (Allen et al, Biochim. Biophys. Acta 1150:9 (1993)).
- Degradable polymer microspheres have been designed to maintain high systemic levels of therapeutic proteins.
- Microspheres are prepared from degradable polymers such as poly(lactide-co-glycolide) (PLG), polyanhydrides, poly (ortho esters), nonbiodegradable ethylvinyl acetate polymers, in which proteins are entrapped in the polymer (Gombotz and Pettit, Bioconjugate Chem.
- Polyethylene glycol (PEG)-coated nanospheres can also provide carriers for intravenous administration of therapeutic proteins (see, for example, Gref et al, Pharm. Biotechnol 10:167 (1997)).
- Other dosage forms can be devised by those skilled in the art, as shown, for example, by Ansel and Popovich, Pharmaceutical Dosage Forms and Drug Delivery Systems, 5 Edition (Lea & Febiger 1990), Gennaro (ed.), Remington's Pharmaceutical Sciences, 19 th Edition (Mack Publishing Company 1995), and by Ranade and Hollinger, Drug Delivery Systems (CRC Press 1996).
- compositions can further comprise a carrier.
- the carrier can be a conventional organic or inorganic carrier. Examples of carriers include water, buffer solution, alcohol, propylene glycol, macrogol, sesame oil, corn oil, and the like.
- Baby Hamster Kidney (BHK) cells that had been transfected with expression vectors encoding human IL-17R (polynucleotide shown in SEQ ID NO:7; polypeptide shown in SEQ ID NO:8) were assessed for their ability to bind biotinylated human IL-17.
- Cells were harvested with versene, counted and diluted to 10 7 cells per ml in staining media (SM), which was HBSS plus 1 mg/ml bovine serum albumin (BSA), 10 mM Hepes, and 0.1% sodium azide (w/v).
- SM staining media
- BSA bovine serum albumin
- Biotinylated human IL-17 SEQ ID NO:2 were incubated with the cells on ice for 30 minutes at various concentrations.
- IL-17 was included in the binding reaction, as well as excess unlabeled IL-17B, IL-17C, IL-17D, IL- 17E and IL-23.
- the amount of unlabeled cytokine was varied over a range of concentrations and we find that addition of unlabeled human IL-17 competed for binding of human IL-17 to human IL-17R-transfected cell, indicating that human IL-17 specifically binds to human IL-17R; the other IL-17 family cytokines tested (B, C, D, E, and F) were not able to compete for binding, further supporting the specificity of IL-17 for IL- 17R and the use of this assay for testing antagonistic binding of IL-17 with an antibody.
- Binding studies were performed as discussed above, except that a range of concentrations of an antagonist of the present invention (i.e. an antibody) to human IL-17 was included in the binding reactions.
- an antagonist of the present invention i.e. an antibody
- Isotype-matched negative control antibodies and antibodies to IL-17 cytokine family members other than IL-17 were unable to block the binding of human IL- 17 to IL-17RA-transfected cells, indicating that the action of the anti-human IL- 17 antibody was specific for human IL- 17.
- Nih3t3 cells derived from mouse fibroblasts were plated at 5000 cells/well in solid white, cell culture coated 96 well plates, (Cat. #3917. Costar) using DMEM/10% FBS, containing glutamine and amended with pyruvate and cultured overnight at 37 0 C and 5% C02. On this second day, the plating media was removed and Kz 142 adenovirus particles at a multiplicity of infection of 5000 particles/cell were prepared in DMEM/1% FBS, containing glutamine and amended with pyruvate and cultured overnight at 37 0 C and 5% C02.
- First strand cDNA was prepared from total RNA isolated from nih3t3 cells using standard methods. PCR was applied using hot start polymerase and the manufacturer's recommendations (Qiagen, Valencia, CA) using sense primer, zc38520 (SEQ ID NO:9) and antisense primer, zc 38521(SEQ ID NO: 10) and 35 cycles of amplification. Agarose gel electrophoresis revealed a single, robust amplicon of the expected, 498 bp size.
- the murine nih3t3 cell line described above was stably trans fected with the kzl42 apl/nfkb reporter construct, containing a neomycin-selectable marker.
- the Neo resistant transfection pool was plated at clonal density. Clones were isolated using cloning rings and screened by luciferase assay using the human IL- 17 ligand as an inducer. Clones with the highest mean fluorescence intensity (MFI) (via apl/NfkB luciferase) and the lowest background were selected.
- MFI mean fluorescence intensity
- a stable transfectant cell line was selected and called nih3t3/kzl42.8.
- Antibodies or other IL- 17A neutralizing entities to human IL-17 were used as antagonists of human IL-17 activation of apl/nfkb elements in a luciferase assay.
- anti-human IL-17 antibodies or neutralizing entities inhibit EC50 levels of human IL-17- mediated apl/nfkb activation in the murine nih3t3/kzl42.8 assay cell line.
- the antibody completely neutralized activity induced by human IL-17, with the inhibition of activity decreasing in a dose dependent fashion at the lower concentrations.
- a purified anti-human IL- 17 antibody was added as a serial dilution, for example, at lO ⁇ g/ml, 5 ⁇ g/ml, 2.5 ⁇ g/ml, 1.25 ⁇ g/ml, 625ng/ml, 313ng/ml, 156ng/ml and 78ng/ml.
- the assay plates were incubated at 37°C, 5% CO2 for 4 days at which time Alamar Blue (Accumed, Chicago, IL) was added at 20 ⁇ l/well. Plates were again incubated at 37 0 C, 5% CO2 for 16 hours.
- This assay is able to demonstrate that the purified anti- human monoclonal antibody was able neutralize signaling of human IL- 17.
- the antibody completely neutralizes proliferation induced by human IL- 17, with the inhibition of proliferation decreasing in a dose dependent fashion at the lower concentrations.
- Microglia are macrophage-like cells that populate the central nervous system (CNS) and become activated upon injury or infection. Microglia have been implicated as playing critical roles in various CNS diseases including multiple sclerosis, and may be used to study mechanism(s) of initiation, progression, and therapy of the disease (Nagai et al. Neurobiol. Dis. 8:1057 (2001); Olson et al. J Neurosci Methods 128:33 (2003)).
- Immortalized human microglial cell lines and/or established human astroglia cell lines can, therefore, be used to study some of the effects of inflammatory mediators on these cell types and their potential for neutralization.
- Inflammatory mediators including but not limited to IL-Ib, IL- 6, IL-8, IL-12, IL-13, IL-15, IL-17 A and F, IL-18, IL-23, TNF-a, IFN-g, MIP family members, RANTES, IP-10, MCP-I, G- and GM-CSF, etc.
- cultured glial cells may be treated with one of the following: vehicle; rhIL-17; rhIL-23; or any of the compounds known to induce an inflammatory response by microglial and/or astroglia cells (e.g. LPS, other TLR agonists, inflammatory cytokines, etc.) In addition, these are treated with or without an antagonist of either IL-17 or IL-23, alone or in combination.
- vehicle e.g. LPS, other TLR agonists, inflammatory cytokines, etc.
- inflammatory mediators including those listed above.
- Levels of inflammatory cytokines and chemokines are elevated in the presence of rhIL-17 and/or IL-23 and/or other inflammatory stimulants compared to cultures treated with vehicle alone.
- antagonists to IL-17 and/or IL-23 activity such as the antibodies of the present invention markedly reduces the production and expression of inflammatory mediators, and thus, would expect to be efficacious in inflammatory aspects associated with human multiple sclerosis.
- EAE experimental autoimmune encephalomyelitis
- the typical pattern of disease symptoms in immunized, but otherwise untreated mice is one of weight loss and paralysis, followed by a period of disease symptom remission, and a subsequent relapse of disease symptoms.
- a pattern of relapses and remissions of disease symptoms ensues, which is also found in humans with this type of multiple sclerosis, known as relapsing-remitting disease.
- Chronic progressive and secondary progressive multiple sclerosis are also targeted indications for this therapeutic combination of IL- 17 and IL-23/pl9 neutralizing antibodies or a single neutralizing entity such as a bispecific antibody or scFV as described in this invention. These latter types of multiple sclerosis are tested in a similar manner using MOG35-55 peptide in C57BL/6 mice, instead of PLP in SJL mice.
- Neutralizing monoclonal antibodies to mouse IL- 17 and IL-23pl9 were administered separately or as a therapeutic combination, during remission from the first peak of EAE disease symptoms.
- the antibodies were delivered as intraperitoneal injections every other day, or as a similar dosing regimen. Groups receive either 25, 50 or 100 ⁇ g of each antibody, alone or as a therapeutic combination, per animal per dose, and control groups receive the vehicle control, PBS (Life Technologies, Rockville, MD) or antibody isotype control.
- 0 Normal; healthy.
- the delivery of the therapeutic combination was significantly more efficacious in reducing active disease and importantly, in preventing disease relapse, than the delivery of either monoclonal antibody alone at similar doses. This is a very important finding since disease relapse is a hallmark of this disease model and of relapsing- remitting MS in humans.
- the greatest overall reduction of inflammatory cell infiltrates in the CNS of mice were those treated with the therapeutic combination of neutralizing monoclonal antibodies to IL- 17 and IL23/pl9.
- mice treated with these therapeutic antibodies also resulted in significant reductions in serum IL-6, IL-13, IL-17A, IL-23, G-CSF, and TNF-a concentrations compared to PBS-treated mice.
- Samples were collected at the same time point following peak of first disease onset (day 27) and after the same number of antibody doses (11 doses). Draining lymph nodes were harvested from the mice at this same time point and cultured for 24 h with PLP139-151. Mice treated with the therapeutic antibody combination had a lower percentage of TNF-a containing draining lymph node cells compared to other groups of mice.
- the significant reductions in disease severity and disease relapse in the mice treated with the antibody combination were associated with reductions in CNS inflammatory infiltrates and inflammatory cytokine production, suggesting a mechanism of action for the observed efficacy.
- an IL-3 -dependent mouse cell line expressing human DCRS2 (IL-23R, SEQ ID NO: 22) was tested with recombinant mouse IL-23 in a proliferation assay to determine whether the human DCRS2 receptor along with endogenous Iy expressed mouse IL-12RBl can bind mouse IL-23 and cause cell signaling and proliferation.
- a second proliferation assay was run with mouse IL-23 and a monoclonal antibody to mouse IL-23/pl9 to determine its ability to specifically neutralize mouse IL-23/pl9.
- the BaF3 assay cell line was a previously utilized cell line and was chosen for use in these assays because it expresses human DCRS2.
- a previously utilized BaF3 cell line that does not express human DCRS2 was selected for use as a negative control.
- the assay cell line was constructed by sequentially placing an expression vector (pZP7Z) containing human WSXl and an expression vector (pZP7NX) containing human DCRS2 into BaF3 cells. These expression vectors and subsequent cell lines were built using the following steps.
- DCRS2 Class I cytokine receptor designated DCRS2 (SEQ ID NO:22) possessing a very short cytoplasmic domain such that it did not appear to be competent to signal if bound by its cognate ligand.
- a PCR, 3 'rapid amplification of cDNA ends (RACE) cloning strategy was initiated.
- cDNA template sources containing DCRS2 transcript a collection of cDNA libraries were screened by PCR using zc38188 (SEQ ID NO: 11 ) and zc38247 (SEQ ID NO: 12). These oligos were used in a PCR reaction at a concentration of 0.2 pmol per uL, with Advantage II thermostable DNA polymerase and buffer (Clontech, Palo Alto,CA), dNTPs at 0.125mM and 40ng per uL of cDNA library plasmid template.
- reaction products were analyzed by TAE, agarose gel elecrophoresis and ethidium bromide staining, and observed from the following cDNA libraries: human adrenal, human bone marrow, human activated CD3+ T cell, and human testis. These products were isolated, sequenced and confirmed to be DCRS2.
- the purified PCR products underwent a secondary amplification using PCR primers, zc 38248 (SEQ ID NO: 14), and zc 5020 (SEQ ID NO: 15) whose complimentary sequences lie within the expected DCRS2-plamid PCR product obtained with zc 38188 (SEQ ID NO:11) and zc 38247 (SEQ ID NO:12), and thus are so called "nested primers".
- the thermal cycling conditions of these reactions began with a hot start preincubation and continued with 30 cycles of 94 0 C , 30 seconds; 64 0 C, 20 seconds; 71 0 C, 70 seconds. Products were gel-purified and sequenced directly using the same amplifying primers.
- the sequence of zc38776 matches the 5' end of zc38188 but also includes a BamHl site and Kozak concensus sequence.
- the resulting PCR product was purified using a Qiaquick mini-elute kit (Qiagen, Valencia,CA) and prepared for cloning into a mammalian expression vector by digestion with BamHl and Xhol restriction enzymes for 90 minutes at 37 0 C.
- the mammalian expression vector pZP7NX was similarly digested with BamHl and Xhol to prepare it for acceptance of the full-length DCRS2 cDNA.
- BaF3 cells were prepared for electroporation by washing twice in RPMI medium (JRH Bioscience Inc., Lenexa, KS) and then resuspending in RPMI at a cell density of 10 7 cells/ml.
- RPMI medium JRH Bioscience Inc., Lenexa, KS
- resuspended BaF3 cells was mixed with 30 ⁇ g of the pZP7Z/h.WSXl plasmid DNA and transferred to separate disposable electroporation chambers (Gibco-BRL).
- the cells were then given 2 serial shocks (800 lFad/300V; 1180 lFad/300V.) delivered by an electroporation apparatus (CELL-PORATORTM; Gibco-BRL, Bethesda,MD).
- the electroporated cells were subsequently transferred to 20 mis of complete media and placed in an incubator for 24 hours (37°C, 5% CO 2 ). The cells were then spun down and resuspended in 20 mLs of complete media containing 240 ⁇ g/mL Zeocin (Invitrogen, Carlsbad,CA) selection in a T-75 flask to isolate the Zeocin resistant pool.
- the resulting stable cell line was called BaF3/WSXl.
- BaF3/WSXl cells were prepared for electroporation by washing twice in RPMI medium (JRH Bioscience Inc., Lenexa, KS) and then resuspending in RPMI at a cell density of 10 7 cells/mL.
- RPMI medium JRH Bioscience Inc., Lenexa, KS
- resuspended BaF3 cells was mixed with 30 ⁇ g of the pZP7NX_DCRS2 plasmid DNA and transferred to separate disposable electroporation chambers (Gibco-BRL).
- the cells were then given 2 serial shocks (800 lFad/300V; 1180 lFad/300V.) delivered by an electroporation apparatus (CELL-PORATORTM; Gibco-BRL, Bethesda,MD).
- the electroporated cells were subsequently transferred to 20 mis of complete media containing 240 ⁇ g/mL Zeocin (Invitrogen, Carlsbad,CA) and placed in an incubator for 24 hours (37 0 C, 5% CO 2 ).
- the cells were then spun down and resuspended in 20 mLs of complete media containing Ix G418 (Gibco- BRL, Bethesda,MD) and 240 ⁇ g/mL Zeocin (Invitrogen, Carlsbad,CA) selection in a T-75 flask to isolate the G418 resistant pool.
- the resulting stable cell line was called BaF3 WSX1/DCRS2.
- the negative control cell line, BaF3/KZ134 was constructed using the following steps.
- the KZ 134 plasmid was constructed with complementary oligonucleotides ZC 12749 (SEQ ID NO:20) and ZC 12748 (SEQ ID NO:21) that contain STAT transcription factor binding elements from 4 genes, which includes a modified c-fos Sis inducible element (m67SIE, or hSIE) (Sadowski, et al, Science 261: 1739 (1993)) the p21 SIEl from the p21 WAFl gene (Chin et al,
- oligonucleotides contain Asp718- Xhol compatible ends and were ligated, using standard methods, into a recipient firefly luciferase reporter vector with a c-fos promoter (Poulsen et al, J. Biol. Chem.
- the KZ 134 plasmid was used to stably transfect BaF3 cells, using standard transfection and selection methods, to make the BaF3/KZ134 cell line.
- Samples were plated into 96-well flat-bottomed plates (Bectin-Dickinson, Franklin Lakes, NJ) in a volume of 100 ⁇ L. The cells were washed 3 times in IL-3 free media and counted using a hemocytometer. Cells were resuspended in IL-3 -free media and plated at a concentration of 5000 cells per well in 100 ⁇ L into the plate containing the samples for total well volume of 200 ⁇ L. The assay plates are incubated at 37°C, 5% CO 2 for 3 days at which time Alamar Blue (Accumed, Chicago, IL) is added at 20 ⁇ L/well.
- Alamar Blue gives a fluorometric readout based on number of live cells, and thus is a direct measurement of cell proliferation in comparison to a negative control. Plates are again incubated at 37°C, 5% CO 2 for 24 hours. Plates are read on the Wallac 1420 microplate reader (PerkinElmer Life Sciences, Boston, MA) at wavelengths 544 (Excitation), and 590 (Emission).
- Results show that both human and mouse IL-23 cause similar proliferative responses on the BaF3 WSX1/DCRS2 cell line.
- Human and mouse IL-23 were negative on the BaF3/KZ134 cell line, which shows that the response is limited to the presence of DCRS2 expression.
- a second BaF3 cell line expressing human DCRS2 was also tested and was found to proliferate in response to human and mouse IL-23, similar to the BaF3 WSX1/DCRS2 cell line.
- Mouse IL-23 was added to each well containing either the anti-mouse IL-23/pl9 antibody or mouse CDl 15 antibody for a final concentration of 1.5 ng/mL mouse IL-23. Wells without antibody were also set up with mouse IL-23 at 1.5 ng/mL, which is approximately 80% of the maximum IL-23 response.
- a positive control of mouse IL-3 was run at concentrations of 20, 10, 5, 2.5, 1.25, 0.6, 0.3, and 0.15 pg/mL. Negative controls were run in parallel using mouse IL-3-free media only. Samples were plated into 96-well flat-bottomed plates (Bectin-Dickinson, Franklin Lakes, NJ) in a volume of 100 ⁇ L.
- the cells were washed 3 times in IL-3-free media and counted using a hemocytometer. Cells were resuspended in IL-3-free media and plated at a concentration of 5000 cells per well in 100 ⁇ L into the plate containing the samples for a final well volume of 200 ⁇ L.
- the assay plates were incubated at 37°C, 5% CO 2 for 3 days at which time Alamar Blue (Accumed, Chicago, IL) was added at 20 ⁇ L /well. Alamar Blue gives a fluorometric readout based on number of live cells, and thus is a direct measurement of cell proliferation in comparison to a negative control. Plates were again incubated at 37°C, 5% CO 2 for 24 hours. Plates were read on the Wallac 1420 microplate reader (PerkinElmer Life Sciences, Boston, MA) at wavelengths 544 (Excitation), and 590 (Emission).
- the BaF3 assay cell line was a previously utilized cell line and was chosen for use in these assays because it expresses human DCRS2.
- a previously utilized BaF3 cell line that does not express human DCRS2 was selected for use as a negative control.
- the assay cell line was constructed by sequentially placing an expression vector (pZP7Z) containing human WSXl and an expression vector (pZP7NX) containing human DCRS2 into BaF3 cells. These expression vectors and subsequent cell lines were built using the steps outlined in Example 9.
- the negative control cell line, BaF3/KZ134 was constructed using the steps outlined in Example 9.
- Another proliferation assay was run to test the ability of an antibody to neutralize human IL-23, via IL-23/pl9.
- Recombinant human IL-23 concentrations of 10, 5, 2.5, 1.25, 0.6, 0.3, 0.15, and 0.08 ng/niL were run.
- a range of recombinant human IL- 12 concentrations up to 200 ng/mL was also tested.
- Concentrations of the anti-human IL-23/pl9 antibody were run at 10, 5, 2.5, 1.25, 0.6, 0.3, 0.15, and 0.08 ug/mL, and a negative control antibody was also run at the same dilutions as the anti-human IL-23/pl9 antibody.
- Human IL-23 was added to each well containing either the anti-human IL-23/pl9 antibody or negative control antibody for a final concentration of 1.5 ng/mL human IL-23.
- Wells without antibody were also set up with human IL-23 at 1.5 ng/mL, which is approximately 80% of the maximum IL-23 response.
- a positive control of human IL-3 was run at concentrations of 20, 10, 5, 2.5, 1.25, 0.6, 0.3, and 0.15 pg/mL. Negative controls were run in parallel using human IL-3-free media only. Samples were plated into 96-well flat-bottomed plates (Bectin-Dickinson, Franklin Lakes, NJ) in a volume of 100 ⁇ L.
- the cells were washed 3 times in IL-3-free media and counted using a hemocytometer. Cells were resuspended in IL-3-free media and plated at a concentration of 5000 cells per well in 100 ⁇ L into the plate containing the samples for a final well volume of 200 ⁇ L.
- the assay plates were incubated at 37°C, 5% CO 2 for 3 days at which time Alamar Blue (Accumed, Chicago, IL) was added at 20 ⁇ L /well. Alamar Blue gives a fluorometric readout based on number of live cells, and thus is a direct measurement of cell proliferation in comparison to a negative control. Plates were again incubated at 37°C, 5% CO 2 for 24 hours. Plates were read on the Wallac 1420 microplate reader (PerkinElmer Life Sciences, Boston, MA) at wavelengths 544 (Excitation), and 590 (Emission).
- Murine IL23/pl9 and IL- 17 niRNAs are Regulated in Select Tissues in a Murine Model of Experimental Allergic Encephalomyelitis (EAE) Compared to Non-Diseased Controls
- Tissues were obtained from mice at the peak of disease onset in the PLP EAE model.
- the model was performed following standard procedures of immunizing female SJL mice with PLP139-151, as described in Example 8 above, in the presence or absence of pertussis toxin, and included appropriate unimmunized, non-diseased controls.
- Tissues that were collected included brain, spinal cord and cervical lymph nodes.
- RNA was isolated from all tissues using standard procedures. In brief, tissues were collected and immediately frozen in liquid N2 and then transferred to -80 0 C until processing. For processing, tissues were placed in Qiazol reagent (Qiagen, Valencia, CA) and RNA was isolated using the Qiagen Rneasy kit according to manufacturer's recommendations.
- IL23/pl9 and IL- 17 mRNAs were measured with multiplex real-time quantitative RT-PCR method (TaqMan) and the ABI PRISM 7900 sequence detection system (PE Applied Biosystems). IL23/pl9 and IL- 17 mRNA levels were normalized to the expression of the murine hypoxanthine guanine physphoribosyl transferase mRNA and determined by the comparative threshold cycle method (User Bulletin 2; PE Applied Biosystems).
- the primers and probe for murine IL23/pl9 included forward primer 5' gcctgagttctagtcagcagtg, reverse primer 5' tggaggcttcgaaggatct, and probe cagcgcccccttctccgttcc.
- the primers and probe for murine IL- 17 included forward primer 5' gctccagaaggccctcaga, reverse primer 5' agctttccctcgcattga, and probe ctctccaccgcaatgaagaccctga. The results were as follows:
- Murine IL23/pl9 mRNA expression was detected in all tissues tested including brain, spinal cord and cervical lymph nodes;
- Murine IL- 17 mRNA expression was detected at very low levels in the lymph nodes and below the level of detection in the brain and spinal cord of unimmunized, control mice;
- Murine IL- 17 mRNA levels were increased approximately 104-fold in the brain tissue of mice immunized with PLP compared to unimmunized controls;
- Murine IL-17 mRNA levels were increased approximately 695-fold in the spinal cord of mice immunized with PLP compared to unimmunized controls;
- Murine IL-17 mRNA levels were increased approximately 1.9-fold in the cervical lymph nodes of mice immunized with PLP compared to unimmunized controls.
- IL-17 and IL-23/pl9 are Overexpressed in Tissues From Mice With Collagen Induced Arthritis (CIA) Compared to Tissue From Non-diseased Mice
- Tissues were obtained from mice with varying degrees of disease in the collagen- induced arthritis (CIA) model.
- the model was performed following standard procedures of immunizing male DBA/1J mice with collagen in complete Freund's adjuvant (CFA) in the tail, followed 3 weeks later by similar immunizations, but with collagen in incomplete Freund's adjuvant (IFA).
- CFA complete Freund's adjuvant
- IFA incomplete Freund's adjuvant
- Non-diseased age- and gender-matched DBA/1J mice were also included for comparison.
- Tissues isolated included affected paws.
- RNA was isolated from the tissues using standard procedures. In brief, tissues were collected and immediately frozen in liquid N2 and then transferred to -8O 0 C until processing.
- Expression of murine IL- 17 and IL-23/pl9 mRNA was measured with multiplex real-time quantitative RT-PCR methods (TaqMan) and the ABI PRISM 7900 sequence detection system (PE Applied Biosystems).
- Murine IL- 17 and IL-23/pl9 mRNA levels were normalized to the expression of murine hypoxanthine guanine physphoribosyl transferase mRNA and determined by the comparative threshold cycle method (User Bulletin 2: PE Applied Biosystems).
- the primers and probe for murine IL- 17 and IL-23/pl9 were the same as described in Example 11.
- Murine IL-17 and IL-23/pl9 mRNA expression was detected in the tissues tested. Both IL-17 and IL-23/pl9 mRNA were increased in the paws from mice in the CIA model of arthritis compared to tissues obtained from non-diseased controls. Murine IL-17 mRNA was increased in the paws approximately 8-fold in mice with more mild disease and approximately 9.3-fold in mice with more severe disease compared to non-diseased controls. Murine IL-23/pl9 mRNA was increased in the paws approximately 2.4 -fold in mice with more mild disease and approximately 2.1 -fold in mice with more severe disease compared to non-diseased controls.
- IL-17 and IL-23/pl9 are Overexpressed in Tissues From Mice With DSS-Induced Colitis Compared to Tissue From Non-diseased Mice
- Tissues were obtained from mice in the dextran sodium sulfate (DSS) model of colitis. The model was performed following standard procedures of administering 1.5 - 2.5 % DSS in the drinking water of female C57BL/6 mice for 5 - 7 days (acute protocol), followed by cycles of regular water and DSS water (chronic protocol). Non-diseased age- and gender- matched C57BL/6 mice were also included for comparison. Tissues isolated included the descending colon and proximal colon. RNA was isolated from the tissues using standard procedures. In brief, tissues were collected and immediately frozen in liquid N2 and then transferred to -8O 0 C until processing.
- DSS dextran sodium sulfate
- Expression of murine IL- 17 and IL-23/pl9 mRNA was measured with multiplex real-time quantitative RT-PCR methods (TaqMan) and the ABI PRISM 7900 sequence detection system (PE Applied Biosystems).
- Murine IL- 17 and IL-23/pl9 mRNA levels were normalized to the expression of murine hypoxanthine guanine physphoribosyl transferase mRNA and determined by the comparative threshold cycle method (User Bulletin 2: PE Applied Biosystems).
- the primers and probe for murine IL- 17 and IL-23/pl9 were the same as described in Example 11.
- Murine IL- 17 and IL-23/pl9 mRNA expression was detected in the tissues tested. Both IL- 17 and IL-23/pl9 mRNA were increased in the descending and proximal colon from mice in the acute and chronic DSS colitis model, compared to tissues obtained from non-diseased controls. Murine IL- 17 mRNA was increased approximately 50-fold in the descending colon and approximately 180-fold in the proximal colon of mice treated acutely with DSS compared to non-diseased controls. With chronic DSS treatment, IL- 17 mRNA levels were approximately 21- and 22-fold higher in the descending and proximal colon, respectively, compared to non- diseased controls.
- Murine IL-23/pl9 mRNA was increased approximately 2-fold in the descending colon and approximately 4.4-fold in the proximal colon of mice treated acutely with DSS compared to non-diseased controls. With chronic DSS treatment, IL-23/pl9 mRNA levels were approximately 1.5- and 2-fold higher in the descending and proximal colon, respectively, compared to non-diseased controls. Because there are significantly higher levels of both IL- 17 and IL-23/pl9 in the colons of mice (i.e. as measured in the same mice) with DSS colitis, this further supports the need to antagonize both of these cytokines in inflammatory bowel disease.
- rhIL-223 Recombinant human IL-23 (rhIL-23) induced the production of IL-17A and IL- 17F in murine splenocytes.
- antagonists to IL-23 we examined the neutralization of IL- 17A and IL- 17F production in rhIL-23 treated murine splenocytes.
- Antagonists to rhIL-23 are compared to the commercial neutralizing antibody anti-IL-12p40 (Pharmingen, Franklin Lakes, NJ).
- a single cell suspension of splenocytes were prepared from whole spleens harvested from either C57BL/6 or BALB/c mice. After red blood cell lysis with ACK buffer (0.010 M KHCO3, 0.0001 M EDTA, 0.150 M NH4C1), splenocytes were washed and resuspended in RPMI buffer (containing 1% non-essential amino acids, 1% Sodium Pyruvate, 2.5 mM HEPES, 1% L-glutamine, 0.00035% 2-mercaptoethanol, 1% Pen/Strep, 10% FCS and 50 ng/ml human IL-2 (R&D Systems, Minneapolis, MN)).
- ACK buffer 0.010 M KHCO3, 0.0001 M EDTA, 0.150 M NH4C1
- splenocytes were washed and resuspended in RPMI buffer (containing 1% non-essential amino acids, 1% Sodium Pyruvate, 2.5 mM HEPES,
- rhIL-23 at a concentration of 10 pM was pre-incubated for 30 - 90 minutes at 37 0 C with 3 -fold serial dilutions of the antagonists listed in Table 7. Concentrations of the antagonists range from 0 - 343 nM.
- the IL-23 ligand plus antagonists were then added to the splenocytes and incubated at 37° C, 5% CO2 for 24-72 hours. The supernatants were collected and frozen at -8O 0 C until ready to process.
- IL- 17A and IL- 17F protein in the supernatants were measured using bead-based sandwich ELISAs.
- a commercial kit (Upstate, Charlottesville, VA) was used to measure IL- 17A protein.
- a bead-based ELISA developed in-house using an antibody to IL- 17F (R&D) conjugated to a bead was used to measure IL-17F.
- IC50 values for each antagonist were calculated as the amount of antagonist needed to neutralize 50% of the activity of rhIL-23.
- Table 7 IC50 values measured in the murine splenocyte assay.
- TMB 50 ul of TMB (TMBW-1000-01, BioFX Laboratories) was added to each well to develop for 20 - 30 min, followed by the addition of 50 ul of stop buffer (STPR- 1000-01, BioFX Laboratories) to quench the reaction. Plates were then read at 450nm on a plate reader. Wells that showed greater binding on the plate coated with IL- 17A than on the plate coated with IL- 17F were chosen for further analysis and manipulation.
- IL- 12 (#219-IL/CF, R&D Systems) at 4 ug/ml in 0.1M NaHCO 3 , pH 9.6, overnight at 4 0 C.
- PBST 0.1% Tween-20/PBS
- Each well was filled with 350 ul of 2% milk (#170-6404, Bio-Rad)/PBST for one hour at RT for blocking.
- Assay plates were then washed three times with PBST.
- Each well was filled with 50 ul of 2% milk/PBST, followed by the addition of 25 ul of Fab or scFv supernatant. Well were mixed and then incubated for one hour at RT. Plates were washed three times with PBST.
- Fab detection 50 ul of (1 :4000) anti-Human Fab specific pAb-HRP (#31482, Pierce) in 2% milk/PBST was added to each well for one hour at RT.
- Each well was filled with 350 ul of 2% milk (#170-6404, Bio-Rad)/PBST for one hour at RT for blocking.
- 2% milk #170-6404, Bio-Rad
- PBST 2% milk
- adjacent plates were set up for preincubation of biotinylated IL- 17A with Fab or scFv supernatant.
- Pre-incubation plates were filled with 75 ul of Fab supernatant, followed by the addition of 25 ul of IL-17A (made in-house) at 0.10 ug/ml in 4% milk/PBST.
- Each well was mixed and then incubated for 30min at RT.
- Assay plates were then washed three times with PBST, and the volume of the supernatant/IL-17A complex transferred from the pre-incubation plate to the assay plate, followed by a one -hour incubation at RT. Plates were then washed three times with PBST. 50 ul of (1 :3000) Streptavidin-HRP (#21124, Pierce) in PBST added to each well to incubate for one hour. Plates then washed three times with PBST. 50 ul of TMB (TMBW-1000-01, BioFX Laboratories) added to each well to develop for 20 - 30 min, followed by the addition of 50 ul of stop buffer (STPR-1000-01, BioFX Laboratories) to quench the reaction. Plates were then read at 450nm on a plate reader.
- TMB TMB
- STPR-1000-01, BioFX Laboratories stop buffer
- Each well was filled with 350 ul of 2% milk (#170-6404, Bio-Rad)/PBST for one hour at RT for blocking.
- 2% milk #170-6404, Bio-Rad
- PBST 2% milk
- adjacent plates were set up for preincubation of biotinylated IL-23 with Fab or scFv supernatant.
- Pre -incubation plates were filled with 75 ul of Fab or scFv supernatant, followed by the addition of 25 ul of IL-23 heterodimer or pl9 (made in-house) at 0.10 ug/ml in 4% milk/PBST.
- Each well was mixed and then incubated for 30min at RT.
- Assay plates were then washed three times with PBST, and the volume of the supernatant/IL-23 complex transferred from the pre-incubation plate to the assay plate, followed by a one -hour incubation at RT. Plates were then washed three times with PBST. 50 ul of (1 :3000) Streptavidin-HRP (#21124, Pierce) in PBST added to each well to incubate for one hour. Plates were then washed three times with PBST.
- TMB TMB
- stop buffer 50 ul of TMB (TMBW-1000-01, BioFX Laboratories)
- IL-17 and IL-23/pl9 are Overexpressed in Tissues From Mouse Model of T-cell Adoptive Transfer Colitis Compared to Tissue From Non-diseased Mice
- T-cell Adoptive Transfer Colitis Model [340] Adoptive transfer of naive T cells into minor histocompatibility mismatched or syngeneic immunocompromised mice leads to development of colitis (Leach MW et al 1996, Powrie F et al, 1997) as well as skin lesions resembling psoriasis (Schon MP et al 1997, Davenport CM et al 2002). Transplantation of as low as 0.2 million CD4+CD25- T cells from Balb/C mice into immunocompromised C.B-17 SCID mice results in weight loss, hemoccult positive stool and development of skin lesions (the symptoms in these mice vary from colony to colony). These symptoms normally arise in mice between 7-10 weeks after transplantation.
- mice (10 Balb/C females, 20 CB 17 SCID female) were obtained from CRL. Mice were on tap water starting on day -6. Spleens from 10 Balb/C mice will be collected. CD4+ CD25- T-cell will be collected from pooled spleen (see below for methods). CB 17 SCID mice will receive either 5xlO ⁇ 5 or 7.5xlO ⁇ 5 CD4+ CD25- T-cells from spleen via i.v. injection. All mice are weighed 3x week and carefully observed for weight loss.
- DAI Disease Activity Index
- mice will receive 5x105 CD4+ CD25- T-cells from spleen via i.v. injection.
- mice are treated with 20ug of LPS (from salmonella) and IOng of rm IL-12 in lOOul i.p. injection. All mice are weighed 3x week and carefully observed for weight loss. When ear thickening is observed, ear thickness are measured 3x week. Mice are carefully monitored for signs of psoriasis (hair loss, scratching, alopecia, etc).
- Treatment groups were as follows: Colitis: (Group I) received 0.5 mil CD4+ CD25 cells, with a N of 6 and (Group II) received 0.75 mil CD4+ CD25 cells, with a N of 6. Psoriasis (Group III) received 0.5 mil CD4+ CD25 cells, with a N of 4.
- CD4+ CD25- T-cell isolation Balb/C mice are sacrificed by CO2 asphyxiation and spleens are removed and single cell suspensions made. CD4 T cells are enriched by using a sterile magnetic enrichment protocol. CD4+CD25-T cells are further enriched using a sterile magnetic enrichment protocol or by sorting using a cell sorter. Purity of T-cells are evaluated by flow.
- Tissues were obtained from mice after onset of disease in a murine model of T- cell adoptive transfer colitis. The model was performed following standard procedures of adoptive transfer of naive T cells into minor histocompatibility mismatched or syngeneic immunocompromised mice and included appropriate immunocompromised, non-diseased controls. Tissues that were collected included the distal part of small intestine, proximal colon, distal colon and mesenteric lymph node. RNA was isolated from all tissues using standard procedures. In brief, tissues were collected and immediately frozen in liquid N2 and then transferred to -800C until processing.
- mice with colitis had levels of IL- 17A mRNA that were approximately 9000-fold greater than levels from control mice (no colitis).
- mice with colitis had levels of IL-17A mRNA that were approximately 18, 900-fold greater than levels from control mice (no colitis).
- mice with colitis had levels of IL-17 A mRNA that were approximately 990-fold greater than levels from control mice (no colitis).
- mice with colitis had levels of IL- 17A mRNA that were approximately 175-fold greater than levels from control mice (no colitis).
- mice with colitis had levels of IL- 17F mRNA that were approximately 3.8-fold greater than levels from control mice (no colitis).
- mice with colitis had levels of IL-17F mRNA that were approximately 7.4-fold greater than levels from control mice (no colitis).
- mice with colitis had levels of IL-17F mRNA that were approximately 4.8-fold greater than levels from control mice (no colitis).
- mice with colitis had levels of IL- 17F mRNA that were approximately 213-fold greater than levels from control mice (no colitis).
- mice with colitis had levels of IL-23pl9 mRNA that were approximately 2-fold greater than levels from control mice (no colitis).
- mice with colitis had levels of IL- 17A mRNA that were approximately 1.5 -fold greater than levels from control mice (no colitis).
- Dysregulated or sustained immune-mediated inflammation may contribute to the symptoms and pathology associated with IBD by way of tissue damage or permanent skewing to inappropriate or prolonged immune responses.
- This model can determine the potential down- stream consequences of exposure of disease-associated T cells and monocytes to IL- 17A and IL- 23 which may be present in the immediate environmental cytokine mileu of the intestinal tissue.
- Therapeutics that would be efficacious in human IBD in vivo would work in ex vivo models by inhibiting and/or neutralizing the production and/or presence of inflammatory mediators (including but not limited to IL-Ib, IL-4, IL-5, IL-6, IL-8, IL-12, IL-13, IL-15, IL-17 A and F, IL-18, IL-23, TNF-a, IFN-g, MIP family members, MCP-I, G- and GM-CSF, etc.).
- inflammatory mediators including but not limited to IL-Ib, IL-4, IL-5, IL-6, IL-8, IL-12, IL-13, IL-15, IL-17 A and F, IL-18, IL-23, TNF-a, IFN-g, MIP family members, MCP-I, G- and GM-CSF, etc.
- T cells and monocytes/macrophages are isolated from intestinal biopsy samples by carefully mincing biopsies with scissors in HBSS, treating with collagense and Dispase II and incubating for 1 hr at 37oC in a shaker. The cell suspension is filtered through nylon mesh to remove debris and cell clumps and washed multiple times in HBSS. T cells and macrophage/monocytes can be isolated using direct cell sorting or bead- depletion/enrichment protocols. Isolated cells are incubated in the presence of IL-17A and IL- 23. This induces the production of inflammatory mediators by T cells and monocytes/macrophages or results in skewing subsequent T cell responses to highly proinflammatory responses.
- the addition of antibodies to IL- 17A and IL-23pl9 to neutralize the production of downstream inflammatory mediators may be efficacious in the therapeutic treatment of patients with IBD.
- the neonatal psychosocial stress model mimics some clinical features associated with IBS patients including visceral hyperalgesia, diarrhea and stress-sensitivity.
- Daily separation of the litter from their mothers for 180 minutes each day during postnatal days 4-18 will result in an alteration of maternal behaviour and significantly reduce times of the licking/grooming behaviour.
- the stress on the neonates results in permanent changes in the CNS resulting in altered stress-induced visceral and somatic pain sensitivity.
- Colonic motor function in response to stress is enhanced in these animals and preliminary data shows evidence of increased intestinal permeability (Mayer et al., Eur. J. surg. Suppl.
- IBS Irritable Bowl Syndrome
- NIH-3T3/KZ142.8/huIL-17RCx4 transfected cell line was generated as described in WO 2005/123778, filed June 10, 2005.
- NIH-3T3/KZ142.8/huIL- 17RCx4 cells were plated out at 7,500 cells/well in growth media (DMEM with L-Glutamine plus 5% fetal bovine serum, 1% Sodium Pyruvate, l ⁇ M MTX) in 96-well, flat-bottom tissue culture plates.
- growth media DMEM with L-Glutamine plus 0.1% BSA and 1OmM HEPES.
- EC 50 or EC 90 , effective concentration at 50 and 90 percent, respectively) of IL- 17A was combined with serial dilutions of the human IL- 17RA-Fc soluble receptor (ZGI), anti-human IL- 17A monoclonal antibody (R&D, MAB317), and anti-human IL- 17A polyclonal antibody (R&D, AF317NA) and incubated together at 37 0 C for 30 minutes in assay media prior to addition to cells. Following pre-incubation, treatments were added to the plates containing the cells and incubated together at 37 0 C for 10 minutes.
- ZGI human IL- 17RA-Fc soluble receptor
- R&D anti-human IL- 17A monoclonal antibody
- R&D anti-human IL- 17A polyclonal antibody
- Capture beads (BIO-PLEX Phospho-I ⁇ - ⁇ Assay, BIO-RAD Laboratories) were combined with 50 ⁇ L of 1 :1 diluted lysates and added to a 96-well filter plate according to manufacture's instructions (BIO-PLEX Phosphoprotein Detection Kit, BIO-RAD Laboratories). The aluminum foil-covered plate was incubated overnight at room temperature, with shaking at 300 rpm. The plate was transferred to a microtiter vacuum apparatus and washed three times with wash buffer. After addition of 25 ⁇ L/well detection antibody, the foil-covered plate was incubated at room temperature for 30 minutes with shaking at 300 rpm. The plate was filtered and washed three times with wash buffer.
- Streptavidin-PE 50 ⁇ L/well was added, and the foil- covered plate was incubated at room temperature for 15 minutes with shaking at 300 rpm. The plate was filtered and washed two times with bead resuspension buffer. After the final wash, beads were resuspended in 125 ⁇ L/well of bead suspension buffer, shaken for 30 seconds, and read on an array reader (BIO-PLEX, BIO-RAD Laboratories) according to the manufacture's instructions. Data were analyzed using analytical software (BIO-PLEX MANAGER 3.0, BIO- RAD Laboratories).
- IL- 17A induced I ⁇ - ⁇ phosphorylation in a dose dependent manner with an EC 90 concentration determined to be 0.25nM for both forms of the ligand.
- IL- 17A was neutralized by the anti-human IL- 17A polyclonal antibody at a 1 :1 molar ratio, by the human IL- 17RA-Fc soluble receptor at a 7:1 molar ratio, and by the anti-human IL- 17A monoclonal antibody at a 50:1 molar ratio.
- TABLE 8 shows IC50 values of representative IL- 17A neutralizing entities described herein, as compared to the IL- 17RA-Fc and IL- 17A polyclonal antibody controls. Results demonstrate that the IL- 17A clones were effective at reducing the signals induced by human IL- 17A.
- Baf3/KZ134/huIL-23R/huIL-12R ⁇ l Clone 6 transfected cell line was generated as described herein.
- Baf3/KZ134/huIL-23R/huIL-12RBl Clone 6 cells were washed two times with assay media (RPMI 1640 with L-Glutamine plus 10% fetal bovine serum, 1% Sodium Pyruvate, and 2uM ⁇ -Mercaptoethanol) before being plated out at 30,000 cells/well in 96-well, round-bottom tissue culture plates.
- EC50 effective concentration at 50 percent
- EC50 effective concentration at 50 percent
- Pharmingen anti-human IL- 12 p40 monoclonal antibody
- R&D anti-human IL-23 pl9 polyclonal antibody
- ZGI human IL-23R-Fc Soluble Receptor
- Capture beads (BIO-PLEX Phospho-STAT3 Assay, BIO-RAD Laboratories) were combined with 50 ⁇ L of 1 :1 diluted lysates and added to a 96-well filter plate according to manufacture's instructions (BIO-PLEX Phosphoprotein Detection Kit, BIO-RAD Laboratories). The aluminum foil-covered plate was incubated overnight at room temperature, with shaking at 300 rpm. The plate was transferred to a microtiter vacuum apparatus and washed three times with wash buffer. After addition of 25 ⁇ L/well detection antibody, the foil-covered plate was incubated at room temperature for 30 minutes with shaking at 300 rpm. The plate was filtered and washed three times with wash buffer.
- Streptavidin-PE 50 ⁇ L/well was added, and the foil- covered plate was incubated at room temperature for 15 minutes with shaking at 300 rpm. The plate was filtered and washed two times with bead resuspension buffer. After the final wash, beads were resuspended in 125 ⁇ L/well of bead suspension buffer, shaken for 30 seconds, and read on an array reader (BIO-PLEX, BIO-RAD Laboratories) according to the manufacture's instructions. Data were analyzed using analytical software (BIO-PLEX MANAGER 3.0, BIO- RAD Laboratories). Increases in the level of the phosphorylated STAT3 transcription factor present in the lysates were indicative of an IL-23 receptor-ligand interaction.
- IL-23 induced STAT3 phosphorylation in a dose dependent manner with an EC50 concentration determined to be 20 pM for ZGI A1806F and 30 pM for eBioscience heterodimer.
- Table 9 presents example IC50 data for the IL-23 positive controls (IL-23 pl9 poly Ab and IL- 23R-Fc) and IL-23 neutralizing entities described herein. These data indicate that the IL-23 neutralizing entities were efficacious and were equally or better at reducing the effects of IL-23 as the controls.
- CnIL-17A was cloned by PCR using a high fidelity thermostable polymerase. (Expand, Roche Applied Science, Indianapolis, IN) Based on available sequence information from the UCSC Genome Browser for chimp and human IL-17A, oligonucleotides 56837 (SEQ ID NO: 27) and 56838 (SEQ ID NO: 28) were designed to amplify the cynomologus gene open reading frame. An oligo dT primer was used to initiate cDNA synthesis from total RNA purified from PMA and Ionomycin stimulated cynomologus monkey PBMCs using SuperscriptII Reverse Transcriptase following the manufacturers recommendations (Invitrogen corp.
- PBMCs were isolated from whole blood obtained from a 13 year old male M. fascularis animal and stimulated for 4 hours in 10ng/ml PMA and 0.5ug/ml Ionomycin.
- Total RNA isolated using RNeasy mini kit (Qiagen, Inc. Valencia, CA) following the manufacturers recommendations. Due to the lack of sequence information for the cynomologus monkey, a number PCR products were cloned into PCR4 TO (Invitrogen corp. Carlsbad, CA) for sequence comparisons. A nucleotide consensus sequence was obtained from 12 clones and is shown in SEQ ID NO: 29.
- CnIL-23pl9 was cloned by PCR using a high fidelity thermostable polymerase. (Expand, Roche Applied Science, Indianapolis, IN) Based on available sequence information from the UCSC Genome Browser for chimp and human IL-23pl9, oligonucleotides 56846 (SEQ ID NO: 1016) and 56855 (SEQ ID NO: 1017) were designed to amplify the cynomologus gene. An oligo dT primer was used to initiate cDNA synthesis from total RNA purified from LPS, ploy IC, TNF and CD40 lig.
- PBMCs peripheral blood cells
- CD 14 non-human primate microbeads Miltneyi Biotec, Bergisch Gremany
- CD14+ cells were differentiated for 4 days with 10ng/ml each hGMCSF and hIL-4 then stimulated for 4 hours with 1 ug/ml LPS, 25ug/ml polylC, 20ng/ml TNF andlOug/ml CD40 lig.
- Leukopheresis PBMC To obtain a consistent pool of PBMCs, normal human donors were voluntarily apheresed. The leukopheresis PBMC were poured into a sterile 500 ml plastic bottle, diluted to 400 ml with room temperature PBS + 1 mM EDTA and transferred to 250 ml conical tubes. The 250 ml tubes were centrifuged at 1500 rpm for 10 minutes to pellet the cells. The cell supernatant was then removed and discarded. The cell pellets were then combined and suspended in 400 ml PBS + 1 mM EDTA.
- the cell suspension (25 ml/tube) was overlaid onto Ficoll (20 ml/tube) in 50 ml conical tubes (total of 16 tubes). The tubes were centrifuged at 2000 rpm for 20 minutes at room temperature. The interface layer ("buffy coat") containing the white blood cells and residual platelets was collected, pooled and washed repeatedly with PBS + 1 mM EDTA until the majority of the platelets had been removed. The white blood cells were then suspended in 100 ml of ice-cold Cryopreservation medium (70% RPMI + 20% FCS + 10% DMSO) and distributed into sterile cryovials (1 ml cells/vial).
- ice-cold Cryopreservation medium 70% RPMI + 20% FCS + 10% DMSO
- the cryovials were placed in a -80° C freezer for 24 hours before transfer to a liquid-nitrogen freezer.
- the white blood-cell yield from a typical apheresis is 0.5 - 1.0 x 10 10 cells.
- Apheresis cells processed in this manner contain T cells, B cells, NK cells, monocytes and dendritic cells.
- T cells must be activated in order to express the IL- 12 receptor and be able to respond to IL-12 and IL-23.
- Cryopreserved leukopheresis PBMC were thawed, transferred to a sterile 50 ml conical tube, washed once with 50 ml of warm RPMI + 10% heat-inactivated FBS + 1 ug/ml DNAse I (Calbiochem), resuspended in 50 ml of fresh RPMI/FBS/DNAse medium and incubated in a 37° F water bath for at least 1 hour to allow the cells to recover from being thawed.
- the cells were then centrifuged and the cell-supernatant discarded.
- the cell pellet was resuspended in RPMI + 10% FBS and distributed into sterile 75 cm 2 tissue culture flasks (1 x 10 7 cells/flask in 40 ml/flask).
- PHA-L (5 mg/ml stock in PBS) was added to the cells at a final concentration of 5 ug/ml.
- the cells were then cultured at 37 0 C in a humidified incubator for a total of 5 days.
- the cells were "rested” for some experiments by harvesting the cells on the afternoon of day 4, replacing the culture medium with fresh RPMI + 10% FBS without PHA-L (40 ml/flask) and returning the cells to their flasks and incubating at 37 0 C the cells in a humidified incubator for the remainder of the 5 day culture period.
- IL-12 and 11-23 bioassays Three in vitro assays for detection of human IL-12 and 11-23 bioactivity on normal human T cells have been established: 1) IFN-gamma and MIP- 1 alpha production, 2) proliferation ([ 3 H] -incorporation) and 3) STAT3 activation. Human PHA blasts (activated T cells) were harvested on day 5 of culture, suspended in fresh RPMI + 10% FBS and plated at the desired cell number per well in 96 well plates. [376] The inclusion of an IL- 12 assay was used to determine specificity of the neutralizing entities described herein for IL-23pl9 and not IL- 12.
- the cells were plated at 1 x 10 6 /well in flat- bottom 96-well plates. The cells were cultured at 37° C in a final volume of 200 ul/well with either medium alone, human IL-2 alone (10 ng/ml; R & D Systems), human IL- 12 alone (graded doses; Invitrogen), human IL-23 alone (graded doses; ZGI lot #A1806; CHO-derived), anti- human CD28 mAb alone (graded doses; clone 28.2, e-Biosciences), or each cytokine in combination with anti-human CD28 mAb. Triplicate wells were set up for each culture condition.
- IFN-gamma production assay cell supernatants (120 ul/well) were harvested after 24 - 48 hours of culturing the cells at 37 0 C in a humidified incubator. Human IFN-gamma and MIP-I alpha concentrations in these supernatants (pooled for each triplicate) were measured using a commercial Luminex bead-based ELISA kit (Invitrogen) following the manufacturer's instructions.
- [379] For the [ 3 H] -incorporation assay the cells were plated at 2 x 10 5 cells/well in U- bottom 96-well plates. The cells were cultured at 37 degrees C for 72 hours. The cells were pulsed with 1 uCi/well of [ 3 H]-Thymidine (Amersham) for the last 8 hours of this culture period. The cells were then harvested onto glass-fiber filters and the CPMs of [ 3 H] incorporated were quantitated using a beta counter (Topcount NXT, Packard).
- STAT3 Bioassav For the STAT3 Bioassay the cells were plated at 2 x 10 5 cells/well in U-bottom 96-well plates. Serial dilutions of human IL- 12 (R&D) or recombinant human IL-23 (ZGI CHO-derived material or eBioscience's Insect heterodimer material) were prepared in assay media (RPMI 1640 with L-Glutamine plus 10% fetal bovine serum), added to the plates containing the cells and incubated together at 37 0 C for 15 minutes.
- R&D human IL- 12
- ZGI CHO-derived material or eBioscience's Insect heterodimer material were prepared in assay media (RPMI 1640 with L-Glutamine plus 10% fetal bovine serum), added to the plates containing the cells and incubated together at 37 0 C for 15 minutes.
- the assay was also used to measure neutralization of IL- 12 and IL-23 activity using either commercially-available neutralizing reagents (as "controls") or the anti-IL-23pl9-containing neutralizing entities described herein.
- a half-maximal concentration (EC50, effective concentration at 50 percent) of IL- 12 or IL-23 were combined with serial dilutions of anti-human IL- 12 p40 monoclonal antibody (Pharmingen), anti-human IL-23 pl9 polyclonal antibody (R&D, AF1716), human IL-23R-Fc Soluble Receptor (ZGI), or any of the neutralizing entities described herein, and incubated together at 37 0 C for 30 minutes in assay media prior to addition to cells. Following pre-incubation, treatments were added to the plates containing the cells and incubated together at 37 0 C for 15 minutes.
- Capture beads (BIO-PLEX Phospho-STAT3 Assay, BIO-RAD Laboratories) were combined with 50 ul of 1 : 1 diluted lysates and added to a 96-well filter plate according to manufacture's instructions (BIO-PLEX Phosphoprotein Detection Kit, BIO-RAD Laboratories). The aluminum foil-covered plate was incubated overnight at room temperature, with shaking at 300 rpm. The plate was transferred to a microtiter vacuum apparatus and washed three times with wash buffer. After addition of 25 ⁇ L/well detection antibody, the foil-covered plate was incubated at room temperature for 30 minutes with shaking at 300 rpm. The plate was filtered and washed three times with wash buffer.
- Streptavidin-PE 50 ul/well was added, and the foil- covered plate was incubated at room temperature for 15 minutes with shaking at 300 rpm. The plate was filtered and washed two times with bead resuspension buffer. After the final wash, beads were resuspended in 125 ul/well of bead suspension buffer, shaken for 30 seconds, and read on an array reader (BIO-PLEX, BIO-RAD Laboratories) according to the manufacture's instructions. Data were analyzed using analytical software (BIO-PLEX MANAGER 3.0, BIO- RAD Laboratories).
- IL-12 and IL-23 both induced STAT3 phosphorylation in a dose dependent manner with variation from donor to donor in PHA-activated human T cells.
- EC50 values for IL-23 were in the range of 12 - 53 pM.
- IL-12 and IL-23 were both neutralized by the anti-human IL-12 p40 monoclonal antibody, whereas only IL-23 was neutralized by the anti-human IL-23 pl9 polyclonal antibody and human IL-23R-Fc controls, and by the anti-IL23pl9 neutralizing entities described herein
- an EC50 concentration was determined to be 20OpM for IL-12 and 2OpM for IL-23 (using ZGI CHO-derived protein lot Al 806F) and 3OpM for IL-23 (using the eBioscience heterodimer).
- IL-12 and IL-23 were both neutralized by the commercially available anti-human IL-12 p40 monoclonal antibody. Only IL-23 was neutralized by the commercially available anti-human IL-23 pl9 polyclonal antibody and human IL-23 R-Fc soluble receptor (as "controls"), indicating that this assay is specific for its intended cytokine activity/neutralization use.
- SAEC small airway epithelial cells
- rhIL-17 Treatment of human small airway epithelial cells (SAEC) with rhIL-17 induces the production of cytokines G-CSF, IL-6, and IL-8, which in turn, play a role in the pathology associated with the diseases for which an IL17/IL23pl9 neutralizing entity would be efficacious.
- the ability of any of the neutralizing entities described herein to inhibit rhIL-17-mediated production of these cytokines is measured in this bioassay, thus being predictive of in vivo efficacy against these cytokines as well.
- SAEC cells and growth media purchased from Cambrex, Inc.
- IL-23 and IL- 17 are important players in murine colitis and human IBD, via the actions of Thl7 cells.
- IL-23 and IL-17 are upregulated in colitis and IBD, and neutralization of either cytokine alone is efficacious in several animal models of colitis (Fujino et al, Gut, 2003, 52:65-70; Schmidt et al, Inflamm Bowel Dis. 2005, 11 :16-23; Yen et al, J Clin Invest. 2006, 116:1310-1316 ; Zhang et al, Inflamm Bowel Dis. 2006, 12:382-388; Kullberg et al, J Exp Med. 2006, 203:2485-94.).
- IL-23 is important for the maintenance, differentiation, and/or induction of ThI 7 cells, neutralization of both cytokines would be more efficacious at reducing disease than either cytokine alone.
- the current example provides data to support this in oxazalone-induced colitis model, which resembles human ulcerative colitis (UC).
- mice obtained from Harlan.
- mice were treated topically with 200ul of 3.0% (w/v) oxazalone in 100% ethanol ("sensitization") on the abdomen.
- all mice receive intrarectal injections (120 uL each) of 2.0% (w/v) oxazalone in 50% ethanol while under light isoflurane gas anesthesia ("challenge”).
- Mice were monitored for disease using a Disease Activity Index (DAI) score, which includes stool consistency, body weight, and blood in stool.
- DAI Disease Activity Index
- mice treated with the combination of antibodies also had significant improvements (p ⁇ 0.0112) in colon shortening compared to PBS-treated mice and mice treated with either of the antibodies alone.
- oxazolone mice treated with the anti-IL-17 + IL-23pl9 combination antibodies had less increases in IL-Ib, IL-12, IL-13, IL-17, IL-23, and TNF-a compared to PBS-treated oxazalone mice.
- Treatment with the combination of anti-IL-17 + IL-23pl9 antibodies also resulted in significant reductions in serum IL-12, IL-17, IL-23, and TNF-a concentrations compared to PBS-treated mice.
- Anti-IL-17A entities described herein were evaluated for their binding affinities to IL- 17A using surface plasmon resonance and Biacore T-IOO instrument (GE Healthcare). Recombinant human IL- 17A was immobilized to the sensor chip, followed by passing the antagonists over the immobilized ligand to attain affinity measurements. These methods allow for binding affinity measurements of the IL- 17A neutralizing entities for their respective ligand (IL- 17A) and also demonstrate specificity for IL- 17A by displaying no binding to similar but different ligands, such as other members of the IL-17 family.
- CM5 GE Healthcare / Biacore #BR- 1006-68
- Biacore Immobilization Wizard the level of immobilization was targeted to 300 Biacore Resonance Units (RU), and IL- 17A was only injected over an active flow cell. After the immobilization procedure, active sites on the flow cell were blocked with ethanolamine. Non-specif ⁇ cally bound protein was removed by washing with 5OmM NaOH. The final immobilization level was 466 RU. The reference cell was activated and then blocked with ethanolamine.
- Regeneration buffers supplied in the Regeneration Scouting Kit were used to determine regeneration conditions. Standard Biacore methods were performed to define the best regeneration conditions for an IL- 17A surface using IL- 17RA-Fc at 100 nM. Mildest conditions were tested first and moved up in strength. The final regeneration condition chosen was a 1-60 sec pulse of 1OmM H3PO4 followed by a 1-60 sec pulse of IX HSB-EP buffer at 50 ul/min.
- Anti-IL-17A entities described herein were evaluated for binding off-rates to IL- 17A using surface plasmon resonance and Biacore T-100 instrument (GE Healthcare). Off-rate analysis is thought to help estimate the interaction that occurs in vivo, since a slow off-rate would predict a greater degree of interaction over long period of time.
- recombinant human IL- 17A was immobilized to the sensor chip, followed by passing the antagonists over the immobilized ligand to attain off-rate analyses. Similar to the Biacore affinity example (see EXAMPLE 29), IL- 17F was used as the negative control, in order to demonstrate IL- 17A specificity.
- IL- 17A human IL- 17A (native and biotinylated) and IL- 17F were diluted to 10 ug/ml in Acetate-4.0. All three proteins were immobilized onto a Series S Sensor Chip (CM5, GE Healthcare / Biacore #BR- 1006-68) using the amine coupling kit and Biacore Immobilization Wizard. Briefly, the level of immobilization was targeted to 500 Biacore Resonance Units (RU). Flow cell 1 was used as the reference, and therefore was only activated and then blocked with ethanolamine.
- CM5 Biacore Resonance Units
- IL-17A The native form of IL-17A was immobilized to flow cell 2, biotinylated IL- 17A was immobilized to flow cell 3 and IL- 17F was immobilized to flow cell 4.
- Analyte was injected only over active flow cells (flow cells 2, 3 and 4). After the immobilization, the active sites on the flow cell were blocked with ethanolamine. Non- specifically bound protein was removed by washing with 5OmM NaOH. The final immobilization level for flow cell 1 (reference) was 175.0 RU and fell between 669.5 and 695.6 RU for the active flow cells (flow cells 2 - 4).
- Samples of the anti-IL-17A neutralizing entities were diluted to 100 nM in IX HBS-EP+ buffer (GE Healthcare / Biacore, #BR- 1006-69).
- IL- 17RA-Fc and IL- 17A monoclonal antibody were also prepared at 10OnM in IX HBS-EP+ buffer as positive controls.
- Duplicate injections of each sample were performed.
- the analyte injections were at 30 ul/min with a dissociation time of 600 seconds. Buffer injections were also performed to allow for subtraction of instrument noise and drift.
- Regeneration buffers supplied in a regeneration scouting kit were used to determine regeneration conditions. Using this procedure, the optimal regeneration condition was found to be 60 seconds of 10 mM H3PO4 followed with 60 seconds of IX HBS-EP+ buffer injections at a flow rate of 50 ul/minute.
- Anti-IL-23pl9 entities described herein were evaluated for their binding affinities to IL-23 using surface plasmon resonance and Biacore T-IOO instrument (GE Healthcare). Recombinant human IL-23 was immobilized to the sensor chip, followed by passing the antagonists over the immobilized ligand to attain affinity measurements. These methods allow for binding affinity measurements of the IL-23pl9 neutralizing entities for their respective ligand (IL-23) and also demonstrate specificity for IL-23 by displaying no binding to similar but different ligands, such as IL- 12.
- IL-23 protein was diluted to lOug/ml in Acetate-4.5, and then immobilized onto a Series S Sensor Chip (CM5, GE Healthcare / Biacore #BR- 1006-68) using the amine coupling kit and Biacore Immobilization Wizard. Briefly, the level of immobilization was targeted to 300 Biacore Resonance Units (RU), and IL-23 was only injected over an active flow cell. After the immobilization procedure, active sites on the flow cell were blocked with ethanolamine. Non-specifically bound protein was removed by washing with 5OmM NaOH. The final immobilization level was 466RU. The reference cell was activated and then blocked with ethanolamine.
- CM5 Biacore Resonance Units
- RL resonance signal of the ligand testing was performed.
- the IL-23R-Fc or IL-23pl9 polyclonal antibody were injected over both the active and reference cells for three different contact times. From this RL testing, the contact time for the IL-23pl9 polyclonal antibody was determined to be 60 seconds and for IL-23R-Fc, it was 300 seconds.
- Regeneration buffers supplied in the Regeneration Scouting Kit were used to determine regeneration conditions. This run was performed manually, starting from the least mild condition. At the end of this procedure, the optimal regeneration condition was 60 seconds of 2M Magnesium Chloride followed with 60 seconds of IX HBS-EP+ buffer injections at a flow rate of 50ul/min.
- Anti-IL-23pl9 entities described herein were evaluated for binding off-rates to IL- 23 using surface plasmon resonance and Biacore T-100 instrument (GE Healthcare). Off-rate analysis is thought to help estimate the interaction that occurs in vivo, since a slow off-rate would predict a greater degree of interaction over long period of time.
- recombinant human IL-23 was immobilized to the sensor chip, followed by passing the antagonists over the immobilized ligand to attain off-rate analyses. Similar to the Biacore affinity example (see EXAMPLE 31), IL- 12 was used as the negative control, in order to demonstrate IL-23 specificity.
- IL-23 human IL-23 (native and biotinylated) and IL- 12 were diluted to lOug/ml in Acetate-4.5. All three proteins were immobilized onto a Series S Sensor Chip (CM5, GE Healthcare / Biacore #BR-1006-68) using the amine coupling kit and Biacore Immobilization Wizard. Briefly, the level of immobilization was targeted to 300 Biacore Resonance Units (RU). Flow cell 1 was used as the reference, and therefore was only activated and then blocked with ethanolamine.
- CM5 Biacore Resonance Units
- IL-23 The native form of IL-23 was immobilized to flow cell 2, biotinylated IL-23 was immobilized to flow cell 3 and IL- 12 was immobilized to flow cell 4. Analyte was injected only over active flow cells (flow cells 2, 3 and 4). After the immobilization, the active sites on the flow cell were blocked with ethanolamine. Non- specifically bound protein was removed by washing with 5OmM NaOH. The final immobilization levels fell between 379 and 415 RU.
- Regeneration buffers supplied in a regeneration scouting kit were used to determine regeneration conditions (RR-2007001). Using this procedure, the optimal regeneration condition was found to be 60 seconds of 2M Magnesium Chloride followed with 60 seconds of IX HBS-EP+ buffer injections at a flow rate of 50ul/min.
- Anti-IL-17A Fabs from 16 different E. coli clones demonstrated the ability to neutralize the activity of IL-17A in a cell-based neutralization assays.
- the functional binding properties of these anti-IL-17A neutralizing Fabs were additionally characterized using competitive binding (epitope binning) experiments.
- Biacore is only one of a variety of assay formats that are routinely used to assign panels of antibody fragments and monoclonal antibodies to epitope bins.
- Many references e.g. The Epitope Mapping Protocols, Methods in Molecular Biology, Volume 6,6 Glenn E. Morris ed.
- Epitope binning experiments were performed with soluble, native antigen.
- Each anti-IL-17A Fab was tested as the primary anti-IL-17A Fab in combination with a subset of secondary anti-IL-17A Fabs.
- the primary anti-IL-17A Fabs were tested at a concentration of 200 nM and a flow rate of 10 ⁇ L/min, while the secondary anti-IL-17A Fabs were tested at a concentration of 100 nM and a flow rate of 50 ⁇ L/min. Experiments were performed at 25 0 C. Between cycles, the antigen on the chip was regenerated with 10 mM phosphoric acid. Data was compiled using BioEvaluation 4.1 RCI software, then loaded into Excel TM for additional data processing.
- the differential between positive and negative response values in this experiment was significant and allowed for an unambiguous assignment of thirteen of the anti-IL-17A Fabs into two distinct families or epitope bins.
- Two binding epitopes were identified within this set of neutralizing anti-IL-17A Fabs, and multiple E. coli clones were found to bind to one of the epitopes.
- the first epitope bin was comprised of anti-IL-17A Fabs from clones M7.19 E7; M7.20 G6; M7.24 E8; M7.19 F4; M7.19 DlO; M7.20 E5; M7.24 A5; M7.20 ClO; M7.20 FI l; M7.20 A9; M7.24 C2; M7.20 F4.
- the second bin was comprised of the anti-IL-17A Fab from clone M7.24 G6.
- Anti-IL-23pl9 Fabs from 9 different E. coli clones demonstrated the ability to neutralize the activity of IL-23 in a cell-based neutralization assays.
- the functional binding properties of these anti-IL-23pl9 neutralizing Fabs were additionally characterized using competitive binding (epitope binning) experiments.
- Biacore is only one of a variety of assay formats that are routinely used to assign panels of antibody fragments and monoclonal antibodies to epitope bins.
- Many references e.g. The Epitope Mapping Protocols, Methods in Molecular Biology, Volume 6,6 Glenn E. Morris ed.
- Epitope binning experiments were performed with soluble, native antigen.
- Each anti-IL-23pl9 Fab was tested as the primary Fab in combination with the entire panel of secondary anti-IL-23pl9 Fabs.
- the primary anti-IL-23pl9 Fabs were tested at a concentration of 210 nM and a flow rate of 10 ⁇ L/min, while the secondary anti-IL-23pl9 Fabs were tested at a concentration of 60 nM and a flow rate of 50 ⁇ L/min. Experiments were performed at 25 0 C. Between cycles, the antigen on the chip was regenerated with 2 M MgC12. Data was compiled using BioEvaluation 4.1 RCI software, then loaded into Excel TM for additional data processing.
- the differential between positive and negative response values in this experiment was significant and allowed for an unambiguous assignment of six of the anti-IL-23pl9 Fabs into two distinct families or epitope bins. Two binding epitopes were identified within this set of neutralizing anti-IL-23pl9 Fabs, and multiple E. coli clones were found to bind to each epitope.
- the first epitope bin was comprised of anti-IL-23pl9 Fabs from clones M7.12 B9; M7.9 G9; and M7.13 D7.
- the second bin was comprised of anti-IL-23pl9 Fabs from clone M7.7 F5; M7.12 A7; and M7.13 A6.
- clone M7.19.E7 (SQ7_c87) had an IC50 of 31.1 nM to inhibit human IL-17A induced G-CSF production, and this same clone had an IC50 of approximately 90 nM to inhibit cynomolgous IL- 17A induced G-CSF production. Therefore, although the IC50 values were higher against cynomolgous IL- 17A activity compared to human IL- 17A, there was clearly species cross-reactivity in the ability of the anti-IL-17A neutralizing entities to inhibit IL-17A-mediated biological activity.
- DNA fragments one containing the sequence for pIL12B and one containing the sequence for pIL23A, and the expression vector pZMP42.
- the pIL12B fragment was generated by PCR amplification using primers zc56242 and zc56243.
- the pIL23A fragment was generated by PCR amplification using primers zc56244 and zc56245.
- the pIL12B fragment was made using a previously generated clone of pIL12B as the template.
- the fragment includes a 5' overlap with the pZMP42 vector sequence, the pIL12B segment, and a linker sequence designed to join pIL12B to pIL23A.
- the pIL23A fragment was made using a previously generated clone of pIL23A as the template.
- the fragment includes a linker sequence designed to join pIL23A to pIL12B, the pIL23A segment, and a 3' overlap with the pZMP42 vector sequence.
- PCR conditions used were as follows: 1 cycle, 94°C, 5 minutes; 35 cycles, 94°C, 1 minute, followed by 58°C, 2 minutes, followed by 72°C, 3 minutes; 1 cycle, 72°C, 10 minutes.
- Plasmid pZMP42 is a mammalian expression vector containing an expression cassette having the MPSV promoter, multiple restriction sites for insertion of coding sequences, and an otPA signal peptide sequence; an internal ribosome entry site (IRES) element from Hepatitis C virus, and the extracellular domain of CD8 truncated at the C-terminal end of the transmembrane domain; an internal ribosome entry site (IRES) element from poliovirus, a DHFR gene, and the SV40 terminator; an E. coli origin of replication; and URA3 and CEN-ARS sequences required for selection and replication in S. cerevisiae. It was constructed from pZMP21 (Patent Pub. No. US 2003/0232414 Al) (deposited at the American Type Culture Collection, 10801 University Boulevard, Manassas, VA 20110-2209, designated as ATCC# PTA-5266).
- the plasmid pZMP42 was cut with BgIII prior to recombination in yeast with the PCR fragment.
- One hundred microliters of competent yeast (S. cerevisiae) cells were independently combined with 10 ⁇ l of the insert DNA and lOOng of cut pZMP42 vector, and the mix was transferred to a 0.2-cm electroporation cuvette.
- the yeast/DNA mixture was electropulsed using power supply (BioRad Laboratories, Hercules, CA) settings of 0.75 kV (5 kV/cm), ⁇ ohms, and 25 ⁇ F.
- Six hundred ⁇ l of 1.2 M sorbitol was added to the cuvette, and the yeast was plated in a 100- ⁇ l and 300 ⁇ l aliquot onto two URA-D plates and incubated at 30 0 C.
- the Ura + yeast transformants from a single plate were resuspended in 1 ml H2O and spun briefly to pellet the yeast cells.
- the cell pellet was resuspended by vortex in 0.1 ml of lysis buffer (2% Triton X-IOO, 1% SDS, 100 mM NaCl, 10 mM Tris, pH 8.0, 1 mM EDTA), and 0.1 mL of Pl (from QIAprep Spin Miniprep Kit, Qiagen, cat# 27106) with 10 units of Zymo lyase added (Zymo Research, cat# E 1002).
- the yeast suspension was incubated for 10 minutes in a 37° C waterbath. DNA from the yeast was isolated using the standard QIAprep Spin Miniprep Kit protocol (Qiagen, cat# 27106), starting at the step of adding reagent P2.
- Transformation of electrocompetent E. coli host cells was done using 5 ⁇ l of the yeast DNA prep and 50 ⁇ l of cells. The cells were electropulsed at 2.0 kV, 25 ⁇ F, and 400 ohms.
- the pellet was then resuspended in 750 ⁇ l of ZFl media in a sterile environment, allowed to incubate at 6O 0 C for 10 minutes, and was allowed to cool to room temperature.
- 5E6 5xSA cells were spun down in each of three tubes and were resuspended using the DNA-media solution.
- the DNA/cell mixtures were placed in a 0.4 cm gap cuvette and electroporated using the following parameters: 950 ⁇ F, high capacitance, and 300 V.
- the contents of the cuvettes were then removed, pooled, and diluted to 25 mLs with ZFl media and placed in a 125 mL shake flask.
- the flask was placed in an incubator on a shaker at 37 0 C, 6% CO 2 , and shaking at 120 RPM.
- the cell line was subjected to nutrient selection followed by step amplification to
- EXAMPLE 38 Expression of IL23 C-terminal His tagged Protein in CHO DXBIl Cells in a Wave Reactor
- IL23 v.1 CH6 protein (IL23A/IL12B) was expressed in a 2OL Wavebag Reactor (Wave Biotech) in CHO DXBl 1 cells trans fected with the ZG construct 1564.
- the cells were scaled up in shake flasks using ZFl medium (JRH imMEDIAte Advantage Cat# 65633) with the addition of 5 mM L-glutamine (from 200 mM L-glutamine, Gibco catalog #25030-081), 1 mM sodium pyruvate (from 100 mM Sodium Pyruvate, Gibco catalog #11360-070) and 500 nM methotrexate.
- the reactor run was initiated by seeding 1.7 L of shake flask culture in log phase into 8.3 L ZFl medium containing L-glutamine and sodium pyruvate but no methotrexate. This resulted in a 10 L final working volume with a density of 3.1 xlOE5 c/mL.
- the CO 2 level was maintained at 6% and was pumped continually into the headspace of the reactor at 0.1 LPM. Dissolved oxygen requirements of the cells were met by rocking the culture on a platform at a rate of 25 rocks per minute at an angle setting of 9.5. pH was not controlled but stayed between 6.6 and 6.9. Temperature was maintained at 37 C until density reached 7.5 x 10E5 cells/mL, then temperature was dropped to 34 C for the remainder of the run. Glucose levels were maintained above 2 g/L and L-glutamine above 2 mM.
- the culture was harvested 9 days after seeding with a density of 4.7 x 10E6 cells/mL and 97% viability. The supernatant was centrifuged at 3500xg for 15 minutes and the clarified conditioned medium was passed through a 0.22 ⁇ m filter (Millipore Opticap Cat# KW1904HB3) and submitted for protein purification.
- Cynomolgus IL23 was produced transiently in 293F cells (Invitrogen, Carlsbad, CA Cat# R790-07). Large-scale plasmid DNA was isolated using a PureLink HiPure Plasmid Gigaprep Kit (Invitrogen, Carlsbad, CA Cat# K210009) according to manufacturer's instructions. 293F suspension cells were cultured in 293 Freestyle medium (Invitrogen, Carlsbad, CA Cat# 12338-018) at 37° C, 6% CO2 in four 3 L spinner flasks at 95 RPM. Fresh medium was added to each spinner immediately prior to transfection to obtain a 1.5 liter working volume at a final density of 1 xlOE6 cells/mL. For each spinner, 2.0 mL of Lipofectamine 2000 (Invitrogen,
- the adjusted concentrate was 0.22um sterile filtered (Nalgene) and analyzed via RP-HPLC and Western blot for recovery, comparing against Ix media and the permeates. Analyses show that target is nearly completely recovered at this step.
- IMAC Immobilized Metal Affinity Chromatography
- UF/DF media was loaded over 137mL Ni NTA His Bind Resin (Novagen) packed in a 2cm glass column (Millipore) at 0.2mL/min at 4 C.
- the column was equilibrated in 500 mM NaCl, 50 mM NaPO 4 , 25 mM Imidaozloe pH 7.5 buffer.
- the flow rate was increased to 20mL/min and the column washed with equilibration buffer until UV at 254nm and 280nm was baseline stable.
- Bound protein was eluted stepwise using a 4OmM and 50OmM Imidazole steps, each in equilibration buffer.
- the elution flow rate was 20mL/min and 25mL fractions were collected. Pools were made based on the inflection of A280nm and analyzed by RP-HPLC, as well as reducing and non-reducing SDS-PAGE coomassie gels. Only the 50OmM pool had target as analyzed by these methods. Protein was completely captured by the IMAC resin, as assessed by Western blot and RP-HPLC. Superdex 200 Coarse SEC (size exclusion chromatography)
- the 50OmM IMAC pool was considered pure enough to warrant SEC for final formulation and polishing.
- the pool was initially concentrated to 5OmL against 1 x 50cm 2 10OkD MWCO membrane (Millipore) in the Labscale TFF system. At 5OmL, this concentrate was transferred to a 3OkD Ultracel membrane (Millipore). Concentration continued via centrifugation until a final volume of 15mL was reached. The final concentrate was injected over a 26/60 (318mL) Superdex 200 size exclusion column (GE Healthcare) running in 35mM NaPO4, 12OmM NaCl pH 7.2 at 3.0mL/min. 2.5mL fractions were collected throughout the isocratic elution.
- [457] -5.8L of delivered media was concentrated to ⁇ 1L against 1 x 0.1 m2 MWCO pellicon membrane (Millipore) using a peristaltic pump system.
- the conductivity of the concentrated media was adjusted to be equivalent to that of 0.5M NaCl via addition of 0.4M solid reagent, 25mM Imidazole via addition of solid, pH 7.5 using HCl and loaded over 5mL Ni Sepharose 6 FF resin (GE Healthcare) packed in a lcm diameter glass column (Millipore) at 0.9mL/min overnight at 4 C.
- IL23R Fc5 protein was expressed in a 2OL Wavebag Reactor (Wave Biotech) in CHO DXBl 1 cells transfected with the ZG construct 1602. The cells were scaled up in shake flasks using ZFl medium (JRH imMEDIAte Advantage Cat# 65633) with the addition of 5 mM L-glutamine (from 200 mM L-glutamine, Gibco catalog #25030-081), 1 mM sodium pyruvate (from 100 mM Sodium Pyruvate, Gibco catalog #11360-070) and 500 nM methotrexate.
- ZFl medium JRH imMEDIAte Advantage Cat# 65633
- the reactor run was initiated by seeding 900 mL of shake flask culture in log phase into 9.1 L ZFl medium containing L-glutamine and sodium pyruvate but no methotrexate. This resulted in a 10 L final working volume with a density of 2.0 xlOE5 c/mL.
- the CO 2 level was maintained at 6% and was pumped continually into the headspace of the reactor at 0.1 LPM. Dissolved oxygen requirements of the cells were met by rocking the culture on a platform at a rate of 25 rocks per minute at an angle setting of 9.5. pH was not controlled. Temperature was maintained at 37 C until density reached approximately 8 x 10E5 cells/mL, then temperature was dropped to 34 C for the remainder of the run. Glucose levels were maintained above 2 g/L and L-glutamine above 2 mM.
- the culture was harvested 9 days after seeding with a density of 8.0 x 10E6 cells/mL and 98% viability. The supernatant was centrifuged at 3500xg for 15 minutes and the clarified conditioned medium was passed through a 0.22 ⁇ m filter (Millipore Opticap Cat# KW1904HB3) and submitted for protein purification.
- the protein was purified from the filtered media using a combination of POROS® A50 Protein A Affinity Chromatography (Applied Biosciences, Foster City, CA) and Superdex 200 Size Exclusion Chromatography (GE Healthcare, Piscataway, NJ.)
- a 27 ml POROS® A50 column (20 mm x 85 mm) was pre-eluted with 3 column volumes (CV) of 25 mM Citrate-Phosphate (1.61 mM Sodium Citrate - 23.4 mM Sodium Phosphate, ) 250 mM Ammonium Sulfate pH 3 buffer and equilibrated with 20 CV PBS.
- the IL23R-Fc5-containing pool was concentrated to 10 ml by ultrafiltration using Amicon Ultra- 15 30K NWML centrifugal devices (Millipore), and injected onto a 318 ml (26 mm x 600 mm) Superdex 200 column pre-equilibrated in 35 mM Sodium Phosphate, 120 mM NaCl pH 7.3 at 28 cm/hr.
- the fractions containing purified IL23R-Fc5 were pooled based on A280 and SDS PAGE, filtered through a 0.2 ⁇ m filter and frozen as aliquots at -8O 0 C.
- the concentration of the final purified protein was determined by BCA assay (Pierce, Rockford, IL). The overall process recovery was approximately 66%. Analysis of Purified IL23R-Fc5
- Recombinant IL23R-Fc5 was analyzed by SDS-PAGE (4-12% BisTris, Invitrogen, Carlsbad, CA) with 0.1% Coomassie R250 staining for protein and immunob lotting with Anti-IgG-HRP.
- the purified protein was electrophoresed and transferred to nitrocellulose (0.2 ⁇ m; Invitrogen, Carlsbad, CA) at ambient temperature at 600 mA for 45 minutes in a buffer containing 25 mM Tris base, 200 mM glycine, and 20% methanol.
- the filters were then blocked with 10% non-fat dry milk in 50 mM Tris, 150 mM NaCl, 5 mM EDTA, 0.05% Igepal (TBS) for 15 minutes at room temperature.
- the nitrocellulose was quickly rinsed, and the IgG-HRP antibody (1 : 10,000) was added.
- the blots were incubated overnight at 4 0 C, with gentle shaking. Following the incubation, the blots were washed three times for 10 minutes each in TBS, and then quickly rinsed in H 2 O.
- the blots were developed using commercially available chemiluminescent substrate reagents (Roche LumiLight), and the signal was captured using Lumi-Imager's Lumi Analyst 3.0 software (Boehringer Mannheim GmbH, Germany.)
- the purified IL23R-Fc5 appeared as a band at about 200 kDA on both the non-reducing Coomassie stained gel and on the immunoblot, suggesting a glycosylated dimeric form as expected.
- the protein had the correct NH 2 terminus and the correct amino acid composition.
- An expression plasmid encoding cynomolgus IL17A CH6 was constructed via homologous recombination in yeast with a DNA fragment containing the IL17A CH6 sequence.
- a cDNA fragment was created using PCR and includes residues 1-465.
- the upstream primer consists of 41 bases of overlap with the vector backbone and 24 bases of the 5' end open reading from of the amino terminus of the inserted gene.
- the downstream primer contains 37 residues of overlap with the backbone vector, the His tag with a GSGG linker, and 23 bases of the gene.
- Amino acid 127 was mutated from R to P to eliminate a potential cleavage site. This mutation converts the cynomolgus sequence to the human sequence at this position.
- the mutation was created by overlapping two fragments via PCR. zc57312, as explained above, was used with a 24 base downstream primer with its 5' end at amino acid 127 and its 3' end 134. This created the 5 ' fragment of the gene containing the mutation.
- the 3 ' fragment was constructed using a forward primer containing the entire sequence from amino acids 126 to 155. This was overlapped with primer zc57313, described previously. These two fragments were fused via PCR.
- the PCR amplification conditions using Promega's GoTaq (Promega, Madison, WI, catalog #M712B), were as follows: 1 cycle of 94°C, 5 minutes; 29 cycles of 94°C for 1 minute, 55°C for 30 seconds, 68°C for 30 seconds; 1 cycle of 4°C forever.
- the entire product of each PCR was run on a 1% LMP agarose gel (Seaplaque GTG) with Ix TAE buffer for analysis. After excising the appropriate band, it was purified using Qiagen's gel purification kit (Qiagen, Valencia, CA, catalog #28704).
- yeast-DNA mixture was electropulsed at 0.75kV (5kV/cm), ⁇ ohms, 25 ⁇ F. To each cuvette was added 600 ⁇ l of 1.2M sorbitol, and the yeast were plated onto a URA-
- E. coli cells (DH12S, Invitrogen, Carlsbad, CA) was transformed with 3 ⁇ L yeast DNA in a 0.2cm electroporation cuvette. The cells were electropulsed at 1.75kV, 25 ⁇ F, and 400 ohms. Following electroporation, 600 ⁇ L SOC (2% Bacto' Tryptone (Difco, Detroit, MI), 0.5% yeast extract (Difco), 1OmM NaCl, 2.5mM KCl, 1OmM MgC12, 1OmM MgSO4, 2OmM glucose) was added to the cuvette. lO ⁇ L of this solution was plated on an LB AMP plate (LB broth (Lennox), 1.8% Bacto Agar (Difco), 100 mg/L Ampicillin).
- LB AMP plate LB broth (Lennox), 1.8% Bacto Agar (Difco), 100 mg/L Ampicillin).
- the DNA sequence is shown in SEQ ID NO: 1018.
- the polypeptide sequen is shown in SEQ ID NO: 1019.
- Cynomolgus IL17A R127P CH6 was produced transiently in 293F cells (Invitrogen, Carlsbad, CA Cat# R790-07). Briefly, 293F suspension cells were cultured in 293 Freestyle medium (Invitrogen, Carlsbad, CA Cat# 12338-018) at 37° C, 6% CO2 in a 3 L spinner flask at 95 RPM. Fresh medium was added immediately prior to transfection to obtain a one liter working volume at a final density of 1 xlOE6 cells/ml.
- An expression plasmid encoding cynomolgus IL17F CH6 was constructed via homologous recombination in yeast with a DNA fragment containing the IL17F CH6 sequence.
- a cDNA fragment was created using PCR and includes residues 1-522.
- the upstream primer consists of 42 bases of overlap with the vector backbone and 24 bases of the 5 ' end open reading from of the amino terminus of the inserted gene.
- the downstream primer contains 37 residues of overlap with the backbone vector, the His tag with a GSGG linker, and 23 bases of the gene.
- the PCR amplification conditions using Promega's GoTaq (Promega, Madison,
- WI catalog #M712B
- 1 cycle of 94°C, 5 minutes 29 cycles of 94°C for 1 minute, 55°C for 30 seconds, 68°C for 30 seconds
- 1 cycle of 4°C forever The entire product of each PCR was run on a 1% LMP agarose gel (Seaplaque GTG) with Ix TAE buffer for analysis. After excising the appropriate band, it was purified using Qiagen's gel purification kit (Qiagen, Valencia, CA, catalog #28704).
- yeast-DNA mixture was electropulsed at 0.75kV (5kV/cm), ⁇ ohms, 25 ⁇ F.
- To each cuvette was added 600 ⁇ l of 1.2M sorbitol, and the yeast were plated onto a URA- DS plate and incubated at 30 0 C.
- E. coli cells (DH12S, Invitrogen, Carlsbad, CA) was transformed with 3 ⁇ L yeast DNA in a 0.2cm electroporation cuvette. The cells were electropulsed at 1.75kV, 25 ⁇ F, and 400 ohms. Following electroporation, 600 ⁇ L SOC (2% Bacto' Tryptone (Difco, Detroit, MI), 0.5% yeast extract (Difco), 1OmM NaCl, 2.5mM KCl, 1OmM MgC12, 1OmM MgSO4, 2OmM glucose) was added to the cuvette. lO ⁇ L of this solution was plated on an LB AMP plate (LB broth (Lennox), 1.8% Bacto Agar (Difco), 100mg/L Ampicillin).
- LB AMP plate LB broth (Lennox), 1.8% Bacto Agar (Difco), 100mg/L Ampicillin).
- the DNA sequence is shown in SEQ ID NO: 1020.
- the polypeptide sequen is shown in SEQ ID NO: 1021.
- Cynomolgus IL17F CH6 was produced transiently in 293F cells (Invitrogen, Carlsbad, CA Cat# R790-07). Briefly, 293F suspension cells were cultured in 293 Freestyle medium (Invitrogen, Carlsbad, CA Cat# 12338-018) at 37° C, 6% CO2 in a 3 L spinner flask at 95 RPM. Fresh medium was added immediately prior to transfection to obtain a one liter working volume at a final density of 1 xlOE6 cells/mL.
- Delivered media was adjusted to 0.5M NaCl and 25mM Imidazole via addition of solid, pH 7.5 via slowly adding ION NaOH while stirring. Adjusted media was loaded over 5mL Ni Sepharose 6 FF resin (GE Healthcare) packed in a 1.0 cm diameter column (Millipore) at 0.9mL/min overnight at 4 C. Upon depletion of media, the flow rate was increased to 4mL/min and the column washed with 5OmM NaPO4, 50OmM NaCl, 25mM Imidazole pH 7.5 until UV @ A254nm and A280nm was baseline stable.
- Bound target was eluted using steps of 4OmM and 50OmM Imidazole in the above mentioned equilibration buffer. Elution proceeded at 2mL/min, collecting 3mL fractions throughout. Only fractions from the 50OmM Imidazole step contained target, a pool was made based on the 280nm absorbance inflection and analyzed by RP HPLC. By analytical RP-HPLC, the entire expressed CH6 target was captured on the IMAC resin.
- Superdex 75 size exclusion chromatography :
- 50OmM Imidazole Pool was considered pure enough to warrant size exclusion chromatography for final formulation.
- the 500 mM Imidazole IMAC pool was concentrated to ⁇ 5.0mL using a 1OkD MWCO Ultracel membrane (Millipore).
- the concentrate was injected over a 26/60 (318mL) Superdex 75 SEC column (GE Healthcare) equilibrated in 35mM NaPO4, 12OmM NaCl pH 7.2. at a flow rate of 3.0mL/min while collecting 2.5mL fractions throughout the isocratic elution.
- Conservative pooling was based on the inflection of A280nm signal and SDS-PAGE analysis of collected fractions.
- the size exclusion pool was concentrated to lmg/mL using another 1OkD MWCO Ultracel membrane, 0.22um filtered (Millipore), aliquotted, and stored at -80C.
- IL 17RA Fc5 (aka IL 17R[FL]x 1 C Fc5) protein was expressed in a 2OL Wavebag Reactor (Wave Biotech) in CHO DXBl 1 cells transfected with the ZG construct 1466.
- the cells were scaled up in shake flasks using ZFl medium (JRH imMEDIAte Advantage Cat# 65633) with the addition of 5 mM L-glutamine (from 200 mM L-glutamine, Gibco catalog #25030-081), 1 mM sodium pyruvate (from 100 mM Sodium Pyruvate, Gibco catalog #11360-070) and 500 nM methotrexate.
- the reactor run was initiated by seeding one liter of shake flask culture in log phase into 9 L ZFl medium containing L-glutamine and sodium pyruvate but no methotrexate.
- the culture was harvested 12 days after seeding with a density of 6.3 x 10E6 cells/mL and 98% viability. The supernatant was centrifuged at 3500xg for 15 minutes and the clarified conditioned medium was passed through a 0.22 ⁇ m filter (Millipore Opticap Cat# KW1904HB3) and submitted for protein purification.
- E. coli W3110 cells from a 2L bioreactor fermentation containing the human IL17A were washed with 50 mM Tris pH 8 containing 200 mM NaCl and 5 mM EDTA to remove any broth contaminants.
- 1.2 L of ice cold lysis buffer 50 mM Tris pH 8, 200 mM NaCl, 5 mM EDTA, 5 mM Benzamidine and 5 mM DTT was added to the 323 g cell pellet and homogenized using the Polytron tissue-grinder until all clumps were disrupted.
- the bacterial cells were lysed with three passes through a MicroFluidizer keeping the cell suspension chilled to 4 0 C.
- the final volume of the cell lysate was 1.73 L.
- the inclusion bodies in this lysate were pelleted by centrifuging 30 min at 20, 000 x g (12,000 rpm in a JA-14 rotor in a Beckman J2-21M centrifuge), 4 0 C in eight 250-ml centrifuge bottles.
- the inclusion bodies were washed three times with lysis buffer to remove any E. coli unbroken cells and large cellular debris from the pelleted inclusion body protein.
- the supernatant was carefully poured off the pellet and the inclusion bodies were washed by suspending the pellet in lysis buffer and completely homogenizing to wash out soluble proteins and cellular components.
- the washed inclusion bodies were recovered by centrifuging 30 min at 15,000 x g (12,000 rpm in JA-14), 4 0 C. Three of four washed pellets (38g each) were stored at -80 0 C in 250 ml bottles and the fourth bottle was processed further. 7M Guanidine-HCl in 50 mM Tris pH 8 containing 100 mM sodium sulfite and 20 mM sodium tethrathionate was used to extract recombinant protein from washed pellets. Extraction with the denaturant dissociates protein-protein interactions and unfolds the protein. As a result, the extracted protein consists of unfolded monomers, with sulfhydryl groups in the reduced state and sulphonated.
- the 38 g pellet was homogenized with 150 ml extraction buffer and clarified by centrifuging the suspension for two hours at 35,000 x g at 4 0 C.
- the 178 ml clarified extract was evaluated by RP HPLC (23.3 mg/ml) and SDS PAGE (20.4 mg/ml) and divided into four parts. Three parts were stored at -
- Ice cold refolding buffer (4 Liters) of the following composition was prepared; 0.75M Arginine, 55 niM MES (N-MorpholinoEthaneSulfonic acid), 10.56 mM NaCl, 0.44 mM KCl, 0.055% Peg 3.4 K (w/v), 1.1 mM EDTA, 440 mM Sucrose, 550 mM GuHCl, 1 mM GSH (reduced Glutithione), 1 mM GSSG (oxidized Glutithione), pH 6.5
- the oxidation-reduction pair (GSH:GSSG) was added just prior to diluting the GuHCl solubilized, S-sulphonated inclusion body stock.
- the concentration of the Sulfytolized inclusion bodies was 20.4 mg/mL as determined by RP HPLC using suitable IL17F standard. 20 mL of the concentrated stock was added, dropwise, to 4 Liters of well stirred ice cold refolding buffer.
- the atmosphere was flooded with Nitrogen and the vessel was tightly capped and placed in the cold room with gentle stirring.
- samples were withdrawn for RP HPLC analysis. Each time a sample was taken, the vessel was flooded with Nitrogen gas and tightly capped, and replaced in the cold room with gentle stirring.
- a cation exchange column (63 ml bed volume, 2 cm. Diameter) of SP Fast Flow (GE Healthcare) was equilibrated in Buffer A: 25 mM Acetic Acid, 100 mM NaCl, at pH 5.0 .
- Buffer B 25 mM Acetic Acid
- 2 Molar NaCl pH 5.0
- Dilution Buffer 100 mM Acetic acid, pH 4.7
- the capture strategy utilizes in-line dilution proportioning at 20 % refold Rxn to 80 % Dilution Buffer to apply the load.
- the flow rate for the sample application phase of the chromatography was 10 ml/min.
- the column effluent conductivity is 20 milli-Siemens under the loading conditions.
- Buffer B and the column washed for 1 CV before eluting the bound protein with a 15 CV gradient from 10% buffer B (starting condition) to 100 % B.
- a symmetric peak eluted fairly soon following initiation of the gradient.
- Fractions containing protein as indicated by the UV trace were analyzed by Reverse phase HPLC for target content. Analysis of the cation exchange protein pool demonstrated that a much higher proportion of dimeric product peak was present at this stage, with some of the cluster peaks still observable.
- Non-reducing SDS-PAGE analysis on protein containing fractions was employed to look at their complexity. The gels indicate a significant amount of monomeric and dimeric species, at a 1 :1 ratio, are present at this stage.
- the cation exchange pool is concentrated to 40 ml volume against a 10 kD cutoff membrane (Amicon Ultra- 15) and adjusted to 0.7M [NH 4 J 2 SO 4 through slow addition of sufficient solid to the well stirred concentrate. Finally, the pH was adjusted to 7.5 with 2N NaOH in preparation for an Isocratic passage over a hydrophobic interaction column. A high performance Phenyl HP (Pharmacia) column (17 mL, 2cm. dia.) was equilibrated in 0.7M Ammonium Sulfate; 20 mM NaPO 4 , 20 mM MES, pH 7.5 buffer, at room temperature.
- the adjusted protein pool was applied to the column using a superloop injection port at a flow rate of 2.5 mL/min. Little protein passed during sample application at 2.5 ml/min. Once the entire sample had been injected, the flow rate of equilibration buffer was increased to washout unbound protein. However, upon increasing the flow rate to 10 mL/min. for the wash phase, protein started to elute from the column. A fairly symmetric peak eluted with small plateau's on the leading and trailing flanks. A pool, excluding the leading and trailing plateau fractions was made and analyzed by RP HPLC. SDS-PAGE analysis (non-reducing) revealed that all of the higher MW multimers were cleared by this step, and that only monomer and dimeric species of IL17A remained, with the dimer being the predominant species. Desalting step :
- the pooled protein from the hydrophobic chromatography step was concentrated to 10 mL against a 10 kD cutoff membrane (Amicon Ultra-15) and injected onto a Hi Trap 26/10 desalting column (Pharmacia) equilibrated in 35 mM NaPO 4 109 mM NaCl, pH 7.0 buffer. Protein containing eluate fractions were analyzed by RP HPLC, sterile filtered, analyzed for protein content and tested for Endotoxin prior to being aliquoted and frozen at -80 degrees
- the column was washed with 20 CV equilibration buffer, then eluted in two steps for 10 CV at 5 ml/min (149 cm/hr) with 5OmM Imidazole, and 50OmM Imidazole, both in 50 mM Sodium Phosphate, 500 mM NaCl, 0.02% Azide pH 7.4. Eluted fractions were analyzed by SDS-PAGE, and those containing the target were pooled. Anti-His western analysis of pass-through indicated that all target bound.
- Recombinant Human IL17A CH6 was analyzed by SDS-PAGE (10% BisTris, Invitrogen, Carlsbad, CA) with 0.1% Coomassie R250 staining for protein and after transfer to nitrocellulose, by immunoblotting with Anti-His-HRP.
- the purified proteins were electrophoresed using an Invitrogen Novex's Xcell II mini-cell, and transferred to nitrocellulose (0.2 mm; Invitrogen, Carlsbad, CA) at ambient temperature at 600 mA for 45 minutes in a buffer containing 25 mM Tris base, 200 mM glycine, and 20% methanol.
- the filters were then blocked with 10% non-fat dry milk in 50 mM Tris, 150 mM NaCl, 5 mM EDTA, 0.05% Igepal (TBS) for 15 minutes at room temperature.
- the nitrocellulose was quickly rinsed, and the Anti-His-HRP antibody (1 :2500) was added.
- the blots were incubated overnight at 4 0 C, with gentle shaking. Following the incubation, the blots were washed three times for 15 minutes each in TBS, and then quickly rinsed in H 2 O.
- the blots were developed using commercially available chemiluminescent substrate reagents (Roche LumiLight), and the signal was captured using Lumi-Imager's Lumi Analyst 3.0 software (Boehringer Mannheim GmbH, Germany.)
- E. coli W3110 cells from a 2L bioreactor fermentation containing the human IL17F were washed with 50 mM Tris pH 8 containing 200 mM NaCl and 5 mM EDTA to remove any broth contaminants.
- 1.2 L of ice cold lysis buffer 50 mM Tris pH 8, 200 mM NaCl, 5 mM EDTA, 5 mM Benzamidine and 5 mM DTT was added to the 350 g cell pellet and homogenized using the Polytron tissue-grinder until all clumps were disrupted.
- the bacterial cells were lysed with three passes through a MicroFluidizer keeping the cell suspension chilled to 4 0 C.
- the final volume of the cell lysate was 1.73 L.
- the inclusion bodies in this lysate were pelleted by centrifuging 30 min at 20, 000 x g (12,000 rpm in a JA-14 rotor in a Beckman J2-21M centrifuge), 4 0 C in eight 250-ml centrifuge bottles.
- the inclusion bodies were washed three times with lysis buffer to remove any E. coli unbroken cells and large cellular debris from the pelleted inclusion body protein.
- the supernatant was carefully poured off the pellet and the inclusion bodies were washed by suspending the pellet in lysis buffer and completely homogenizing to wash out soluble proteins and cellular components.
- the washed inclusion bodies were recovered by centrifuging 30 min at 15,000 x g (12,000 rpm in JA-14 rotor), 4 0 C.
- One half of the washed inclusion bodies ( ⁇ 64 grams wet weight) were stored at -80 0 C in 250 ml bottles while the other half was processed further.
- the extracted protein consists of unfolded monomers, with sulfhydryl groups in the reduced state and sulphonated.
- tissue homogenizer the 64 g pellet was homogenized with 100 ml extraction buffer and clarified by centrifuging the suspension for two hours at 35,000 x g at 4 0 C.
- the 60 ml of clarified extract was evaluated by RP HPLC (28.4 mg/ml) and divided into four parts. Three parts were stored at
- the fourth part was used for preparing refolded IL17F.
- Ice cold refolding buffer (4 Liters) of the following composition was prepared; 0.75M Arginine, 55 mM MES (N-MorpholinoEthaneSulfonic acid), 10.56 mM NaCl, 0.44 mM KCl, 0.055% Peg 3.4 K (w/v), 1.1 mM EDTA, 440 mM Sucrose, 550 mM GuHCl, 1 mM GSH (reduced Glutithione), 1 mM GSSG (oxidized Glutithione), pH 6.5
- the refold mixture was put through a UF/DF process phase.
- the mixture was first concentrated, Vs 5K cutoff membrane, from 4 Liters down to approximately 475mL. At this stage, the concentrate was left gently stirring in the cold room overnight.
- a DiaFiltration phase was initiated transitioning the retentate buffer composition with 900 mL throughput of 2OmM Tris; 12OmM NaCl @ pH 8.0 buffer. As diafiltration proceeded, at fixed vessel volume of 475mL, clouding and flux rate reduction was apparent. The contents of the vessel were harvested at this point and centrifuged to remove the precipitate that had formed. RP HPLC analysis of the clarified solution indicated that no target had precipitated.
- the clarified mixture was diluted 1 : 1 (v/v) with 25mM Acetic acid @ pH 5.4.
- the conductivity measured 9.8 milli-Siemens matching that which was needed for binding to a cation exchange column step.
- An additional 0.68ml acetic acid was added, dropwise with simaltaneous titration (addition 2N NaOH) to keep pH at 5.4.
- simaltaneous titration addition 2N NaOH
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- General Chemical & Material Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Biomedical Technology (AREA)
- Diabetes (AREA)
- Neurosurgery (AREA)
- Neurology (AREA)
- Dermatology (AREA)
- Pulmonology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Rheumatology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Pain & Pain Management (AREA)
- Physical Education & Sports Medicine (AREA)
- Transplantation (AREA)
- Endocrinology (AREA)
- Hospice & Palliative Care (AREA)
- Hematology (AREA)
- Obesity (AREA)
- Ophthalmology & Optometry (AREA)
- Psychiatry (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Emergency Medicine (AREA)
- Peptides Or Proteins (AREA)
Applications Claiming Priority (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US80460206P | 2006-06-13 | 2006-06-13 | |
| US82466506P | 2006-09-06 | 2006-09-06 | |
| US82827706P | 2006-10-05 | 2006-10-05 | |
| US89141007P | 2007-02-23 | 2007-02-23 | |
| PCT/US2007/071152 WO2007147019A2 (en) | 2006-06-13 | 2007-06-13 | Il-17 and il-23 antagonists and methods of using the same |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP2044118A2 true EP2044118A2 (de) | 2009-04-08 |
Family
ID=38832829
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP07798524A Withdrawn EP2044118A2 (de) | 2006-06-13 | 2007-06-13 | Il-17- und il-23-antagonisten sowie verwendungsverfahren |
Country Status (7)
| Country | Link |
|---|---|
| US (3) | US7790862B2 (de) |
| EP (1) | EP2044118A2 (de) |
| JP (1) | JP2009540018A (de) |
| AU (1) | AU2007260787A1 (de) |
| CA (1) | CA2655372A1 (de) |
| IL (1) | IL195382A0 (de) |
| WO (1) | WO2007147019A2 (de) |
Families Citing this family (121)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ES2424353T3 (es) | 2003-07-08 | 2013-10-01 | Genentech, Inc. | Polipéptidos heterólogos IL-17 A/F y usos terapéuticos de los mismos |
| AU2005314089B2 (en) * | 2004-12-08 | 2011-03-03 | Cedars-Sinai Medical Center | Methods for diagnosis and treatment of Crohn's disease |
| US7910703B2 (en) | 2006-03-10 | 2011-03-22 | Zymogenetics, Inc. | Antagonists to IL-17A, IL-17F, and IL-23P19 and methods of use |
| EP2044118A2 (de) | 2006-06-13 | 2009-04-08 | Zymogenetics, Inc. | Il-17- und il-23-antagonisten sowie verwendungsverfahren |
| CA2660463C (en) | 2006-08-11 | 2013-07-16 | Schering Corporation | Antibodies to il-17a |
| US8414897B1 (en) | 2006-10-02 | 2013-04-09 | The Uab Research Foundation | Pathway for Th-17 cell development and methods utilizing same |
| TWI426918B (zh) | 2007-02-12 | 2014-02-21 | Merck Sharp & Dohme | Il-23拮抗劑於治療感染之用途 |
| US20100021917A1 (en) * | 2007-02-14 | 2010-01-28 | Cedars-Sinai Medical Center | Methods of using genes and genetic variants to predict or diagnose inflammatory bowel disease |
| CN103396489A (zh) * | 2007-02-23 | 2013-11-20 | 默沙东公司 | 工程改造的抗IL-23p19抗体 |
| PL2059534T3 (pl) | 2007-02-23 | 2012-09-28 | Merck Sharp & Dohme | Przeciwciała Anty-IL-23p19 wytworzone metodą inżynierii genetycznej |
| US20100190162A1 (en) * | 2007-02-26 | 2010-07-29 | Cedars-Sinai Medical Center | Methods of using single nucleotide polymorphisms in the tl1a gene to predict or diagnose inflammatory bowel disease |
| WO2008106579A2 (en) * | 2007-02-28 | 2008-09-04 | Cedars-Sinai Medical Center | The role of il-12, il-23 and il-17 receptors in inflammatory bowel disease |
| CN101668531B (zh) | 2007-02-28 | 2014-05-07 | 默沙东公司 | 用于治疗免疫病症的联合治疗 |
| US20100015156A1 (en) * | 2007-03-06 | 2010-01-21 | Cedars-Sinai Medical Center | Diagnosis of inflammatory bowel disease in children |
| US8486640B2 (en) | 2007-03-21 | 2013-07-16 | Cedars-Sinai Medical Center | Ileal pouch-anal anastomosis (IPAA) factors in the treatment of inflammatory bowel disease |
| WO2008134569A2 (en) * | 2007-04-26 | 2008-11-06 | Cedars-Sinai Medical Center | Diagnosis and treatment of inflammatory bowel disease in the puerto rican population |
| CA2683145C (en) | 2007-04-27 | 2018-06-12 | Katherine E. Lewis | Antagonists to il-17a, il-17f, and il-23p19 and methods of use |
| US20100144903A1 (en) * | 2007-05-04 | 2010-06-10 | Cedars-Sinai Medical Center | Methods of diagnosis and treatment of crohn's disease |
| US9305137B1 (en) | 2007-05-18 | 2016-04-05 | Cedars-Sinai Medical Center | Methods of identifying the genetic basis of a disease by a combinatorial genomics approach, biological pathway approach, and sequential approach |
| WO2009014263A1 (ja) * | 2007-07-26 | 2009-01-29 | Osaka University | インターロイキン6受容体阻害剤を有効成分とする眼炎症疾患治療剤 |
| US20100203009A1 (en) * | 2007-10-02 | 2010-08-12 | The Uab Research Foundation | Pathway for Th-17 Cell Development and Methods Utilizing Same |
| WO2009082624A2 (en) * | 2007-12-10 | 2009-07-02 | Zymogenetics, Inc. | Antagonists of il-17a, il-17f, and il-23 and methods of using the same |
| SI2274008T1 (sl) * | 2008-03-27 | 2014-08-29 | Zymogenetics, Inc. | Sestavki in metode za zaviranje PDGFRBETA in VEGF-A |
| KR20150002874A (ko) | 2008-05-05 | 2015-01-07 | 노비뮨 에스 에이 | 항-il-17a/il-17f 교차-반응성 항체 및 그의 사용 방법 |
| UA112050C2 (uk) * | 2008-08-04 | 2016-07-25 | БАЄР ХЕЛСКЕР ЛЛСі | Терапевтична композиція, що містить моноклональне антитіло проти інгібітора шляху тканинного фактора (tfpi) |
| WO2010019565A2 (en) * | 2008-08-12 | 2010-02-18 | Medlmmune, Llc | Anti-ephrin b2 antibodies and their use in treatment of disease |
| CN102202655B (zh) | 2008-08-27 | 2013-06-19 | 默沙东公司 | 基因工程抗IL-23p19抗体的冻干制剂 |
| US8790642B2 (en) | 2008-08-29 | 2014-07-29 | Genentech, Inc. | Cross-reactive and bispecific anti-IL-17A/F antibodies |
| US20110177969A1 (en) * | 2008-10-01 | 2011-07-21 | Cedars-Sinai Medical Center | The role of il17rd and the il23-1l17 pathway in crohn's disease |
| US20110189685A1 (en) * | 2008-10-22 | 2011-08-04 | Cedars-Sinai Medical Center | Methods of using jak3 genetic variants to diagnose and predict crohn's disease |
| SG2014010573A (en) * | 2008-11-12 | 2014-04-28 | Merck Sharp & Dohme | ßGI-IGG INTRON FOR ENHANCED ANTI-IGF1 R EXPRESSION |
| WO2010062858A1 (en) * | 2008-11-26 | 2010-06-03 | Allergan, Inc. | Il-17 antibody inhibitor for treating dry eye |
| US8211434B2 (en) * | 2008-11-26 | 2012-07-03 | Allergan, Inc. | KLK-13 antibody inhibitor for treating dry eye |
| US20110229471A1 (en) * | 2008-11-26 | 2011-09-22 | Cedars-Sinai Medical Center | Methods of determining responsiveness to anti-tnf alpha therapy in inflammatory bowel disease |
| AU2009327411A1 (en) | 2008-12-19 | 2010-06-24 | Merck Sharp & Dohme Corp. | Feed supplement for mammalian cell culture and methods of use |
| US9580752B2 (en) | 2008-12-24 | 2017-02-28 | Cedars-Sinai Medical Center | Methods of predicting medically refractive ulcerative colitis (MR-UC) requiring colectomy |
| US8137671B2 (en) | 2009-05-05 | 2012-03-20 | Genentech, Inc. | Anti-IL-17F antibodies |
| CN102482321B (zh) | 2009-06-22 | 2015-06-17 | 安姆根有限公司 | 使用化学控制的氧化还原态重折叠蛋白质 |
| WO2010151688A2 (en) | 2009-06-25 | 2010-12-29 | Amgen Inc. | Capture purification processes for proteins expressed in a non-mammalian system |
| WO2011017294A1 (en) | 2009-08-07 | 2011-02-10 | Schering Corporation | Human anti-rankl antibodies |
| WO2011032119A1 (en) | 2009-09-14 | 2011-03-17 | The Regents Of The University Of Colorado | Modulation of yeast-based immunotherapy products and responses |
| JO3244B1 (ar) | 2009-10-26 | 2018-03-08 | Amgen Inc | بروتينات ربط مستضادات il – 23 البشرية |
| MX2012005086A (es) * | 2009-10-30 | 2012-09-28 | Janssen Biotech Inc | Antagonistas de il-17a. |
| GB201013975D0 (en) | 2010-08-20 | 2010-10-06 | Imp Innovations Ltd | Method of treating desease |
| ES2776980T3 (es) | 2009-12-23 | 2020-08-03 | Merck Sharp & Dohme | Línea celular 3M |
| SG183443A1 (en) | 2010-03-01 | 2012-09-27 | Bayer Healthcare Llc | Optimized monoclonal antibodies against tissue factor pathway inhibitor (tfpi) |
| US20130011406A1 (en) * | 2010-03-26 | 2013-01-10 | Kolltan Pharmaceuticals, Inc. | Anti-kit antibodies and uses thereof |
| US20110311527A1 (en) * | 2010-06-16 | 2011-12-22 | Allergan, Inc. | IL23p19 ANTIBODY INHIBITOR FOR TREATING OCULAR AND OTHER CONDITIONS |
| SG190006A1 (en) | 2010-11-04 | 2013-06-28 | Boehringer Ingelheim Int | Anti-il-23 antibodies |
| AR085091A1 (es) | 2011-01-26 | 2013-09-11 | Kolltan Pharmaceuticals Inc | Anticuerpos anti-kit y sus usos |
| UA117218C2 (uk) | 2011-05-05 | 2018-07-10 | Мерк Патент Гмбх | Поліпептид, спрямований проти il-17a, il-17f та/або il17-a/f |
| CA2838211C (en) | 2011-06-10 | 2023-08-01 | Medimmmune Limited | Anti-pseudomonas psl binding molecules and uses thereof |
| US8946150B2 (en) | 2011-06-14 | 2015-02-03 | Medical Diagnostic Laboratories, LLC. | Polypeptides that bound to IL-23 receptor and inhibit binding of IL-23 and cell signaling thereof |
| USRE49026E1 (en) | 2011-06-14 | 2022-04-12 | Medical Diagnostic Laboratories, Llc | Polypeptides that bound to IL-23 receptor and inhibit binding of IL-23 and cell signaling thereof |
| EP2583979B1 (de) * | 2011-10-19 | 2015-12-16 | Effimune | Verfahren zur Vorbereitung von menschlichem IL-23 gerichtete Antikörper, gegen die p19 |
| HUE050985T2 (hu) | 2011-11-07 | 2021-01-28 | Medimmune Ltd | Pseudomonas PSL és PCRV elleni kötõmolekulát alkalmazó kombinációs terápiák |
| US9284283B2 (en) | 2012-02-02 | 2016-03-15 | Ensemble Therapeutics Corporation | Macrocyclic compounds for modulating IL-17 |
| NZ700802A (en) | 2012-05-03 | 2017-06-30 | Boehringer Ingelheim Int | Anti-il-23p19 antibodies |
| LT2852615T (lt) * | 2012-05-22 | 2019-02-11 | Bristol-Myers Squibb Company | Il-17a/f il-23 bispecifiniai antikūnai ir jų panaudojimai |
| WO2013180649A1 (en) * | 2012-05-31 | 2013-12-05 | Agency For Science, Technology And Research | Mixed multifunctional metal affinity surfaces for reducing aggregate content in protein preparations field |
| ES2729603T3 (es) | 2012-06-27 | 2019-11-05 | Merck Sharp & Dohme | Anticuerpos IL-23 antihumanos cristalinos |
| RU2681730C2 (ru) | 2012-07-25 | 2019-03-12 | Селлдекс Терапьютикс Инк. | Антитела против kit и их применения |
| EP3685855B1 (de) | 2012-10-05 | 2023-11-22 | Kadmon Corporation, LLC | Menschliche anti-vegfr-2-/kdr-antikörper |
| WO2014055999A2 (en) * | 2012-10-05 | 2014-04-10 | Kadmon Corporation, Llc | Treatment of ocular disorders |
| US9273093B2 (en) | 2012-10-11 | 2016-03-01 | Protagonist Therapeutics, Inc. | α4β7 peptide dimer antagonists |
| UA117466C2 (uk) | 2012-12-13 | 2018-08-10 | Мерк Шарп Енд Доме Корп. | СТАБІЛЬНИЙ СКЛАД У ВИГЛЯДІ РОЗЧИНУ АНТИТІЛА ДО IL-23p19 |
| EP3689369A1 (de) | 2013-03-15 | 2020-08-05 | Amgen, Inc | Verfahren zur behandlung von psoriasis unter verwendung eines anti-il-23-antikörpers |
| RS62633B1 (sr) | 2013-03-15 | 2021-12-31 | Protagonist Therapeutics Inc | Analozi hepcidina i njihove primene |
| WO2014143540A1 (en) | 2013-03-15 | 2014-09-18 | Amgen Inc. | Methods for treating crohn's disease using an anti-il23 antibody |
| CA2891557A1 (en) * | 2013-03-26 | 2014-05-22 | Pieris Ag | Novel specific-binding polypeptides and uses thereof |
| KR20240122922A (ko) | 2013-03-27 | 2024-08-13 | 세다르스-신나이 메디칼 센터 | Tl1a 기능 및 관련된 신호전달 경로의 저해에 의한 섬유증 및 염증의 완화 및 반전 |
| EP4105236A1 (de) | 2013-07-19 | 2022-12-21 | Cedars-Sinai Medical Center | Anti-tl1a (tnfsf15) antikörper zur behandlung von entzündlichen darmerkrankungen |
| RU2577228C2 (ru) * | 2014-03-14 | 2016-03-10 | Закрытое Акционерное Общество "Биокад" | Анти-il-17-антитела, способ их получения и способ применения |
| SI3143037T1 (sl) | 2014-05-16 | 2021-11-30 | Protagonist Therapeutics, Inc. | Antagonisti integrin alpha4beta7 tioeterskih peptidov |
| SG10201912019WA (en) | 2014-05-22 | 2020-02-27 | Pieris Pharmaceuticals Gmbh | Novel specific-binding polypeptides and uses thereof |
| CN113908269A (zh) | 2014-05-23 | 2022-01-11 | 塞尔德克斯医疗公司 | 嗜酸性粒细胞或肥大细胞相关病症的治疗 |
| TWI713453B (zh) | 2014-06-23 | 2020-12-21 | 美商健生生物科技公司 | 干擾素α及ω抗體拮抗劑 |
| ES3002087T3 (en) * | 2014-07-14 | 2025-03-06 | Gennova Biopharmaceuticals Ltd | A novel process for purification of rhu-gcsf |
| CN107206254B (zh) * | 2014-07-17 | 2021-08-24 | 领导医疗有限公司 | 白细胞介素-23受体的口服肽抑制剂以及其治疗炎症性肠病的用途 |
| EP3708679A1 (de) | 2014-07-24 | 2020-09-16 | Boehringer Ingelheim International GmbH | In der behandlung von il-23a-assoziierten erkrankungen nützlicher biomarker |
| MY192824A (en) | 2014-09-03 | 2022-09-12 | Boehringer Ingelheim Int | Compound targeting il-23a and tnf-alpha and uses thereof |
| WO2016054445A1 (en) | 2014-10-01 | 2016-04-07 | Protagonist Therapeutics, Inc. | Novel cyclic monomer and dimer peptides having integrin antagonist activity |
| WO2016054411A1 (en) | 2014-10-01 | 2016-04-07 | Protagonist Therapeutics, Inc. | NOVEL α4β7 PEPTIDE MONOMER AND DIMER ANTAGONISTS |
| AR102417A1 (es) | 2014-11-05 | 2017-03-01 | Lilly Co Eli | Anticuerpos biespecíficos anti-tnf- / anti-il-23 |
| AR103173A1 (es) | 2014-12-22 | 2017-04-19 | Novarits Ag | Productos farmacéuticos y composiciones líquidas estables de anticuerpos il-17 |
| IL321788A (en) | 2015-02-04 | 2025-08-01 | Boehringer Ingelheim Int | Methods of treating inflammatory diseases |
| EP3262411B1 (de) * | 2015-02-25 | 2022-04-06 | Vanderbilt University | Antikörper-vermittelte neutralisierung von marburg-virus |
| CA2978431C (en) | 2015-03-02 | 2023-10-24 | 180 Therapeutics Lp | Method of treating a localized fibrotic disorder using a tnf receptor 2 antagonist |
| EP3391905A1 (de) * | 2015-04-14 | 2018-10-24 | Boehringer Ingelheim International GmbH | Behandlung von asthma mittels antikörper gegen il-23a |
| EP3297673A4 (de) * | 2015-05-22 | 2019-05-08 | Memorial Sloan-Kettering Cancer Center | Für ein prame-peptid spezifische t-zell-rezeptor-ähnliche antikörper |
| MA41010B1 (fr) * | 2015-06-15 | 2020-01-31 | 4D Pharma Res Ltd | Compositions comprenant des souches bactériennes |
| US10787490B2 (en) | 2015-07-15 | 2020-09-29 | Protaganist Therapeutics, Inc. | Peptide inhibitors of interleukin-23 receptor and their use to treat inflammatory diseases |
| RU2018113694A (ru) | 2015-09-17 | 2019-10-17 | Эмджен Инк. | Прогноз клинического ответа на антагонисты ил-23 с использованием биомаркеров сигнального пути ил-23 |
| KR102802396B1 (ko) | 2015-11-27 | 2025-05-07 | 씨에스엘 리미티드 | Cd131 결합 단백질 및 이의 용도 |
| AU2016379157A1 (en) | 2015-12-22 | 2018-06-21 | Amgen Inc. | CCL20 as a predictor of clinical response to IL23-antagonists |
| CA3009834A1 (en) | 2015-12-30 | 2017-07-06 | Protagonist Therapeutics, Inc. | Analogues of hepcidin mimetics with improved in vivo half lives |
| CN109462996A (zh) | 2016-03-17 | 2019-03-12 | 西达-赛奈医疗中心 | 通过rnaset2诊断炎性肠病的方法 |
| WO2017165676A1 (en) | 2016-03-23 | 2017-09-28 | Protagonist Therapeutics, Inc. | METHODS FOR SYNTHESIZING α4β7 PEPTIDE ANTAGONISTS |
| WO2017205820A1 (en) * | 2016-05-27 | 2017-11-30 | The Board Of Trustees Of The Leland Stanford Junior University | Affinity matured broad spectrum antibodies to hepatitis c virus |
| US9611297B1 (en) * | 2016-08-26 | 2017-04-04 | Thrasos Therapeutics Inc. | Compositions and methods for the treatment of cast nephropathy and related conditions |
| JOP20190260A1 (ar) | 2017-05-02 | 2019-10-31 | Merck Sharp & Dohme | صيغ ثابتة لأجسام مضادة لمستقبل الموت المبرمج 1 (pd-1) وطرق استخدامها |
| AU2018263868A1 (en) | 2017-05-02 | 2019-12-12 | Merck Sharp & Dohme Llc | Formulations of anti-LAG3 antibodies and co-formulations of anti-LAG3 antibodies and anti-PD-1 antibodies |
| EP4092038A1 (de) | 2017-09-11 | 2022-11-23 | Protagonist Therapeutics, Inc. | Opioidagonistpeptide und verwendungen davon |
| EP4501952A3 (de) | 2018-02-08 | 2025-04-16 | Protagonist Therapeutics, Inc. | Konjugierte hepcidin-mimetika |
| WO2019191563A1 (en) * | 2018-03-29 | 2019-10-03 | Remd Biotherapeutics, Inc. | Treatment of autoimmune and inflammatory disorders using antibodies that bind interleukin-17a (il-17a) |
| EP3820883A4 (de) | 2018-07-12 | 2022-04-20 | Protagonist Therapeutics, Inc. | Peptidinhibitoren des interleukin-23-rezeptors und deren verwendung zur behandlung entzündlicher erkrankungen |
| CN112689643A (zh) | 2018-07-13 | 2021-04-20 | 阿斯特捷利康合作创业有限责任公司 | 用布雷库单抗治疗溃疡性结肠炎 |
| JP7467438B2 (ja) | 2018-10-18 | 2024-04-15 | メルク・シャープ・アンド・ドーム・エルエルシー | 抗rsv抗体の製剤及びその使用方法 |
| CN113015748B (zh) | 2018-10-31 | 2025-12-12 | 默沙东有限责任公司 | 抗人pd-1抗体晶体及其使用方法 |
| CN113316458B (zh) | 2018-11-07 | 2024-08-02 | 默沙东有限责任公司 | 抗lag3抗体和抗pd-1抗体的共制剂 |
| CN116082455A (zh) | 2019-07-10 | 2023-05-09 | 领导医疗有限公司 | 白细胞介素-23受体的肽抑制剂及其用于治疗炎症性疾病的用途 |
| TW202535466A (zh) | 2019-09-09 | 2025-09-16 | 德商百靈佳殷格翰國際股份有限公司 | 抗-il-23p19抗體調配物 |
| CA3164996A1 (en) | 2019-12-20 | 2021-06-14 | Novarock Biotherapeutics, Ltd. | Anti-interleukin-23 p19 antibodies and methods of use thereof |
| SI4090670T1 (sl) | 2020-01-15 | 2025-08-29 | Janssen Biotech, Inc. | Peptidni zaviralci receptorja interlevkina-23 in njihova uporaba za zdravljenje vnetnih bolezni |
| EP4090669A4 (de) | 2020-01-15 | 2024-11-20 | Janssen Biotech, Inc. | Peptidinhibitoren des interleukin-23-rezeptors und deren verwendung zur behandlung entzündlicher erkrankungen |
| WO2022087293A1 (en) * | 2020-10-22 | 2022-04-28 | Twist Bioscience Corporation | Methods and systems for detecting coronavirus |
| IL316550A (en) | 2020-11-20 | 2024-12-01 | Janssen Pharmaceutica Nv | Compositions of interleukin-23 receptor peptide inhibitors |
| IL310061A (en) | 2021-07-14 | 2024-03-01 | Janssen Biotech Inc | Peptide inhibitors linked to fatty residues of the interleukin-23 receptor |
| WO2023122211A2 (en) * | 2021-12-21 | 2023-06-29 | Duke University | Coronavirus antibodies and uses thereof |
| WO2024119065A2 (en) * | 2022-12-02 | 2024-06-06 | Jecho Laboratories, Inc. | Anti-mesothelin bispecific antibodies and methods of use |
| WO2025071335A1 (ko) * | 2023-09-27 | 2025-04-03 | 삼성바이오에피스 주식회사 | 항-il-17 항체의 안정한 액상 제형 |
Family Cites Families (41)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CO4810232A1 (es) | 1997-07-25 | 1999-06-30 | Schering Corp | Citoquinas de mamiferos y sus secuencias codificadoras |
| US6060284A (en) * | 1997-07-25 | 2000-05-09 | Schering Corporation | DNA encoding interleukin-B30 |
| AU2661199A (en) | 1998-02-06 | 1999-08-23 | Schering Corporation | Mammalian receptor proteins; related reagents and methods |
| DE69942607D1 (de) * | 1998-04-14 | 2010-09-02 | Chugai Pharmaceutical Co Ltd | Neues cytokinartiges protein |
| US7090847B1 (en) * | 1999-09-09 | 2006-08-15 | Schering Corporation | Mammalian cytokines; related reagents and methods |
| HK1044170B (en) | 1999-09-09 | 2008-08-01 | Merck Sharp & Dohme Corp. | Mammalian interleukin-12 p40 and interleukin b30. combinations thereof. antibodies. uses in pharmaceutical compositions |
| US7422743B2 (en) * | 2000-05-10 | 2008-09-09 | Schering Corporation | Mammalian receptor protein DCRS5;methods of treatment |
| AU2003253589A1 (en) | 2002-03-26 | 2003-11-10 | Centocor, Inc. | Epitope mapping using nuclear magnetic resonance |
| AU2003220557A1 (en) | 2002-03-26 | 2003-10-13 | Centocor, Inc. | Multiple sclerosis-related immunoglobulin derived proteins, compositions, methods and uses |
| JP4902961B2 (ja) | 2002-12-23 | 2012-03-21 | シェーリング コーポレイション | 哺乳動物サイトカインの用途;関連試薬 |
| ATE506987T1 (de) | 2002-12-31 | 2011-05-15 | Schering Corp | Il-27 et il-2 pour le traitement du cancer |
| US20040219150A1 (en) | 2003-02-06 | 2004-11-04 | Cua Daniel J. | Uses of mammalian cytokine; related reagents |
| SI1601694T1 (sl) | 2003-03-10 | 2010-01-29 | Schering Corp | Uporabe IL-23 antagonistov; sorodni reagenti |
| ES2424353T3 (es) | 2003-07-08 | 2013-10-01 | Genentech, Inc. | Polipéptidos heterólogos IL-17 A/F y usos terapéuticos de los mismos |
| US7485297B2 (en) * | 2003-08-12 | 2009-02-03 | Dyax Corp. | Method of inhibition of vascular development using an antibody |
| WO2005037314A1 (en) | 2003-08-20 | 2005-04-28 | Centocor, Inc. | Method for generating antibodies |
| AU2005215527B2 (en) * | 2004-02-17 | 2011-04-07 | Merck Sharp & Dohme Corp. | Methods of modulating IL-23 activity; related reagents |
| WO2005108616A1 (en) | 2004-05-03 | 2005-11-17 | Schering Corporation | Use of il-17 expression to predict skin inflammation; methods of treatment |
| US20050287593A1 (en) * | 2004-05-03 | 2005-12-29 | Schering Corporation | Use of cytokine expression to predict skin inflammation; methods of treatment |
| GB0417487D0 (en) | 2004-08-05 | 2004-09-08 | Novartis Ag | Organic compound |
| AR051444A1 (es) * | 2004-09-24 | 2007-01-17 | Centocor Inc | Proteinas derivadas de inmunoglobulina especifica de il-23p40, composiciones, epitopos, metodos y usos |
| GB0425569D0 (en) | 2004-11-19 | 2004-12-22 | Celltech R&D Ltd | Biological products |
| EP2292758A3 (de) * | 2004-12-20 | 2013-12-25 | Merck Sharp & Dohme Corp. | Verwendung von Säuger-Zytokin; verwandte Reagenzien |
| KR100631924B1 (ko) * | 2005-01-24 | 2006-10-04 | 삼성전자주식회사 | 반도체 설비의 잔류부산물 포집장치 |
| PT2452694T (pt) | 2005-06-30 | 2019-02-21 | Janssen Biotech Inc | Anticorpos anti-il-23, composições, métodos e utilizações |
| AU2006283194B9 (en) | 2005-08-25 | 2011-02-03 | Eli Lilly And Company | Anti-IL-23 Antibodies |
| US20070048306A1 (en) * | 2005-08-30 | 2007-03-01 | Giles-Komar Jill M | Method for generating anti-variable region monoclonal antibodies |
| LT1931710T (lt) * | 2005-08-31 | 2017-03-27 | Merck Sharp & Dohme Corp. | Rekombinantiniai anti-il-23 antikūnai |
| EP2322219A3 (de) | 2005-09-01 | 2013-06-05 | Merck Sharp & Dohme Corp. | Verwendung von IL-23- und IL-17-Antagonisten zur Behandlung von Augenentzündungsautoimmunerkrankungen |
| JP2009513680A (ja) | 2005-10-28 | 2009-04-02 | セントカー・インコーポレーテツド | 抗体の生成におけるb細胞増殖剤の使用 |
| WO2007076523A2 (en) | 2005-12-28 | 2007-07-05 | Centocor, Inc. | Markers and methods for assessing and treating psoriasis and related disorders |
| EA035459B1 (ru) | 2005-12-29 | 2020-06-19 | Сентокор, Инк. | Антитело против il-23p19 |
| CA2646478A1 (en) | 2006-03-10 | 2007-09-20 | Zymogenetics, Inc. | Antibodies that bind both il-17a and il-17f and methods of using the same |
| US7910703B2 (en) * | 2006-03-10 | 2011-03-22 | Zymogenetics, Inc. | Antagonists to IL-17A, IL-17F, and IL-23P19 and methods of use |
| EP1996577B1 (de) | 2006-03-21 | 2016-02-10 | Merck Sharp & Dohme Corp. | Heterocyclische substituierte pyridinverbindungen mit cxcr3-antagonistenaktivität |
| EP2044118A2 (de) | 2006-06-13 | 2009-04-08 | Zymogenetics, Inc. | Il-17- und il-23-antagonisten sowie verwendungsverfahren |
| CA2673231A1 (en) | 2006-12-22 | 2008-07-03 | Schering Corporation | Heterocyclic compounds with cxcr3 antagonist activity |
| CN103396489A (zh) | 2007-02-23 | 2013-11-20 | 默沙东公司 | 工程改造的抗IL-23p19抗体 |
| PL2059534T3 (pl) | 2007-02-23 | 2012-09-28 | Merck Sharp & Dohme | Przeciwciała Anty-IL-23p19 wytworzone metodą inżynierii genetycznej |
| CN101668531B (zh) | 2007-02-28 | 2014-05-07 | 默沙东公司 | 用于治疗免疫病症的联合治疗 |
| WO2009082624A2 (en) | 2007-12-10 | 2009-07-02 | Zymogenetics, Inc. | Antagonists of il-17a, il-17f, and il-23 and methods of using the same |
-
2007
- 2007-06-13 EP EP07798524A patent/EP2044118A2/de not_active Withdrawn
- 2007-06-13 AU AU2007260787A patent/AU2007260787A1/en not_active Abandoned
- 2007-06-13 CA CA002655372A patent/CA2655372A1/en not_active Abandoned
- 2007-06-13 JP JP2009515638A patent/JP2009540018A/ja active Pending
- 2007-06-13 US US11/762,738 patent/US7790862B2/en active Active
- 2007-06-13 WO PCT/US2007/071152 patent/WO2007147019A2/en not_active Ceased
-
2008
- 2008-11-19 IL IL195382A patent/IL195382A0/en unknown
-
2010
- 2010-08-27 US US12/870,199 patent/US8227579B2/en active Active
-
2012
- 2012-06-21 US US13/528,918 patent/US20120295310A1/en not_active Abandoned
Non-Patent Citations (1)
| Title |
|---|
| See references of WO2007147019A2 * |
Also Published As
| Publication number | Publication date |
|---|---|
| IL195382A0 (en) | 2011-08-01 |
| AU2007260787A1 (en) | 2007-12-21 |
| US20120295310A1 (en) | 2012-11-22 |
| WO2007147019A2 (en) | 2007-12-21 |
| WO2007147019A3 (en) | 2008-08-07 |
| CA2655372A1 (en) | 2007-12-21 |
| US7790862B2 (en) | 2010-09-07 |
| US20110059087A1 (en) | 2011-03-10 |
| US8227579B2 (en) | 2012-07-24 |
| JP2009540018A (ja) | 2009-11-19 |
| US20080095775A1 (en) | 2008-04-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8227579B2 (en) | IL-23 antagonists | |
| US10562967B2 (en) | Treating inflammation with IL-17/IL-23 bispecific antibodies | |
| EP2392597B1 (de) | IL-17A-, IL-17F- und IL-23P19-Antagonisten und Verwendungsverfahren | |
| US9416183B2 (en) | Methods of treating inflammatory diseases using antibodies that bind both IL-17A and IL-17F | |
| AU2007352412B2 (en) | Antibodies that bind both IL-17A and IL-17F and methods of using the same | |
| WO2009082624A2 (en) | Antagonists of il-17a, il-17f, and il-23 and methods of using the same | |
| EP2377887A1 (de) | IL-17A- und IL-17F-bindende Antikörper und Verfahren zur ihrer Anwendung | |
| HK1161276A (en) | Antagonists to il-17a, il-17f, and il-23p19 and methods of use |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20090112 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC MT NL PL PT RO SE SI SK TR |
|
| AX | Request for extension of the european patent |
Extension state: AL BA HR MK RS |
|
| 17Q | First examination report despatched |
Effective date: 20090717 |
|
| DAX | Request for extension of the european patent (deleted) | ||
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20120731 |