EP1636367A2 - Verfahren zur herstellung eines interessierenden rekombinanten proteins und so produziertes protein - Google Patents

Verfahren zur herstellung eines interessierenden rekombinanten proteins und so produziertes protein

Info

Publication number
EP1636367A2
EP1636367A2 EP04767394A EP04767394A EP1636367A2 EP 1636367 A2 EP1636367 A2 EP 1636367A2 EP 04767394 A EP04767394 A EP 04767394A EP 04767394 A EP04767394 A EP 04767394A EP 1636367 A2 EP1636367 A2 EP 1636367A2
Authority
EP
European Patent Office
Prior art keywords
protein
interest
integrin
fragment
alpha
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP04767394A
Other languages
English (en)
French (fr)
Inventor
Bernard Mouillac
Tuhnadri Sen
Jean-Louis Baneres
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Centre National de la Recherche Scientifique CNRS
Institut National de la Sante et de la Recherche Medicale INSERM
Original Assignee
Centre National de la Recherche Scientifique CNRS
Institut National de la Sante et de la Recherche Medicale INSERM
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Centre National de la Recherche Scientifique CNRS, Institut National de la Sante et de la Recherche Medicale INSERM filed Critical Centre National de la Recherche Scientifique CNRS
Publication of EP1636367A2 publication Critical patent/EP1636367A2/de
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70546Integrin superfamily
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67General methods for enhancing the expression
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/20Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C07K2319/21Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag

Definitions

  • the subject of the invention is a new process for producing protein of interest, in large quantity, which can be directly used for structural analyzes.
  • the invention also relates to the recombinant protein obtained.
  • the receptors coupled to G proteins constitute a super-family of membrane proteins characterized by 7 transmembrane domains (TM I to VII) which play a primordial role in intercellular communication and the reception of sensory signals [1].
  • RCPGs constitute the most important structural and functional family of membrane receptors. They represent in particular a significant part of the human genome known to date (at least 700 receptors, 0.5% of the genome). Expressed on the surface of all cells in an organism (from yeast to humans), they are activated by a very wide variety of extracellular messages.
  • peptides peptides, hormones, lipids, odorous molecules, light, nucleotides, nucleosides, taste molecules, etc.
  • Their activation leads to an intracellular cascade of signals via G proteins and results in a large number of cellular responses (for example cell division or contraction, neurotransmission).
  • RCPGs are involved in each physiological function.
  • the importance of these receptors as well as the knowledge of their cellular localization designates them as ideal targets for therapy. And indeed, we can estimate that almost 50% of the drugs on the market act via GPCRs.
  • GPCRs Many pathologies are the consequence of mutations in GPCRs, and their clinical manifestations are well known, we can cite for example blindness, nephrogenic diabetes insipidus, hypo- or hyperthyroidism, precocious puberty, obesity [2].
  • GPCRs are very difficult for various reasons: the transmembrane nature of these proteins and their hydrophobic nature make them difficult to handle and generally lead to a loss of functionality and to denaturation after solubilization; - obtaining them in their entire primary sequence remains very difficult. Most of the time, they are expressed in truncated form [5].
  • the RCPGs represent in this area of the production in large quantity of a protein only one example of the difficulties which one meets when it is a question of obtaining a significant quantity of a protein of interest.
  • the object of the present invention is to provide a method for producing a large quantity of a protein of interest, in particular RCPGs.
  • recombinant proteins particularly membrane proteins, very particularly RCPGs, comprising at least one fragment of an alpha integrin and the protein of interest
  • This strategy makes it possible in particular to obtain a production of said proteins in large quantities in microorganisms, particularly in bacteria.
  • the recombinant proteins of the invention are produced in bacteria, they accumulate in the inclusion bodies of the bacterial cytoplasm. It is then necessary to renaturate the proteins of interest in order to obtain them in active form in an amount compatible with a direct analysis of their structure, for example by X-ray crystallography or by nuclear magnetic resonance (NMR).
  • NMR nuclear magnetic resonance
  • the process of the invention can also allow the production of non-truncated proteins, particularly when applied to GPCRs.
  • Integrins form a family of structurally and functionally linked receptors that participate in cell-cell and cell-extracellular matrix interactions. All integrins are in the form of heterodimers of alpha and beta subunits, linked non-covalently. Based on their primary sequence, all alpha integrins have an N-terminal region made up of seven repeated amino acid sequences (repeat I to VII), each comprising approximately 60 amino acids. Some alpha subunits include an insertion domain (domain-I) of approximately 200 amino acids, located between repetitions II and III.
  • the homologies between repetitions I and VII essentially comprise consensus sequences FG and GAP, corresponding to the phenylalanine, glycyl-glycyl, alanyl, prolyl sequences, hence their name "FG-GAP repeat”.
  • the alpha subunit of integrins (also called integrin alpha (integrin ⁇ ) in the text) has never been used for the production of recombinant proteins of interest in cells other than cells of mammals and this in an amount directly compatible with a structural analysis of the protein of interest, which requires an amount of said protein which can range up to several milligrams.
  • the present invention aims to meet this requirement.
  • the primary object of the invention is the use of at least one fragment of an alpha integrin in the construction of at least one recombinant protein of interest.
  • the invention also relates to the use of at least one fragment of an alpha integrin for the production of at least one recombinant protein of interest.
  • recombinant protein or “recombinant protein of interest” refers to the recombinant protein produced according to the invention.
  • This recombinant protein can in particular comprise the chain of several (at least two) proteins of interest, fused, optionally separated by spacer sequences and / or cleavage sequences.
  • protein of interest refers to the peptide sequence corresponding to a protein of interest that one wants to produce (or that one has produced).
  • a "recombinant protein” consists of one or more "protein of interest” possibly separated by spacer sequences and / or cleavage sequences.
  • fragment of an alpha integrin is meant both the complete amino acid sequence of the alpha integrin used and a partial sequence.
  • the sequence of the integrin alpha used can be native or mutated.
  • the sequence used is a sequence comprising the N-terminal end of the alpha integrin used, even more preferably a sequence corresponding to the N-terminal end of the alpha integrin used.
  • the fragment of the alpha integrin used comprises at least the FG-GAP modules IV to VII and a portion of the FG-GAP III module of the alpha integrin used.
  • the fragment of the alpha integrin used can be a fragment of any known alpha integrin. Particular mention will be made of the integrins al, ⁇ 2, ⁇ 3, ⁇ 4, 5, 6, al, ⁇ , ⁇ 9, iO, garlic, ⁇ D, ⁇ E, ⁇ L, ⁇ M, ⁇ X, ⁇ llb or even ⁇ v.
  • a fragment of 287 amino acids is used, corresponding to the part of the N-terminal end of the alpha 5 integrin which extends between positions 231 and 517, depending on the numbering taking into account the presence of the signal peptide. If the signal peptide is not taken into account, the fragment which can be used in the invention extends from positions 190 (residue G) to 476 (residue G) of the alpha5 integrin.
  • the fragments which can be used according to the invention are the fragments homologous to the fragments defined above.
  • the fragment which can be used according to the invention corresponds to the part of the N-terminal end of the ⁇ V integrin which extends from positions 211
  • the fragment which can be used in the invention extends from positions 181 (residue G) to 465
  • the fragment usable according to the invention corresponds to the part of the N-terminal end of integrin ⁇ llb which extends from positions 224 (residue G) to 508 (residue Q), according to the numbering account for the presence of the signal peptide. If the signal peptide is not taken into account, the fragment which can be used in the invention extends from positions 193 (residue G) to 477 (residue Q) of the ⁇ 11b integrin.
  • the fragment of the alpha integrin used comprises at least one amino acid sequence chosen from the sequences SEQ ID No. 1 (fragment of the human integrin ⁇ £), SEQ ID No. 2 (fragment of human integrin V) and SEQ ID No. 3 (fragment of human ⁇ 11b integrin), from the sequence list provided in the appendix.
  • the fragment of the alpha integrin used comprises at least one amino acid sequence coded by one of the nucleotide sequences, chosen from the sequences SEQ ID No. 4 (fragment of 1 ' human integrin ⁇ 5), SEQ ID N ° 5 (fragment of human integrin V) and SEQ ID N ° 6 (fragment of human integrin ⁇ llb), from the sequence list provided in the appendix.
  • the fragment of the alpha integrin is used in the construction of several (at least two) proteins of recombinant interest.
  • the recombinant proteins will be fused during translation. This may prove necessary in the case of a protein of interest for which the construction according to the invention does not allow its direct production (refractory protein). It is then necessary to couple in tandem the sequence of said refractory protein to a recombinant protein of interest which the constructs according to the invention make it possible to produce.
  • the construction according to the invention will comprise at least one DNA fragment coding for at least one fragment of an alpha integrin, then at least one DNA coding for at least one first recombinant protein. of interest and at least one DNA encoding at least one second recombinant protein of interest.
  • the DNA encoding the second protein of interest will be inserted into the phase construction downstream of the DNA sequence encoding the first protein of interest.
  • the integrin alpha fragment is located in the recombinant protein of interest prepared according to the invention, upstream of the sequence of the protein of interest (or sequences of the proteins of interest) that the 'We aim to produce, that is to say on the N-terminal side of the recombinant protein of interest (or recombinant proteins of interest) that we seek to construct and / or produce.
  • the subject of the invention is also a recombinant protein characterized in that it comprises, fused, at least one fragment of an alpha integrin as defined above and at least one protein of interest.
  • the protein (s) of interest, part (s) of the recombinant protein of the invention can be any protein that it is desired to produce, particularly a membrane protein, very particularly a receptor coupled to proteins G (RCPGs).
  • vasopressin and oxytocin receptors Via, V2, OTR
  • BLT1, BLT2, CysLTl, CysLT2 leukotriene receptors
  • BLT1 leukotriene receptors
  • BLT2 CysLTl
  • CysLT2 adrenergic receptors
  • Beta 3 canabinoid receptors
  • CB1 canabinoid receptors
  • CCR5 chemokine receptors
  • ATI receptor for angiotensin II the bradykinin B2 receptor.
  • the recombinant protein of the invention can also comprise any amino acid sequence which makes it possible to purify it in an easy manner.
  • the recombinant protein can comprise a sequence of 6 histidine residues (tag 6xHIS).
  • This 6xHIS tag can be incorporated into the protein sequence for purification on a column of Ni-NTA (Nickel-nitrilotriacetic acid) agarose.
  • this sequence is at the C-terminal end of the recombinant protein of the invention.
  • the 6xHIS tag is preferably located downstream of the last of the proteins of interest which it is sought to produce.
  • sequence encoding the recombinant protein may further comprise at least one sequence encoding at least one endoprotease cleavage site.
  • the sequence coding for the last integrin residues can be mutated to constitute a cleavage site for an endoprotease (factor Xa, thrombin), which will allow, after expression and purification of the recombinant protein, to separate the protein of interest from its fusion partner.
  • the residue L (position 285) can be modified by mutation into a residue I, the residues E and G (positions 286 and 287) being preserved.
  • An additional R residue can be introduced by mutagenesis.
  • the sequence thus constituted (IEGR) corresponds to the cleavage site by factor Xa which cuts the protein after the residue R.
  • the cleavage site for factor Xa can be transformed into a cleavage site at the thrombin.
  • the residues I, E, and G can be replaced by residues L, V and P.
  • the residue R is kept in order to obtain the LVPR sequence.
  • the integrin fragment was incorporated into the 3 '' side vector by a BamHI site (ggatcc sequence)
  • the ggatcc sequence coding for two residues G and S is therefore obtained just after LVPR.
  • the LVPRGS chain constitutes the thrombin cleavage site, which cuts the protein after the residue R.
  • the recombinant protein of the invention comprises, from its N-terminal end to its end C-Terminal, the alpha integrin fragment comprising the endoprotease cleavage site, the protein (s) of interest and the tag 6xHIS.
  • the recombinant protein of the invention comprises, from its N-terminal end to its C-terminal end, the fragment of alpha integrin comprising the site of cleavage by factor Xa, the protein (s) ( s) of interest and the 6xHIS tag.
  • the recombinant protein of the invention comprises, from its N-terminal end to its C-terminal end, the fragment of alpha integrin comprising the site of cleavage by the thrombin, the protein (s) of interest and the 6xHIS tag.
  • the recombinant protein according to the invention comprises more than one protein of interest fused together, that said proteins of interest can be separated after their synthesis, for example before purification.
  • the recombinant protein may be necessary to make the cleavage of the recombinant protein even more efficient.
  • a sequence encoding a peptide sequence serving as a spacer arm preferably located upstream of the site of cleavage by an endoprotease.
  • the recombinant protein further comprises a peptide sequence serving as a spacer arm, preferably located upstream of the site of cleavage by an endoprotease.
  • the recombinant protein of the invention comprises, from its N-terminal end to its C-terminal end, the fragment of alpha integrin comprising a spacer arm and the site of cleavage by an endoprotease. , the protein (s) of interest and the 6xHIS tag.
  • the recombinant protein of the invention comprises, from its N-terminal end to its C-terminal end, the fragment of alpha integrin comprising a spacer arm, the site of cleavage by the factor Xa, the protein (s) of interest and the 6xHIS tag.
  • the recombinant protein of the invention comprises, from its N-terminal end to its C-terminal end, the alpha integrin fragment comprising a spacer arm, the site of cleavage by thrombin, the (or the) protein (s) of interest and the 6xHIS tag.
  • sequence coding for a peptide sequence serving as a spacer arm can be any sequence known to those skilled in the art allowing sufficient spacing of the site of cleavage by an endoprotease and the protein (s) of interest for the cleavage of the recombinant protein to be effective.
  • sequence coding for a peptide sequence serving as a spacer arm is the following sequence SEQ ID No. 7:
  • the recombinant protein of the invention comprises, from its N-terminal end to its C-terminal end, the fragment of alpha integrin comprising a spacer arm and the site of cleavage by an endoprotease, the protein (s) of interest, separated by one or more endoprotease cleavage sites (for example factor Xa or thrombin) and the tag 6xHIS.
  • Another subject of the invention is the use of at least one fragment of a nucleotide sequence coding for at least one fragment of an alpha integrin as defined above, in the construction of a sequence nucleotides encoding a recombinant protein of interest, as defined above.
  • the subject of the invention is also the use of at least one fragment of a nucleotide sequence coding for at least one fragment of an alpha integrin as defined above, for the production of a recombinant protein of interest such as defined above.
  • the subject of the invention is also a nucleotide sequence coding for a recombinant protein of interest comprising at least one fragment of a nucleotide sequence coding for at least one fragment of an alpha integrin, as defined above, and a nucleotide sequence coding for at least one protein of interest, as defined above.
  • the nucleotide sequence coding for at least one fragment of an alpha integrin usable according to the invention or included in the nucleotide sequence coding for a recombinant protein of interest according to the invention can be chosen from the nucleotide sequences SEQ ID No. 4, SEQ ID No. 5 and SEQ ID No. 6, from the sequence list provided in the appendix.
  • the subject of the invention is also a vector comprising a nucleotide sequence coding for a recombinant protein of interest, as defined above, comprising at least one fragment of a nucleotide sequence coding for at least one fragment of an alpha integrin and a nucleotide sequence encoding at least one protein of interest.
  • the vector can be a eukaryotic vector such as a plasmid or a virus.
  • the vector can also be any prokaryotic vector such as a plasmid or a phage.
  • the vector is an expression vector, that is to say capable of allowing the transcription and the translation of the sequence into nucleotides which it contains.
  • the vectors of the pET family sold by the company Novagen or those of the pGEX family sold by the company AmershamBiosciences are examples of expression vectors.
  • the invention also relates to a cell into which a nucleotide sequence coding for a recombinant protein of interest, as defined above, has been introduced.
  • the sequence was introduced in the form of a vector as defined above.
  • cell By cell is meant here both a eukaryotic cell and a prokaryotic cell, particularly a bacterium.
  • Any bacterium capable of allowing the expression of a protein from a nucleotide sequence can be used according to the invention.
  • the subject of the invention is also a method for producing at least one protein of interest, characterized in that in a first step, a nucleotide sequence coding for a recombinant protein of interest as defined above is introduced into a cell. , and that in a second step, the cell is placed in conditions sufficient to allow the expression of the recombinant protein of interest.
  • the method of the invention can also comprise an additional step during which the recombinant protein of interest can be cut by the action of an endoprotease (factor Xa, thrombin, for example), at the site created in the last residues integrin to separate the protein of interest from its fusion partner.
  • an endoprotease factor Xa, thrombin, for example
  • the method of the invention may also include an additional step during which the protein recombinant of interest, or the protein (s) of interest separated from its fusion partner (s), can be purified.
  • the nucleotide sequence coding for a recombinant protein of interest can be introduced into the cell by any known method.
  • any known method it is possible to cite for prokaryotic cells, thermal shock or electroporation.
  • electroporation the calcium phosphate precipitate method, the use of cationic polymers such as DEAE-dextran or any method using cationic liposomes or activated dendrimers.
  • Retroviruses can also be used to transfer genes, as can techniques using microprojectiles to deliver DNA to target cells.
  • any sufficient condition allowing the expression of the recombinant protein of interest known to those skilled in the art, can be used according to the method of the invention.
  • any method of purification of the protein (s), known to those skilled in the art, can be used according to the method of the invention.
  • the recombinant protein of interest comprises the tag 6xHIS
  • purification on a Nickel-nitrilotriacetic acid agarose (Ni-NTA) column represents a particularly satisfactory purification method within the framework of the process of the invention.
  • Ni-NTA Nickel-nitrilotriacetic acid agarose
  • Figure 1 shows a construction corresponding to a vector according to the invention.
  • FIG. 2 represents the production of the integrin fusion protein ⁇ 5-vasopressin receptor V2 according to the method of the invention (left column: molecular weights of proteins in the marker sample; arrow: position of the recombinant protein integrin ⁇ 5 - V2 receptor for vasopressin, NI: proteins from an uninduced sample, 2h, 3h and 4h: proteins from an induced sample after 2h, 3h and 4h of induction).
  • FIG. 3 represents the recombinant integrin protein ⁇ 5-V2 receptor for vasopressin of FIG. 2 after purification and migration on an electrophoresis gel.
  • left column molecular weights of proteins in the marker sample;
  • arrow position of the recombinant protein integrin ⁇ 5-vasopressin receptor V2
  • FIG. 4 represents the result of the purification of the recombinant fusion protein integrin ⁇ 5-V2 receptor-CXCR4 receptor ( ⁇ 5-V2-CXCR4) by affinity chromatography
  • FT sample not retained on the resin : wash fraction containing 15 mM imidazole
  • E100 purified fusion eluted in buffer containing 100 mM imidazole
  • the arrow indicates the position of the fusion protein ⁇ 5-V2-CXCR4.
  • Example 1 Construction of a vector allowing the expression in bacteria of a recombinant protein of interest:
  • a complementary DNA coding for the protein of interest which it is desired to express is positioned in the vector pET21a (+) (sold by the company Novagen) in phase with a DNA fragment complementary to the integrin ⁇ 5, by the use of appropriate restriction sites.
  • the fragment of the ⁇ 5 integrin is delimited by the NdeI and BamHI sites.
  • the Ndel site has the advantage of incorporating an ATG codon which is the codon initiating translation. This initiator codon codes for a methionine (M).
  • M methionine
  • the ATG of the NdeI site is positioned upstream of its nucleotide sequence.
  • the ATG will code for an M1 and the G of the integrin will be residue 2.
  • the fragment of 287 residues will be coupled to methionine 1 and therefore a fusion partner of 288 residues is obtained: M1-G288.
  • the vector directly provides the sequence coding for the tag 6xHIS which will be located at the C-terminal end of the recombinant protein of interest.
  • An EcoRI site is located in the vector on the side of the N-terminal end of the tag site.
  • Example 2 Expression of the human vasopressin V2 receptor: Construction of the vector:
  • Step 1 Preparation of the complementary DNA of the human vasopressin V2 receptor:
  • oligo sense (allows the incorporation of the BamHI site): 5 'ATG GGT CGC GGA TCC ATG CTC ATG GCG TCC ACC ACT TCC 3' oligo antisense (allows the incorporation of the EcoRI site) : 5 'CGA CGG AAT TCT GCG ATG AAG TGT CCT TGG CCA G 3'.
  • the PCR reaction is carried out in 50 microliters of a reaction mixture comprising:
  • amplified fragment is checked on 1% agarose gel.
  • Step 2 Purification of the amplified fragment (amplified PCR V2 fragment): The area of the agarose gel where the amplified DNA fragment is viewed is cut out and 1 ⁇ DNc is purified using the Qiaquick gel extraction purification kit kit
  • Step 3 Cutting of the PCR V2 fragment amplified by the BamHI and EcoRI enzymes:
  • the two enzymes are inactivated by heating to 80 ° C. for 20 minutes.
  • the PCR V2 fragment is then purified from a 1% agarose gel according to the protocol described above.
  • Step 3 Subcloning of the PCR V2 Fragment Amplified in the BamHI and EcoRI Sites of the Vector pET21a of Example 1:
  • the ligation is carried out by incubation at room temperature (20-25 ° C) for 4 hours in a medium comprising: PCR fragment V2 BamHI / EcoRI (100 to 200 ng) 8 ⁇ l vector pET21a (30 ng) cut with BamHI / EcoRI 3 .mu.l
  • the ligation product, integrin-human V2 vasopressin receptor fusion protein, is then used for a transformation of Rosetta bacteria (DE3) in order to carry out the receptor expression tests.
  • the vector obtained previously is then introduced into a Rosetta strain bacterium (DE3) by the thermal shock technique by following the transformation protocol recommended by the supplier, in this case Novagen.
  • the incubation medium is then spread on petri dishes containing LB agar medium + ampicillin at 100 micrograms / ml.
  • the dishes are incubated at 37 ° C for 16 hours.
  • the bacteria of a colony are then cultivated at 37 ° C. in 10 ml of LB medium containing 100 ⁇ g / ml of ampicillin (or its analogous to carbenicillin), and the cell suspension is stirred at 300 revolutions / minute.
  • Samples are taken 2, 3 or 4 hours after induction. For this, 1 ml of bacterial suspension, with an optical density of 0.6, is taken from each culture. The sample is centrifuged for 2 minutes at 12,000 rpm. The supernatant is removed and the pellet is resuspended in 60 ⁇ l of lysis buffer (25 mM Tris, pH 8.3, 185 mM glycine, 0.1% SDS).
  • lysis buffer 25 mM Tris, pH 8.3, 185 mM glycine, 0.1% SDS.
  • SDS deposition buffer (10% glycerol, 5% 2-mercaptoethanol, 25 mM Tris-HCl, pH 6.5, 8% SDS, bromophenol blue (some grains)
  • 10 ⁇ l of l 'lysed sample total protein extracts
  • 10 ⁇ l of l 'lysed sample total protein extracts
  • they are stained with Coomassie blue according to the usual techniques.
  • Figure 2 shows the results obtained. Induced samples are compared to controls not induced (NI) but having been cultured for an equivalent time. It is obvious that the fusion protein ⁇ 5-receptor V2, which has an apparent molecular weight around 65 kDa, constitutes one of the majority proteins of the bacterium, which is a condition required for a purification of the receptor in an amount compatible with analyzes of its structure via crystallography or NMR approaches.
  • Example 2 The result obtained in Example 2 was reproduced with the same efficiency, for other RCPGs, such as the ⁇ 3-adrenergic receptor, the BLT2, Cys-LTl and Cys-LT2 receptors of the leukotrienes LTB4, LTD4 and LTC, the cannabinoid type 1 receptor, the vasopressin receptor Via and the oxytocin receptor.
  • other RCPGs such as the ⁇ 3-adrenergic receptor, the BLT2, Cys-LTl and Cys-LT2 receptors of the leukotrienes LTB4, LTD4 and LTC, the cannabinoid type 1 receptor, the vasopressin receptor Via and the oxytocin receptor.
  • Example 4 Purification of the fusion protein integrin fragment ⁇ 5-vasopressin V2 receptor obtained in Example 2:
  • a colony isolated on LB agar + Ampicillin (100 ⁇ g / ml) is pricked and cultured in 10 ml of LB + carbenicillin culture medium (100 ⁇ g / ml).
  • the culture is carried out at 37 ° C., with stirring at 300 rpm.
  • the optical density of the culture reaches 0.6, the culture is stopped and stored in the refrigerator (this sample is called preculture).
  • 100 ml of LB culture medium + carbenicillin (100 ⁇ g / ml) are seeded with 2 ml of preculture and left at 37 ° C., at 300 rpm until the density culture optics reached 0.6.
  • 0.1 mM IPTG are then added to the culture in order to induce the expression of recombinant protein.
  • the culture is continued for approximately 3 hours, until an optical density of 2.4 is obtained (stimulation factor of 4).
  • the culture is then centrifuged at 4000 revolutions per minute for 5 minutes.
  • the supernatant is removed and the residue can be directly lysed or stored at -80 ° C.
  • the pellet is taken up by homogenization with a pipette in 6 ml of 20 mM Tris-HCl, pH 8.00 + protease inhibitors (leupeptin 5 ⁇ g / ml; benzamidine 10 ⁇ g / ml and PMSF 10 ⁇ g / ml) .
  • protease inhibitors leupeptin 5 ⁇ g / ml; benzamidine 10 ⁇ g / ml and PMSF 10 ⁇ g / ml
  • the bacteria are lysed by sonication using a Branson conical microprobe (duty cycle 50%, output control 5, frequency 1 burst per second for 30 seconds, then rest 30 seconds; this cycle is repeated 5 times).
  • the tube is kept in ice during sonication.
  • the medium is then centrifuged for 30 minutes at 15,000 rpm at 4 ° C. The supernatant is retained for control over one gel electrophoresis.
  • the pellet contains the protein of interest since it is accumulated in inclusion bodies.
  • the pellet is taken up by homogenization with a pipette in 5 ml of 20 mM Tris-HCl, pH 8.00. The lysis and centrifugation steps are repeated once.
  • the supernatants of the centrifugations are kept for control on an electrophoresis gel.
  • the pellet is taken up by homogenization with a pipette in 5 ml of Tris-HCl, pH 8.00, 1M urea. A magnetic bar is placed in the sample and the latter is stirred gently for 1 h 30 min. The tube is kept in ice during this step which corresponds to washing the inclusion bodies and makes it possible to eliminate membrane or cytoplasmic proteins associated with the inclusion bodies but which are considered to be contaminating with respect to the recombinant protein.
  • the whole is then centrifuged at 15,000 revolutions per minute for 30 minutes at 4 ° C.
  • the supernatant is kept for control on an electrophoresis gel.
  • the pellet is taken up by homogenization with a pipette in 5 ml of 20 mM Tris-HCl, pH 8.00, 6M urea, 0.2% SDS. A magnetic bar is placed in the sample and the latter is stirred gently for 3 hours in ice.
  • the protein of interest (the integrin fragment protein ⁇ 5-vasopressin V2 receptor) is then completely denatured.
  • the whole is then centrifuged at 15,000 revolutions per minute for 30 minutes at 4 ° C.
  • the supernatant contains the protein of interest and constitutes the sample which will be brought into contact with the Ni-NTA resin (Nickel-nitriloacetic acid) in order to purify the alpha5-V2 fusion by affinity chromatography.
  • Ni-NTA resin Nickel-nitriloacetic acid
  • 3 ml of Superflow agarose Ni-NTA resin (Qiagen, ref 30430) are balanced in 20 mM Tris-HCl, pH 8.00, 6M urea, 0.2% SDS, 150 mM NaCl, 5 mM imidazole. A sufficient amount of NaCl and imidazole is added to the sample containing the protein of interest to obtain a final concentration of 150 mM NaCl and 5 mM imidazole. The sample and the resin are brought into contact and incubated at 4 ° C. for 16 hours and with gentle shaking. The sample / resin mixture is placed in a plastic column. After decantation, the "flowthrough" fraction is recovered at a low flow rate, for checking on electrophoresis gel.
  • the resin is then washed with 3 x 9 ml of a 20 mM Tris-HCl solution, pH 8.00, 6M urea, 0.2% SDS, 150 mM NaCl, 20 mM imidazole, to remove all the proteins not retained. specifically on Nickel groups.
  • the washing eluates are kept for control on an electrophoresis gel.
  • the protein of interest is then detached from the resin by passing 3 ml of a 20 mM Tris-HCl solution pH 8.00, 6M urea, 0.2% SDS, 150 mM NaCl, 100 mM imidazole. An aliquot of the purified protein is stored for control on gel electrophoresis 1.
  • 10 ⁇ l of the medium containing the purified protein are mixed with 10 ⁇ l of SDS deposition buffer and the whole is deposited on an electrophoresis gel.
  • 10 ⁇ l of purified sample contain 5 to 10 ⁇ g of protein, ie in 3 ml of eluate, 1.5 to 3 mg of recombinant protein.
  • FIG. 3 shows the purified protein deposited on an electrophoresis gel.
  • the purified sample is dialyzed against a 20 mM Tris-HCl solution, pH 8.00, 6M urea, 150 mM NaCl to remove the SDS and imidazole.
  • the sample is placed in a Pierce dialysis cassette (M CO membrane of 10,000) and the dialysis is carried out in a beaker containing one liter of the buffer. Dialysis is carried out at 4 ° C for at least 24 hours.
  • the sample is recovered and the quantity of protein of interest obtained is measured by absorption measurement (excitation at 280 nM, absorption between 235 and 500 nM). In general, an OD of 1 to 1.5 is obtained, which is equivalent to a concentration of 0.5 to 1 mg / ml, which is equivalent to a concentration of the order of 10 ⁇ M.
  • the purified and denatured protein (because dissolved in 6M urea) is used for the renaturation tests.
  • Example 5 Construction of a vector allowing the simultaneous expression of two proteins of interest (here two RCPGs) in Escherichia coli and their purification.
  • a complementary DNA coding for a protein of interest in this case the human CXCR4 chemokine receptor, is inserted into the vector pET21a (+) - ⁇ 5V2 described previously in example 2.
  • This DNA must be in phase with that coding for the ⁇ 5V2 fusion and is positioned between the SacI and HindIII restriction sites for example.
  • the vector directly provides the sequence coding for the tag 6xHIS which will therefore be located at the C-terminal end of the CXCR4 receptor and will therefore allow its purification in a later step.
  • Step 1 Preparation of the DNA complementary to the human CXCR4 receptor.
  • Recognition sites for the restriction enzymes SacI and HindIII are added to either side of the sequence coding for the human CXCR4 receptor during a standard PCR reaction.
  • the complementary DNA of this receptor is amplified from the vector pET10 / D-TOPO (Invitrogen) in which it is subcloned and from two priming oligonucleotides making it possible to insert the restriction sites considered. Oligo sens (incorporation of the Sacl site): 5 'CGAGCTAAGGC GAGCTC A ATGGAAGGCATTAGCATTTATAC 3'
  • Oligo antisense incorporation of the HindIII site: 5 'CGACGGCCC AAGCTT GCTGCTATGAAAGCTGCTGCTTTC 3'
  • the PCR reaction is carried out in 50 microliters and is composed of: pET10 / D-TOPO 20 ng
  • the reaction parameters are: initial denaturation at 95 ° C for 2 minutes then 25 cycles: 95 ° C, 30 s; 55 ° C, 1 min; 72 ° C, 1.5 min then final elongation at 72 ° C, 10 min.
  • the presence of the amplified fragment is verified on 1% agarose gel.
  • Step 2 purification of the amplified fragment
  • the area of the agarose gel in which the amplified DNA fragment is viewed is cut out and the cDNA is purified using the Qiaquick gel extraction purification kit.
  • Step 3 cutting of the CXCR4 PCR fragment amplified by Sacl and HindIII
  • the PCR fragment amplified and cut with SacI is purified from an agarose gel according to the protocol described in step 2.
  • the PCR fragment amplified and cut with SacI / HindIII is purified from an agarose gel according to the protocol described in step 2.
  • Step 4 subcloning of the amplified and cut SacI / HindIII PCR fragment CXCR4 in the vector pET21a (+) - ⁇ 5V2. This step is carried out by ligation at room temperature for 16H00.
  • the vector obtained which codes for a triple integrin-V2 receptor-CXCR4 receptor fusion protein is then used for a transformation of the Rosetta bacteria (DE3) in order to express this fusion and to purify it.
  • Step 5 transformation of Rosetta bacteria.
  • Step 6 expression of the ⁇ 5V2-CXCR4 fusion
  • the LB culture medium is replaced by Hyperbroth medium (Athena Enzyme Systems) and the optimum induction time is 4 hours .
  • Step 7 purification of the ⁇ 5V2-CXCR4 fusion. This step is illustrated in Figure 4.
  • Example 4 Following the protocol of Example 4 to the letter but during the washing step of the agarose Ni-NTA resin, a concentration of 15 mM of imidazole instead of 20 mM is used in the washing solution. The elution is carried out at 100 mM as in Example 4.
  • the spacer arm can also be inserted upstream of the thrombin cleavage site just after the site

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Toxicology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Wood Science & Technology (AREA)
  • Cell Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
EP04767394A 2003-06-19 2004-06-18 Verfahren zur herstellung eines interessierenden rekombinanten proteins und so produziertes protein Withdrawn EP1636367A2 (de)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FR0307411A FR2856407B1 (fr) 2003-06-19 2003-06-19 Procede de production d'une proteine recombinante d'interet et proteine produite
PCT/FR2004/001538 WO2004113539A2 (fr) 2003-06-19 2004-06-18 Procede de production d’une proteine recombinante d’interet et proteine produite

Publications (1)

Publication Number Publication Date
EP1636367A2 true EP1636367A2 (de) 2006-03-22

Family

ID=33484572

Family Applications (1)

Application Number Title Priority Date Filing Date
EP04767394A Withdrawn EP1636367A2 (de) 2003-06-19 2004-06-18 Verfahren zur herstellung eines interessierenden rekombinanten proteins und so produziertes protein

Country Status (4)

Country Link
US (1) US20070149766A1 (de)
EP (1) EP1636367A2 (de)
FR (1) FR2856407B1 (de)
WO (1) WO2004113539A2 (de)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2631597C2 (ru) 2011-07-15 2017-09-25 Нусерт Сайенсиз, Инк. Композиции и способы модулирования метаболических путей
SG10201709195TA (en) 2012-11-13 2017-12-28 Nusirt Sciences Inc Compositions and methods for increasing energy metabolism
WO2019018270A1 (en) * 2017-07-21 2019-01-24 Conagen, Inc. PLASMID DEPENDENCE SYSTEM FOR DIRECTING THE EXPRESSION OF A DESIRED GENE

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1990006953A2 (en) * 1988-12-22 1990-06-28 Genentech, Inc. Method for preparing water soluble polypeptides
WO1998032771A1 (en) * 1997-01-29 1998-07-30 Toray Industries, Inc. Chimeric proteins, heterodimer complexes thereof and substitute for platelet

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2004113539A2 *

Also Published As

Publication number Publication date
WO2004113539A2 (fr) 2004-12-29
WO2004113539A3 (fr) 2005-06-16
US20070149766A1 (en) 2007-06-28
FR2856407A1 (fr) 2004-12-24
FR2856407B1 (fr) 2007-10-12

Similar Documents

Publication Publication Date Title
KR102827276B1 (ko) 아데노신 핵염기 편집제 및 그의 용도
KR101299417B1 (ko) 카복시-말단 아미드화 펩티드를 제조하는 방법
CN110914310A (zh) 胞嘧啶至鸟嘌呤碱基编辑器
JP6714902B2 (ja) ペプチドおよびタンパク質の発現のための方法
KR20150058478A (ko) 글루칸 중합체의 생성을 위한 글루코실트랜스퍼라제 효소
CA2637881A1 (en) Production of a soluble native form of recombinant protein by the signal sequence and secretional enhancer
CN111278979B (zh) 重组大肠杆菌天冬酰胺酶的生产方法
Garza-Sánchez et al. Amino acid starvation and colicin D treatment induce A-site mRNA cleavage in Escherichia coli
EP2906593B1 (de) Verfahren zur herstellung von rekombinantem c1q-protein
Basalla et al. An invariant C-terminal tryptophan in McdB mediates its interaction and positioning function with carboxysomes
JP2842693B2 (ja) 宿主細胞中でのタンパク質の過剰発現のための方法およびdna発現システム
WO2004113539A2 (fr) Procede de production d’une proteine recombinante d’interet et proteine produite
WO2004000879A1 (fr) Polynucleotides et polypeptides codes par lesdits polynucleotides impliques dans la synthese de derives des dicetopiperazines____
EP0252894A2 (de) Somatokrinin und alpha-Antitrypsin enthaltende Hybridpolypeptide, Verfahren zu deren Herstellung von Bakterienklonen, und deren Verwendung zur Herstellung von Somatokrinin
TWI282370B (en) Improved method for the recombinant production of polypeptides
TWI283246B (en) Removal of N-terminal methionine from proteins by engineered methionine aminopeptidase
FR2550800A1 (fr) Vecteur plasmide ameliore et son utilisation
JP2010119322A (ja) シャペロニン変異体およびこれをコードするdna
JP2005514028A (ja) 融合タンパク質
JP3172968B2 (ja) Il―16の多量体形態、それらを生産するための方法及びそれらの使用
EP4416291B1 (de) Verfahren zur reinigung eines proteins von interesse und mittel zur durchführung des verfahrens
JP2003339385A5 (de)
JP4917542B2 (ja) 新規dnaポリメラーゼ
CN108342370A (zh) 一种新型果糖基肽氧化酶及其应用
KR100339151B1 (ko) 인간근세포성장인자

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20051229

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PL PT RO SE SI SK TR

DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20091029