EP1603898A2 - Derives chimiques se liant de maniere tres specifique aux structures d adn en g-quadruplexe et leur application comme agent anticancereux specifique - Google Patents

Derives chimiques se liant de maniere tres specifique aux structures d adn en g-quadruplexe et leur application comme agent anticancereux specifique

Info

Publication number
EP1603898A2
EP1603898A2 EP04708378A EP04708378A EP1603898A2 EP 1603898 A2 EP1603898 A2 EP 1603898A2 EP 04708378 A EP04708378 A EP 04708378A EP 04708378 A EP04708378 A EP 04708378A EP 1603898 A2 EP1603898 A2 EP 1603898A2
Authority
EP
European Patent Office
Prior art keywords
amide
methyl
formula
products
pyridine
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP04708378A
Other languages
German (de)
English (en)
French (fr)
Inventor
Augustin Hittinger
Thomas Caulfield
Patrick Mailliet
Hervé Bouchard
Eliane Mandine
Jean-Louis Mergny
Lionel Guittat
Jean-François RIOU
Dennis Gomez
Chafke Belmokhtar
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Centre National de la Recherche Scientifique CNRS
Aventis Pharma SA
Institut Curie
Museum National dHistoire Naturelle
Universite de Reims Champagne Ardenne URCA
Commissariat a lEnergie Atomique et aux Energies Alternatives CEA
Original Assignee
Centre National de la Recherche Scientifique CNRS
Commissariat a lEnergie Atomique CEA
Aventis Pharma SA
Institut Curie
Museum National dHistoire Naturelle
Universite de Reims Champagne Ardenne URCA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Centre National de la Recherche Scientifique CNRS, Commissariat a lEnergie Atomique CEA, Aventis Pharma SA, Institut Curie, Museum National dHistoire Naturelle, Universite de Reims Champagne Ardenne URCA filed Critical Centre National de la Recherche Scientifique CNRS
Publication of EP1603898A2 publication Critical patent/EP1603898A2/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D401/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/12Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings linked by a chain containing hetero atoms as chain links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/18Drugs for disorders of the alimentary tract or the digestive system for pancreatic disorders, e.g. pancreatic enzymes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/08Drugs for disorders of the urinary system of the prostate
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/10Drugs for disorders of the urinary system of the bladder
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/12Drugs for disorders of the urinary system of the kidneys
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00Drugs for genital or sexual disorders; Contraceptives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00Drugs for disorders of the endocrine system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D215/00Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems
    • C07D215/02Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom
    • C07D215/16Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D215/38Nitrogen atoms
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D401/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/14Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing three or more hetero rings

Definitions

  • the present invention relates to cancer therapy and relates to new anticancer agents having a specific mechanism of action. It also relates to a selection of chemical compounds as well as their therapeutic application in humans.
  • the present invention relates to the use of new non-nucleotide chemical compounds which interact with specific structures of deoxyribonucleic acid (DNA) or ribonucleic acid (RNA).
  • DNA deoxyribonucleic acid
  • RNA ribonucleic acid
  • These new compounds consist of a distributing agent linked to two nitrogen heteroaromatic groups, at least one of the nitrogen atoms of which is in quaternized form. They are particularly useful for very selectively stabilizing DNA folded into G-quadruplex structure (tetrads of guanines), as well when the G-quadruplex is formed by one, two or four strands of DNA.
  • These new compounds are useful in the treatment of cancers and act in particular as telomerase inhibiting agents.
  • telomerase inhibition via the stabilization of these G-quadruplexes can either be the arrest of cell mitosis and the death of rapidly dividing cells within one to a few weeks by a deprotection mechanism telomeric DNA, the induction of cancer cell senescence, as a result of the progressive shortening of telomeric DNA (Oncogene 2002, 21, 553-63; Oncogene 2002, 21, 592-97).
  • Another therapeutic application, in the treatment of cancer, of the stabilization of DNA structures in G-quadruplex can be done by the inactivation of the promoter regions, rich in repetitions of guanines, oncogenes such as c-myc (J Biol. Chem. 2001, 276, 4640-46; Proc.
  • Another therapeutic application, in the treatment of cancer, of the stabilization of DNA structures in G-quadruplexes can be the inhibition of helicases specific for DNA structures in G-quadruplexes, involved in mitosis. These helicases are also directly involved in various genetic diseases such as Bloom's syndromes (Cell 1995, 83, 655-66), Werner (Science 1996, 272, 258-62), Rothmund-Thomson (Nature Genetics 1999, 22, 82-4) or ataxia telangiectaxis.
  • the compounds of the present invention have in particular the advantage from the therapeutic point of view of blocking telomerase.
  • telomerase makes it possible to add repeated DNA sequences of the TTAGGG type, called telomeric sequences, at the end of the telomer, during cell division.
  • telomerase makes the cell immortal. Indeed, in the absence of this enzymatic activity, the cell loses 100 to 150 bases per division, which makes it quickly senescent.
  • telomeres maintained at a stable length during cell division.
  • the telomerase was highly activated and that it allowed the addition of repeated motifs of telomeric sequences at the end of the telomer and therefore allowed the conservation of the length of the telomer. It has been shown for some time that more than 85% of cancer cells have positive tests for the presence of telomerase while somatic cells do not have this characteristic.
  • telomerase is thus a highly wished target for treating cancer cells.
  • the first obvious approach to blocking telomerase was the use of nucleotide structures (Proc. Natl. Acad. Sci. USA 1996, 93, 2635-39). Since then, various approaches have been developed to inhibit telomerase (Curr. Pharm. Des. 2002, 8, 2491-504). Among these approaches, the development of DNA ligands in G-quadruplexes is arousing growing interest (Mini Rev. Med. Chem. 2003, 3, 11-21).
  • telomestatin a molecule capable of binding to a G-quadruplex DNA structure, in a very selective manner compared to a double stranded DNA (J. Amer. Chem. Soc. 2001, 123, 1262-1263).
  • a highly selective DNA molecule in G-quadruplex will have the double advantage of targeting DNA structures in G-quadruplex while avoiding undesirable mechanisms of toxicity linked to non-selective attachment to the genome.
  • WO 0296903 describes the preparation of heterocyclic diamides of general formula (I) below, as DNA ligands in G-quadruplex and their use as telomerase inhibitors: (I) nitrogen aromatic cycle - (NR 3 ) p - (CO) n- distributor - (CO) m - (NR ' 3 ) q - aromatic or non-aromatic cycle with n, m, p and q identical or different represent l 'integer 0 or 1, in which
  • Ra and Rb which are identical or different, represent hydrogen or a C1-C4 alkyl radical or
  • Ra and Rb which are identical or different, represent hydrogen or a C1-C4 alkyl radical or
  • a triazine group optionally substituted by one or more radicals chosen from halogen atoms, alkyl radicals having 1 to 4 carbon atoms and thio, oxy or amino radicals themselves optionally substituted by one or more short-chain alkyl chains containing 1 to 4 carbon atoms or 0 a heterocyclic radical containing 5 to 6 links containing a sulfur, oxygen or nitrogen atom
  • a phenyl radical -NH-phenyl-NH-, -NH-phenyl-CH2- NH-, -NH-CH2-phenyl-CH2-NH-, -NH-CH2-phenyl-NH-, -CH2- phenyl- CH2-, -CH2-phenyl, -phenyl-CH2-, -CH2-thienyl-, -thienyl-CH2-, the radical -CH ⁇ CH-, or
  • Ra and Rb which are identical or different, represent hydrogen or a C1-C4 alkyl radical or
  • Ra and Rb which are identical or different, represent hydrogen or a C1-C4 alkyl radical or
  • a phenyl ring optionally substituted by a halogen group, C1-C4 alkoxy, cyano, carbonylamino optionally substituted by one or more C1-C4 alkyl groups, guanyl, alkylthio in C1-C4, amino, C1-C4 alkylamino, dialkylamino in C1-
  • heterocyclic ring aromatic or non-aromatic, mono or bi or tricyclic comprising 0 to 2 heteroatoms per cycle provided that at least one heteroatom is present in at least one ring optionally substituted by one or more C1-C4 alkyl groups or by C1-C4 alkylene or C2-C4 alkenylene groups, the heteroatom of which, when it represents a nitrogen atom, may optionally be in quaternary form.
  • R3 and R'3, identical or different, independently of one another represent hydrogen or a C1-C4 or aralkyl alkyl radical, the alkyl part of which is C1-C4.
  • • X represents a single bond, or a straight or branched C1-C4 alkyl radical, a C2-C4 alkenyl radical, a C2-C4 alkynyl radical or a phenyl radical.
  • a phenyl radical or 0 a diazine or triazine group
  • the heterocyclic, phenyl, diazine or triazine radicals being optionally substituted by one or more radicals chosen from halogen atoms, alkyl radicals having 1 to 4 carbon atoms and thio, oxy or amino radicals themselves optionally substituted by one or more short chain alkyl chains containing 1 to 4 carbon atoms.
  • Said products of formula (IB) can in all the possible racemic isomeric, enantiomeric and diastereoisomeric forms, as well as the addition salts with mineral and organic acids or with the mineral and organic bases of said products of formula (IB).
  • the compounds described in the present invention :
  • alkyl or alk radical denotes a linear or branched radical containing at most 12 carbon atoms chosen from the methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl radicals, isopentyl, sec-pentyl, tert-pentyl, neo-pentyl, hexyl, isohexyl, sec- hexyl, tert-hexyl and also heptyl, octyl, nonyl, decyl, undecyl and dodecyl, as well as their linear or branched position isomers, On more particularly cites the alkyl radicals having at most 6 carbon atoms and in particular the methyl, ethyl, propyl, isopropyl, n-butyl, isobutyl, terbutyl, linear
  • alkenyl radical designates a linear or branched radical containing at most 12 carbon atoms and preferably 4 carbon atoms chosen, for example, from the following values: ethenyl or vinyl, propenyl or allyl, 1-propenyl, n-butenyl, i- butenyl, 3-methylbut-2-enyl, n-pentenyl, hexenyl, heptenyl, octenyl, cyclohexylbutenyl and decenyl as well as their linear or branched position isomers.
  • the alkenyl values the allyl or butenyl values are more particularly cited.
  • alkynyl radical designates a linear or branched radical containing at most 12 carbon atoms and preferably 4 carbon atoms chosen for example from the following values: ethynyl, propynyl or propargyl, butynyl, n-butynyl, i-butynyl, 3- methylbut-2-ynyl, pentynyl or hexynyl as well as their linear or branched position isomers.
  • the propargyl value is more particularly cited.
  • aryl radical denotes unsaturated radicals, monocyclic or made up of condensed, carbocyclic rings.
  • aryl radical mention may be made of phenyl or naphthyl radicals. Mention is more particularly made of the phenyl radical.
  • arylalkyl is meant the radicals resulting from the combination of the alkyl radicals mentioned above optionally substituted and the aryl radicals also mentioned above, optionally substituted: mention is made, for example, of the benzyl, phenylethyl, 2-phenethyl, triphenylmethyl or naphthlenemethyl radicals.
  • heterocyclic radical denotes a saturated (heterocycloalkyl) or unsaturated (heteroaryl) carbocylic radical consisting of at most 6 links interrupted by one or more heteroatoms, identical or different, chosen from oxygen, nitrogen or sulfur atoms.
  • heterocycloalkyl radicals mention may be made in particular of radicals dioxolane, dioxane, dithiolane, thiooxolane, thiooxane, oxiranyl, oxolanyl, dioxolanyl, piperazinyl, piperidinyl, pyrrolidinyl, imidazolidinyl, pyrazolidinyl, morpholinyl or tetrahydrofuryl, tetrahydrothienyl, chromanyl, dihydrobenzofuranyl, indolinyl, piperidyl, perhydropyranyl, pyrindolinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl or thioazolidinyl , all these radicals being optionally substituted.
  • heterocycloalkyl radicals mention may in particular be made of the optionally substituted piperazinyl, optionally substituted piperidinyl, optionally substituted pyrrolidinyl, imidazolidinyl, pyrazolidinyl, morpholinyl or thioazolidinyl radicals.
  • heterocycloalkylalkyl radical is meant the radicals in which the heterocycloalkyl and alkyl radicals have the above meanings.
  • the furyl radicals such as 2-furyl, thienyl such as 2-thienyl and 3-thienyl, pyrrolyl , diazolyle, thiazolyle, thiadiazolyle, thiatriazolyle, isothiazolyle, oxazolyle oxadiazolyle, 3- or 4-isoxazolyle, imidazolyle, pyrazolyle, isoxazolyle.
  • 6-membered heteroaryl radicals such as 2-pyridyl, 3-pyridyl and 4-pyridyl, pyrimidyl, pyrimidinyl, pyridazinyl, pyrazinyl and tetrazolyl.
  • heteroaryl radicals containing at least one heteroatom chosen from sulfur, nitrogen and oxygen mention may, for example, be made of benzothienyl such as 3-benzothienyl, benzofuryl, benzofurannyl, benzopyrrolyl, benzimidazolyl, benzoxazolyl, thionaphthyl, indolyl, purinyl, quinoline, isoquinoline and naphthyridinyl.
  • heteroaryl radicals mention may be made more particularly of the benzothienyl, benzofurannyl, indolyl or quinolinyl, benzimidazolyl, benzothiazolyl, furyl, imidazolyl, indolizinyl, isoxazolyl, isoquinolinyl, isothiazolyl, pyridinyl, pyridinyl, pyridinyl radicals. , quinazolinyl, 1,3,4-thiadiazolyl, thiazolyl, thienyl and triazolyl groups, these radicals being optionally substituted as indicated for the heteroaryl radicals.
  • R3 and R'3, identical or different represent independently of one another hydrogen or an alkyl radical in C1 -C4 or aralkyl in which the alkyl radical is C1-C4,
  • X represents a single bond, a C1-C4 alkyl radical, a C2-C4 alkenyl or alkynyl radical or a phenyl radical, the other substituents being chosen from the values indicated above.
  • nitrogen aromatic ring means a heterocycle comprising at least one nitrogen atom or an aromatic group not comprising a heteroatom in the ring but containing at least one nitrogen atom in a hydrocarbon chain linked to the cycle such as a guanidino or guanyl chain.
  • quinoline units can be substituted by any other group which does not intervene in the intended application, thus acridine or isoquinoline or quinazoline or quinoxaline or phthalazine or benzothiazine or benzoxazine or phenoxazine or phenothiazine groups are included in the definition of quinoline groups.
  • Preferred among all of the above compounds are those comprising a distributor chosen from heterocyclic groups such as for example pyridyl, or thienyl, a phenyl radical, a diazine or a triazine.
  • a distributor chosen from heterocyclic groups such as for example pyridyl, or thienyl, a phenyl radical, a diazine or a triazine.
  • diazine groups it is preferred to use pyridazines.
  • Particularly preferred among all of the above compounds are those comprising a meta-disubstituted distributor by the groups "nitrogen aromatic ring having a nitrogen atom in quaternary form - (NR 3 ) p - CO” and "(CO) m - (NR ' 3 ) q - aromatic or non-aromatic cycle "as defined above and in which the distributor is moreover optionally substituted by a halogen atom.
  • Preferred among all of the above compounds are those comprising a meta-disubstituted distributor by the groups "nitrogen aromatic ring having a nitrogen atom in quaternary form - (NR 3 ) p - CO" and "(CO) m - (NR ' 3 ) q - aromatic or non-aromatic cycle "as defined above.
  • nitrogen aromatic ring having a nitrogen atom in quaternary form - (NR 3 ) p - CO” and "(CO) m - (NR ' 3 ) q - aromatic or non-aromatic cycle "as defined above.
  • the heterocycle in quaternary form is a quinoline.
  • the compounds defined above are particularly preferred, characterized in that m, p and q represent the integer 1.
  • the compounds of the present invention very particularly preferred are those compounds whose distributor represents a pyridine-2,6-disubstituted or a pyridazine-2-6-disubstituted by the groups "nitrogen aromatic cycle having a quaternary nitrogen atom in quaternary form - (NR 3 ) p - CO" and "(CO) m - (NR ' 3 ) q - aromatic cycle or non-aromatic "and in which the quaternized heterocycle is an N-methyl-quinolinium, and in which the distributor is moreover optionally substituted by a halogen atom.
  • the compounds of the present invention very particularly preferred are those compounds whose distributor represents a pyridine-2,6-disubstituted or a pyridazine-2-6-disubstituted by the groups "aromatic nitrogen ring having a quaternary nitrogen atom under quaternary form - (NR 3 ) p - CO "and” (CO) rn - (NR ' 3 ) q - aromatic or non-aromatic cycle "and whose quaternized heterocycle is an N-methyl-quinolinium.
  • the present invention particularly relates in particular to the products of formula (IB) as defined above, characterized in that they correspond to the formula (la) below:
  • the heterocyclic, phenyl, diazine or triazine radicals being optionally substituted by one or more radicals chosen from halogen atoms, alkyl radicals having 1 to 4 carbon atoms and thio, oxy or amino radicals themselves optionally substituted by one or more short-chain alkyl chains containing 1 to 4 carbon atoms,
  • An and Ar 2 identical or different represent when A and Ar 2 are identical, they represent a nitrogen aromatic cycle having a quaternary atom represented by a quinoline optionally substituted by at least
  • Ra and Rb which are identical or different, represent hydrogen or a C1-C4 alkyl radical or
  • a phenyl ring optionally substituted by a halogen group, C1-C4 alkoxy, cyano, carbonylamino optionally substituted by one or more C1-C4 alkyl groups, guanyl, C1-C4 alkylthio, amino, C1-C4 alkylamino, dialkylamino in C1-C4 for each alkyl, nitro, C1-C4 alkyleneamino or C2-C4 alkenyleneamino
  • heterocyclic aromatic or non-aromatic mono or bi or tricyclic ring comprising 0 to 2 heteroatoms per cycle provided that at least one heteroatom is present in at least one cycle optionally substituted by one or more C1-C4 alkyl groups or by C1-C4 alkylene or C2-C4 alkenylene groups,
  • R3 and R'3, identical or different, independently of one another represent hydrogen or a C1-C4 or aralkyl alkyl radical in which the alkyl radical is C1-C4,
  • X represents a single bond, a C1-C4 alkyl radical, a C2-C4 alkenyl or alkynyl radical or a phenyl radical, said products of formula (la) being in all the possible racemic, enantiomeric and diastereomeric isomeric forms , as well as the addition salts with mineral and organic acids or with mineral and organic bases of said products of formula (la).
  • a subject of the present invention is therefore the products of formula (la) as defined above in which X represents a C1-C4 alkyl radical, the other substituents of the products of formula (la) being chosen from the values indicated below above, said products of formula (la) being in all the possible racemic isomeric, enantiomeric and diastereoisomeric forms, as well as the addition salts with mineral and organic acids or with mineral and organic bases of said products of formula (la ).
  • a subject of the present invention is thus the products of formula (la) as defined above in which characterized in that A is chosen from heterocyclic groups, such as for example pyridyl or thienyl, a phenyl radical, a diazine or a triazine as defined above.
  • heterocyclic groups such as for example pyridyl or thienyl, a phenyl radical, a diazine or a triazine as defined above.
  • a subject of the present invention is thus the products of formula (la) as defined above, characterized in that the diazine groups that A can represent are pyrazines.
  • the present invention thus particularly relates to the products of formula (la) as defined above, characterized in that A is metasubstituted by the groups “aromatic nitrogen ring having a nitrogen atom in quaternary form - (NR 3 ) p - CO "and” (CO) m - (NR ' 3 ) q - aromatic or non-aromatic ring "as defined above and in which A is additionally optionally substituted by a halogen atom.
  • a subject of the present invention is therefore the products of formula (la) as defined above, characterized in that A is meta-disubstituted by the groups “aromatic nitrogen cycle having a nitrogen atom in quaternary form - (NR 3 ) p - CO "and” (CO) m - (NR ' 3 ) q - aromatic or non-aromatic cycle "as defined above.
  • the present invention thus relates to the products of formula (la) as defined above, characterized in that the heterocycle in quaternary form is a quinoline.
  • the present invention thus particularly relates to the products of formula (la) as defined above characterized in that A represents a pyridine-2,6-disubstituted or a pyridazine-2-6-disubstituted by groups "aromatic nitrogen cycle having a quaternary nitrogen atom in quaternary form - (NR 3 ) p - CO" and "(CO) m - (NR ' 3 ) q - aromatic or non-aromatic cycle” and including the quaternized heterocycle is an N-methyl-quinolinium, and in which A is additionally optionally substituted by a halogen atom.
  • the present invention thus relates to the products of formula (la) as defined above, characterized in that A represents a pyridine-2,6-disubstituted or a pyridazine-2-6-disubstituted by the groups "aromatic nitrogen cycle having a quaternary nitrogen atom in quaternary form - (NR 3 ) p - CO "and” (CO) m - (NR ' 3 ) q - aromatic or non-aromatic ring "and of which the quaternized heterocycle is N-methyl - quinolinium.
  • the present invention thus relates to the products of formula (la) as defined above, characterized in that p and q represent the integer 1.
  • the present invention thus relates to the products of formula (la) as defined above, characterized in that m, p and q represent the integer 1.
  • the subject of the present invention is in particular the products of formula (la) as defined above, characterized in that Ar 2 represents a group chosen from the following groups: 4-amino- or 4-methylamino-, 4-dimethylamino- or 4-alkoxyquinolyl or quinolinium in which the quinolinium nucleus is optionally substituted by one or two methyl group (s).
  • Ar 2 represents a group chosen from the following groups: 4-amino- or 4-methylamino-, 4-dimethylamino- or 4-alkoxyquinolyl or quinolinium in which the quinolinium nucleus is optionally substituted by one or two methyl group (s).
  • the subject of the present invention is in particular the products of formula (la) as defined above, characterized in that R3 and R3 'represent hydrogen.
  • the present invention particularly relates to the products of formula (IB) as defined above, the names of which follow:
  • the present invention thus particularly relates to the products of formula (IB) as defined above, the names of which follow:
  • the present invention thus relates to the following product of formula (IB):
  • the present invention also relates to a process for preparing the products of formula (IB) according to the present invention: a general method of synthesis is thus described as follows.
  • the present invention also relates to a process for preparing the products of formula (IB) according to the present invention: a general method of synthesis is thus described as follows ⁇ St an N-methyl-quinolinium.
  • a particularly advantageous method within the framework of the invention consists in alkylating at the end of the synthesis a product of general formula (IA) into a product of general formula (IB) using an alkyl halide, or optionally an alkyl sulphate according to the general scheme below:
  • a subject of the present invention is therefore the products of formula (IB) as defined above, characterized in that they have a telomerase inhibiting activity.
  • the present invention thus relates to the products of formula (IB) as defined above, characterized in that they have an anticancer activity.
  • the present invention also relates to, as medicaments, the products of formula (IB) as defined above, as well as their prodrugs, said products of formula (I) being in all the isomeric, racemic, enantiomeric and diastereo forms -isomers, as well as addition salts with mineral and organic acids or with pharmaceutically acceptable mineral and organic bases of said products of formula (I).
  • the subject of the present invention is therefore, as medicaments, the products of formula (la) as defined in the preceding claims as well as their prodrugs, said products of formula (la) being in all the isomeric, racemic, enantiomeric and diastereogenic forms isomers, as well as addition salts with mineral and organic acids or with pharmaceutically acceptable mineral and organic bases of said products of formula (la).
  • the present invention relates particularly as medicaments, the products described below in the experimental part, as well as their prodrugs, as well as addition salts with mineral and organic acids or with pharmaceutically acceptable mineral and organic bases of these products.
  • patient designates human beings but also other mammals.
  • Prodrug denotes a product which can be transformed in vivo by metabolic mechanisms (such as hydrolysis) into a product of formula (I).
  • metabolic mechanisms such as hydrolysis
  • an ester of a product of formula (I) containing a hydroxyl group can be converted by hydrolysis in vivo to its parent molecule.
  • an ester of a product of formula (I) containing a carboxy group can be converted by hydrolysis in vivo to its parent molecule.
  • the products can be administered parenterally, buccally, perlingually, rectally or topically.
  • a subject of the invention is also pharmaceutical compositions, characterized in that they contain, as active principle, at least one of the drugs of general formula (IB) as defined above and in particular the products described below in the experimental part.
  • compositions can be presented in the form of solutions or injectable suspensions, tablets, coated tablets, capsules, syrups, suppositories, creams, ointments and lotions.
  • These pharmaceutical forms are prepared according to the usual methods.
  • the active principle can be incorporated into excipients usually used in these compositions, such as aqueous vehicles or not, talc, gum arabic, lactose, starch, magnesium stearate, cocoa butter, fatty substances of animal or vegetable origin, paraffinic derivatives, glycols, various wetting agents, dispersants or emulsifiers, preservatives.
  • the usual dose which varies depending on the subject treated and the condition in question, can be, for example, from 10 mg to 500 mg per day in humans, orally.
  • the present invention also relates to the pharmaceutical compositions as defined above containing, in addition, active principles of other chemotherapy drugs against cancer.
  • the present invention also relates to pharmaceutical compositions as defined above, characterized in that they are used as medicaments, in particular for the chemotherapy of cancers.
  • the present invention thus relates to the use of the compounds defined above as a pharmaceutical product for human use.
  • the present invention also relates to therapeutic combinations consisting of a compound of formula (IB) as defined above and of another anticancer compound.
  • the present invention thus relates to therapeutic combinations as defined above, characterized in that the anticancer compound is chosen from alkylating agents, platinum derivatives, antibiotic agents, antimicrotubule agents, anthracyclines, topoisomerases from groups I and II, fluoropyrimidines, cytidine analogs, adenosine analogs, enzymes and various compounds such as L-asparaginase, hydroxyurea, trans-retinoic acid, suramin, irinotecan, topotecan, dexrazoxane, amifostine, herceptin as well as oetrogenic and androgenic hormones, anti-vascular agents.
  • the anticancer compound is chosen from alkylating agents, platinum derivatives, antibiotic agents, antimicrotubule agents, anthracyclines, topoisomerases from groups I and II, fluoropyrimidines, cytidine analogs, adenosine analogs, enzymes and various compounds such as L-aspara
  • the present invention also relates to a therapeutic association consisting of a compound of formula (IB) as defined above and of radiation.
  • the present invention thus relates to combinations as defined above, characterized in that each of the compounds or of treatments is administered simultaneously, separately or sequentially.
  • the present invention thus relates to the use of products of formula (IB) as defined above or of pharmaceutically acceptable salts of said products of formula (IB) for the preparation of medicaments intended to treat cancers, genetic diseases or abnormalities hairiness.
  • the present invention thus relates to the use of products of formula (IB) as defined above or of pharmaceutically acceptable salts of said products of formula (I) for the preparation of a medicament intended for treat cancer.
  • the present invention thus relates to the use of products of formula (IB) as defined above or of pharmaceutically acceptable salts of said products of formula (I) for the preparation of a medicament intended to treat genetic diseases such as syndromes Bloom, Werner, Rothmund-Thomson or ataxia telangiectaxis.
  • the present invention thus relates to the use of products of formula (IB) as defined above or of pharmaceutically acceptable salts of said products of formula (I) for the preparation of a medicament intended for treating hair abnormalities such as l 'Excessive hair.
  • the present invention particularly relates to the use of products of formula (IB) as defined above or of pharmaceutically acceptable salts of said products of formula (I) for the preparation of a medicament intended for treating breast cancers, , colon, lungs, ovaries, uterus, brain, kidney, larynx, lymphatic system, thyroid, urogenital tract, tract including vesicle and prostate, cancer bones, pancreas, melanomas and more particularly breast, colon or lung cancer.
  • the present invention particularly relates to the use of products of formula (IB) as defined above or of pharmaceutically acceptable salts of said products of formula (I) for the preparation of a medicament intended for the chemotherapy of cancers and in particular intended for chemotherapy for cancers used alone or in combination.
  • the present invention thus relates to the use of products of formula (IB) as defined in any one of the preceding claims or of pharmaceutically acceptable salts of said products of formula (IB) for the preparation of medicaments intended to be used alone or in combination with them. combination with chemotherapy or radiotherapy or alternatively in combination with other therapeutic agents and in particular such a use in which the therapeutic agents can be commonly used anti-tumor agents.
  • the products of formula (I) according to the present invention can thus also be advantageously used in combination with anti-proliferative agents: as examples of such anti-proliferative agents but without however being limited to this list, there may be mentioned aromatase inhibitors, antiestrogens, topoisomerase I inhibitors , topoisomerase II inhibitors, microtubule active agents, alkylating agents, histone deacetylase inhibitors, farnesyl transferase inhibitors, COX-2 inhibitors, MMP inhibitors, mTOR inhibitors, antineoplastic antimetabolites, platinum compounds, compounds which decrease the activity of protein kinases and also antiangiogenic compounds, gonadoreline agonists, antiandrogens, bengamides, biphophonates and trastuzumab.
  • anti-microtubule agents such as taxoids, vinka-alkaloids, alkylating agents such as cyclophosphamide, DNA-intercalating agents such as cis-platinum, interactive agents on topoisomerase such as camptothecin and derivatives, anthracyclines such as adriamycin, antimetabolites such as 5-fluorouracil and derivatives and the like.
  • the affinity and selectivity of the products of general formula (IB) according to the present invention for G-quadruplex DNA structures can be determined by one or more of the following methods:
  • n ° 1 Measurement of the inhibition of pairing of an oligonucleotide. likely to form a G-quadruplex structure, with its complementary strand measured in the form of an inhibitory concentration 50% IC50. expressed in ⁇ M. by a luminescence method according to the experimental protocol is described below
  • the “donor” beads are conjugated to streptavidin and the acceptor beads to an anti-digoxigenin antibody (catalog reference 6760604).
  • a DNA strand, in this case the telomeric strand is coupled at its 5 'end with biotin so as to be able to bind to “donor” beads, while the complementary strand is coupled to digoxigenin in order to be able to bind to “acceptor” beads.
  • the balls are put in proximity and a luminescence signal is then emitted at a wavelength of 520-620 nm.
  • the oligonucleotides used in the experiments were synthesized by Perkin Elmer Life Sciences (Finland).
  • the G-rich strand corresponding to the repeating units of human telomeric DNA has the sequence G-GTT-TAA-AAT-AAT-TGA-GGG-TTA-GGG-TTA-GGG-TTA-GGG.
  • Biotin or digoxigenin are added to the 5 'end of the oligonucleotides.
  • the experiments are carried out in a 50 mM TRIS-HCl buffer pH 7.4 containing 100 mM KCI and 0.1% BSA.
  • the measurements are carried out with an Alphaquest microplate analyzer (Fusion ⁇ ) from Packard Biosciences.
  • the experiments are carried out in 96-well plates (1/2 well).
  • a stock solution of oligonucleotide at the concentration of 25 nM in the buffer described above is prepared. 10 ⁇ l of this solution are distributed in the wells. 10 ⁇ l of the product to be tested at different concentrations prepared in the same buffer containing 0.6% of DMSO are then added. 10 ⁇ l of buffer + 0.6% DMSO are distributed in the control wells. The samples are incubated for 15 minutes at room temperature. After this incubation time 10 ⁇ l of the complementary strand at the concentration of 25 nM and 20 ⁇ l of a solution containing the 2 types of beads previously diluted to 50 mg / ml are added to the wells.
  • telomeric strand can adopt a secondary conformation of the G-quadruplex type which the product as a function of its affinity for this structure stabilizes, preventing pairing with the complementary strand.
  • the signal transmitted is then minimal.
  • the telomeric strand pairs with the complementary strand, which results in a maximum signal.
  • n ° 1 Measurement of the inhibition of apartment of an olioonucleotide. any, with its complementary strand measured under form of inhibitory concentration 50% IC50. expressed in ⁇ M. by a luminescence method according to the experimental protocol is described below
  • the test used is the same as that described above. Only the oligonucleotides are different, the telomeric strand being replaced by an oligonucleotide having the following sequence: G-GTT-TAA-AAT-AAT- TGA-GGC-TTA-CCG-TTA-CCG-TTA-CGG biotinylated at the end 5 .
  • the complementary strand has the sequence: 5'-GGT-TTA-AAA-AAT-TTG -CGG-TAA-CGG-TAA-CGG-TAA-GCC-T labeled with digoxigenin at the 5 'end.
  • the product to be tested has an affinity for the biotinylated DNA sequence, the matching to the complementary strand will be prevented and the signal obtained minimal. In the absence of a product or if the latter has no affinity for this DNA, the pairing will be done and the signal will be maximum.
  • Affinity test No. 2 Measurement of the dissociation constant, expressed in ⁇ M, of the complex between a product of the invention and an oligonucleotide, capable of forming a monomeric G-quadruplex structure; by a fluorescence method according to the experimental protocol is described below.
  • the titrations are carried out at 20 ° C. in a quartz cell of 3 ml of useful volume and square section 10 ⁇ 10 mm placed in the thermostatically controlled compartment of the Spex Fluorolog 3 fluorimeter (Jobin-Yvon).
  • the buffer used in all experiments is a sodium cacolylate pH 7.2 (10 mM) containing 100 mM in potassium chloride.
  • To a 0.1 ⁇ M solution of compound are added increasing concentrations of nucleic acid. After an equilibration time of 3 minutes, a fluorescence emission spectrum is recorded for each point, using 5 nm slits and an excitation wavelength of 340 nm. Each aliquot represents an additional volume of 3 microliters.
  • the dilution effects are corrected at the end of the experiment after integration of the emission signal.
  • the curves representing the emission intensity as a function of the nucleic acid concentration are then analyzed and fitted with Kaleidagaph 3.52 software for Macintosh.
  • the titrations are carried out according to a protocol identical to that used for the titrations of the previous test.
  • n ° 3 Measurement of the stabilization of G-quadruplexes D Tm. expressed in ° C. by a method using the formation of a complex with fluorescein, the experimental protocol of which is described below
  • the FAM + DABCYL oligoncleotide carries the catalog reference, OL-0371-0802. It has the sequence: GGGTTAGGGTTAGGGTTAGGG corresponding to 3.5 repetitions of the human telomeric motif (strand rich in G). Fluorescein is attached to the 5 'end, DABCYL to the 3' end, by the chemical arms described by Eurogentec. A FAM + TAMRA oligonucleotide can also be used. The concentration of the samples is verified by spectrophotometry, by recording the absorbance spectrum between 220 and 700 nm and using the molar extinction coefficient supplied by the supplier.
  • 0.2 ⁇ M in 0.1 M LiCI 10 mM cacodylate pH 7.6 buffer is previously prepared, briefly heated to 90 ° C and slowly cooled to 20 ° C, then distributed in aliquots of 600 ⁇ l in the fluorescence tanks. 3 ⁇ l of water (for control) or 3 ⁇ l of the product to be tested (stock at 200 ⁇ M, final concentration 1 ⁇ M) are then added and mixed. The samples are then left to incubate for at least 1 hour at 20 ° C before each measurement. The use of longer incubation times (up to 24 hours) has no influence on the result obtained. Each experiment allows the measurement of 1 to 4 samples. This is first incubated at an initial temperature of 20 ° C and brought to 80 ° C in 38 minutes.
  • fluorescence is measured simultaneously at one (515 nm) or two emission wavelengths (515 nm and 588 nm) using 470 nm as the excitation wavelength. A measurement is made every 30 seconds or every degree.
  • the temperature of the water bath is recorded in parallel, and the fluorescence profile as a function of the temperature is reconstructed from these values.
  • the fluorescence profiles are then normalized between 20 ° C and 80 ° C, and the temperature for which the emission intensity at 515 nm is the average of those at high and low temperatures is called Tm. Under these conditions, the Tm of the reference sample without addition of product is approximately 44 ° C in a Lithium Chloride buffer. This temperature is brought to more than 55 ° C. in a sodium chloride buffer.
  • the GA “duplex” results from auto-matching of the oligonucleotide (5 'GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA).
  • the parallel duplex results from the association of 5'AAAAAAAA TAATTTTAAATATT with 5 'IIIIIIIII lATTAAAATTTATAA.
  • 24 CTG mimics 8 repetitions of trinucleotide: 5 'CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG.
  • ds26 (sample # 11) is an autocomplementary duplex of 26 bases 5 'CAATCGGATCGAATTCGATCCGATTG.
  • 22CT is an oligonucleotide which mimics the C-rich strand of human telomeres: 5 'CCCTAACCCTAACCCTAACCCT
  • 22AG is an oligonucleotide which mimics the G-rich strand of human telomeres: 5' AGGGTTAGGGTTAGGGTTAGGG.
  • 24G20 T 2 G 20 T 2 , sample # 15) can form a 5 'intermolecular quadruplex
  • poly polynucleotide
  • oligo oligonucleotide
  • oligos structure formed by the association of two different oligonucleotides. The lengths are indicated in brackets. Polynucleotides are more than 100 bases long. b: These duplexes involve the formation of non-canonical base pairs.
  • the antitelomerase activity of the products of the invention which depends specifically on the stabilization of the G-guadruplex structure, measured by the inhibitory concentration 50% IC50 expressed in ⁇ M, can be evaluated according to the protocol below:
  • the pulmonary carcinoma line A549 is obtained from the ATCC (American Type Culture Collection, Rockville USA).
  • the cells are cultured in a layer, in a culture flask in DMEM medium, supplemented with 2 mM glutamax, Penicillin 200 U / ml streptomycin 200 ⁇ g / ml and 10% fetal calf serum inactivated by heat.
  • the cells in the exponential growth phase are trypsinized, washed in 1 ⁇ PBS and an aliquot of 10 6 cells is centrifuged at 3000 ⁇ G and the supernatant discarded.
  • the cell pellet is resuspended by several successive pipetting in 200 ⁇ l of lysis buffer containing CHAPS 0.5%, Tris-HCl pH 7.5 10 mM, 1 mM MgCl 2 , 1 mM EGTA, 5 mM ⁇ -mercaptoethanol, 0.1 mM PMSF and 10% glycerol and is kept in ice for 30 minutes.
  • the lysate is centrifuged at 160000xG for 20 minutes at 4 ° C and 160 ⁇ l of the supernatant is recovered.
  • the determination of the proteins of the extract is carried out by the Bradford method.
  • the extract is stored at -80 ° C.
  • telomerase inhibition is determined by a modified TRAP protocol which makes it possible to measure the extension of telomerase from an oligonucleotide TSG4 ( 5 GGGATTGGGATTGGGATTGGGTT 3 ) which can form an intramolecular G-quadruplex structure, in the presence of a cell extract enriched in telomerase activity and compounds which are added at different concentrations (30, 10, 1, 0.1 and 0.01 ⁇ M).
  • the extension reaction is followed by PCR amplification of the extension products using the oligonucleotide CXext ( 5 GTGCCCTTACCCTTACCCTTACCCTAA 3 ).
  • the selectivity of inhibition is measured by amplifying an oligonucleotide control TSNT (5 ATTCCGTCGAGCAGAGTTAAAAGGCCGAGAAGCGAT 3) by the TS oligonucleotide (5 'AATCGTTCGAGCAGAGTT 3) and oligonucleotide NT (5 ATCGCTTCTCGGCCTTTT 3').
  • oligonucleotide control TSNT (5 ATTCCGTCGAGCAGAGTTAAAAGGCCGAGAAGCGAT 3) by the TS oligonucleotide (5 'AATCGTTCGAGCAGAGTT 3) and oligonucleotide NT (5 ATCGCTTCTCGGCCTTTT 3').
  • the reaction medium is prepared in a final volume of 50 ⁇ L according to the following composition:
  • telomerase extract 100 ng telomerase extract in a volume of 1 ⁇ l
  • Bi-distilled water QS 50 ⁇ l The oligonucleotides are obtained from Eurogentec Belgium) and are stored at -20 ° C at a stock concentration of 100 ⁇ M in sterile distilled water without ribonucleases and deoxyribonucleases.
  • reaction samples are assembled in ice in 0.2 ml PCR tubes.
  • the reaction samples are then incubated in an Eppendorf Mastercycler PCR apparatus under the following temperature conditions: 15 minutes at 30 ° C, 1 minute at 90 ° C, followed by 30 cycles of, 30 seconds at 92 ° C,
  • the samples are then analyzed by electrophoresis in 12% acrylamide / bisacrylamide gel (19: 1) in 1 ⁇ TBE buffer for 45 minutes at a voltage of 200 volts, using a Novex electrophoresis system.
  • the gels are stained for 15 minutes in a 1 ⁇ solution of SYBR Green (Roche) and the fluorescence of the PCR products is digitized by a digital camera (Bioprint System).
  • the disappearance of the band formed by the dimerization of the oligonucleotides TSG4 and Cxext corresponds to a stabilization of the G-quadruplex form of the oligonucleotide TSG4 and corresponds to an inhibition of the extension of telomeric repeats from the oligonucleotide TSG4.
  • the disappearance of the band formed by the amplification of the control oligonucleotide TSNT corresponds to a non-specific inhibition of the activity of Taq polymerase.
  • the results are expressed by calculating the concentration ( ⁇ M) inhibiting 50% of the formation of the TSG4-Cxext band (CI50 TRAP-G4) and by calculating the concentration inhibiting 50% of the formation of the TSNT control band (CI50 Taq), relative to the value of the enzymatic sample without compound.
  • the ratio CI50 Taq / CI50 TRAP-G4 indicates the selectivity factor for the inhibition of the extension of telomerase by stabilization of G-quadruplex compared to the inhibition of Taq polymerase.
  • a compound is active as an antitelomerase agent stabilizing the G-quadruplex DNA when the IC50 TRAP-G4 is in particular less than 5 ⁇ M.
  • the compound is considered to be selective as an anti -lomerase agent stabilizing the G-quadruplex when the CI50 TRAP-G4 / CI50 Taq ratio is greater than 3.
  • Step 1 In a 50 ml three-necked flask, with magnetic stirring, 1 g of 2,6-pyridine-dicarboxylic acid and 1.81 g of 6-aminoquinoline are dissolved in 30 ml of dichloromethane and 5 ml of dimethylformamide (DMF), then add 2.4 g of 1- (3-dimethylaminopropyl) -carbodiimide hydrochloride (EDCI) and 162 mg of 1-hydroxybenzotriazole (HOBT). A transient yellow precipitate forms which slowly redissolves. After 1 to 2 hours of stirring at room temperature, an abundant white precipitate appears.
  • DMF dimethylformamide
  • Step 2 In a 25 mL flask, 200 mg of 2,6-pyridine-dicarboxylic acid-bis - [(quinolin-6-yl) amide], obtained in the previous step, are dissolved in 2 mL of methanol , 4 mL of DMF and 10 mL of iodomethane, then the mixture is heated to 50 ° for 72 hours during which an orange precipitate gradually forms. After cooling, this precipitate is drained and washed with methanol.
  • Step 1 In a 50 ml three-necked flask, 1.3 g of n-butyl monoester of 2,6-pyridine-dicarboxylic acid, which can be obtained according to Khim, are dissolved in 35 ml of dichloromethane. Geterosikl. Soedin 1976 (2), 233-7, and 1.17 g of 6-amino-4-dimethylamino-quinaldine, which can be obtained according to WO 0140218, then 1.35 g of EDCI and 90 mg of HOBT are added. . After 2 to 3 hours, a yellow precipitate appears; stirring is continued for 36 hours at room temperature, until the reaction is complete (LC / MS).
  • the reaction medium is diluted with water, the organic phase is decanted and the aqueous phase is extracted with dichloromethane.
  • the combined organic phases are concentrated to dryness under reduced pressure.
  • the pasty residue obtained is taken up with stirring in 20 ml of diisopropyl ether, to form a light beige solid which is drained and air dried. 820 mg of n-butyl ester of 2,6-pyridine-dicarboxylic acid-6 - [(4-dimethylamino-quinaldin-6-yl) amide] are thus obtained, used as such in the following step.
  • Step 3 In a 50 mL flask, 760 mg of 2,6-pyridine-dicarboxylic acid-6 - [(4-dimethylamino-quinaldin-6-yl) amide], obtained above, and 360 mg are dissolved. of 6-aminoquinoline in 15 ml of DMF, then 458 mg of EDCI and 30 mg of HOBT are added. After 72 hours of stirring at room temperature, the solvent is removed under reduced pressure. The residue is taken up in water, and the precipitate thus formed is washed with water and then with a saturated solution of sodium hydrogencarbonate.
  • Step 4 The procedure is as in step 2 of Example 1, but starting with 400 mg of 2,6-pyridine-dicarboxylic acid-2 - [(quinolin-6-yl) amide] -6- [ (4-dimethylamino-quinaldin-6-yl) amide], obtained above in 6 ml of methanol and 15 ml of iodomethane. After recrystallization from ethanol, 382 mg of diodide of 2,6-pyridine-dicarboxylic acid-2- [(1-methyl-quinolinio-6-yl) amide] -6 - [(4-dimethylamino) are then obtained. -1-methyl-quinaldinio-6-yl) amide], in the form of a pale green solid whose characteristics are the following: - Melting point (Kofler)> 260 ° C
  • Step 1 The procedure is as in step 1 of Example 1, but starting with 450 mg of 2,6-pyrazine-dicarboxylic acid, which can be prepared according to J. Med. Chem. (1996), 29, 1452-57, 450 mg of 6-aminoquinoline, 600 mg of EDCI and 40 mg of HOBT in 15 ml of dichloromethane and 10 ml of DMF with stirring overnight at room temperature. After purification by preparative LC / MS, 170 mg of 2,6-pyrazine-dicarboxylic acid-bis - [(quinolin-6-yl) amide] are obtained, in the form of a white powder used as it is in step next.
  • Step 2 The procedure is as in step 2 of Example 1, but starting with 50 mg of 2,6-pyrazine-dicarboxylic acid-bis - [(quinolin-6-yl) amide], obtained here- above in 1 mL of DMF and 5 mL of iodomethane.
  • Step 1 The procedure is as in step 1 of Example 1, but starting with 300 mg of isophthalic acid, 521 mg of 6-aminoquinoline, 727 mg of EDCI and 50 mg of HOBT in 10 ml of DMF with stirring for 1 night at room temperature. 593 mg of 1,3-benzene-dicarboxylic acid-bis - [(quinolin-6-yl) amide] are obtained in the form of a white powder, used as it is in the following step.
  • 2nd step The operation is carried out as in step 2 of Example 1, but starting with 100 mg of 1,3-benzene-dicarboxylic acid-bis - [(quinolin-6-yl) amide], obtained above in 1 mL of DMF and 6 mL of iodomethane. 72 mg of diodide of 1,3-benzene-dicarboxylic acid-bis - [(1-methyl-quinolinio-6-yl) amide] is then obtained, after recrystallization from ethanol, in the form of a yellow solid.
  • -pale with the following characteristics: - Melting point (Kofler)> 260 ° C - 1 H NMR spectrum (300 MHz, (CD 3 ) 2 SO d6, ⁇ in ppm): 4.63 (s:
  • Stage 1 The procedure is carried out as in Stage 1 of Example 1, but starting with 500 mg of 2,6-pyridine-dicarboxylic acid, of 945 mg of 6-aminoquinaldin, which can be prepared according to EP 286277, 1.2 g of EDCI and 100 mg of HOBT in 15 mL of dichloromethane and 3 mL of DMF with stirring for 24 hours at room temperature. 1.47 g of 2,6-pyridine-dicarboxylic acid-bis - [(quinaldin-6-yl) amide] are obtained in the form of a white powder used as it is in the following step.
  • Step 2 The procedure is carried out as in step 2 of Example 1, but starting with 150 mg of 2,6-pyridine-dicarboxylic acid-bis - [(quinaldin-6-yl) amide], obtained below. above in 1.5 mL of DMF and 6 mL of iodomethane. Is then obtained after recrystallization from ethanol, 161 mg of diodide of 2,6-pyridine-dicarboxylic acid-bis - [(1-methyl-quinaldinio-6-yl) amide], in the form of a yellow solid with the following characteristics: - Melting point (Kofler)> 260 ° C
  • Stage 1 The procedure is carried out as in Stage 1 of Example 2, but starting from 500 mg of n-butyl monoester of 2,6-pyridine-dicarboxylic acid, of 388 mg of 4,6-diaminoquinaldin, which can be obtained according to WO 0140218, from 472 mg of EDCI and 30 mg of HOBT in 10 ml of dichloromethane and 5 ml of DMF for 20 hours at room temperature. After purification by flash chromatography on alumina, 450 mg of n-butyl ester of 2,6-pyridine-dicarboxylic acid are obtained, eluting with a mixture of dichloromethane and methanol (95/5 by volume). 6 - [(4-amino-quinaldin-6-yl) amide], used as is in the next step.
  • 2nd step The procedure is as in step 2 of Example 2, but starting with 450 mg of n-butyl ester of 2,6-pyridine-dicarboxylic acid-6 - [(4-amino-quinaldin-6- yl) amide], obtained above, in 20 ml and 1.19 ml of a 1M aqueous solution of potassium hydroxide. 243 mg of 2,6-pyridine-dicarboxylic acid-6 - [(4-amino-quinaldin-6-yl) amide] are thus obtained in the form of a beige solid used as it is in the following step.
  • Step 3 The procedure is as in step 3 of Example 2, but starting from 93 mg of 2,6-pyridine-dicarboxylic acid-6 - [(4-amino-quinaldin-6-yl) amide], obtained here above, 41.6 mg of 6-aminoquinoline, 61 mg of EDCI and 14 mg of HOBT in 5 ml of dichloromethane and 5 ml of DMF for 48 hours at room temperature. 101 mg of 2,6-pyridine acid are thus obtained. dicarboxylic-2 - [(quinolin-6-yl) amide] -6 - [(4-amino-quinaldin-6-yl) amide], in the form of a beige powder, used as it is in the next step.
  • Step 4 The procedure is as in step 2 of Example 1, but starting with 65 mg of 2,6-pyridine-dicarboxylic acid-2 - [(quinolin-6-yl) amide] -6- [ (4-amino-quinaldin-6-yl) -amide], obtained above, in 1 ml of DMF and 5 ml of iodomethane. After recrystallization from ethanol, 58 mg of 2,6-pyridine-dicarboxylic acid-2 - [(1-methyl-quinolinio-6-yl) amide] -6 - [(4- amino-quinaldin-6-yl) amide], isolated in its tautomeric imino form, in the form of a yellow solid whose characteristics are the following:
  • Step 1 The operation is carried out as in step 1 of Example 1, but starting with 100 mg of isophthalic acid, 190.5 mg of 6-aminoquinaldin, 242 mg of EDCI and 20 mg of HOBT in 5 mL of DMF with stirring for 20 hours at room temperature. 265 mg of 2,6-benzene-dicarboxylic acid-bis - [(quinaldin-6-yl) amide] are obtained in the form of a beige powder used as it is in the following step.
  • Step 2 The operation is carried out as in step 2 of Example 1, but starting from 95 mg of 2,6-benzene-dicarboxylic acid-bis - [(quinaldin-6-yl) amide], obtained below. above, in 1 mL of DMF and 5 mL of iodomethane. 83 mg of 2,6-benzene acid diodide are then obtained after recrystallization from ethanol. dicarboxylic-bis - [(1-methyl-quinaldinio-6-yl) amide], in the form of a yellow solid, the characteristics of which are the following:
  • Step 1 The procedure is as in step 1 of Example 1, but starting with 100 mg of 2,4-pyridine-dicarboxylic acid, 181 mg of 6-aminoquinaldin, 241 mg of EDCI and 16 mg of HOBT in 5 mL of DMF with stirring for 20 hours at room temperature. 325 mg of 2,4-pyridine-dicarboxylic acid-bis - [(quinolin-6-yl) amide] are obtained in the form of a beige powder used as it is in the following step.
  • 2nd step The procedure is as in step 2 of Example 1, but starting with 300 mg of 2,4-pyridine-dicarboxylic acid-bis - [(quinolin-6-yl) amide], obtained above, in 3 mL of DMF and 10 mL of iodomethane. 372 mg of 2,4-pyridine-dicarboxylic acid-bis - [(1-methyl-quinolin-6-yl) amide] diodide are then obtained after recrystallization from ethanol, in the form of a yellow solid. the characteristics of which are as follows: - Melting point (Kofler)> 260 ° C. - 1 H NMR spectrum (400 MHz, (CD 3 ) 2 SO d6, at a temperature of
  • Step 1 Dissolve 1.74 g of 2,6-pyridine-dicarboxylic acid, 500 mg of 4-aminoquinoline, 543 ⁇ L of N- (2-chloroethyl) diisopropylamine hydrochloride (DIC) in a 25 ml three-necked flask and 469 mg of HOBT in 15 mL of DMF.
  • CCM chemical vapor deposition
  • eluent dichloromethane / methanol 90/10 the reaction medium is deposited on a cartridge of 5 g of sulphonic resin (40 ⁇ M of Varian Mega Bond Elut SCX model).
  • Step 2 The operation is carried out as in step 3 of Example 2, but starting with 150 mg of 2,6-pyridine-dicarboxylic-2 - [(quinolin-6-yl) amide], obtained below. above, 74 mg of 3-aminoquinoline, which can be prepared according to Tetrahedron. Lett. 2001, 42, 3251-54, 109 mg of EDCI and 7 mg of HOBT in 5 mL of dichloromethane and 5 mL of DMF for 48 hours at room temperature. 180 mg of 2,6-pyridine-dicarboxylic acid-2 - [(quinolin-6-yl) amide] -6 - [(quinolin-3-yl) amide] are thus obtained in the form of a pinkish beige powder. , used as is in the next step.
  • Step 3 The procedure is as in step 2 of Example 1, but starting with 150 mg of 2,6-pyridine-dicarboxylic acid-2 - [(quinolin-6-yl) amide] -6-
  • Step 1 The operation is carried out as in step 3 of Example 2, but starting with 150 mg of 2,6-pyridine-dicarboxylic acid-2 - [(quinolin-6-yl) amide], obtained with 1 step 1 of Example 9, 74 mg of 5-aminoquinoline, 109 mg of EDCI and 7 mg of HOBT in 5 ml of dichloromethane and 5 ml of DMF for 48 hours at room temperature. This gives 201 mg of 2,6-pyridine-dicarboxylic acid-2 - [(quinolin-6-yl) amide] -6 - [(quinolin-5-yl) amide], in the form of a beige powder, used as is in the next step.
  • Step 2 The procedure is as in step 2 of Example 1, but starting with 180 mg of 2,6-pyridine-dicarboxylic acid-2 - [(quinolin-6-yl) amide] -6- [ (quinolin-5-yl) -amide], obtained above, in 1.5 ml of DMF and 5 ml of iodomethane.
  • Step 1 The operation is carried out as in step 1 of Example 1, but starting from 150 mg of 2,6-pyridine-dicarboxylic acid, from 945 mg of 3-aminoquinoline, which can be prepared according to Tetrahedron. Lett. 2001, 42, 3251-54, 361 mg of EDCI and 24 mg of HOBT in 10 mL of DMF with stirring for 18 hours at room temperature. 495 mg of 2,6-pyridine-dicarboxylic acid-bis - [(quinolin-3-yl) amide] are obtained in the form of a white powder, used as it is in the following step.
  • 2nd step The procedure is as in step 2 of Example 1, but starting with 200 mg of 2,6-pyridine-dicarboxylic acid-bis - [(quinolin-3-yl) amide], obtained above in 3 mL of DMF and 10 mL of iodomethane. 231 mg of diodide of 2,6-pyridine-dicarboxylic acid-bis - [(1-methyl-quinolinio-3-yl) amide] is then obtained after recrystallization from ethanol, in the form of a yellow solid. with the following characteristics:
  • Step 1 The operation is carried out as in step 3 of Example 2, but starting from 140 mg of 2,6-pyridine-dicarboxylic-2 - [(quinolin-6-yl) amide], obtained with 1 step 1 of Example 9, 73 ⁇ L of 1- (2-aminoethyl) piperidine, 100 mg of EDCI and 7 mg of HOBT in 5 ml of dichloromethane and 5 ml of DMF for 48 hours at temperature room.
  • Step 2 The procedure is as in step 2 of Example 1, but starting with 200 mg of 2,6-pyridine-dicarboxylic acid-2 - [(quinolin-6-yl) amide] -6- [ 2- (piperidin-1-yl) -ethylamide], obtained above, in 2 ml of DMF and 6 ml of iodomethane.
  • Step 1 The procedure is as in step 1 of Example 1, but starting from 502 mg of 4-bromo-2,6-pyridine-dicarboxylic acid, which can be prepared according to Tetrahedron lett. 2001, 42, 4849-51, and 588 mg of 3-aminoquinoline, which can be prepared according to Tetrahedron. Lett. 2001, 42, 3251-54, 821 mg of EDCI and 55 mg of HOBT in 23 ml of DMF with stirring for 20 hours at room temperature. 935 mg of 4-bromo-2,6-pyridine-dicarboxylic acid-bis - [(quinolin-3-yl) amide] is obtained in the form of a gray-green powder, used as it is in the following step .
  • Step 2 The procedure is as in step 2 of Example 1, but starting with 300 mg of 4-bromo-2,6-pyridine-dicarboxylic-bis - [(quinolin-3-yl) amide] acid] , obtained above in 8 mL of DMF and 12.63 mL of iodomethane. Then obtained after recrystallization from ethanol, 296 mg of diodide of 4-bromo-2,6-pyridine-dicarboxylic acid-bis - [(1-methyl-quinolinio-3-yl) amide], in the form d '' a yellow solid with the following characteristics:

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Urology & Nephrology (AREA)
  • Endocrinology (AREA)
  • Immunology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Cardiology (AREA)
  • Diabetes (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Pulmonology (AREA)
  • Dermatology (AREA)
  • Reproductive Health (AREA)
  • Epidemiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Quinoline Compounds (AREA)
  • Plural Heterocyclic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
EP04708378A 2003-02-07 2004-02-05 Derives chimiques se liant de maniere tres specifique aux structures d adn en g-quadruplexe et leur application comme agent anticancereux specifique Withdrawn EP1603898A2 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
FR0301478A FR2850970B1 (fr) 2003-02-07 2003-02-07 Derives chimiques se liant de maniere tres specifique aux structures d'adn en g-quadruplexe et leur application comme agent anticancereux specifique
FR0301478 2003-02-07
PCT/FR2004/000260 WO2004072027A2 (fr) 2003-02-07 2004-02-05 Derives chimiques se liant de maniere tres specifique aux structures d'adn en g-quadruplexe et leur application comme agent anticancereux specifique

Publications (1)

Publication Number Publication Date
EP1603898A2 true EP1603898A2 (fr) 2005-12-14

Family

ID=32731875

Family Applications (1)

Application Number Title Priority Date Filing Date
EP04708378A Withdrawn EP1603898A2 (fr) 2003-02-07 2004-02-05 Derives chimiques se liant de maniere tres specifique aux structures d adn en g-quadruplexe et leur application comme agent anticancereux specifique

Country Status (8)

Country Link
EP (1) EP1603898A2 (https=)
JP (1) JP2006518726A (https=)
AU (1) AU2004210753A1 (https=)
BR (1) BRPI0407320A (https=)
CA (1) CA2514105A1 (https=)
FR (1) FR2850970B1 (https=)
MX (1) MXPA05007648A (https=)
WO (1) WO2004072027A2 (https=)

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6887873B2 (en) 2001-03-23 2005-05-03 Aventis Pharma S.A. Triazine derivatives and their application as antitelomerase agents
US8293716B2 (en) 2005-05-26 2012-10-23 Ramot At Tel Aviv University Ltd. Method of treating cancer by modulation of mortalin
WO2008032324A2 (en) * 2006-09-14 2008-03-20 Ramot At Tel Aviv University Ltd. Combination therapy for tumoral disease treatment
GB0706932D0 (en) * 2007-04-10 2007-05-16 Univ London Pharmacy Ureylene derivatives
WO2009040819A2 (en) 2007-09-25 2009-04-02 Ramot At Tel Aviv University Ltd. DOWN-REGULATION OF MORTALIN BY siRNA
CN101889210B (zh) 2008-05-27 2014-12-10 松下电器产业株式会社 G-quadruplex检测方法、形成G-quadruplex的DNA的检测方法以及端粒酶活性测定方法
JP4510929B1 (ja) 2009-04-09 2010-07-28 パナソニック株式会社 テロメラーゼ反応阻害方法およびそれに用いられるテロメラーゼ反応阻害剤
CN108066341B (zh) * 2016-11-10 2020-10-30 中国科学院化学研究所 化合物在制备抗癌药物中的用途
CN108066340B (zh) * 2016-11-10 2020-10-27 中国科学院化学研究所 药物组合物
WO2018211148A1 (en) * 2017-05-19 2018-11-22 Universite De Bretagne Occidentale Bisquinolium derivatives for preventing or treating ebv-related cancers
CN113272294A (zh) * 2018-08-24 2021-08-17 雅典学院生物医学研究基金会 2,6-双(((1h-苯并[d]咪唑-2-基)硫)甲基)吡啶和n2,n6-二苄基吡啶-2,6-二甲酰胺衍生物以及相关化合物作为磷酸肌醇3-激酶(pi3k)抑制剂用于治疗癌症

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
SK7402002A3 (en) * 1999-11-29 2002-11-06 Aventis Pharma Sa Arylamine derivatives and their use as anti-telomerase agent
FR2819255B1 (fr) * 2001-01-09 2003-02-28 Aventis Pharma Sa Derives chimiques et leur application comme agent antitelomerase
FR2821355A1 (fr) * 2001-02-23 2002-08-30 Aventis Pharma Sa Derives chimiques et leur application comme agent antitelomerase
CO5380035A1 (es) * 2001-03-23 2004-03-31 Aventis Pharma Sa Derivados quimicos y su aplicacion como agente antitelomerasa
WO2002096903A2 (fr) * 2001-05-28 2002-12-05 Aventis Pharma S.A. Derives chimiques et leur application comme agent antitelomerase

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2004072027A2 *

Also Published As

Publication number Publication date
FR2850970B1 (fr) 2006-07-07
WO2004072027A2 (fr) 2004-08-26
AU2004210753A1 (en) 2004-08-26
WO2004072027A3 (fr) 2004-09-23
JP2006518726A (ja) 2006-08-17
BRPI0407320A (pt) 2006-02-21
FR2850970A1 (fr) 2004-08-13
CA2514105A1 (fr) 2004-08-26
MXPA05007648A (es) 2006-12-15

Similar Documents

Publication Publication Date Title
EP1244650B1 (fr) Derives arylamines et leur application comme agent antitelomerase
Sissi et al. Tri-, tetra-and heptacyclic perylene analogues as new potential antineoplastic agents based on DNA telomerase inhibition
WO2002096903A2 (fr) Derives chimiques et leur application comme agent antitelomerase
WO2004072027A2 (fr) Derives chimiques se liant de maniere tres specifique aux structures d'adn en g-quadruplexe et leur application comme agent anticancereux specifique
EP1373252A1 (fr) Derives chimiques et leur application comme agents antitelomerase
US20030087931A1 (en) Chemical derivatives and their application as antitelomerease agent
Chen et al. Disubstituted 1, 8-dipyrazolcarbazole derivatives as a new type of c-myc G-quadruplex binding ligands
US20070232572A1 (en) Chemical derivatives as antitelomerase agents which bind specifically to the G-quadruplex DNA structures and their application as a specific anticancer agent
WO2002012194A1 (fr) Derives de phenanthridine et leur application comme agents antitelomerases
EP1351957A1 (fr) Derives chimiques et leur application comme agent antitelomerase
Desai et al. Synthesis, characterization, molecular docking studies and biological activity of coumarin linked 2-pyridone heterocycles
FR2812634A1 (fr) Utilisation de composes aromatiques polycycliques pour fabriquer des medicaments capables d'inhiber la telomerase
WO2002068408A1 (fr) Derives chimiques et leur application comme agent antitelomerase
FR2825090A1 (fr) Derives chimiques et leur application comme agent antitelomerase
Sonyanaik et al. Green Construction of Aryl-1, 8-Naphthyridine-Thiazole Scaffolds and in Vitro-Antimicrobial Evaluation, Dna-Binding Interactions, Viscosity Measurements, Molecular Modeling Studies, and Adme Properties
FR2822468A1 (fr) Derives chimiques et leur application comme agent anti-telomerase
JP4629993B2 (ja) ピラゾロン誘導体及びテロメラーゼ阻害剤
FR2801588A1 (fr) Derives chimiques et leur application comme agent antitelomerase
Silva G-quadruplex ligands for cancer therapy
EP3148997A1 (en) Helquats with heteroaromatic substituents, preparation thereof, and use thereof as g-quadruplex stabilizers

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20050907

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK

DAX Request for extension of the european patent (deleted)
RIN1 Information on inventor provided before grant (corrected)

Inventor name: BELMOKHTAR, CHAFKE

Inventor name: GOMEZ, DENNIS

Inventor name: RIOU, JEAN-FRANCOIS

Inventor name: GUITTAT, LIONEL

Inventor name: MERGNY, JEAN-LOUIS

Inventor name: MANDINE, ELIANE

Inventor name: BOUCHARD, HERVE

Inventor name: MAILLIET, PATRICK

Inventor name: CAULFIELD, THOMAS

Inventor name: HITTINGER, AUGUSTIN

17Q First examination report despatched

Effective date: 20070817

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Effective date: 20090317