EP1603898A2 - Chemical derivatives binding very specifically with g-quadruplex dna structures and use thereof as a specific anti-cancer agent - Google Patents

Chemical derivatives binding very specifically with g-quadruplex dna structures and use thereof as a specific anti-cancer agent

Info

Publication number
EP1603898A2
EP1603898A2 EP04708378A EP04708378A EP1603898A2 EP 1603898 A2 EP1603898 A2 EP 1603898A2 EP 04708378 A EP04708378 A EP 04708378A EP 04708378 A EP04708378 A EP 04708378A EP 1603898 A2 EP1603898 A2 EP 1603898A2
Authority
EP
European Patent Office
Prior art keywords
amide
methyl
formula
products
pyridine
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP04708378A
Other languages
German (de)
French (fr)
Inventor
Augustin Hittinger
Thomas Caulfield
Patrick Mailliet
Hervé Bouchard
Eliane Mandine
Jean-Louis Mergny
Lionel Guittat
Jean-François RIOU
Dennis Gomez
Chafke Belmokhtar
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Centre National de la Recherche Scientifique CNRS
Aventis Pharma SA
Institut Curie
Museum National dHistoire Naturelle
Universite de Reims Champagne Ardenne URCA
Commissariat a lEnergie Atomique et aux Energies Alternatives CEA
Original Assignee
Centre National de la Recherche Scientifique CNRS
Commissariat a lEnergie Atomique CEA
Aventis Pharma SA
Institut Curie
Museum National dHistoire Naturelle
Universite de Reims Champagne Ardenne URCA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Centre National de la Recherche Scientifique CNRS, Commissariat a lEnergie Atomique CEA, Aventis Pharma SA, Institut Curie, Museum National dHistoire Naturelle, Universite de Reims Champagne Ardenne URCA filed Critical Centre National de la Recherche Scientifique CNRS
Publication of EP1603898A2 publication Critical patent/EP1603898A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/12—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings linked by a chain containing hetero atoms as chain links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/18—Drugs for disorders of the alimentary tract or the digestive system for pancreatic disorders, e.g. pancreatic enzymes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/08—Drugs for disorders of the urinary system of the prostate
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/10—Drugs for disorders of the urinary system of the bladder
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/12—Drugs for disorders of the urinary system of the kidneys
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00—Drugs for disorders of the endocrine system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D215/00—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems
    • C07D215/02—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom
    • C07D215/16—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D215/38—Nitrogen atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/14—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing three or more hetero rings

Definitions

  • the present invention relates to cancer therapy and relates to new anticancer agents having a specific mechanism of action. It also relates to a selection of chemical compounds as well as their therapeutic application in humans.
  • the present invention relates to the use of new non-nucleotide chemical compounds which interact with specific structures of deoxyribonucleic acid (DNA) or ribonucleic acid (RNA).
  • DNA deoxyribonucleic acid
  • RNA ribonucleic acid
  • These new compounds consist of a distributing agent linked to two nitrogen heteroaromatic groups, at least one of the nitrogen atoms of which is in quaternized form. They are particularly useful for very selectively stabilizing DNA folded into G-quadruplex structure (tetrads of guanines), as well when the G-quadruplex is formed by one, two or four strands of DNA.
  • These new compounds are useful in the treatment of cancers and act in particular as telomerase inhibiting agents.
  • telomerase inhibition via the stabilization of these G-quadruplexes can either be the arrest of cell mitosis and the death of rapidly dividing cells within one to a few weeks by a deprotection mechanism telomeric DNA, the induction of cancer cell senescence, as a result of the progressive shortening of telomeric DNA (Oncogene 2002, 21, 553-63; Oncogene 2002, 21, 592-97).
  • Another therapeutic application, in the treatment of cancer, of the stabilization of DNA structures in G-quadruplex can be done by the inactivation of the promoter regions, rich in repetitions of guanines, oncogenes such as c-myc (J Biol. Chem. 2001, 276, 4640-46; Proc.
  • Another therapeutic application, in the treatment of cancer, of the stabilization of DNA structures in G-quadruplexes can be the inhibition of helicases specific for DNA structures in G-quadruplexes, involved in mitosis. These helicases are also directly involved in various genetic diseases such as Bloom's syndromes (Cell 1995, 83, 655-66), Werner (Science 1996, 272, 258-62), Rothmund-Thomson (Nature Genetics 1999, 22, 82-4) or ataxia telangiectaxis.
  • the compounds of the present invention have in particular the advantage from the therapeutic point of view of blocking telomerase.
  • telomerase makes it possible to add repeated DNA sequences of the TTAGGG type, called telomeric sequences, at the end of the telomer, during cell division.
  • telomerase makes the cell immortal. Indeed, in the absence of this enzymatic activity, the cell loses 100 to 150 bases per division, which makes it quickly senescent.
  • telomeres maintained at a stable length during cell division.
  • the telomerase was highly activated and that it allowed the addition of repeated motifs of telomeric sequences at the end of the telomer and therefore allowed the conservation of the length of the telomer. It has been shown for some time that more than 85% of cancer cells have positive tests for the presence of telomerase while somatic cells do not have this characteristic.
  • telomerase is thus a highly wished target for treating cancer cells.
  • the first obvious approach to blocking telomerase was the use of nucleotide structures (Proc. Natl. Acad. Sci. USA 1996, 93, 2635-39). Since then, various approaches have been developed to inhibit telomerase (Curr. Pharm. Des. 2002, 8, 2491-504). Among these approaches, the development of DNA ligands in G-quadruplexes is arousing growing interest (Mini Rev. Med. Chem. 2003, 3, 11-21).
  • telomestatin a molecule capable of binding to a G-quadruplex DNA structure, in a very selective manner compared to a double stranded DNA (J. Amer. Chem. Soc. 2001, 123, 1262-1263).
  • a highly selective DNA molecule in G-quadruplex will have the double advantage of targeting DNA structures in G-quadruplex while avoiding undesirable mechanisms of toxicity linked to non-selective attachment to the genome.
  • WO 0296903 describes the preparation of heterocyclic diamides of general formula (I) below, as DNA ligands in G-quadruplex and their use as telomerase inhibitors: (I) nitrogen aromatic cycle - (NR 3 ) p - (CO) n- distributor - (CO) m - (NR ' 3 ) q - aromatic or non-aromatic cycle with n, m, p and q identical or different represent l 'integer 0 or 1, in which
  • Ra and Rb which are identical or different, represent hydrogen or a C1-C4 alkyl radical or
  • Ra and Rb which are identical or different, represent hydrogen or a C1-C4 alkyl radical or
  • a triazine group optionally substituted by one or more radicals chosen from halogen atoms, alkyl radicals having 1 to 4 carbon atoms and thio, oxy or amino radicals themselves optionally substituted by one or more short-chain alkyl chains containing 1 to 4 carbon atoms or 0 a heterocyclic radical containing 5 to 6 links containing a sulfur, oxygen or nitrogen atom
  • a phenyl radical -NH-phenyl-NH-, -NH-phenyl-CH2- NH-, -NH-CH2-phenyl-CH2-NH-, -NH-CH2-phenyl-NH-, -CH2- phenyl- CH2-, -CH2-phenyl, -phenyl-CH2-, -CH2-thienyl-, -thienyl-CH2-, the radical -CH ⁇ CH-, or
  • Ra and Rb which are identical or different, represent hydrogen or a C1-C4 alkyl radical or
  • Ra and Rb which are identical or different, represent hydrogen or a C1-C4 alkyl radical or
  • a phenyl ring optionally substituted by a halogen group, C1-C4 alkoxy, cyano, carbonylamino optionally substituted by one or more C1-C4 alkyl groups, guanyl, alkylthio in C1-C4, amino, C1-C4 alkylamino, dialkylamino in C1-
  • heterocyclic ring aromatic or non-aromatic, mono or bi or tricyclic comprising 0 to 2 heteroatoms per cycle provided that at least one heteroatom is present in at least one ring optionally substituted by one or more C1-C4 alkyl groups or by C1-C4 alkylene or C2-C4 alkenylene groups, the heteroatom of which, when it represents a nitrogen atom, may optionally be in quaternary form.
  • R3 and R'3, identical or different, independently of one another represent hydrogen or a C1-C4 or aralkyl alkyl radical, the alkyl part of which is C1-C4.
  • • X represents a single bond, or a straight or branched C1-C4 alkyl radical, a C2-C4 alkenyl radical, a C2-C4 alkynyl radical or a phenyl radical.
  • a phenyl radical or 0 a diazine or triazine group
  • the heterocyclic, phenyl, diazine or triazine radicals being optionally substituted by one or more radicals chosen from halogen atoms, alkyl radicals having 1 to 4 carbon atoms and thio, oxy or amino radicals themselves optionally substituted by one or more short chain alkyl chains containing 1 to 4 carbon atoms.
  • Said products of formula (IB) can in all the possible racemic isomeric, enantiomeric and diastereoisomeric forms, as well as the addition salts with mineral and organic acids or with the mineral and organic bases of said products of formula (IB).
  • the compounds described in the present invention :
  • alkyl or alk radical denotes a linear or branched radical containing at most 12 carbon atoms chosen from the methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl radicals, isopentyl, sec-pentyl, tert-pentyl, neo-pentyl, hexyl, isohexyl, sec- hexyl, tert-hexyl and also heptyl, octyl, nonyl, decyl, undecyl and dodecyl, as well as their linear or branched position isomers, On more particularly cites the alkyl radicals having at most 6 carbon atoms and in particular the methyl, ethyl, propyl, isopropyl, n-butyl, isobutyl, terbutyl, linear
  • alkenyl radical designates a linear or branched radical containing at most 12 carbon atoms and preferably 4 carbon atoms chosen, for example, from the following values: ethenyl or vinyl, propenyl or allyl, 1-propenyl, n-butenyl, i- butenyl, 3-methylbut-2-enyl, n-pentenyl, hexenyl, heptenyl, octenyl, cyclohexylbutenyl and decenyl as well as their linear or branched position isomers.
  • the alkenyl values the allyl or butenyl values are more particularly cited.
  • alkynyl radical designates a linear or branched radical containing at most 12 carbon atoms and preferably 4 carbon atoms chosen for example from the following values: ethynyl, propynyl or propargyl, butynyl, n-butynyl, i-butynyl, 3- methylbut-2-ynyl, pentynyl or hexynyl as well as their linear or branched position isomers.
  • the propargyl value is more particularly cited.
  • aryl radical denotes unsaturated radicals, monocyclic or made up of condensed, carbocyclic rings.
  • aryl radical mention may be made of phenyl or naphthyl radicals. Mention is more particularly made of the phenyl radical.
  • arylalkyl is meant the radicals resulting from the combination of the alkyl radicals mentioned above optionally substituted and the aryl radicals also mentioned above, optionally substituted: mention is made, for example, of the benzyl, phenylethyl, 2-phenethyl, triphenylmethyl or naphthlenemethyl radicals.
  • heterocyclic radical denotes a saturated (heterocycloalkyl) or unsaturated (heteroaryl) carbocylic radical consisting of at most 6 links interrupted by one or more heteroatoms, identical or different, chosen from oxygen, nitrogen or sulfur atoms.
  • heterocycloalkyl radicals mention may be made in particular of radicals dioxolane, dioxane, dithiolane, thiooxolane, thiooxane, oxiranyl, oxolanyl, dioxolanyl, piperazinyl, piperidinyl, pyrrolidinyl, imidazolidinyl, pyrazolidinyl, morpholinyl or tetrahydrofuryl, tetrahydrothienyl, chromanyl, dihydrobenzofuranyl, indolinyl, piperidyl, perhydropyranyl, pyrindolinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl or thioazolidinyl , all these radicals being optionally substituted.
  • heterocycloalkyl radicals mention may in particular be made of the optionally substituted piperazinyl, optionally substituted piperidinyl, optionally substituted pyrrolidinyl, imidazolidinyl, pyrazolidinyl, morpholinyl or thioazolidinyl radicals.
  • heterocycloalkylalkyl radical is meant the radicals in which the heterocycloalkyl and alkyl radicals have the above meanings.
  • the furyl radicals such as 2-furyl, thienyl such as 2-thienyl and 3-thienyl, pyrrolyl , diazolyle, thiazolyle, thiadiazolyle, thiatriazolyle, isothiazolyle, oxazolyle oxadiazolyle, 3- or 4-isoxazolyle, imidazolyle, pyrazolyle, isoxazolyle.
  • 6-membered heteroaryl radicals such as 2-pyridyl, 3-pyridyl and 4-pyridyl, pyrimidyl, pyrimidinyl, pyridazinyl, pyrazinyl and tetrazolyl.
  • heteroaryl radicals containing at least one heteroatom chosen from sulfur, nitrogen and oxygen mention may, for example, be made of benzothienyl such as 3-benzothienyl, benzofuryl, benzofurannyl, benzopyrrolyl, benzimidazolyl, benzoxazolyl, thionaphthyl, indolyl, purinyl, quinoline, isoquinoline and naphthyridinyl.
  • heteroaryl radicals mention may be made more particularly of the benzothienyl, benzofurannyl, indolyl or quinolinyl, benzimidazolyl, benzothiazolyl, furyl, imidazolyl, indolizinyl, isoxazolyl, isoquinolinyl, isothiazolyl, pyridinyl, pyridinyl, pyridinyl radicals. , quinazolinyl, 1,3,4-thiadiazolyl, thiazolyl, thienyl and triazolyl groups, these radicals being optionally substituted as indicated for the heteroaryl radicals.
  • R3 and R'3, identical or different represent independently of one another hydrogen or an alkyl radical in C1 -C4 or aralkyl in which the alkyl radical is C1-C4,
  • X represents a single bond, a C1-C4 alkyl radical, a C2-C4 alkenyl or alkynyl radical or a phenyl radical, the other substituents being chosen from the values indicated above.
  • nitrogen aromatic ring means a heterocycle comprising at least one nitrogen atom or an aromatic group not comprising a heteroatom in the ring but containing at least one nitrogen atom in a hydrocarbon chain linked to the cycle such as a guanidino or guanyl chain.
  • quinoline units can be substituted by any other group which does not intervene in the intended application, thus acridine or isoquinoline or quinazoline or quinoxaline or phthalazine or benzothiazine or benzoxazine or phenoxazine or phenothiazine groups are included in the definition of quinoline groups.
  • Preferred among all of the above compounds are those comprising a distributor chosen from heterocyclic groups such as for example pyridyl, or thienyl, a phenyl radical, a diazine or a triazine.
  • a distributor chosen from heterocyclic groups such as for example pyridyl, or thienyl, a phenyl radical, a diazine or a triazine.
  • diazine groups it is preferred to use pyridazines.
  • Particularly preferred among all of the above compounds are those comprising a meta-disubstituted distributor by the groups "nitrogen aromatic ring having a nitrogen atom in quaternary form - (NR 3 ) p - CO” and "(CO) m - (NR ' 3 ) q - aromatic or non-aromatic cycle "as defined above and in which the distributor is moreover optionally substituted by a halogen atom.
  • Preferred among all of the above compounds are those comprising a meta-disubstituted distributor by the groups "nitrogen aromatic ring having a nitrogen atom in quaternary form - (NR 3 ) p - CO" and "(CO) m - (NR ' 3 ) q - aromatic or non-aromatic cycle "as defined above.
  • nitrogen aromatic ring having a nitrogen atom in quaternary form - (NR 3 ) p - CO” and "(CO) m - (NR ' 3 ) q - aromatic or non-aromatic cycle "as defined above.
  • the heterocycle in quaternary form is a quinoline.
  • the compounds defined above are particularly preferred, characterized in that m, p and q represent the integer 1.
  • the compounds of the present invention very particularly preferred are those compounds whose distributor represents a pyridine-2,6-disubstituted or a pyridazine-2-6-disubstituted by the groups "nitrogen aromatic cycle having a quaternary nitrogen atom in quaternary form - (NR 3 ) p - CO" and "(CO) m - (NR ' 3 ) q - aromatic cycle or non-aromatic "and in which the quaternized heterocycle is an N-methyl-quinolinium, and in which the distributor is moreover optionally substituted by a halogen atom.
  • the compounds of the present invention very particularly preferred are those compounds whose distributor represents a pyridine-2,6-disubstituted or a pyridazine-2-6-disubstituted by the groups "aromatic nitrogen ring having a quaternary nitrogen atom under quaternary form - (NR 3 ) p - CO "and” (CO) rn - (NR ' 3 ) q - aromatic or non-aromatic cycle "and whose quaternized heterocycle is an N-methyl-quinolinium.
  • the present invention particularly relates in particular to the products of formula (IB) as defined above, characterized in that they correspond to the formula (la) below:
  • the heterocyclic, phenyl, diazine or triazine radicals being optionally substituted by one or more radicals chosen from halogen atoms, alkyl radicals having 1 to 4 carbon atoms and thio, oxy or amino radicals themselves optionally substituted by one or more short-chain alkyl chains containing 1 to 4 carbon atoms,
  • An and Ar 2 identical or different represent when A and Ar 2 are identical, they represent a nitrogen aromatic cycle having a quaternary atom represented by a quinoline optionally substituted by at least
  • Ra and Rb which are identical or different, represent hydrogen or a C1-C4 alkyl radical or
  • a phenyl ring optionally substituted by a halogen group, C1-C4 alkoxy, cyano, carbonylamino optionally substituted by one or more C1-C4 alkyl groups, guanyl, C1-C4 alkylthio, amino, C1-C4 alkylamino, dialkylamino in C1-C4 for each alkyl, nitro, C1-C4 alkyleneamino or C2-C4 alkenyleneamino
  • heterocyclic aromatic or non-aromatic mono or bi or tricyclic ring comprising 0 to 2 heteroatoms per cycle provided that at least one heteroatom is present in at least one cycle optionally substituted by one or more C1-C4 alkyl groups or by C1-C4 alkylene or C2-C4 alkenylene groups,
  • R3 and R'3, identical or different, independently of one another represent hydrogen or a C1-C4 or aralkyl alkyl radical in which the alkyl radical is C1-C4,
  • X represents a single bond, a C1-C4 alkyl radical, a C2-C4 alkenyl or alkynyl radical or a phenyl radical, said products of formula (la) being in all the possible racemic, enantiomeric and diastereomeric isomeric forms , as well as the addition salts with mineral and organic acids or with mineral and organic bases of said products of formula (la).
  • a subject of the present invention is therefore the products of formula (la) as defined above in which X represents a C1-C4 alkyl radical, the other substituents of the products of formula (la) being chosen from the values indicated below above, said products of formula (la) being in all the possible racemic isomeric, enantiomeric and diastereoisomeric forms, as well as the addition salts with mineral and organic acids or with mineral and organic bases of said products of formula (la ).
  • a subject of the present invention is thus the products of formula (la) as defined above in which characterized in that A is chosen from heterocyclic groups, such as for example pyridyl or thienyl, a phenyl radical, a diazine or a triazine as defined above.
  • heterocyclic groups such as for example pyridyl or thienyl, a phenyl radical, a diazine or a triazine as defined above.
  • a subject of the present invention is thus the products of formula (la) as defined above, characterized in that the diazine groups that A can represent are pyrazines.
  • the present invention thus particularly relates to the products of formula (la) as defined above, characterized in that A is metasubstituted by the groups “aromatic nitrogen ring having a nitrogen atom in quaternary form - (NR 3 ) p - CO "and” (CO) m - (NR ' 3 ) q - aromatic or non-aromatic ring "as defined above and in which A is additionally optionally substituted by a halogen atom.
  • a subject of the present invention is therefore the products of formula (la) as defined above, characterized in that A is meta-disubstituted by the groups “aromatic nitrogen cycle having a nitrogen atom in quaternary form - (NR 3 ) p - CO "and” (CO) m - (NR ' 3 ) q - aromatic or non-aromatic cycle "as defined above.
  • the present invention thus relates to the products of formula (la) as defined above, characterized in that the heterocycle in quaternary form is a quinoline.
  • the present invention thus particularly relates to the products of formula (la) as defined above characterized in that A represents a pyridine-2,6-disubstituted or a pyridazine-2-6-disubstituted by groups "aromatic nitrogen cycle having a quaternary nitrogen atom in quaternary form - (NR 3 ) p - CO" and "(CO) m - (NR ' 3 ) q - aromatic or non-aromatic cycle” and including the quaternized heterocycle is an N-methyl-quinolinium, and in which A is additionally optionally substituted by a halogen atom.
  • the present invention thus relates to the products of formula (la) as defined above, characterized in that A represents a pyridine-2,6-disubstituted or a pyridazine-2-6-disubstituted by the groups "aromatic nitrogen cycle having a quaternary nitrogen atom in quaternary form - (NR 3 ) p - CO "and” (CO) m - (NR ' 3 ) q - aromatic or non-aromatic ring "and of which the quaternized heterocycle is N-methyl - quinolinium.
  • the present invention thus relates to the products of formula (la) as defined above, characterized in that p and q represent the integer 1.
  • the present invention thus relates to the products of formula (la) as defined above, characterized in that m, p and q represent the integer 1.
  • the subject of the present invention is in particular the products of formula (la) as defined above, characterized in that Ar 2 represents a group chosen from the following groups: 4-amino- or 4-methylamino-, 4-dimethylamino- or 4-alkoxyquinolyl or quinolinium in which the quinolinium nucleus is optionally substituted by one or two methyl group (s).
  • Ar 2 represents a group chosen from the following groups: 4-amino- or 4-methylamino-, 4-dimethylamino- or 4-alkoxyquinolyl or quinolinium in which the quinolinium nucleus is optionally substituted by one or two methyl group (s).
  • the subject of the present invention is in particular the products of formula (la) as defined above, characterized in that R3 and R3 'represent hydrogen.
  • the present invention particularly relates to the products of formula (IB) as defined above, the names of which follow:
  • the present invention thus particularly relates to the products of formula (IB) as defined above, the names of which follow:
  • the present invention thus relates to the following product of formula (IB):
  • the present invention also relates to a process for preparing the products of formula (IB) according to the present invention: a general method of synthesis is thus described as follows.
  • the present invention also relates to a process for preparing the products of formula (IB) according to the present invention: a general method of synthesis is thus described as follows ⁇ St an N-methyl-quinolinium.
  • a particularly advantageous method within the framework of the invention consists in alkylating at the end of the synthesis a product of general formula (IA) into a product of general formula (IB) using an alkyl halide, or optionally an alkyl sulphate according to the general scheme below:
  • a subject of the present invention is therefore the products of formula (IB) as defined above, characterized in that they have a telomerase inhibiting activity.
  • the present invention thus relates to the products of formula (IB) as defined above, characterized in that they have an anticancer activity.
  • the present invention also relates to, as medicaments, the products of formula (IB) as defined above, as well as their prodrugs, said products of formula (I) being in all the isomeric, racemic, enantiomeric and diastereo forms -isomers, as well as addition salts with mineral and organic acids or with pharmaceutically acceptable mineral and organic bases of said products of formula (I).
  • the subject of the present invention is therefore, as medicaments, the products of formula (la) as defined in the preceding claims as well as their prodrugs, said products of formula (la) being in all the isomeric, racemic, enantiomeric and diastereogenic forms isomers, as well as addition salts with mineral and organic acids or with pharmaceutically acceptable mineral and organic bases of said products of formula (la).
  • the present invention relates particularly as medicaments, the products described below in the experimental part, as well as their prodrugs, as well as addition salts with mineral and organic acids or with pharmaceutically acceptable mineral and organic bases of these products.
  • patient designates human beings but also other mammals.
  • Prodrug denotes a product which can be transformed in vivo by metabolic mechanisms (such as hydrolysis) into a product of formula (I).
  • metabolic mechanisms such as hydrolysis
  • an ester of a product of formula (I) containing a hydroxyl group can be converted by hydrolysis in vivo to its parent molecule.
  • an ester of a product of formula (I) containing a carboxy group can be converted by hydrolysis in vivo to its parent molecule.
  • the products can be administered parenterally, buccally, perlingually, rectally or topically.
  • a subject of the invention is also pharmaceutical compositions, characterized in that they contain, as active principle, at least one of the drugs of general formula (IB) as defined above and in particular the products described below in the experimental part.
  • compositions can be presented in the form of solutions or injectable suspensions, tablets, coated tablets, capsules, syrups, suppositories, creams, ointments and lotions.
  • These pharmaceutical forms are prepared according to the usual methods.
  • the active principle can be incorporated into excipients usually used in these compositions, such as aqueous vehicles or not, talc, gum arabic, lactose, starch, magnesium stearate, cocoa butter, fatty substances of animal or vegetable origin, paraffinic derivatives, glycols, various wetting agents, dispersants or emulsifiers, preservatives.
  • the usual dose which varies depending on the subject treated and the condition in question, can be, for example, from 10 mg to 500 mg per day in humans, orally.
  • the present invention also relates to the pharmaceutical compositions as defined above containing, in addition, active principles of other chemotherapy drugs against cancer.
  • the present invention also relates to pharmaceutical compositions as defined above, characterized in that they are used as medicaments, in particular for the chemotherapy of cancers.
  • the present invention thus relates to the use of the compounds defined above as a pharmaceutical product for human use.
  • the present invention also relates to therapeutic combinations consisting of a compound of formula (IB) as defined above and of another anticancer compound.
  • the present invention thus relates to therapeutic combinations as defined above, characterized in that the anticancer compound is chosen from alkylating agents, platinum derivatives, antibiotic agents, antimicrotubule agents, anthracyclines, topoisomerases from groups I and II, fluoropyrimidines, cytidine analogs, adenosine analogs, enzymes and various compounds such as L-asparaginase, hydroxyurea, trans-retinoic acid, suramin, irinotecan, topotecan, dexrazoxane, amifostine, herceptin as well as oetrogenic and androgenic hormones, anti-vascular agents.
  • the anticancer compound is chosen from alkylating agents, platinum derivatives, antibiotic agents, antimicrotubule agents, anthracyclines, topoisomerases from groups I and II, fluoropyrimidines, cytidine analogs, adenosine analogs, enzymes and various compounds such as L-aspara
  • the present invention also relates to a therapeutic association consisting of a compound of formula (IB) as defined above and of radiation.
  • the present invention thus relates to combinations as defined above, characterized in that each of the compounds or of treatments is administered simultaneously, separately or sequentially.
  • the present invention thus relates to the use of products of formula (IB) as defined above or of pharmaceutically acceptable salts of said products of formula (IB) for the preparation of medicaments intended to treat cancers, genetic diseases or abnormalities hairiness.
  • the present invention thus relates to the use of products of formula (IB) as defined above or of pharmaceutically acceptable salts of said products of formula (I) for the preparation of a medicament intended for treat cancer.
  • the present invention thus relates to the use of products of formula (IB) as defined above or of pharmaceutically acceptable salts of said products of formula (I) for the preparation of a medicament intended to treat genetic diseases such as syndromes Bloom, Werner, Rothmund-Thomson or ataxia telangiectaxis.
  • the present invention thus relates to the use of products of formula (IB) as defined above or of pharmaceutically acceptable salts of said products of formula (I) for the preparation of a medicament intended for treating hair abnormalities such as l 'Excessive hair.
  • the present invention particularly relates to the use of products of formula (IB) as defined above or of pharmaceutically acceptable salts of said products of formula (I) for the preparation of a medicament intended for treating breast cancers, , colon, lungs, ovaries, uterus, brain, kidney, larynx, lymphatic system, thyroid, urogenital tract, tract including vesicle and prostate, cancer bones, pancreas, melanomas and more particularly breast, colon or lung cancer.
  • the present invention particularly relates to the use of products of formula (IB) as defined above or of pharmaceutically acceptable salts of said products of formula (I) for the preparation of a medicament intended for the chemotherapy of cancers and in particular intended for chemotherapy for cancers used alone or in combination.
  • the present invention thus relates to the use of products of formula (IB) as defined in any one of the preceding claims or of pharmaceutically acceptable salts of said products of formula (IB) for the preparation of medicaments intended to be used alone or in combination with them. combination with chemotherapy or radiotherapy or alternatively in combination with other therapeutic agents and in particular such a use in which the therapeutic agents can be commonly used anti-tumor agents.
  • the products of formula (I) according to the present invention can thus also be advantageously used in combination with anti-proliferative agents: as examples of such anti-proliferative agents but without however being limited to this list, there may be mentioned aromatase inhibitors, antiestrogens, topoisomerase I inhibitors , topoisomerase II inhibitors, microtubule active agents, alkylating agents, histone deacetylase inhibitors, farnesyl transferase inhibitors, COX-2 inhibitors, MMP inhibitors, mTOR inhibitors, antineoplastic antimetabolites, platinum compounds, compounds which decrease the activity of protein kinases and also antiangiogenic compounds, gonadoreline agonists, antiandrogens, bengamides, biphophonates and trastuzumab.
  • anti-microtubule agents such as taxoids, vinka-alkaloids, alkylating agents such as cyclophosphamide, DNA-intercalating agents such as cis-platinum, interactive agents on topoisomerase such as camptothecin and derivatives, anthracyclines such as adriamycin, antimetabolites such as 5-fluorouracil and derivatives and the like.
  • the affinity and selectivity of the products of general formula (IB) according to the present invention for G-quadruplex DNA structures can be determined by one or more of the following methods:
  • n ° 1 Measurement of the inhibition of pairing of an oligonucleotide. likely to form a G-quadruplex structure, with its complementary strand measured in the form of an inhibitory concentration 50% IC50. expressed in ⁇ M. by a luminescence method according to the experimental protocol is described below
  • the “donor” beads are conjugated to streptavidin and the acceptor beads to an anti-digoxigenin antibody (catalog reference 6760604).
  • a DNA strand, in this case the telomeric strand is coupled at its 5 'end with biotin so as to be able to bind to “donor” beads, while the complementary strand is coupled to digoxigenin in order to be able to bind to “acceptor” beads.
  • the balls are put in proximity and a luminescence signal is then emitted at a wavelength of 520-620 nm.
  • the oligonucleotides used in the experiments were synthesized by Perkin Elmer Life Sciences (Finland).
  • the G-rich strand corresponding to the repeating units of human telomeric DNA has the sequence G-GTT-TAA-AAT-AAT-TGA-GGG-TTA-GGG-TTA-GGG-TTA-GGG.
  • Biotin or digoxigenin are added to the 5 'end of the oligonucleotides.
  • the experiments are carried out in a 50 mM TRIS-HCl buffer pH 7.4 containing 100 mM KCI and 0.1% BSA.
  • the measurements are carried out with an Alphaquest microplate analyzer (Fusion ⁇ ) from Packard Biosciences.
  • the experiments are carried out in 96-well plates (1/2 well).
  • a stock solution of oligonucleotide at the concentration of 25 nM in the buffer described above is prepared. 10 ⁇ l of this solution are distributed in the wells. 10 ⁇ l of the product to be tested at different concentrations prepared in the same buffer containing 0.6% of DMSO are then added. 10 ⁇ l of buffer + 0.6% DMSO are distributed in the control wells. The samples are incubated for 15 minutes at room temperature. After this incubation time 10 ⁇ l of the complementary strand at the concentration of 25 nM and 20 ⁇ l of a solution containing the 2 types of beads previously diluted to 50 mg / ml are added to the wells.
  • telomeric strand can adopt a secondary conformation of the G-quadruplex type which the product as a function of its affinity for this structure stabilizes, preventing pairing with the complementary strand.
  • the signal transmitted is then minimal.
  • the telomeric strand pairs with the complementary strand, which results in a maximum signal.
  • n ° 1 Measurement of the inhibition of apartment of an olioonucleotide. any, with its complementary strand measured under form of inhibitory concentration 50% IC50. expressed in ⁇ M. by a luminescence method according to the experimental protocol is described below
  • the test used is the same as that described above. Only the oligonucleotides are different, the telomeric strand being replaced by an oligonucleotide having the following sequence: G-GTT-TAA-AAT-AAT- TGA-GGC-TTA-CCG-TTA-CCG-TTA-CGG biotinylated at the end 5 .
  • the complementary strand has the sequence: 5'-GGT-TTA-AAA-AAT-TTG -CGG-TAA-CGG-TAA-CGG-TAA-GCC-T labeled with digoxigenin at the 5 'end.
  • the product to be tested has an affinity for the biotinylated DNA sequence, the matching to the complementary strand will be prevented and the signal obtained minimal. In the absence of a product or if the latter has no affinity for this DNA, the pairing will be done and the signal will be maximum.
  • Affinity test No. 2 Measurement of the dissociation constant, expressed in ⁇ M, of the complex between a product of the invention and an oligonucleotide, capable of forming a monomeric G-quadruplex structure; by a fluorescence method according to the experimental protocol is described below.
  • the titrations are carried out at 20 ° C. in a quartz cell of 3 ml of useful volume and square section 10 ⁇ 10 mm placed in the thermostatically controlled compartment of the Spex Fluorolog 3 fluorimeter (Jobin-Yvon).
  • the buffer used in all experiments is a sodium cacolylate pH 7.2 (10 mM) containing 100 mM in potassium chloride.
  • To a 0.1 ⁇ M solution of compound are added increasing concentrations of nucleic acid. After an equilibration time of 3 minutes, a fluorescence emission spectrum is recorded for each point, using 5 nm slits and an excitation wavelength of 340 nm. Each aliquot represents an additional volume of 3 microliters.
  • the dilution effects are corrected at the end of the experiment after integration of the emission signal.
  • the curves representing the emission intensity as a function of the nucleic acid concentration are then analyzed and fitted with Kaleidagaph 3.52 software for Macintosh.
  • the titrations are carried out according to a protocol identical to that used for the titrations of the previous test.
  • n ° 3 Measurement of the stabilization of G-quadruplexes D Tm. expressed in ° C. by a method using the formation of a complex with fluorescein, the experimental protocol of which is described below
  • the FAM + DABCYL oligoncleotide carries the catalog reference, OL-0371-0802. It has the sequence: GGGTTAGGGTTAGGGTTAGGG corresponding to 3.5 repetitions of the human telomeric motif (strand rich in G). Fluorescein is attached to the 5 'end, DABCYL to the 3' end, by the chemical arms described by Eurogentec. A FAM + TAMRA oligonucleotide can also be used. The concentration of the samples is verified by spectrophotometry, by recording the absorbance spectrum between 220 and 700 nm and using the molar extinction coefficient supplied by the supplier.
  • 0.2 ⁇ M in 0.1 M LiCI 10 mM cacodylate pH 7.6 buffer is previously prepared, briefly heated to 90 ° C and slowly cooled to 20 ° C, then distributed in aliquots of 600 ⁇ l in the fluorescence tanks. 3 ⁇ l of water (for control) or 3 ⁇ l of the product to be tested (stock at 200 ⁇ M, final concentration 1 ⁇ M) are then added and mixed. The samples are then left to incubate for at least 1 hour at 20 ° C before each measurement. The use of longer incubation times (up to 24 hours) has no influence on the result obtained. Each experiment allows the measurement of 1 to 4 samples. This is first incubated at an initial temperature of 20 ° C and brought to 80 ° C in 38 minutes.
  • fluorescence is measured simultaneously at one (515 nm) or two emission wavelengths (515 nm and 588 nm) using 470 nm as the excitation wavelength. A measurement is made every 30 seconds or every degree.
  • the temperature of the water bath is recorded in parallel, and the fluorescence profile as a function of the temperature is reconstructed from these values.
  • the fluorescence profiles are then normalized between 20 ° C and 80 ° C, and the temperature for which the emission intensity at 515 nm is the average of those at high and low temperatures is called Tm. Under these conditions, the Tm of the reference sample without addition of product is approximately 44 ° C in a Lithium Chloride buffer. This temperature is brought to more than 55 ° C. in a sodium chloride buffer.
  • the GA “duplex” results from auto-matching of the oligonucleotide (5 'GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA).
  • the parallel duplex results from the association of 5'AAAAAAAA TAATTTTAAATATT with 5 'IIIIIIIII lATTAAAATTTATAA.
  • 24 CTG mimics 8 repetitions of trinucleotide: 5 'CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG.
  • ds26 (sample # 11) is an autocomplementary duplex of 26 bases 5 'CAATCGGATCGAATTCGATCCGATTG.
  • 22CT is an oligonucleotide which mimics the C-rich strand of human telomeres: 5 'CCCTAACCCTAACCCTAACCCT
  • 22AG is an oligonucleotide which mimics the G-rich strand of human telomeres: 5' AGGGTTAGGGTTAGGGTTAGGG.
  • 24G20 T 2 G 20 T 2 , sample # 15) can form a 5 'intermolecular quadruplex
  • poly polynucleotide
  • oligo oligonucleotide
  • oligos structure formed by the association of two different oligonucleotides. The lengths are indicated in brackets. Polynucleotides are more than 100 bases long. b: These duplexes involve the formation of non-canonical base pairs.
  • the antitelomerase activity of the products of the invention which depends specifically on the stabilization of the G-guadruplex structure, measured by the inhibitory concentration 50% IC50 expressed in ⁇ M, can be evaluated according to the protocol below:
  • the pulmonary carcinoma line A549 is obtained from the ATCC (American Type Culture Collection, Rockville USA).
  • the cells are cultured in a layer, in a culture flask in DMEM medium, supplemented with 2 mM glutamax, Penicillin 200 U / ml streptomycin 200 ⁇ g / ml and 10% fetal calf serum inactivated by heat.
  • the cells in the exponential growth phase are trypsinized, washed in 1 ⁇ PBS and an aliquot of 10 6 cells is centrifuged at 3000 ⁇ G and the supernatant discarded.
  • the cell pellet is resuspended by several successive pipetting in 200 ⁇ l of lysis buffer containing CHAPS 0.5%, Tris-HCl pH 7.5 10 mM, 1 mM MgCl 2 , 1 mM EGTA, 5 mM ⁇ -mercaptoethanol, 0.1 mM PMSF and 10% glycerol and is kept in ice for 30 minutes.
  • the lysate is centrifuged at 160000xG for 20 minutes at 4 ° C and 160 ⁇ l of the supernatant is recovered.
  • the determination of the proteins of the extract is carried out by the Bradford method.
  • the extract is stored at -80 ° C.
  • telomerase inhibition is determined by a modified TRAP protocol which makes it possible to measure the extension of telomerase from an oligonucleotide TSG4 ( 5 GGGATTGGGATTGGGATTGGGTT 3 ) which can form an intramolecular G-quadruplex structure, in the presence of a cell extract enriched in telomerase activity and compounds which are added at different concentrations (30, 10, 1, 0.1 and 0.01 ⁇ M).
  • the extension reaction is followed by PCR amplification of the extension products using the oligonucleotide CXext ( 5 GTGCCCTTACCCTTACCCTTACCCTAA 3 ).
  • the selectivity of inhibition is measured by amplifying an oligonucleotide control TSNT (5 ATTCCGTCGAGCAGAGTTAAAAGGCCGAGAAGCGAT 3) by the TS oligonucleotide (5 'AATCGTTCGAGCAGAGTT 3) and oligonucleotide NT (5 ATCGCTTCTCGGCCTTTT 3').
  • oligonucleotide control TSNT (5 ATTCCGTCGAGCAGAGTTAAAAGGCCGAGAAGCGAT 3) by the TS oligonucleotide (5 'AATCGTTCGAGCAGAGTT 3) and oligonucleotide NT (5 ATCGCTTCTCGGCCTTTT 3').
  • the reaction medium is prepared in a final volume of 50 ⁇ L according to the following composition:
  • telomerase extract 100 ng telomerase extract in a volume of 1 ⁇ l
  • Bi-distilled water QS 50 ⁇ l The oligonucleotides are obtained from Eurogentec Belgium) and are stored at -20 ° C at a stock concentration of 100 ⁇ M in sterile distilled water without ribonucleases and deoxyribonucleases.
  • reaction samples are assembled in ice in 0.2 ml PCR tubes.
  • the reaction samples are then incubated in an Eppendorf Mastercycler PCR apparatus under the following temperature conditions: 15 minutes at 30 ° C, 1 minute at 90 ° C, followed by 30 cycles of, 30 seconds at 92 ° C,
  • the samples are then analyzed by electrophoresis in 12% acrylamide / bisacrylamide gel (19: 1) in 1 ⁇ TBE buffer for 45 minutes at a voltage of 200 volts, using a Novex electrophoresis system.
  • the gels are stained for 15 minutes in a 1 ⁇ solution of SYBR Green (Roche) and the fluorescence of the PCR products is digitized by a digital camera (Bioprint System).
  • the disappearance of the band formed by the dimerization of the oligonucleotides TSG4 and Cxext corresponds to a stabilization of the G-quadruplex form of the oligonucleotide TSG4 and corresponds to an inhibition of the extension of telomeric repeats from the oligonucleotide TSG4.
  • the disappearance of the band formed by the amplification of the control oligonucleotide TSNT corresponds to a non-specific inhibition of the activity of Taq polymerase.
  • the results are expressed by calculating the concentration ( ⁇ M) inhibiting 50% of the formation of the TSG4-Cxext band (CI50 TRAP-G4) and by calculating the concentration inhibiting 50% of the formation of the TSNT control band (CI50 Taq), relative to the value of the enzymatic sample without compound.
  • the ratio CI50 Taq / CI50 TRAP-G4 indicates the selectivity factor for the inhibition of the extension of telomerase by stabilization of G-quadruplex compared to the inhibition of Taq polymerase.
  • a compound is active as an antitelomerase agent stabilizing the G-quadruplex DNA when the IC50 TRAP-G4 is in particular less than 5 ⁇ M.
  • the compound is considered to be selective as an anti -lomerase agent stabilizing the G-quadruplex when the CI50 TRAP-G4 / CI50 Taq ratio is greater than 3.
  • Step 1 In a 50 ml three-necked flask, with magnetic stirring, 1 g of 2,6-pyridine-dicarboxylic acid and 1.81 g of 6-aminoquinoline are dissolved in 30 ml of dichloromethane and 5 ml of dimethylformamide (DMF), then add 2.4 g of 1- (3-dimethylaminopropyl) -carbodiimide hydrochloride (EDCI) and 162 mg of 1-hydroxybenzotriazole (HOBT). A transient yellow precipitate forms which slowly redissolves. After 1 to 2 hours of stirring at room temperature, an abundant white precipitate appears.
  • DMF dimethylformamide
  • Step 2 In a 25 mL flask, 200 mg of 2,6-pyridine-dicarboxylic acid-bis - [(quinolin-6-yl) amide], obtained in the previous step, are dissolved in 2 mL of methanol , 4 mL of DMF and 10 mL of iodomethane, then the mixture is heated to 50 ° for 72 hours during which an orange precipitate gradually forms. After cooling, this precipitate is drained and washed with methanol.
  • Step 1 In a 50 ml three-necked flask, 1.3 g of n-butyl monoester of 2,6-pyridine-dicarboxylic acid, which can be obtained according to Khim, are dissolved in 35 ml of dichloromethane. Geterosikl. Soedin 1976 (2), 233-7, and 1.17 g of 6-amino-4-dimethylamino-quinaldine, which can be obtained according to WO 0140218, then 1.35 g of EDCI and 90 mg of HOBT are added. . After 2 to 3 hours, a yellow precipitate appears; stirring is continued for 36 hours at room temperature, until the reaction is complete (LC / MS).
  • the reaction medium is diluted with water, the organic phase is decanted and the aqueous phase is extracted with dichloromethane.
  • the combined organic phases are concentrated to dryness under reduced pressure.
  • the pasty residue obtained is taken up with stirring in 20 ml of diisopropyl ether, to form a light beige solid which is drained and air dried. 820 mg of n-butyl ester of 2,6-pyridine-dicarboxylic acid-6 - [(4-dimethylamino-quinaldin-6-yl) amide] are thus obtained, used as such in the following step.
  • Step 3 In a 50 mL flask, 760 mg of 2,6-pyridine-dicarboxylic acid-6 - [(4-dimethylamino-quinaldin-6-yl) amide], obtained above, and 360 mg are dissolved. of 6-aminoquinoline in 15 ml of DMF, then 458 mg of EDCI and 30 mg of HOBT are added. After 72 hours of stirring at room temperature, the solvent is removed under reduced pressure. The residue is taken up in water, and the precipitate thus formed is washed with water and then with a saturated solution of sodium hydrogencarbonate.
  • Step 4 The procedure is as in step 2 of Example 1, but starting with 400 mg of 2,6-pyridine-dicarboxylic acid-2 - [(quinolin-6-yl) amide] -6- [ (4-dimethylamino-quinaldin-6-yl) amide], obtained above in 6 ml of methanol and 15 ml of iodomethane. After recrystallization from ethanol, 382 mg of diodide of 2,6-pyridine-dicarboxylic acid-2- [(1-methyl-quinolinio-6-yl) amide] -6 - [(4-dimethylamino) are then obtained. -1-methyl-quinaldinio-6-yl) amide], in the form of a pale green solid whose characteristics are the following: - Melting point (Kofler)> 260 ° C
  • Step 1 The procedure is as in step 1 of Example 1, but starting with 450 mg of 2,6-pyrazine-dicarboxylic acid, which can be prepared according to J. Med. Chem. (1996), 29, 1452-57, 450 mg of 6-aminoquinoline, 600 mg of EDCI and 40 mg of HOBT in 15 ml of dichloromethane and 10 ml of DMF with stirring overnight at room temperature. After purification by preparative LC / MS, 170 mg of 2,6-pyrazine-dicarboxylic acid-bis - [(quinolin-6-yl) amide] are obtained, in the form of a white powder used as it is in step next.
  • Step 2 The procedure is as in step 2 of Example 1, but starting with 50 mg of 2,6-pyrazine-dicarboxylic acid-bis - [(quinolin-6-yl) amide], obtained here- above in 1 mL of DMF and 5 mL of iodomethane.
  • Step 1 The procedure is as in step 1 of Example 1, but starting with 300 mg of isophthalic acid, 521 mg of 6-aminoquinoline, 727 mg of EDCI and 50 mg of HOBT in 10 ml of DMF with stirring for 1 night at room temperature. 593 mg of 1,3-benzene-dicarboxylic acid-bis - [(quinolin-6-yl) amide] are obtained in the form of a white powder, used as it is in the following step.
  • 2nd step The operation is carried out as in step 2 of Example 1, but starting with 100 mg of 1,3-benzene-dicarboxylic acid-bis - [(quinolin-6-yl) amide], obtained above in 1 mL of DMF and 6 mL of iodomethane. 72 mg of diodide of 1,3-benzene-dicarboxylic acid-bis - [(1-methyl-quinolinio-6-yl) amide] is then obtained, after recrystallization from ethanol, in the form of a yellow solid.
  • -pale with the following characteristics: - Melting point (Kofler)> 260 ° C - 1 H NMR spectrum (300 MHz, (CD 3 ) 2 SO d6, ⁇ in ppm): 4.63 (s:
  • Stage 1 The procedure is carried out as in Stage 1 of Example 1, but starting with 500 mg of 2,6-pyridine-dicarboxylic acid, of 945 mg of 6-aminoquinaldin, which can be prepared according to EP 286277, 1.2 g of EDCI and 100 mg of HOBT in 15 mL of dichloromethane and 3 mL of DMF with stirring for 24 hours at room temperature. 1.47 g of 2,6-pyridine-dicarboxylic acid-bis - [(quinaldin-6-yl) amide] are obtained in the form of a white powder used as it is in the following step.
  • Step 2 The procedure is carried out as in step 2 of Example 1, but starting with 150 mg of 2,6-pyridine-dicarboxylic acid-bis - [(quinaldin-6-yl) amide], obtained below. above in 1.5 mL of DMF and 6 mL of iodomethane. Is then obtained after recrystallization from ethanol, 161 mg of diodide of 2,6-pyridine-dicarboxylic acid-bis - [(1-methyl-quinaldinio-6-yl) amide], in the form of a yellow solid with the following characteristics: - Melting point (Kofler)> 260 ° C
  • Stage 1 The procedure is carried out as in Stage 1 of Example 2, but starting from 500 mg of n-butyl monoester of 2,6-pyridine-dicarboxylic acid, of 388 mg of 4,6-diaminoquinaldin, which can be obtained according to WO 0140218, from 472 mg of EDCI and 30 mg of HOBT in 10 ml of dichloromethane and 5 ml of DMF for 20 hours at room temperature. After purification by flash chromatography on alumina, 450 mg of n-butyl ester of 2,6-pyridine-dicarboxylic acid are obtained, eluting with a mixture of dichloromethane and methanol (95/5 by volume). 6 - [(4-amino-quinaldin-6-yl) amide], used as is in the next step.
  • 2nd step The procedure is as in step 2 of Example 2, but starting with 450 mg of n-butyl ester of 2,6-pyridine-dicarboxylic acid-6 - [(4-amino-quinaldin-6- yl) amide], obtained above, in 20 ml and 1.19 ml of a 1M aqueous solution of potassium hydroxide. 243 mg of 2,6-pyridine-dicarboxylic acid-6 - [(4-amino-quinaldin-6-yl) amide] are thus obtained in the form of a beige solid used as it is in the following step.
  • Step 3 The procedure is as in step 3 of Example 2, but starting from 93 mg of 2,6-pyridine-dicarboxylic acid-6 - [(4-amino-quinaldin-6-yl) amide], obtained here above, 41.6 mg of 6-aminoquinoline, 61 mg of EDCI and 14 mg of HOBT in 5 ml of dichloromethane and 5 ml of DMF for 48 hours at room temperature. 101 mg of 2,6-pyridine acid are thus obtained. dicarboxylic-2 - [(quinolin-6-yl) amide] -6 - [(4-amino-quinaldin-6-yl) amide], in the form of a beige powder, used as it is in the next step.
  • Step 4 The procedure is as in step 2 of Example 1, but starting with 65 mg of 2,6-pyridine-dicarboxylic acid-2 - [(quinolin-6-yl) amide] -6- [ (4-amino-quinaldin-6-yl) -amide], obtained above, in 1 ml of DMF and 5 ml of iodomethane. After recrystallization from ethanol, 58 mg of 2,6-pyridine-dicarboxylic acid-2 - [(1-methyl-quinolinio-6-yl) amide] -6 - [(4- amino-quinaldin-6-yl) amide], isolated in its tautomeric imino form, in the form of a yellow solid whose characteristics are the following:
  • Step 1 The operation is carried out as in step 1 of Example 1, but starting with 100 mg of isophthalic acid, 190.5 mg of 6-aminoquinaldin, 242 mg of EDCI and 20 mg of HOBT in 5 mL of DMF with stirring for 20 hours at room temperature. 265 mg of 2,6-benzene-dicarboxylic acid-bis - [(quinaldin-6-yl) amide] are obtained in the form of a beige powder used as it is in the following step.
  • Step 2 The operation is carried out as in step 2 of Example 1, but starting from 95 mg of 2,6-benzene-dicarboxylic acid-bis - [(quinaldin-6-yl) amide], obtained below. above, in 1 mL of DMF and 5 mL of iodomethane. 83 mg of 2,6-benzene acid diodide are then obtained after recrystallization from ethanol. dicarboxylic-bis - [(1-methyl-quinaldinio-6-yl) amide], in the form of a yellow solid, the characteristics of which are the following:
  • Step 1 The procedure is as in step 1 of Example 1, but starting with 100 mg of 2,4-pyridine-dicarboxylic acid, 181 mg of 6-aminoquinaldin, 241 mg of EDCI and 16 mg of HOBT in 5 mL of DMF with stirring for 20 hours at room temperature. 325 mg of 2,4-pyridine-dicarboxylic acid-bis - [(quinolin-6-yl) amide] are obtained in the form of a beige powder used as it is in the following step.
  • 2nd step The procedure is as in step 2 of Example 1, but starting with 300 mg of 2,4-pyridine-dicarboxylic acid-bis - [(quinolin-6-yl) amide], obtained above, in 3 mL of DMF and 10 mL of iodomethane. 372 mg of 2,4-pyridine-dicarboxylic acid-bis - [(1-methyl-quinolin-6-yl) amide] diodide are then obtained after recrystallization from ethanol, in the form of a yellow solid. the characteristics of which are as follows: - Melting point (Kofler)> 260 ° C. - 1 H NMR spectrum (400 MHz, (CD 3 ) 2 SO d6, at a temperature of
  • Step 1 Dissolve 1.74 g of 2,6-pyridine-dicarboxylic acid, 500 mg of 4-aminoquinoline, 543 ⁇ L of N- (2-chloroethyl) diisopropylamine hydrochloride (DIC) in a 25 ml three-necked flask and 469 mg of HOBT in 15 mL of DMF.
  • CCM chemical vapor deposition
  • eluent dichloromethane / methanol 90/10 the reaction medium is deposited on a cartridge of 5 g of sulphonic resin (40 ⁇ M of Varian Mega Bond Elut SCX model).
  • Step 2 The operation is carried out as in step 3 of Example 2, but starting with 150 mg of 2,6-pyridine-dicarboxylic-2 - [(quinolin-6-yl) amide], obtained below. above, 74 mg of 3-aminoquinoline, which can be prepared according to Tetrahedron. Lett. 2001, 42, 3251-54, 109 mg of EDCI and 7 mg of HOBT in 5 mL of dichloromethane and 5 mL of DMF for 48 hours at room temperature. 180 mg of 2,6-pyridine-dicarboxylic acid-2 - [(quinolin-6-yl) amide] -6 - [(quinolin-3-yl) amide] are thus obtained in the form of a pinkish beige powder. , used as is in the next step.
  • Step 3 The procedure is as in step 2 of Example 1, but starting with 150 mg of 2,6-pyridine-dicarboxylic acid-2 - [(quinolin-6-yl) amide] -6-
  • Step 1 The operation is carried out as in step 3 of Example 2, but starting with 150 mg of 2,6-pyridine-dicarboxylic acid-2 - [(quinolin-6-yl) amide], obtained with 1 step 1 of Example 9, 74 mg of 5-aminoquinoline, 109 mg of EDCI and 7 mg of HOBT in 5 ml of dichloromethane and 5 ml of DMF for 48 hours at room temperature. This gives 201 mg of 2,6-pyridine-dicarboxylic acid-2 - [(quinolin-6-yl) amide] -6 - [(quinolin-5-yl) amide], in the form of a beige powder, used as is in the next step.
  • Step 2 The procedure is as in step 2 of Example 1, but starting with 180 mg of 2,6-pyridine-dicarboxylic acid-2 - [(quinolin-6-yl) amide] -6- [ (quinolin-5-yl) -amide], obtained above, in 1.5 ml of DMF and 5 ml of iodomethane.
  • Step 1 The operation is carried out as in step 1 of Example 1, but starting from 150 mg of 2,6-pyridine-dicarboxylic acid, from 945 mg of 3-aminoquinoline, which can be prepared according to Tetrahedron. Lett. 2001, 42, 3251-54, 361 mg of EDCI and 24 mg of HOBT in 10 mL of DMF with stirring for 18 hours at room temperature. 495 mg of 2,6-pyridine-dicarboxylic acid-bis - [(quinolin-3-yl) amide] are obtained in the form of a white powder, used as it is in the following step.
  • 2nd step The procedure is as in step 2 of Example 1, but starting with 200 mg of 2,6-pyridine-dicarboxylic acid-bis - [(quinolin-3-yl) amide], obtained above in 3 mL of DMF and 10 mL of iodomethane. 231 mg of diodide of 2,6-pyridine-dicarboxylic acid-bis - [(1-methyl-quinolinio-3-yl) amide] is then obtained after recrystallization from ethanol, in the form of a yellow solid. with the following characteristics:
  • Step 1 The operation is carried out as in step 3 of Example 2, but starting from 140 mg of 2,6-pyridine-dicarboxylic-2 - [(quinolin-6-yl) amide], obtained with 1 step 1 of Example 9, 73 ⁇ L of 1- (2-aminoethyl) piperidine, 100 mg of EDCI and 7 mg of HOBT in 5 ml of dichloromethane and 5 ml of DMF for 48 hours at temperature room.
  • Step 2 The procedure is as in step 2 of Example 1, but starting with 200 mg of 2,6-pyridine-dicarboxylic acid-2 - [(quinolin-6-yl) amide] -6- [ 2- (piperidin-1-yl) -ethylamide], obtained above, in 2 ml of DMF and 6 ml of iodomethane.
  • Step 1 The procedure is as in step 1 of Example 1, but starting from 502 mg of 4-bromo-2,6-pyridine-dicarboxylic acid, which can be prepared according to Tetrahedron lett. 2001, 42, 4849-51, and 588 mg of 3-aminoquinoline, which can be prepared according to Tetrahedron. Lett. 2001, 42, 3251-54, 821 mg of EDCI and 55 mg of HOBT in 23 ml of DMF with stirring for 20 hours at room temperature. 935 mg of 4-bromo-2,6-pyridine-dicarboxylic acid-bis - [(quinolin-3-yl) amide] is obtained in the form of a gray-green powder, used as it is in the following step .
  • Step 2 The procedure is as in step 2 of Example 1, but starting with 300 mg of 4-bromo-2,6-pyridine-dicarboxylic-bis - [(quinolin-3-yl) amide] acid] , obtained above in 8 mL of DMF and 12.63 mL of iodomethane. Then obtained after recrystallization from ethanol, 296 mg of diodide of 4-bromo-2,6-pyridine-dicarboxylic acid-bis - [(1-methyl-quinolinio-3-yl) amide], in the form d '' a yellow solid with the following characteristics:

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Urology & Nephrology (AREA)
  • Endocrinology (AREA)
  • Immunology (AREA)
  • Cardiology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Dermatology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Diabetes (AREA)
  • Epidemiology (AREA)
  • Reproductive Health (AREA)
  • Pulmonology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Plural Heterocyclic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Quinoline Compounds (AREA)

Abstract

The invention relates to cancer therapy and concerns novel anti-cancer agents exhibiting a highly specific action mechanism. The invention also relates to novel chemical compounds and the therapeutic use thereof in man. The invention describes the preparation of heterocylic diamides of general formula (IB) as highly specific G quadruplex DNA ligands and the use thereof as telomerase inhibitors in man. (IB) nitrogenous aromatic cycle comprising a nitrogen atom in a quaternary form (NR3)p CO distributor (CO)m NR'3)qu X- aromatic or non-aromatic cycle.

Description

DERIVES CHIMIQUES SE LIANT DE MANIERE TRES SPECIFIQUE AUX CHEMICAL DERIVATIVES THAT BIND VERY SPECIFICALLY TO
STRUCTURES D'ADN EN G-QUADRUPLEXE ET LEUR APPLICATIONDNA STRUCTURES IN G-QUADRUPLEX AND THEIR APPLICATION
COMME AGENT ANTICANCEREUX SPECIFIQUEAS A SPECIFIC ANTI-CANCER AGENT
La présente invention est relative à la thérapie du cancer et concerne de nouveaux agents anticancéreux ayant un mécanisme d'action spécifique. Elle concerne aussi une sélection de composés chimiques ainsi que leur application thérapeutique chez l'homme.The present invention relates to cancer therapy and relates to new anticancer agents having a specific mechanism of action. It also relates to a selection of chemical compounds as well as their therapeutic application in humans.
La présente invention concerne l'utilisation de nouveaux composés chimiques non nucléotidiques qui interagissent avec des structures spécifiques de l'acide désoxyribonucléique (ADN) ou de l'acide ribonucléique (ARN). Ces nouveaux composés sont constitués d'un agent répartiteur lié à deux groupes hétéroaromatiques azotés dont l'un au moins des atomes d'azote est sous forme quaternarisé. Ils sont particulièrement utiles pour stabiliser de manière très sélective l'ADN replié en structure G-quadruplexe (tétrades de guanines), aussi bien lorsque le G-quadruplexe est formé par un, deux ou quatre brins d'ADN. Ces nouveaux composés sont utiles dans le traitement des cancers et agissent en particulier en tant qu'agents inhibiteurs de la télomérase.The present invention relates to the use of new non-nucleotide chemical compounds which interact with specific structures of deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). These new compounds consist of a distributing agent linked to two nitrogen heteroaromatic groups, at least one of the nitrogen atoms of which is in quaternized form. They are particularly useful for very selectively stabilizing DNA folded into G-quadruplex structure (tetrads of guanines), as well when the G-quadruplex is formed by one, two or four strands of DNA. These new compounds are useful in the treatment of cancers and act in particular as telomerase inhibiting agents.
L'application thérapeutique de l'inhibition de la télomérase via la stabilisation de ces G-quadruplexes peut être soit l'arrêt de la mitose cellulaire et la mort des cellules à division rapide dans un délai de une à quelques semaines par un mécanisme de déprotection de l'ADN télomérique, soit l'induction de la sénescence des cellules cancéreuses, par suite du raccourcissement progressif de l'ADN télomérique (Oncogene 2002, 21, 553-63 ; Oncogene 2002, 21, 592-97). Une autre application thérapeutique, dans le traitement du cancer, de la stabilisation de structures d'ADN en G-quadruplexe peut se faire par l'inactivation des régions promotrices, riches en répétitions de guanines, d'oncogènes tels que c-myc (J. Biol. Chem. 2001 , 276, 4640-46 ; Proc. Natl. Acad. Sci. USA 2002, 99, 11593-98), H-ras ou h-TERT. Une autre application thérapeutique, dans le traitement du cancer, de la stabilisation de structures d'ADN en G-quadruplexes peut être l'inhibition des hélicases spécifiques des structures d'ADN en G-quadruplexes, impliquées lors de la mitose. Ces hélicases sont également directement impliquées dans diverses maladies génétiques telles que les syndromes de Bloom (Cell 1995, 83, 655-66), de Werner (Science 1996, 272, 258-62), de Rothmund-Thomson (Nature Genetics 1999, 22, 82-4) ou d'ataxie télangiectaxie. Les composés de la présente invention présentent en particulier l'avantage du point de vue thérapeutique de bloquer la télomérase. Du point de vue biologique, la télomérase permet l'ajout de séquences d'ADN répétées du type T T A G G G, dites séquences télomériques, à l'extrémité du télomère, lors de la division cellulaire. Par cette action la télomérase rend la cellule immortelle. En effet, en l'absence de cette activité enzymatique, la cellule perd à chaque division 100 à 150 bases, ce qui la rend rapidement sénescente. Lors de l'apparition de cellules cancéreuses à division rapide, il est apparu que ces cellules présentaient des télomères maintenus à une longueur stable au cours de la division cellulaire. Dans ces cellules cancéreuses il est apparu que la télomérase était fortement activée et qu'elle permettait l'addition de motifs répétés de séquences télomériques à la fin du télomère et permettait donc la conservation de la longueur du télomère. Il est apparu depuis quelques temps que plus de 85 % des cellules cancéreuses présentent des tests positifs à la présence de télomérase alors que les cellules somatiques ne présentent pas cette caractéristique.The therapeutic application of telomerase inhibition via the stabilization of these G-quadruplexes can either be the arrest of cell mitosis and the death of rapidly dividing cells within one to a few weeks by a deprotection mechanism telomeric DNA, the induction of cancer cell senescence, as a result of the progressive shortening of telomeric DNA (Oncogene 2002, 21, 553-63; Oncogene 2002, 21, 592-97). Another therapeutic application, in the treatment of cancer, of the stabilization of DNA structures in G-quadruplex can be done by the inactivation of the promoter regions, rich in repetitions of guanines, oncogenes such as c-myc (J Biol. Chem. 2001, 276, 4640-46; Proc. Natl. Acad. Sci. USA 2002, 99, 11593-98), H-ras or h-TERT. Another therapeutic application, in the treatment of cancer, of the stabilization of DNA structures in G-quadruplexes can be the inhibition of helicases specific for DNA structures in G-quadruplexes, involved in mitosis. These helicases are also directly involved in various genetic diseases such as Bloom's syndromes (Cell 1995, 83, 655-66), Werner (Science 1996, 272, 258-62), Rothmund-Thomson (Nature Genetics 1999, 22, 82-4) or ataxia telangiectaxis. The compounds of the present invention have in particular the advantage from the therapeutic point of view of blocking telomerase. From a biological point of view, telomerase makes it possible to add repeated DNA sequences of the TTAGGG type, called telomeric sequences, at the end of the telomer, during cell division. By this action telomerase makes the cell immortal. Indeed, in the absence of this enzymatic activity, the cell loses 100 to 150 bases per division, which makes it quickly senescent. When rapidly dividing cancer cells appeared, these cells appeared to have telomeres maintained at a stable length during cell division. In these cancer cells it appeared that the telomerase was highly activated and that it allowed the addition of repeated motifs of telomeric sequences at the end of the telomer and therefore allowed the conservation of the length of the telomer. It has been shown for some time that more than 85% of cancer cells have positive tests for the presence of telomerase while somatic cells do not have this characteristic.
La télomérase est ainsi une cible très convoitée pour traiter les cellules cancéreuses. La première approche évidente pour bloquer la télomérase a été l'utilisation de structures nucléotidiques (Proc. Natl. Acad. Sci. USA 1996, 93, 2635-39). Depuis des approches diverses ont été développées pour inhiber la télomérase (Curr. Pharm. Des. 2002, 8, 2491-504). Parmi ces approches, le développement de ligands d'ADN en G-quadruplexe suscite un intérêt croissant (Mini Rev. Med. Chem.2003, 3, 11-21).Telomerase is thus a highly coveted target for treating cancer cells. The first obvious approach to blocking telomerase was the use of nucleotide structures (Proc. Natl. Acad. Sci. USA 1996, 93, 2635-39). Since then, various approaches have been developed to inhibit telomerase (Curr. Pharm. Des. 2002, 8, 2491-504). Among these approaches, the development of DNA ligands in G-quadruplexes is arousing growing interest (Mini Rev. Med. Chem. 2003, 3, 11-21).
On peut noter la mise en évidence delà téloméstatine, molécule capable de se fixer à une structure d'ADN en G-quadruplexe, de manière très sélective par rapport à un ADN double brin (J. Amer. Chem. Soc. 2001 , 123, 1262-63). Une molécule hautement sélective de l'ADN en G-quadruplexe présentera le double avantage de cibler les structures d'ADN en G-quadruplexe tout en évitant des mécanismes de toxicité indésirables liés à une fixation non sélective sur le génome.We can note the highlighting of telomestatin, a molecule capable of binding to a G-quadruplex DNA structure, in a very selective manner compared to a double stranded DNA (J. Amer. Chem. Soc. 2001, 123, 1262-1263). A highly selective DNA molecule in G-quadruplex will have the double advantage of targeting DNA structures in G-quadruplex while avoiding undesirable mechanisms of toxicity linked to non-selective attachment to the genome.
Le brevet WO 0296903 décrit la préparation de diamides hétérocycliques de formule générale (I) suivante, comme ligands d'ADN en G-quadruplexe et leur l'utilisation comme inhibiteurs de télomérase : (I) cycle aromatique azoté - (NR3)p - (CO)n- répartiteur - (CO)m - (NR'3)q - cycle aromatique ou non aromatique avec n, m, p et q identiques ou différents représentent l'entier 0 ou 1 , dans laquelleWO 0296903 describes the preparation of heterocyclic diamides of general formula (I) below, as DNA ligands in G-quadruplex and their use as telomerase inhibitors: (I) nitrogen aromatic cycle - (NR 3 ) p - (CO) n- distributor - (CO) m - (NR ' 3 ) q - aromatic or non-aromatic cycle with n, m, p and q identical or different represent l 'integer 0 or 1, in which
• le cycle aromatique azoté, représente :• the nitrogen aromatic cycle, represents:
0 une quinoléine éventuellement substituée par au moins0 a quinoline optionally substituted by at least
- un groupe N(Ra)(Rb) dans lequel Ra et Rb, identiques ou différents représentent l'hydrogène ou un radical alkyle en C1-C4 ouan N (Ra) (Rb) group in which Ra and Rb, which are identical or different, represent hydrogen or a C1-C4 alkyl radical or
- un groupe alkyle ou alkoxy à chaîne courte en C1- C4 ou- a C1-C4 short chain alkyl or alkoxy group or
0 une quinoléine possédant un atome d'azote sous forme quaternaire ou 0 une benzamidine ou0 a quinoline having a nitrogen atom in quaternary form or 0 a benzamidine or
0 une pyridine0 a pyridine
• le cycle aromatique ou non aromatique représente• the aromatic or non-aromatic cycle represents
0 une quinoléine éventuellement substituée par au moins0 a quinoline optionally substituted by at least
- un groupe N(Ra)(Rb) dans lequel Ra et Rb, identiques ou différents représentent l'hydrogène ou un radical alkyle en C1-C4 ouan N (Ra) (Rb) group in which Ra and Rb, which are identical or different, represent hydrogen or a C1-C4 alkyl radical or
- un groupe alkyle ou alkoxy à chaîne courte en C1-C4 ou- a C1-C4 short chain alkyl or alkoxy group or
0 une quinoléine possédant un atome d'azote sous forme quaternaire ou0 a quinoline having a nitrogen atom in quaternary form or
0 une benzamidine ou 0 une pyridine ou0 a benzamidine or 0 a pyridine or
0 un noyau phényle éventuellement substitué par un groupement halogène, alkoxy en C1-C4, cyano, carbonylamino éventuellement substitué par un ou plusieurs groupes alkyle en C1-C4, guanyl, alkylthio en C1-C4, amino, alkylamino en C1-C4, dialkylamino en C1- C4 pour chaque groupe alkyle, nitro, alkylèneamino en C1-C4 ou alkénylèneamino en C2-C4 ou 0 un noyau heterocyclique aromatique ou non aromatique mono ou bi ou tricyclique comportant 0 à 2 hétéroatome par cycle à la condition qu'au moins un hétéroatome soit présent dans au moins un cycle éventuellement substitué par un ou plusieurs groupes alkyle en C1-C4 ou par des groupes alkylène en C1-C4 ou alkénylène en C2-C4 • R3 et R'3, identiques ou différents, représentent indépendamment l'un de l'autre l'hydrogène ou un radical alkyle en C1-C4 • le répartiteur représente :0 a phenyl nucleus optionally substituted by a halogen group, C1-C4 alkoxy, cyano, carbonylamino optionally substituted by one or more C1-C4 alkyl groups, guanyl, C1-C4 alkylthio, amino, C1-C4 alkylamino, dialkylamino in C1-C4 for each alkyl, nitro, C1-C4 alkyleneamino or C2-C4 alkenyleneamino or 0 a mono or bi or tricyclic aromatic or non-aromatic heterocyclic ring having 0 to 2 heteroatoms per cycle provided that at least one heteroatom is present in at least one cycle optionally substituted by one or more C1-C4 alkyl groups or by C1-C4 alkylene or C2-C4 alkenylene groups • R3 and R ' 3, identical or different, independently of one another represent hydrogen or a C1-C4 alkyl radical • the distributor represents:
0 un groupe triazine éventuellement substitué par un ou plusieurs radicaux choisis parmi les atomes d'halogène, les radicaux alkyle ayant 1 à 4 atomes de carbone et les radicaux thio, oxy ou amino eux mêmes éventuellement substitués par une ou plusieurs chaînes alkyle à chaîine courte contenant 1 à 4 atomes de carbone ou 0 un radical heterocyclique renfermant 5 à 6 chaînons renfermant un atome de soufre, d'oxygène ou d'azote0 a triazine group optionally substituted by one or more radicals chosen from halogen atoms, alkyl radicals having 1 to 4 carbon atoms and thio, oxy or amino radicals themselves optionally substituted by one or more short-chain alkyl chains containing 1 to 4 carbon atoms or 0 a heterocyclic radical containing 5 to 6 links containing a sulfur, oxygen or nitrogen atom
0 un radical phényle, -NH-phényle-NH-, -NH-phényle-CH2- NH-, -NH-CH2-phényle-CH2-NH-, -NH-CH2-phényle-NH-, -CH2- phényle-CH2-, -CH2-phényle, -phényle-CH2-, -CH2-thiényle-, -thiényle-CH2-, le radical -CH≈CH-, ou0 a phenyl radical, -NH-phenyl-NH-, -NH-phenyl-CH2- NH-, -NH-CH2-phenyl-CH2-NH-, -NH-CH2-phenyl-NH-, -CH2- phenyl- CH2-, -CH2-phenyl, -phenyl-CH2-, -CH2-thienyl-, -thienyl-CH2-, the radical -CH≈CH-, or
0 un groupe diazine, les radicaux hétérocycliques, phényle, -NH-phényle-NH-, -NH- phényle-CH2-NH-, -NH-CH2-phényle-CH2-NH-, -NH-CH2-phényle- NH-, -CH2-phényle-CH2-, -CH2-phényle, -phényle-CH2-, -CH2- thiényle-, -thiényle-CH2-, le radical -CH=CH-, et diazine étant éventuellement substitués par les mêmes groupes que la triazine étant entendu que lorsque le répartiteur représente phényle éventuellement substitué par NH2, que n, m, p et q représentent 1 et R3 et R3' représentent hydrogène alors le cycle aromatique azoté et le cycle aromatique ne représentent pas tous deux une quinoléine non substituée ou substituée sur son atome d'azote par un radical alkyle renfermant 1 à 6 atomes de carbone, ou un de ses sels et lorsque le répartiteur représente une triazine et p et q représentent tous deux l'entier 1 alors n et m ne représentent pas tous deux l'entier 0. La présente invention décrit la préparation de diamides hétérocycliques de formule générale (IB) suivante, comme ligands hautement spécifiques d'ADN en G-quadruplexe et leur l'utilisation comme inhibiteurs de télomérase :0 a diazine group, heterocyclic radicals, phenyl, -NH-phenyl-NH-, -NH- phenyl-CH2-NH-, -NH-CH2-phenyl-CH2-NH-, -NH-CH2-phenyl- NH- , -CH2-phenyl-CH2-, -CH2-phenyl, -phenyl-CH2-, -CH2- thienyl-, -thienyl-CH2-, the radical -CH = CH-, and diazine being optionally substituted by the same groups as triazine being understood that when the distributor represents phenyl optionally substituted by NH2, that n, m, p and q represent 1 and R3 and R3 'represent hydrogen then the aromatic nitrogen cycle and the aromatic cycle do not both represent an unsubstituted quinoline or substituted on its nitrogen atom by an alkyl radical containing 1 to 6 carbon atoms, or one of its salts and when the distributor represents a triazine and p and q both represent the whole 1 then n and m do not represent both the integer 0. The present invention describes the preparation of heterocyclic diamides of general formula (IB) as highly specific ligands of G-quadruplex DNA and their use as telomerase inhibitors:
(IB) cycle aromatique azoté possédant un atome d'azote sous forme quaternaire - (NR3)p - CO- répartiteur - (CO)m - (NR'3)q -X- cycle aromatique ou non aromatique avec m, p et q identiques ou différents représentent l'entier 0 ou 1 , dans laquelle • le cycle aromatique azoté possédant un atome quaternaire, représente :(IB) nitrogen aromatic cycle having a nitrogen atom in quaternary form - (NR 3 ) p - CO- distributor - (CO) m - (NR ' 3 ) q -X- aromatic or non-aromatic cycle with m, p and q identical or different represent the integer 0 or 1, in which • the nitrogen aromatic ring having a quaternary atom, represents:
0 une quinoléine éventuellement substituée par au moins0 a quinoline optionally substituted by at least
- un groupe N(Ra)(Rb) dans lequel Ra et Rb, identiques ou différents représentent l'hydrogène ou un radical alkyle en C1-C4 ouan N (Ra) (Rb) group in which Ra and Rb, which are identical or different, represent hydrogen or a C1-C4 alkyl radical or
- un groupe alkyle ou alkoxy à chaîne courte en C1- C4 ou- a C1-C4 short chain alkyl or alkoxy group or
0 et dont l'atome d'azote est quaternarisé par une chaîne alkyle en C1-C4, éventuellement substituée par un radical hydroxy, carboxy, alkoxy en C1-C4, alkylthio en C1-C4, amino, alkylamino en0 and whose nitrogen atom is quaternized by a C1-C4 alkyl chain, optionally substituted by a hydroxy, carboxy, C1-C4 alkoxy, C1-C4 alkylthio, amino, alkylamino radical
C1-C4, dialkylamino en C1-C4 pour chaque groupe alkyle, • le cycle aromatique ou non aromatique représenteC1-C4, C1-C4 dialkylamino for each alkyl group, • the aromatic or non-aromatic ring represents
0 une quinoléine éventuellement substituée par au moins0 a quinoline optionally substituted by at least
- un groupe N(Ra)(Rb) dans lequel Ra et Rb, identiques ou différents représentent l'hydrogène ou un radical alkyle en C1-C4 ouan N (Ra) (Rb) group in which Ra and Rb, which are identical or different, represent hydrogen or a C1-C4 alkyl radical or
- un groupe alkyle ou alkoxy à chaîne courte en C1-C4 ou- a C1-C4 short chain alkyl or alkoxy group or
0 une quinoléine possédant un atome d'azote sous forme quaternaire ou0 a quinoline having a nitrogen atom in quaternary form or
0 une benzamidine ou 0 une pyridine ou0 a benzamidine or 0 a pyridine or
0 un noyau phényle éventuellement substitué par un groupement halogène, alkoxy en C1-C4, cyano, carbonylamino éventuellement substitué par un ou plusieurs groupes alkyle en C1-C4, guanyl, alkylthio en C1-C4, amino, alkylamino en C1-C4, dialkylamino en C1-0 a phenyl ring optionally substituted by a halogen group, C1-C4 alkoxy, cyano, carbonylamino optionally substituted by one or more C1-C4 alkyl groups, guanyl, alkylthio in C1-C4, amino, C1-C4 alkylamino, dialkylamino in C1-
C4 pour chaque groupe alkyle, nitro, alkylèneamino enC4 for each alkyl, nitro, alkylene amino group in
C1-C4 ou alkénylèneamino en C2-C4 ouC1-C4 or C2-C4 alkenyleneamino or
0 un noyau heterocyclique aromatique ou non aromatique mono ou bi ou tricyclique comportant 0 à 2 hétéroatome par cycle à la condition qu'au moins un hétéroatome soit présent dans au moins un cycle éventuellement substitué par un ou plusieurs groupes alkyle en C1-C4 ou par des groupes alkylène en C1-C4 ou alkénylène en C2-C4, et dont l' hétéroatome, lorsqu'il représente un atome d'azote, peut être éventuellement sous forme quaternaire.0 a heterocyclic ring, aromatic or non-aromatic, mono or bi or tricyclic comprising 0 to 2 heteroatoms per cycle provided that at least one heteroatom is present in at least one ring optionally substituted by one or more C1-C4 alkyl groups or by C1-C4 alkylene or C2-C4 alkenylene groups, the heteroatom of which, when it represents a nitrogen atom, may optionally be in quaternary form.
• R3 et R'3, identiques ou différents, représentent indépendamment l'un de l'autre l'hydrogène ou un radical alkyle en C1-C4 ou aralkyle, dont la partie alkyle est en C1-C4. • X représente une simple liaison, ou un radical alkyle droit ou ramifié en C1-C4, un radical alkényle en C2-C4, un radical alkynyle en C2-C4 ou un radical phényle.• R3 and R'3, identical or different, independently of one another represent hydrogen or a C1-C4 or aralkyl alkyl radical, the alkyl part of which is C1-C4. • X represents a single bond, or a straight or branched C1-C4 alkyl radical, a C2-C4 alkenyl radical, a C2-C4 alkynyl radical or a phenyl radical.
• le répartiteur représente :• the dispatcher represents:
0 un radical heterocyclique renfermant 5 à 6 chaînons renfermant un atome de soufre, d'oxygène ou d'azote0 a heterocyclic radical containing 5 to 6 links containing a sulfur, oxygen or nitrogen atom
0 un radical phényle, ou 0 un groupe diazine ou triazine, les radicaux hétérocycliques, phényle, diazine ou triazine étant éventuellement substitués par un ou plusieurs radicaux choisis parmi les atomes d'halogène, les radicaux alkyle ayant 1 à 4 atomes de carbone et les radicaux thio, oxy ou amino eux mêmes éventuellement substitués par une ou plusieurs chaînes alkyle à chaîne courte contenant 1 à 4 atomes de carbone.0 a phenyl radical, or 0 a diazine or triazine group, the heterocyclic, phenyl, diazine or triazine radicals being optionally substituted by one or more radicals chosen from halogen atoms, alkyl radicals having 1 to 4 carbon atoms and thio, oxy or amino radicals themselves optionally substituted by one or more short chain alkyl chains containing 1 to 4 carbon atoms.
Lesdits produits de formule (IB) peuvent sous toutes les formes isomères possibles racemiques, enantiomeres et diastéréo-isomeres, ainsi que les sels d'addition avec les acides minéraux et organiques ou avec les bases minérales et organiques desdits produits de formule (IB). Dans les composés décrits dans la présente invention :Said products of formula (IB) can in all the possible racemic isomeric, enantiomeric and diastereoisomeric forms, as well as the addition salts with mineral and organic acids or with the mineral and organic bases of said products of formula (IB). In the compounds described in the present invention:
- le terme radical alkyle ou alk désigne un radical linéaire ou ramifié renfermant au plus 12 atomes de carbone choisi parmi les radicaux méthyle, éthyle, propyle, isopropyle, butyle, isobutyle, sec-butyle, tert-butyle, pentyle, isopentyle, sec-pentyle, tert-pentyle, néo-pentyle, hexyle, isohexyle, sec- hexyle, tert-hexyle et également heptyle, octyle, nonyle, décyle, undécyle et dodécyle, ainsi que leurs isomères de position linéaires ou ramifiés, On cite plus particulièrement les radicaux alkyle ayant au plus 6 atomes de carbone et notamment les radicaux méthyle, éthyle, propyle, isopropyle, n- butyle, isobutyle, terbutyle, pentyle linéaire ou ramifié, hexyle linéaires ou ramifiés.the term alkyl or alk radical denotes a linear or branched radical containing at most 12 carbon atoms chosen from the methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl radicals, isopentyl, sec-pentyl, tert-pentyl, neo-pentyl, hexyl, isohexyl, sec- hexyl, tert-hexyl and also heptyl, octyl, nonyl, decyl, undecyl and dodecyl, as well as their linear or branched position isomers, On more particularly cites the alkyl radicals having at most 6 carbon atoms and in particular the methyl, ethyl, propyl, isopropyl, n-butyl, isobutyl, terbutyl, linear or branched pentyl, linear or branched hexyl radicals.
- le terme radical alkényle désigne un radical linéaire ou ramifié renfermant au plus 12 atomes de carbone et préférentiellement 4 atomes de carbone choisi par exemple parmi les valeurs suivantes: éthényle ou vinyle, propényl ou allyle, 1-propényle, n-butényle, i-butényle, 3-méthylbut-2-ényle, n-pentényle, hexényle, heptényle, octényle, cyclohexylbutényle et décényle ainsi que leurs isomères de position linéaires ou ramifiés. Parmi les valeurs alkényle, on cite plus particulièrement les valeurs allyle ou butényle.the term alkenyl radical designates a linear or branched radical containing at most 12 carbon atoms and preferably 4 carbon atoms chosen, for example, from the following values: ethenyl or vinyl, propenyl or allyl, 1-propenyl, n-butenyl, i- butenyl, 3-methylbut-2-enyl, n-pentenyl, hexenyl, heptenyl, octenyl, cyclohexylbutenyl and decenyl as well as their linear or branched position isomers. Among the alkenyl values, the allyl or butenyl values are more particularly cited.
- le terme radical alkynyle désigne un radical linéaire ou ramifié renfermant au plus 12 atomes de carbone et préférentiellement 4 atomes de carbone choisi par exemple parmi les valeurs suivantes: éthynyle, propynyle ou propargyle, butynyle, n-butynyle, i-butynyle, 3-méthylbut-2-ynyle, pentynyle ou hexynyle ainsi que leurs isomères de position linéaires ou ramifiés. Parmi les valeurs alkynyle, on cite plus particulièrement la valeur propargyle.- The term alkynyl radical designates a linear or branched radical containing at most 12 carbon atoms and preferably 4 carbon atoms chosen for example from the following values: ethynyl, propynyl or propargyl, butynyl, n-butynyl, i-butynyl, 3- methylbut-2-ynyl, pentynyl or hexynyl as well as their linear or branched position isomers. Among the alkynyl values, the propargyl value is more particularly cited.
- le terme radical aryle désigne les radicaux insaturés, monocycliques ou constitués de cycles condensés, carbocycliques. Comme exemples de tel radical aryle, on peut citer lès radicaux phényle ou naphtyle, On cite plus particulièrement le radical phényle.- The term aryl radical denotes unsaturated radicals, monocyclic or made up of condensed, carbocyclic rings. As examples of such an aryl radical, mention may be made of phenyl or naphthyl radicals. Mention is more particularly made of the phenyl radical.
- par arylalkyle on entend les radicaux résultant de la combinaison des radicaux alkyle cités précédemment éventuellement substitués et les radicaux aryles également cités ci-dessus, éventuellement substitués : on cite par exemple les radicaux benzyle, phenylethyle, 2-phénéthyle, triphénylméthyle ou naphthlèneméthyle.- By arylalkyl is meant the radicals resulting from the combination of the alkyl radicals mentioned above optionally substituted and the aryl radicals also mentioned above, optionally substituted: mention is made, for example, of the benzyl, phenylethyl, 2-phenethyl, triphenylmethyl or naphthlenemethyl radicals.
- le terme radical heterocyclique désigne un radical carbocylique saturé (hétérocycloalkyle) ou insaturé (hétéroaryle) constitué au plus de 6 chaînons interrompus par un ou plusieurs hétéroatomes, identiques ou différents, choisis parmi les atomes d'oxygène, d'azote ou de soufre.- The term heterocyclic radical denotes a saturated (heterocycloalkyl) or unsaturated (heteroaryl) carbocylic radical consisting of at most 6 links interrupted by one or more heteroatoms, identical or different, chosen from oxygen, nitrogen or sulfur atoms.
Comme radicaux hétérocycloalkyles, on peut citer notamment les radicaux dioxolane, dioxane, dithiolane, thiooxolane, thiooxane, oxirannyle, oxolannyle, dioxolannyle, pipérazinyle, pipéridinyle, pyrrolidinyle, imidazolidinyle, pyrazolidinyle, morpholinyle ou encore tétrahydrofuryle, tétrahydrothiényle, chromanyle, dihydrobenzofuranyle, indolinyle, pipéridinyle, perhydropyranyle, pyrindolinyle, tétrahydroquinoléinyle, tétrahydroisoquinoléinyle ou thioazolidinyle, tous ces radicaux étant éventuellement substitués. Parmi les radicaux hétérocycloalkyles, on peut citer notamment les radicaux pipérazinyle éventuellement substitué, pipéridinyle éventuellement substitué, pyrrolidinyle éventuellement substitué, imidazolidinyle, pyrazolidinyle, morpholinyle ou thioazolidinyle.As heterocycloalkyl radicals, mention may be made in particular of radicals dioxolane, dioxane, dithiolane, thiooxolane, thiooxane, oxiranyl, oxolanyl, dioxolanyl, piperazinyl, piperidinyl, pyrrolidinyl, imidazolidinyl, pyrazolidinyl, morpholinyl or tetrahydrofuryl, tetrahydrothienyl, chromanyl, dihydrobenzofuranyl, indolinyl, piperidyl, perhydropyranyl, pyrindolinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl or thioazolidinyl , all these radicals being optionally substituted. Among the heterocycloalkyl radicals, mention may in particular be made of the optionally substituted piperazinyl, optionally substituted piperidinyl, optionally substituted pyrrolidinyl, imidazolidinyl, pyrazolidinyl, morpholinyl or thioazolidinyl radicals.
Par radical hétérocycloalkylalkyle, on entend les radicaux dans lesquels les restes hétérocycloalkyle et alkyle ont les significations précédentes Parmi les radicaux héteroaryles à 5 chaînons on peut citer les radicaux furyle tel que 2-furyle, thienyle tel que 2-thiényle et 3-thiényle, pyrrolyle, diazolyle, thiazolyle, thiadiazolyle, thiatriazolyle, isothiazolyle, oxazolyle oxadiazolyle, 3- ou 4-isoxazolyle, imidazolyle, pyrazolyle, isoxazolyle. Parmi les radicaux héteroaryles à 6 chaînons on peut citer notamment les radicaux pyridyle tel que 2-pyridyle, 3-pyridyle et 4-pyridyle, pyrimidyle, pyrimidinyle, pyridazinyle, pyrazinyle et tétrazolyle. Comme radicaux héteroaryles condensés contenant au moins un hétéroatome choisi parmi le soufre, l'azote et l'oxygène, on peut citer par exemple benzothiényle tel que 3-benzothiényle, benzofuryle, benzofurannyle, benzopyrrolyle, benzimidazolyle, benzoxazolyle, thionaphtyle, indolyle, purinyle, quinoléinyle, isoquinoléinyle et naphtyridinyle. Parmi les radicaux héteroaryles condensés, on peut citer plus particulièrement les radicaux benzothiényle, benzofurannyle, indolyle ou quinoléinyle, benzimidazolyle, benzothiazolyle, furyle, imidazolyle, indolizinyle, isoxazolyle, isoquinolinyle, isothiazolyle, oxadiazolyle, pyrazinyle, pyridazinyle, pyrazolyle, pyridyle, pyrimidinyle, pyrrolyle, quinazolinyle, 1 ,3,4- thiadiazolyle, thiazolyle, thienyle et groupes triazolyle, ces radicaux étant éventuellement substitués comme indiqué pour les radicaux héteroaryles.By heterocycloalkylalkyl radical is meant the radicals in which the heterocycloalkyl and alkyl radicals have the above meanings. Among the 5-membered heteroaryl radicals, mention may be made of the furyl radicals such as 2-furyl, thienyl such as 2-thienyl and 3-thienyl, pyrrolyl , diazolyle, thiazolyle, thiadiazolyle, thiatriazolyle, isothiazolyle, oxazolyle oxadiazolyle, 3- or 4-isoxazolyle, imidazolyle, pyrazolyle, isoxazolyle. Among the 6-membered heteroaryl radicals that may be mentioned in particular are pyridyl radicals such as 2-pyridyl, 3-pyridyl and 4-pyridyl, pyrimidyl, pyrimidinyl, pyridazinyl, pyrazinyl and tetrazolyl. As condensed heteroaryl radicals containing at least one heteroatom chosen from sulfur, nitrogen and oxygen, mention may, for example, be made of benzothienyl such as 3-benzothienyl, benzofuryl, benzofurannyl, benzopyrrolyl, benzimidazolyl, benzoxazolyl, thionaphthyl, indolyl, purinyl, quinoline, isoquinoline and naphthyridinyl. Among the condensed heteroaryl radicals, mention may be made more particularly of the benzothienyl, benzofurannyl, indolyl or quinolinyl, benzimidazolyl, benzothiazolyl, furyl, imidazolyl, indolizinyl, isoxazolyl, isoquinolinyl, isothiazolyl, pyridinyl, pyridinyl, pyridinyl radicals. , quinazolinyl, 1,3,4-thiadiazolyl, thiazolyl, thienyl and triazolyl groups, these radicals being optionally substituted as indicated for the heteroaryl radicals.
Dans les produits de formule (IB) tels que définis ci-dessus, on cite plus particulièrement ceux pour lesquels R3 et R'3, identiques ou différents, représentent indépendamment l'un de l'autre l'hydrogène ou un radical alkyle en C1-C4 ou aralkyle dans lequel le radical alkyle est C1-C4, X représente une simple liaison, un radical alkyle en C1-C4, un radical alkényle ou alkynyle en C2-C4 ou un radical phényle, les autres substituants étant choisis parmi les valeurs indiquées ci-dessus.In the products of formula (IB) as defined above, there are more particularly cited those for which R3 and R'3, identical or different, represent independently of one another hydrogen or an alkyl radical in C1 -C4 or aralkyl in which the alkyl radical is C1-C4, X represents a single bond, a C1-C4 alkyl radical, a C2-C4 alkenyl or alkynyl radical or a phenyl radical, the other substituents being chosen from the values indicated above.
On entend au sens de la formule ci-dessus par cycle aromatique azoté un hétérocycle comportant au moins un atome d'azote ou un groupe aromatique ne comportant pas d'hétéroatome dans le cycle mais contenant au moins un atome d'azote dans une chaîne hydrocarbonée liée au cycle comme par exemple une chaîne guanidino ou guanyl.In the sense of the above formula, the term nitrogen aromatic ring means a heterocycle comprising at least one nitrogen atom or an aromatic group not comprising a heteroatom in the ring but containing at least one nitrogen atom in a hydrocarbon chain linked to the cycle such as a guanidino or guanyl chain.
Il est évident que les motifs quinoléines peuvent être substitués par tout autre groupe n'intervenant pas dans l'application visée, ainsi des groupes acridines ou isoquinoléines ou quinazolines ou quinoxalines ou phtalazines ou benzothiazines ou benzoxazines ou phénoxazines ou phénothiazines sont inclus dans la définition des groupes quinoléines.It is obvious that the quinoline units can be substituted by any other group which does not intervene in the intended application, thus acridine or isoquinoline or quinazoline or quinoxaline or phthalazine or benzothiazine or benzoxazine or phenoxazine or phenothiazine groups are included in the definition of quinoline groups.
On préfère parmi l'ensemble des composés ci-dessus ceux comportant un répartiteur choisi parmi les groupes hétérocycliques tels que par exemple pyridyle, ou thienyle, un radical phényle, une diazine ou une triazine,. Parmi les groupes diazines on préfère utiliser les pyridazines. On préfère particulièrement parmi l'ensemble des composés ci-dessus ceux comportant un répartiteur méta-disubstitué par les groupements « cycle aromatique azoté possédant un atome d'azote sous forme quaternaire - (NR3)p - CO » et « (CO)m - (NR'3)q - cycle aromatique ou non aromatique » tels que définis ci-dessus et dans lesquels le répartiteur est de plus éventuellement substitué par un atome d'halogène. On préfère parmi l'ensemble des composés ci-dessus ceux comportant un répartiteur méta-disubstitué par les groupements « cycle aromatique azoté possédant un atome d'azote sous forme quaternaire - (NR3)p - CO » et « (CO)m - (NR'3)q - cycle aromatique ou non aromatique » tels que définis ci- dessus. Parmi les composés de la présente invention, on préfère notamment les composés dont l'hétérocycle sous forme quaternaire est une quinoléine.Preferred among all of the above compounds are those comprising a distributor chosen from heterocyclic groups such as for example pyridyl, or thienyl, a phenyl radical, a diazine or a triazine. Among the diazine groups, it is preferred to use pyridazines. Particularly preferred among all of the above compounds are those comprising a meta-disubstituted distributor by the groups "nitrogen aromatic ring having a nitrogen atom in quaternary form - (NR 3 ) p - CO" and "(CO) m - (NR ' 3 ) q - aromatic or non-aromatic cycle "as defined above and in which the distributor is moreover optionally substituted by a halogen atom. Preferred among all of the above compounds are those comprising a meta-disubstituted distributor by the groups "nitrogen aromatic ring having a nitrogen atom in quaternary form - (NR 3 ) p - CO" and "(CO) m - (NR ' 3 ) q - aromatic or non-aromatic cycle "as defined above. Among the compounds of the present invention, particular preference is given to compounds in which the heterocycle in quaternary form is a quinoline.
Parmi les composés de la présente invention, on préfère notamment les composés définis ci-dessus caractérisés en ce que m, p et q représentent l'entier 1.Among the compounds of the present invention, the compounds defined above are particularly preferred, characterized in that m, p and q represent the integer 1.
Parmi les composés de la présente invention, on préfère tout particulièrement les composés dont le répartiteur représente une pyridine-2,6-disubstituée ou une pyridazine-2-6-disubstituée par les groupements « cycle aromatique azoté possédant un atome d'azote quaternaire sous forme quaternaire -(NR3)p - CO » et « (CO)m - (NR'3)q - cycle aromatique ou non aromatique » et dont l'hétérocycle quaternarisé est un N-méthyl-quinolinium, et dans lesquels le répartiteur est de plus éventuellement substitué par un atome d'halogène.Among the compounds of the present invention, very particularly preferred are those compounds whose distributor represents a pyridine-2,6-disubstituted or a pyridazine-2-6-disubstituted by the groups "nitrogen aromatic cycle having a quaternary nitrogen atom in quaternary form - (NR 3 ) p - CO" and "(CO) m - (NR ' 3 ) q - aromatic cycle or non-aromatic "and in which the quaternized heterocycle is an N-methyl-quinolinium, and in which the distributor is moreover optionally substituted by a halogen atom.
Parmi les composés de la présente invention, on préfère tout spécialement les composés dont le répartiteur représente une pyridine-2,6-disubstituée ou une pyridazine-2-6-disubstituée par les groupements « cycle aromatique azoté possédant un atome d'azote quaternaire sous forme quaternaire -(NR3)p - CO » et « (CO)rn - (NR'3)q - cycle aromatique ou non aromatique » et dont l'hétérocycle quaternarisé est un N-méthyl-quinolinium.Among the compounds of the present invention, very particularly preferred are those compounds whose distributor represents a pyridine-2,6-disubstituted or a pyridazine-2-6-disubstituted by the groups "aromatic nitrogen ring having a quaternary nitrogen atom under quaternary form - (NR 3 ) p - CO "and" (CO) rn - (NR ' 3 ) q - aromatic or non-aromatic cycle "and whose quaternized heterocycle is an N-methyl-quinolinium.
La présente invention a particulièrement notamment pour objet les produits de formule (IB) tels que définis ci-dessus caractérisés en ce qu'ils répondent à la formule (la) ci-dessous :The present invention particularly relates in particular to the products of formula (IB) as defined above, characterized in that they correspond to the formula (la) below:
avec m, p et q identiques ou différents représentent l'entier 0 ou 1 • A représente: with m, p and q identical or different represent the integer 0 or 1 • A represents:
0 un radical heterocyclique renfermant 5 à 6 chaînons renfermant un atome de soufre, d'oxygène ou d'azote0 a heterocyclic radical containing 5 to 6 links containing a sulfur, oxygen or nitrogen atom
0 un radical phényle, ou0 a phenyl radical, or
0 un groupe diazine ou triazine, les radicaux hétérocycliques, phényle, diazine ou triazine étant éventuellement substitués par un ou plusieurs radicaux choisis parmi les atomes d'halogène, les radicaux alkyle ayant 1 à 4 atomes de carbone et les radicaux thio, oxy ou amino eux mêmes éventuellement substitués par une ou plusieurs chaînes alkyle à chaîne courte contenant 1 à 4 atomes de carbone,0 a diazine or triazine group, the heterocyclic, phenyl, diazine or triazine radicals being optionally substituted by one or more radicals chosen from halogen atoms, alkyl radicals having 1 to 4 carbon atoms and thio, oxy or amino radicals themselves optionally substituted by one or more short-chain alkyl chains containing 1 to 4 carbon atoms,
- An et Ar2 identiques ou différents représentent quand A et Ar2 sont identiques, ils représentent un cycle aromatique azoté possédant un atome quaternaire représenté par une quinoléine éventuellement substituée par au moins- An and Ar 2 identical or different represent when A and Ar 2 are identical, they represent a nitrogen aromatic cycle having a quaternary atom represented by a quinoline optionally substituted by at least
- un groupe N(Ra)(Rb) dans lequel Ra et Rb, identiques ou différents représentent l'hydrogène ou un radical alkyle en C1-C4 ouan N (Ra) (Rb) group in which Ra and Rb, which are identical or different, represent hydrogen or a C1-C4 alkyl radical or
- un groupe alkyle ou alkoxy à chaîne courte en C1- C4 ou- a C1-C4 short chain alkyl or alkoxy group or
0 et dont l'atome d'azote est quaternarisé par une chaîne alkyle en C1-C4, éventuellement substituée par un radical hydroxy, carboxy, alkoxy en C1-C4, alkylthio en C1-C4, amino, alkylamino en0 and whose nitrogen atom is quaternized by a C1-C4 alkyl chain, optionally substituted by a hydroxy, carboxy, C1-C4 alkoxy, C1-C4 alkylthio, amino, alkylamino radical
C1-C4, dialkylamino en C1-C4 pour chaque groupe alkyle, quand An et Ar2 sont différents An représente l'une des possibilités ci-dessus et Ar2 représenteC1-C4, C1-C4 dialkylamino for each alkyl group, when An and Ar 2 are different An represents one of the above possibilities and Ar 2 represents
* un noyau phényle éventuellement substitué par un groupement halogène, alkoxy en C1-C4, cyano, carbonylamino éventuellement substitué par un ou plusieurs groupes alkyle en C1-C4, guanyl, alkylthio en C1-C4, amino, alkylamino en C1-C4, dialkylamino en C1-C4 pour chaque groupe alkyle, nitro, alkylèneamino en C1-C4 ou alkénylèneamino en C2-C4* a phenyl ring optionally substituted by a halogen group, C1-C4 alkoxy, cyano, carbonylamino optionally substituted by one or more C1-C4 alkyl groups, guanyl, C1-C4 alkylthio, amino, C1-C4 alkylamino, dialkylamino in C1-C4 for each alkyl, nitro, C1-C4 alkyleneamino or C2-C4 alkenyleneamino
* une benzamidine * un noyau pyridyle* a benzamidine * a pyridyl ring
* un noyau heterocyclique aromatique ou non aromatique mono ou bi ou tricyclique comportant 0 à 2 hétéroatome par cycle à la condition qu'au moins un hétéroatome soit présent dans au moins un cycle éventuellement substitué par un ou plusieurs groupes alkyle en C1-C4 ou par des groupes alkylène en C1-C4 ou alkénylène en C2-C4,* a heterocyclic aromatic or non-aromatic mono or bi or tricyclic ring comprising 0 to 2 heteroatoms per cycle provided that at least one heteroatom is present in at least one cycle optionally substituted by one or more C1-C4 alkyl groups or by C1-C4 alkylene or C2-C4 alkenylene groups,
• R3 et R'3, identiques ou différents, représentent indépendamment l'un de l'autre l'hydrogène ou un radical alkyle en C1-C4 ou aralkyle dans lequel le radical alkyle est C1-C4,R3 and R'3, identical or different, independently of one another represent hydrogen or a C1-C4 or aralkyl alkyl radical in which the alkyl radical is C1-C4,
• X représente une simple liaison, un radical alkyle en C1-C4, un radical alkényle ou alkynyle en C2-C4 ou un radical phényle, lesdits produits de formule (la) étant sous toutes les formes isomères possibles racemiques, enantiomeres et diastéréo-isomeres, ainsi que les sels d'addition avec les acides minéraux et organiques ou avec les bases minérales et organiques desdits produits de formule (la). La présente invention a ainsi pour objet les produits de formule (la) tels que définis ci-dessus dans laquelle X représente un radical alkyle en C1-C4, les autres substituants des produits de formule (la) étant choisis parmi les valeurs indiquées ci-dessus, lesdits produits de formule (la) étant sous toutes les formes isomères possibles racemiques, enantiomeres et diastéréo-isomeres, ainsi que les sels d'addition avec les acides minéraux et organiques ou avec les bases minérales et organiques desdits produits de formule (la).• X represents a single bond, a C1-C4 alkyl radical, a C2-C4 alkenyl or alkynyl radical or a phenyl radical, said products of formula (la) being in all the possible racemic, enantiomeric and diastereomeric isomeric forms , as well as the addition salts with mineral and organic acids or with mineral and organic bases of said products of formula (la). A subject of the present invention is therefore the products of formula (la) as defined above in which X represents a C1-C4 alkyl radical, the other substituents of the products of formula (la) being chosen from the values indicated below above, said products of formula (la) being in all the possible racemic isomeric, enantiomeric and diastereoisomeric forms, as well as the addition salts with mineral and organic acids or with mineral and organic bases of said products of formula (la ).
La présente invention a ainsi pour objet les produits de formule (la) tels que définis ci-dessus dans laquelle caractérisés en ce que A est choisi parmi les groupes hétérocycliques, tels que par exemple pyridyle ou thienyle, un radical phényle, une diazine ou une triazine tels que définis ci-dessus.A subject of the present invention is thus the products of formula (la) as defined above in which characterized in that A is chosen from heterocyclic groups, such as for example pyridyl or thienyl, a phenyl radical, a diazine or a triazine as defined above.
La présente invention a ainsi pour objet les produits de formule (la) tels que définis ci-dessus caractérisés en ce que les groupes diazines que peut représenter A sont des pyrazines.A subject of the present invention is thus the products of formula (la) as defined above, characterized in that the diazine groups that A can represent are pyrazines.
La présente invention a ainsi particulièrement pour objet les produits de formule (la) tels que définis ci-dessus caractérisés en ce que A est méta- disubstitué par les groupements « cycle aromatique azoté possédant un atome d'azote sous forme quaternaire - (NR3)p - CO » et « (CO)m -(NR'3)q - cycle aromatique ou non aromatique » tels que définis ci-dessus et dans lesquels A est de plus éventuellement substitué par un atome d'halogène.The present invention thus particularly relates to the products of formula (la) as defined above, characterized in that A is metasubstituted by the groups “aromatic nitrogen ring having a nitrogen atom in quaternary form - (NR 3 ) p - CO "and" (CO) m - (NR ' 3 ) q - aromatic or non-aromatic ring "as defined above and in which A is additionally optionally substituted by a halogen atom.
La présente invention a ainsi pour objet les produits de formule (la) tels que définis ci-dessus caractérisés en ce que A est méta-disubstitué par les groupements « cycle aromatique azoté possédant un atome d'azote sous forme quaternaire - (NR3)p - CO » et « (CO)m - (NR'3)q - cycle aromatique ou non aromatique » tels que définis ci-dessus.A subject of the present invention is therefore the products of formula (la) as defined above, characterized in that A is meta-disubstituted by the groups “aromatic nitrogen cycle having a nitrogen atom in quaternary form - (NR 3 ) p - CO "and" (CO) m - (NR ' 3 ) q - aromatic or non-aromatic cycle "as defined above.
La présente invention a ainsi pour objet les produits de formule (la) tels que définis ci-dessus caractérisés en ce que l'hétérocycle sous forme quaternaire est une quinoléine.The present invention thus relates to the products of formula (la) as defined above, characterized in that the heterocycle in quaternary form is a quinoline.
La présente invention a ainsi particulièrement pour objet les produits de formule (la) tels que définis ci-dessus caractérisés en ce que A représente une pyridine-2,6-disubstituée ou une pyridazine-2-6-disubstituée par les groupements « cycle aromatique azoté possédant un atome d'azote quaternaire sous forme quaternaire - (NR3)p - CO » et « (CO)m - (NR'3)q - cycle aromatique ou non aromatique » et dont l'hétérocycle quaternarisé est un N-méthyl-quinolinium, et dans lesquels A est de plus éventuellement substitué par un atome d'halogène.The present invention thus particularly relates to the products of formula (la) as defined above characterized in that A represents a pyridine-2,6-disubstituted or a pyridazine-2-6-disubstituted by groups "aromatic nitrogen cycle having a quaternary nitrogen atom in quaternary form - (NR 3 ) p - CO" and "(CO) m - (NR ' 3 ) q - aromatic or non-aromatic cycle" and including the quaternized heterocycle is an N-methyl-quinolinium, and in which A is additionally optionally substituted by a halogen atom.
La présente invention a ainsi pour objet les produits de formule (la) tels que définis ci-dessus caractérisés en ce que A représente une pyridine-2,6- disubstituée ou une pyridazine-2-6-disubstituée par les groupements « cycle aromatique azoté possédant un atome d'azote quaternaire sous forme quaternaire - (NR3)p - CO » et « (CO)m - (NR'3)q - cycle aromatique ou non aromatique » et dont l'hétérocycle quaternarisé est un N-méthyl- quinolinium.The present invention thus relates to the products of formula (la) as defined above, characterized in that A represents a pyridine-2,6-disubstituted or a pyridazine-2-6-disubstituted by the groups "aromatic nitrogen cycle having a quaternary nitrogen atom in quaternary form - (NR 3 ) p - CO "and" (CO) m - (NR ' 3 ) q - aromatic or non-aromatic ring "and of which the quaternized heterocycle is N-methyl - quinolinium.
La présente invention a ainsi pour objet les produits de formule (la) tels que définis ci-dessus caractérisés en ce que p et q représentent l'entier 1.The present invention thus relates to the products of formula (la) as defined above, characterized in that p and q represent the integer 1.
La présente invention a ainsi pour objet les produits de formule (la) tels que définis ci-dessus caractérisés en ce que m, p et q représentent l'entier 1.The present invention thus relates to the products of formula (la) as defined above, characterized in that m, p and q represent the integer 1.
La présente invention a notamment pour objet les produits de formule (la) tels que définis ci-dessus caractérisés en ce que Ar2 représentent un groupe choisi parmi les groupes suivants : 4-amino- ou 4-méthylamino-, 4-diméthylamino- ou 4-alcoxy- quinolyl ou quinolinium dont le noyau quinolinium est éventuellement substitué par un ou deux groupe(s) méthyle.The subject of the present invention is in particular the products of formula (la) as defined above, characterized in that Ar 2 represents a group chosen from the following groups: 4-amino- or 4-methylamino-, 4-dimethylamino- or 4-alkoxyquinolyl or quinolinium in which the quinolinium nucleus is optionally substituted by one or two methyl group (s).
La présente invention a notamment pour objet les produits de formule (la) tels que définis ci-dessus caractérisés en ce que R3 et R3' représentent l'hydrogène.The subject of the present invention is in particular the products of formula (la) as defined above, characterized in that R3 and R3 'represent hydrogen.
La présente invention a particulièrement pour objet les produits de formule (IB) tels que définis ci-dessus dont les noms suivent:The present invention particularly relates to the products of formula (IB) as defined above, the names of which follow:
- le diodure de l'acide 2,6-pyridine-dicarboxylique-bis-[(1-méthyl-quinolinio-6- yl)amide]- the diodide of 2,6-pyridine-dicarboxylic-bis - [(1-methyl-quinolinio-6-yl) amide]
- le diodure de l'acide 2,6-pyridine-dicarboxylique-2-[(1-méthyl-quinolinio-6- yl)amide]-6-[(4-diméthylamino-1-méthyl-quinaldinio-6-yl)amide].- the diodide of 2,6-pyridine-dicarboxylic acid-2 - [(1-methyl-quinolinio-6-yl) amide] -6 - [(4-dimethylamino-1-methyl-quinaldinio-6-yl) amide].
- le diodure de l'acide 2,6-pyrazine-dicarboxylique-bis-[(1-méthyl-quinolinio-6- yl)amide] - le diodure de l'acide 1,3-benzène-dicarboxylique-bis-[(1-méthyl-quinolinio-6- yl)amide]- the diodide of 2,6-pyrazine-dicarboxylic-bis - [(1-methyl-quinolinio-6-yl) amide] - the diodide of 1,3-benzene-dicarboxylic acid-bis - [(1-methyl-quinolinio-6-yl) amide]
- le diodure de l'acide 2,6-pyridine-dicarboxylique-bis-[(1-méthyl-quinaldinio-6- yl)amide] - l'iodure de l'acide 2,6-pyridine-dicarboxylique-2-[(1-méthyl-quinolinio-6- yl)amide]-6-[(4-amino-quinaldinio-6-yl)amide], isolé sous sa forme tautomère imino ci-dessous :- 2,6-pyridine-dicarboxylic-bis diodide - [(1-methyl-quinaldinio-6-yl) amide] - 2,6-pyridine-dicarboxylic acid-2- iodide (1-methyl-quinolinio-6-yl) amide] -6 - [(4-amino-quinaldinio-6-yl) amide], isolated in its tautomeric imino form below:
- le diodure de l'acide 2,6-benzène-dicarboxylique-bis-[(1-méthyl-quinaldinio- 6-yl)amide] - le diodure de l'acide 2,4-pyridine-dicarboxylique-bis-[(1-méthyl-quinolin-6- yl)amide]- the diodide of 2,6-benzene-dicarboxylic acid-bis - [(1-methyl-quinaldinio-6-yl) amide] - the diodide of 2,4-pyridine-dicarboxylic acid-bis - [( 1-methyl-quinolin-6-yl) amide]
- l'iodure de l'acide 2,6-pyridine-dicarboxylique-2-[(1-méthyl-quinolinio-6- yl)amide]-6-[(1-méthyl-quinolinio-3-yl)amide],- 2,6-pyridine-dicarboxylic acid-2 iodide - [(1-methyl-quinolinio-6-yl) amide] -6 - [(1-methyl-quinolinio-3-yl) amide],
- l'iodure de l'acide 2,6-pyridine-dicarboxylique-2-[(1-méthyl-quinolinio-6- yl)amide]-6-[(1-méthyl-quinolinio-5-yl)amide]- 2,6-pyridine-dicarboxylic acid-2 iodide - [(1-methyl-quinolinio-6-yl) amide] -6 - [(1-methyl-quinolinio-5-yl) amide]
- le diodure de l'acide 2,6-pyridine-dicarboxylique-bis-[(1-méthyl-quinolinio-3- yl)amide]- the diodide of 2,6-pyridine-dicarboxylic-bis - [(1-methyl-quinolinio-3-yl) amide]
- le diodure de l'acide 2,6-pyridine-dicarboxylique-2-[(1-méthyl-quinolinio-6- yl)amide]-6-[2(-1-méthyl-pipéridinio-1-yl)éthylamide] - l'iodure de l'acide 2,6- pyridine-dicarboxylique-2-[(1-méthyl-quinolinio-3-yl)amide]-6-[quinolin-3- yl)amide]- 2,6-pyridine-dicarboxylic acid-2 diodide - [(1-methyl-quinolinio-6-yl) amide] -6- [2 (-1-methyl-piperidinio-1-yl) ethylamide] - 2,6-pyridine-dicarboxylic acid-2 iodide - [(1-methyl-quinolinio-3-yl) amide] -6- [quinolin-3-yl) amide]
- le diodure de l'acide 2,6-pyridine-dicarboxylique-2-[(1-méthyl-quinolinio-3- yl)amide]-6-[1-(2-hydroxyéthyl)quinolinio-3-yl)amide]- the diodide of 2,6-pyridine-dicarboxylic-2 - [(1-methyl-quinolinio-3-yl) amide] -6- [1- (2-hydroxyethyl) quinolinio-3-yl) amide]
- le diodure de l'acide 4-bromo-2,6-pyridine-dicarboxylique-bis-[(1-méthyl- quinolinio-3-yl)amide] lesdits produits de formule (I) étant sous toutes les formes isomères possibles racemiques, enantiomeres et diastéréo-isomeres, ainsi que les sels d'addition avec les acides minéraux et organiques ou avec les bases minérales et organiques desdits produits de formule (I).- the diodide of 4-bromo-2,6-pyridine-dicarboxylic-bis - [(1-methyl-quinolinio-3-yl) amide], said products of formula (I) being in all the isomeric forms possible racemics , enantiomers and diastereoisomers, as well as the addition salts with mineral and organic acids or with mineral and organic bases of the said products of formula (I).
La présente invention a ainsi particulièrement pour objet les produits de formule (IB) tels que définis ci-dessus dont les noms suivent :The present invention thus particularly relates to the products of formula (IB) as defined above, the names of which follow:
- le diodure de l'acide 2,6-pyridine-dicarboxylique-bis-[(1-méthyl-quinolinio-6- yl)amide]- the diodide of 2,6-pyridine-dicarboxylic-bis - [(1-methyl-quinolinio-6-yl) amide]
- le diodure de l'acide 2,6-pyridine-dicarboxylique-2-[(1-méthyl-quinolinio-6- yl)amide]-6-[(4-diméthylamino-1-méthyl-quinaldinio-6-yl)amide]. - le diodure de l'acide 2,6-pyrazine-dicarboxylique-bis-[(1-méthyl-quinolinio-6- yl)amide]- the diodide of 2,6-pyridine-dicarboxylic acid-2 - [(1-methyl-quinolinio-6-yl) amide] -6 - [(4-dimethylamino-1-methyl-quinaldinio-6-yl) amide]. - the diodide of 2,6-pyrazine-dicarboxylic-bis - [(1-methyl-quinolinio-6-yl) amide]
- le diodure de l'acide 1,3-benzène-dicarboxylique-bis-[(1-méthyl-quinolinio-6- yl)amide] - le diodure de l'acide 2,6-pyridine-dicarboxylique-bis-[(1-méthyI-quinaldinio-6- yl)amide]- the diodide of 1,3-benzene-dicarboxylic acid-bis - [(1-methyl-quinolinio-6-yl) amide] - the diodide of 2,6-pyridine-dicarboxylic acid-bis - [( 1-méthyI-quinaldinio-6- yl) amide]
- l'iodure de l'acide 2,6-pyridine-dicarboxylique-2-[(1-méthyl-quinolinio-6- yl)amide]-6-[(4-amino-quinaldinio-6-yl)amide], isolé sous sa forme tautomère imino ci-dessous - le diodure de l'acide 2,6-benzène-dicarboxylique-bis-[(1-méthyl-quinaldinio- 6-yl)amide]- 2,6-pyridine-dicarboxylic acid-2 iodide - [(1-methyl-quinolinio-6-yl) amide] -6 - [(4-amino-quinaldinio-6-yl) amide], isolated in its imino tautomeric form below - 2,6-benzene-dicarboxylic acid-bis diodide - [(1-methyl-quinaldinio- 6-yl) amide]
- le diodure de l'acide 2,4-pyridine-dicarboxylique-bis-[(1-méthyl-quinolin-6- yl)amide]- 2,4-pyridine-dicarboxylic acid-bis diodide - [(1-methyl-quinolin-6-yl) amide]
- l'iodure de l'acide 2,6-pyridine-dicarboxylique-2-[(1-méthyl-quinolinio-6- yl)amide]-6-[(1 -méthyl-quinolinio-3-yl)amide]- 2,6-pyridine-dicarboxylic acid-2 iodide - [(1-methyl-quinolinio-6-yl) amide] -6 - [(1-methyl-quinolinio-3-yl) amide]
- l'iodure de l'acide 2,6-pyridine-dicarboxylique-2-[(1-méthyl-quinolinio-6- yl)amide]-6-[(1-méthyl-quinolinio-5-yl)amide]- 2,6-pyridine-dicarboxylic acid-2 iodide - [(1-methyl-quinolinio-6-yl) amide] -6 - [(1-methyl-quinolinio-5-yl) amide]
- le diodure de l'acide 2,6-pyridine-dicarboxylique-bis-[(1-méthyl-quinolinio-3- yl)amide] - l'iodure de l'acide 2,6-pyridine-dicarboxylique-2-[(1-méthyl- quinolinio-3-yl)amide]-6-[quinolin-3-yl)amide]- the 2,6-pyridine-dicarboxylic-bis diodide - [(1-methyl-quinolinio-3-yl) amide] - the 2,6-pyridine-dicarboxylic acid-iodide 2- [ (1-methyl-quinolinio-3-yl) amide] -6- [quinolin-3-yl) amide]
- le diodure de l'acide 2,6-pyridine-dicarboxylique-2-[(1-méthyl-quinolinio-3- yl)amide]-6-[1-(2-hydroxyéthyl)quinolinio-3-yl)amide]- the diodide of 2,6-pyridine-dicarboxylic-2 - [(1-methyl-quinolinio-3-yl) amide] -6- [1- (2-hydroxyethyl) quinolinio-3-yl) amide]
- le diodure de l'acide 4-bromo-2,6-pyridine-dicarboxylique-bis-[(1-méthyl- quinolinio-3-yl)amide] ou les sels ou d'autres sels de ces composés lesdits produits de formule (I) étant sous toutes les formes isomères possibles racemiques, enantiomeres et diastéréo-isomeres, ainsi que les sels d'addition avec les acides minéraux et organiques ou avec les bases minérales et organiques desdits produits de formule (I).- the diodide of 4-bromo-2,6-pyridine-dicarboxylic-bis - [(1-methyl-quinolinio-3-yl) amide] or the salts or other salts of these compounds, the said products of formula (I) being in all the possible racemic, enantiomeric and diastereoisomeric isomeric forms, as well as the addition salts with mineral and organic acids or with mineral and organic bases of the said products of formula (I).
La présente invention a ainsi pour objet le produit de formule (IB) suivant :The present invention thus relates to the following product of formula (IB):
le diodure de l'acide 2,6-pyridine-dicarboxylique-2-[(1-méthyl-quinolinio-6- yl)amide]-6-[2(-1 -méthyl-pipéridinio-1 -yl)éthylamide] ce produit de formule (I) étant sous toutes les formes isomères possibles racemiques, enantiomeres et diastéréo-isomeres, ainsi que les sels d'addition avec les acides minéraux et organiques ou avec les bases minérales et organiques2,6-pyridine-dicarboxylic acid-2 - [(1-methyl-quinolinio-6-yl) amide] -6- [2 (-1-methyl-piperidinio-1-yl) ethylamide] diodide product of formula (I) being in all the possible racemic isomeric, enantiomeric and diastereoisomeric forms, as well as the addition salts with mineral and organic acids or with mineral and organic bases
La présente invention a également pour objet un procédé de préparation des produits de formule (IB) selon la présente invention : on décrit ainsi une méthode générale de synthèse comme suit.The present invention also relates to a process for preparing the products of formula (IB) according to the present invention: a general method of synthesis is thus described as follows.
La présente invention a également pour objet un procédé de préparation des produits de formule (IB) selon la présente invention : on décrit ainsi une méthode générale de synthèse comme suit ΘSt un N-méthyl-quinolinium.The present invention also relates to a process for preparing the products of formula (IB) according to the present invention: a general method of synthesis is thus described as follows ΘSt an N-methyl-quinolinium.
Méthode générale de synthèseGeneral method of synthesis
Une méthode particulièrement intéressante dans le cadre de l'invention consiste à alkyler en fin de synthèse un produit de formule générale (IA) en produit de formule générale (IB) à l'aide d'un halogénure d'alkyle, ou éventuellement d'un sulfate d'alkyle selon le schéma général ci-dessous :A particularly advantageous method within the framework of the invention consists in alkylating at the end of the synthesis a product of general formula (IA) into a product of general formula (IB) using an alkyl halide, or optionally an alkyl sulphate according to the general scheme below:
(IA)(IA)
cycle aromatique azoté -(NR3)p-C0-répartiteur-(C0M)m-(NR'3)q-X- cycle aromatique ou non aromatique alk-lnitrogen aromatic cycle - (NR 3 ) p-C0-distributor - (C0M) m- (NR ' 3 ) qX- aromatic or non-aromatic cycle alk-l
(IB) cycle aromatique azoté possédant un atome d'azote sous forme quaternaire (NR3)p-CO- répartiteur-(CO)m-(NR'3)q-X-cycle aromatique ou non aromatique(IB) nitrogen aromatic ring having a nitrogen atom in quaternary form (NR 3 ) p-CO- distributor- (CO) m- (NR ' 3 ) qX aromatic or non-aromatic ring
Les produits de formule générale (IA) dans lesquels X représente une simple liaison peuvent être préparés selon l'une quelconque des méthodes générales de synthèse décrites dans le brevet WO 0296903.The products of general formula (IA) in which X represents a single bond can be prepared according to any one of the general methods of synthesis described in patent WO 0296903.
Les produits de formule générale (IA) dans lesquels X est différent d'une simple liaison peuvent avantageusement être préparés selon le schéma général ci-dessous : HOOC-répartiteur-COOHThe products of general formula (IA) in which X is different from a single bond can advantageously be prepared according to the general scheme below: HOOC-distributor-COOH
HOOC-répartiteur-(CO)m-(NR'3)q-X-cycle aromatique ou non aromatiqueHOOC-dispatcher- (CO) m- (NR ' 3 ) qX-aromatic or non-aromatic cycle
cycle aromatique azoté (NR3)p-CO-répartiteur-COOH aromatic nitrogen cycle (NR 3 ) p-CO-distributor-COOH
cycle aromatique azoté -(NR3)p-CO-répartiteur-(CO)m-(NR'-)q-X- cycle aromatique ou non aromatique nitrogen aromatic cycle - (NR 3 ) p-CO-distributor - (CO) m- (NR '-) qX- aromatic or non-aromatic cycle
La présente invention a ainsi pour objet les produits de formule (IB) tels que définis ci-dessus caractérisés en ce qu'ils ont une activité inhibitrice des télomérases. La présente invention a ainsi pour objet les produits de formule (IB) tels que définis ci-dessus caractérisés en ce qu'ils ont une activité anticancéreuse.A subject of the present invention is therefore the products of formula (IB) as defined above, characterized in that they have a telomerase inhibiting activity. The present invention thus relates to the products of formula (IB) as defined above, characterized in that they have an anticancer activity.
La présente invention a également pour objet à titre de médicaments, les produits de formule (IB) tels que définis ci-dessus, ainsi que leurs prodrugs, lesdits produits de formule (I) étant sous toutes les formes isomères possibles racemiques, enantiomeres et diastéréo-isomeres, ainsi que les sels d'addition avec les acides minéraux et organiques ou avec les bases minérales et organiques pharmaceutiquement acceptables desdits produits de formule (I).The present invention also relates to, as medicaments, the products of formula (IB) as defined above, as well as their prodrugs, said products of formula (I) being in all the isomeric, racemic, enantiomeric and diastereo forms -isomers, as well as addition salts with mineral and organic acids or with pharmaceutically acceptable mineral and organic bases of said products of formula (I).
La présente invention a ainsi pour objet à titre de médicaments, les produits de formule (la) telle que définie aux revendications précédentes ainsi que leurs prodrugs, lesdits produits de formule (la) étant sous toutes les formes isomères possibles racemiques, enantiomeres et diastéréo-isomeres, ainsi que les sels d'addition avec les acides minéraux et organiques ou avec les bases minérales et organiques pharmaceutiquement acceptables desdits produits de formule (la).The subject of the present invention is therefore, as medicaments, the products of formula (la) as defined in the preceding claims as well as their prodrugs, said products of formula (la) being in all the isomeric, racemic, enantiomeric and diastereogenic forms isomers, as well as addition salts with mineral and organic acids or with pharmaceutically acceptable mineral and organic bases of said products of formula (la).
La présente invention a particulièrement pour objet à titre de médicaments, les produits décrits ci-après dans la partie expérimentale, ainsi que leurs prodrugs, ainsi que les sels d'addition avec les acides minéraux et organiques ou avec les bases minérales et organiques pharmaceutiquement acceptables de ces produits.The present invention relates particularly as medicaments, the products described below in the experimental part, as well as their prodrugs, as well as addition salts with mineral and organic acids or with pharmaceutically acceptable mineral and organic bases of these products.
Le terme patient désigne les êtres humains mais aussi les autres mammifères.The term patient designates human beings but also other mammals.
Le terme "Prodrug" désigne un produit qui peut être transformé in vivo par des mécanismes métaboliques (tel que l'hydrolyse) en un produit de formule (I). Par exemple, un ester d'un produit de formule (I) contenant un groupe hydroxyle peut être converti par hydrolyse in vivo en sa molécule mère. Ou encore un ester d'un produit de formule (I) contenant un groupe carboxy peut être converti par hydrolyse in vivo en sa molécule mère.The term "Prodrug" denotes a product which can be transformed in vivo by metabolic mechanisms (such as hydrolysis) into a product of formula (I). For example, an ester of a product of formula (I) containing a hydroxyl group can be converted by hydrolysis in vivo to its parent molecule. Or an ester of a product of formula (I) containing a carboxy group can be converted by hydrolysis in vivo to its parent molecule.
Les produits peuvent être administrés par voie parentérale, buccale, perlinguale, rectale ou topique.The products can be administered parenterally, buccally, perlingually, rectally or topically.
L'invention a aussi pour objet les compositions pharmaceutiques, caractérisées en ce qu'elles renferment, à titre de principe actif, un au moins des médicaments de formule générale (IB) telle que définie ci-dessus et notamment les produits décrits ci-après dans la partie expérimentale.A subject of the invention is also pharmaceutical compositions, characterized in that they contain, as active principle, at least one of the drugs of general formula (IB) as defined above and in particular the products described below in the experimental part.
Ces compositions peuvent être présentées sous forme de solutions ou de suspensions injectables, de comprimés, de comprimés enrobés, de capsules, de sirops, de suppositoires, de crèmes, de pommades et de lotions. Ces formes pharmaceutiques sont préparées selon les méthodes usuelles. Le principe actif peut être incorporé à des excipients habituellement employés dans ces compositions, tels que les véhicules aqueux ou non, le talc, la gomme arabique, le lactose, l'amidon, le stéarate de magnésium, le beurre de cacao, les corps gras d'origine animale ou végétale, les dérivés paraffiniques, les glycols, les divers agents mouillants, dispersants ou émulsifiants, les conservateurs.These compositions can be presented in the form of solutions or injectable suspensions, tablets, coated tablets, capsules, syrups, suppositories, creams, ointments and lotions. These pharmaceutical forms are prepared according to the usual methods. The active principle can be incorporated into excipients usually used in these compositions, such as aqueous vehicles or not, talc, gum arabic, lactose, starch, magnesium stearate, cocoa butter, fatty substances of animal or vegetable origin, paraffinic derivatives, glycols, various wetting agents, dispersants or emulsifiers, preservatives.
La dose usuelle, variable selon le sujet traité et l'affection en cause, peut être, par exemple, de 10 mg à 500 mg par jour chez l'homme, par voie orale.The usual dose, which varies depending on the subject treated and the condition in question, can be, for example, from 10 mg to 500 mg per day in humans, orally.
La présente invention a également pour objet les compositions pharmaceutiques telles que définies ci-dessus contenant en plus, des principes actifs d'autres médicaments de chimiothérapie contre le cancer. La présente invention a également pour objet les compositions pharmaceutiques telles que définies ci-dessus caractérisées en ce qu'elles sont utilisées comme médicaments, en particulier pour la chimiothérapie de cancers.The present invention also relates to the pharmaceutical compositions as defined above containing, in addition, active principles of other chemotherapy drugs against cancer. The present invention also relates to pharmaceutical compositions as defined above, characterized in that they are used as medicaments, in particular for the chemotherapy of cancers.
La présente invention a ainsi pour objet l'utilisation des composés définis ci-dessus comme produit pharmaceutique à usage humain.The present invention thus relates to the use of the compounds defined above as a pharmaceutical product for human use.
La présente invention concerne également les associations thérapeutiques constituées d'un composé de formule (IB) telle que définie ci-dessus et d'un autre composé anticancéreux.The present invention also relates to therapeutic combinations consisting of a compound of formula (IB) as defined above and of another anticancer compound.
La présente invention concerne ainsi les associations thérapeutiques telles que définies ci-dessus caractérisées en ce que le composé anticancéreux est choisi parmi les agents alkylants, les dérivés du platine, les agents antibiotiques, les agents antimicrotubules, les anthracyclines, les topoisomérases des groupes I et II, les fluoropyrimidines, les analogues de cytidine, les analogues d'adénosine, les enzymes et composés divers tels que la L-asparaginase, l'hydroxyurée, l'acide trans-rétinoique, la suramine, l'irinotecan, le topotecan, la dexrazoxane, l'amifostine, l'herceptin ainsi que les hormones oetrogéniques, androgéniques, les agents antivasculaires.The present invention thus relates to therapeutic combinations as defined above, characterized in that the anticancer compound is chosen from alkylating agents, platinum derivatives, antibiotic agents, antimicrotubule agents, anthracyclines, topoisomerases from groups I and II, fluoropyrimidines, cytidine analogs, adenosine analogs, enzymes and various compounds such as L-asparaginase, hydroxyurea, trans-retinoic acid, suramin, irinotecan, topotecan, dexrazoxane, amifostine, herceptin as well as oetrogenic and androgenic hormones, anti-vascular agents.
La présente invention concerne également une association thérapeutique constituée d'un composé de formule (IB) telle que définie ci-dessus et de radiations.The present invention also relates to a therapeutic association consisting of a compound of formula (IB) as defined above and of radiation.
La présente invention concerne ainsi les associations telles que définies ci- dessus caractérisées en ce que chacun des composés ou des traitements est administré simultanément, séparément ou séquentiellement.The present invention thus relates to combinations as defined above, characterized in that each of the compounds or of treatments is administered simultaneously, separately or sequentially.
La présente invention concerne ainsi l'utilisation de produits de formule (IB) tels que définis ci-dessus ou de sels pharmaceutiquement acceptables desdits produits de formule (IB) pour la préparation de médicaments destinés à traiter des cancers , des maladies génétiques ou les anomalies de pilosité.The present invention thus relates to the use of products of formula (IB) as defined above or of pharmaceutically acceptable salts of said products of formula (IB) for the preparation of medicaments intended to treat cancers, genetic diseases or abnormalities hairiness.
La présente invention concerne ainsi l'utilisation de produits de formule (IB) tels que définis ci -dessus ou de sels pharmaceutiquement acceptables desdits produits de formule (I) pour la préparation d'un médicament destiné à traiter des cancers.The present invention thus relates to the use of products of formula (IB) as defined above or of pharmaceutically acceptable salts of said products of formula (I) for the preparation of a medicament intended for treat cancer.
La présente invention concerne ainsi l'utilisation de produits de formule (IB) tels que définis ci -dessus ou de sels pharmaceutiquement acceptables desdits produits de formule (I) pour la préparation d'un médicament destiné à traiter des maladies génétiques telles que les syndromes de Bloom, de Werner, de Rothmund-Thomson ou d'ataxie télangiectaxie.The present invention thus relates to the use of products of formula (IB) as defined above or of pharmaceutically acceptable salts of said products of formula (I) for the preparation of a medicament intended to treat genetic diseases such as syndromes Bloom, Werner, Rothmund-Thomson or ataxia telangiectaxis.
La présente invention concerne ainsi l'utilisation de produits de formule (IB) tels que définis ci-dessus ou de sels pharmaceutiquement acceptables desdits produits de formule (I) pour la préparation d'un médicament destiné à traiter des anomalies de pilosité telle que l'hyperpilosité.The present invention thus relates to the use of products of formula (IB) as defined above or of pharmaceutically acceptable salts of said products of formula (I) for the preparation of a medicament intended for treating hair abnormalities such as l 'Excessive hair.
La présente invention concerne particulièrement l'utilisation de produits de formule (IB) tels que définis ci -dessus ou de sels pharmaceutiquement acceptables desdits produits de formule (I) pour la préparation d'un médicament destiné à traiter des cancers du sein, de l'estomac, du colon, des poumons, des ovaires, de l'utérus, du cerveau, du rein, du larynx, du système lymphatique, de la thyroïde, du tractus uro-génital, du tractus incluant vésicule et prostate, du cancer des os, du pancréas, les mélanomes et plus particulièrement des cancers du sein, du colon ou des poumons.The present invention particularly relates to the use of products of formula (IB) as defined above or of pharmaceutically acceptable salts of said products of formula (I) for the preparation of a medicament intended for treating breast cancers, , colon, lungs, ovaries, uterus, brain, kidney, larynx, lymphatic system, thyroid, urogenital tract, tract including vesicle and prostate, cancer bones, pancreas, melanomas and more particularly breast, colon or lung cancer.
La présente invention concerne particulièrement l'utilisation de produits de formule (IB) tels que définis ci -dessus ou de sels pharmaceutiquement acceptables desdits produits de formule (I) pour la préparation d'un médicament destiné à la chimiothérapie de cancers et notamment destinés à la chimiothérapie de cancers utilisés seuls ou en association.The present invention particularly relates to the use of products of formula (IB) as defined above or of pharmaceutically acceptable salts of said products of formula (I) for the preparation of a medicament intended for the chemotherapy of cancers and in particular intended for chemotherapy for cancers used alone or in combination.
La présente invention concerne ainsi l'utilisation de produits de formule (IB) telle que définie à l'une quelconque des revendications précédentes ou de sels pharmaceutiquement acceptables desdits produits de formule (IB) pour la préparation de médicaments destinés à être utilisés seuls ou en association avec chimiothérapie ou radiothérapie ou alternativement en association avec d'autres agents thérapeutiques et en particulier une telle utilisation dans laquelle les agents thérapeutiques peuvent être des agents anti-tumoraux utilisés communément.The present invention thus relates to the use of products of formula (IB) as defined in any one of the preceding claims or of pharmaceutically acceptable salts of said products of formula (IB) for the preparation of medicaments intended to be used alone or in combination with them. combination with chemotherapy or radiotherapy or alternatively in combination with other therapeutic agents and in particular such a use in which the therapeutic agents can be commonly used anti-tumor agents.
Les produits de formule (I) selon la présente invention peuvent ainsi également être avantageusement utilisés en combinaison avec des agents anti-prolifératifs : à titre d'exemples de tels agents anti-prolifératifs mais sans toutefois se limiter à cette liste, on peut citer les inhibiteurs d'aromatase, les antiestrogènes, les inhibiteurs de topoisomerase I, les inhibiteurs de topoisomerase II, les agents actifs sur les microtubules, les agents d'alkylation, les inhibiteurs d'histone désacétylase, les inhibiteurs de farnésyl transférase, les inhibiteurs de COX-2, les inhibiteurs de MMP, les inhibiteurs de mTOR, les antimétabolites antinéoplastique, les composés du platine, les composés faisant décroître l'activité des protéines kinases et également les composés anti-angiogéniques, les agonistes de la gonadoreline, les anti- androgènes, les bengamides, les biphophonates et le trastuzumab.The products of formula (I) according to the present invention can thus also be advantageously used in combination with anti-proliferative agents: as examples of such anti-proliferative agents but without however being limited to this list, there may be mentioned aromatase inhibitors, antiestrogens, topoisomerase I inhibitors , topoisomerase II inhibitors, microtubule active agents, alkylating agents, histone deacetylase inhibitors, farnesyl transferase inhibitors, COX-2 inhibitors, MMP inhibitors, mTOR inhibitors, antineoplastic antimetabolites, platinum compounds, compounds which decrease the activity of protein kinases and also antiangiogenic compounds, gonadoreline agonists, antiandrogens, bengamides, biphophonates and trastuzumab.
On peut citer ainsi à titre d'exemples, des agents anti-microtubules comme les taxoides, vinka-alkaloides, des agents d'alkylation tels que cyclophosphamide, des agents DNA-intercalant comme le cis-platinum, des agents interactifs sur topoisomerase comme la camptothecine et dérivés, les anthracyclines comme l'adriamycine, des antimétabolites comme le 5-fluorouracile et dérivés et analogues.Examples that may be mentioned are anti-microtubule agents such as taxoids, vinka-alkaloids, alkylating agents such as cyclophosphamide, DNA-intercalating agents such as cis-platinum, interactive agents on topoisomerase such as camptothecin and derivatives, anthracyclines such as adriamycin, antimetabolites such as 5-fluorouracil and derivatives and the like.
L'affinité et la sélectivité des produits de formule générale (IB) selon la présente invention pour des structures d'ADN en G-quadruplexe peut être déterminée par une ou plusieurs des méthodes suivantes :The affinity and selectivity of the products of general formula (IB) according to the present invention for G-quadruplex DNA structures can be determined by one or more of the following methods:
Test d'affinité n°1 : Mesure de l'inhibition d'appariement d'un oligonucléotide. susceptible de former une structure G-quadruplexe, avec son brin complémentaire mesurée sous forme de concentration inhibitrice 50 % CI50. exprimée en uM. par une méthode de luminescence selon le protocole expérimental est décrit ci-aprèsAffinity test n ° 1: Measurement of the inhibition of pairing of an oligonucleotide. likely to form a G-quadruplex structure, with its complementary strand measured in the form of an inhibitory concentration 50% IC50. expressed in µM. by a luminescence method according to the experimental protocol is described below
Le principe de ce test utilise l'activation de billes « accepteurs » par un singlet d'oxygène émis par des billes « donneurs » excitées par un laser lorsque les billes « accepteurs » et « donneurs » sont à proximité. Ce test a été développé par Packard Bioscience sous le nom Amplified Luminescent Proximity Homogeneous Assay ou ALPHA screen.The principle of this test uses the activation of “acceptor” beads by an oxygen singlet emitted by “donor” beads excited by a laser when the “acceptor” and “donor” beads are nearby. This test was developed by Packard Bioscience under the name Amplified Luminescent Proximity Homogeneous Assay or ALPHA screen.
Les billes « donneurs » sont conjuguées à la streptavidine et les billes accepteurs à un anticorps anti-digoxigénine (référence catalogue 6760604). Un brin d'ADN, dans ce cas le brin télomérique est couplé à son extrémité 5' à la biotine de façon à pouvoir se lier aux billes « donneurs », tandis que le brin complémentaire est couplé à la digoxigénine pour pouvoir se lier aux billes « accepteurs ». Lors de l'appariement du brin télomérique à son brin complémentaire, les billes sont mises à proximité et un signal de luminescence est alors émis à une longueur d'onde de 520-620 nm.The “donor” beads are conjugated to streptavidin and the acceptor beads to an anti-digoxigenin antibody (catalog reference 6760604). A DNA strand, in this case the telomeric strand is coupled at its 5 'end with biotin so as to be able to bind to “donor” beads, while the complementary strand is coupled to digoxigenin in order to be able to bind to “acceptor” beads. During the pairing of the telomeric strand with its complementary strand, the balls are put in proximity and a luminescence signal is then emitted at a wavelength of 520-620 nm.
Les oligonucléotides utilisés dans les expériences ont été synthétisés par Perkin Elmer Life Sciences (Finlande). Le brin riche en G correspondant aux motifs répétitifs de l'ADN télomérique humain possède la séquence G-GTT- TAA-AAT-AAT-TGA-GGG-TTA-GGG-TTA-GGG-TTA-GGG. Le brin complémentaire a la séquence GGT-TTA-AAA-AAT-TTG-CCC-TAA-CCC- TAA-CCC-TAA-CCC -T. La biotine ou la digoxigénine sont ajoutés à l'extrémité 5' des oligonucléotides.The oligonucleotides used in the experiments were synthesized by Perkin Elmer Life Sciences (Finland). The G-rich strand corresponding to the repeating units of human telomeric DNA has the sequence G-GTT-TAA-AAT-AAT-TGA-GGG-TTA-GGG-TTA-GGG-TTA-GGG. The strand complementary to the sequence GGT-TTA-AAA-AAT-TTG-CCC-TAA-CCC-TAA-CCC-TAA-CCC -T. Biotin or digoxigenin are added to the 5 'end of the oligonucleotides.
Les expériences sont réalisées dans un tampon TRIS-HCI 50 mM pH 7.4 contenant 100 mM de KCI et 0.1 % de BSA. Les mesures sont effectuées avec un Alphaquest microplate analyser (Fusion α) de chez Packard Biosciences.The experiments are carried out in a 50 mM TRIS-HCl buffer pH 7.4 containing 100 mM KCI and 0.1% BSA. The measurements are carried out with an Alphaquest microplate analyzer (Fusion α) from Packard Biosciences.
Les expériences sont réalisées en plaques 96 puits (1/2 puits) Une solution stock d'oligonucléotide à la concentration de 25 nM dans le tampon décrit ci-dessus est préparée. 10 μl de cette solution sont distribués dans les puits. 10 μl du produit à tester à différentes concentrations préparées dans le même tampon contenant 0.6 % de DMSO sont alors ajoutés. 10 μl de tampon + 0.6 % DMSO sont distribués dans les puits contrôles. Les échantillons sont laissés à incuber 15 minutes à température ambiante. Après ce temps d'incubation 10 μl du brin complémentaire à la concentration de 25 nM et 20 μl d'une solution contenant les 2 types de billes préalablement diluées à 50 mg/ml sont ajoutés dans les puits. Les plaques sont incubées à température ambiante pendant 2 heures avant lecture. Dans ces conditions le brin télomérique peut adopter une conformation secondaire du type G-quadruplexe que le produit en fonction de son affinité pour cette structure stabilise, en empêchant l'appariement au brin complémentaire. Le signal émis est alors minimal. En absence de produit dans les puits contrôles, le brin télomérique s'apparie au brin complémentaire ce qui se traduit par un signal maximal.The experiments are carried out in 96-well plates (1/2 well). A stock solution of oligonucleotide at the concentration of 25 nM in the buffer described above is prepared. 10 μl of this solution are distributed in the wells. 10 μl of the product to be tested at different concentrations prepared in the same buffer containing 0.6% of DMSO are then added. 10 μl of buffer + 0.6% DMSO are distributed in the control wells. The samples are incubated for 15 minutes at room temperature. After this incubation time 10 μl of the complementary strand at the concentration of 25 nM and 20 μl of a solution containing the 2 types of beads previously diluted to 50 mg / ml are added to the wells. The plates are incubated at room temperature for 2 hours before reading. Under these conditions the telomeric strand can adopt a secondary conformation of the G-quadruplex type which the product as a function of its affinity for this structure stabilizes, preventing pairing with the complementary strand. The signal transmitted is then minimal. In the absence of product in the control wells, the telomeric strand pairs with the complementary strand, which results in a maximum signal.
Test de sélectivité n°1 : Mesure de l'inhibition d'appartement d'un olioonucléotide. quelconque, avec son brin complémentaire mesurée sous forme de concentration inhibitrice 50 % CI50. exprimée en uM . par une méthode de luminescence selon le protocole expérimental est décrit ci-aprèsSelectivity test n ° 1: Measurement of the inhibition of apartment of an olioonucleotide. any, with its complementary strand measured under form of inhibitory concentration 50% IC50. expressed in µM. by a luminescence method according to the experimental protocol is described below
Le test utilisé est le même que celui décrit ci-dessus. Seuls les oligonucléotides sont différents, le brin télomérique étant remplacé par un oligonucléotide possédant la séquence suivante : G-GTT-TAA-AAT-AAT- TGA-GGC-TTA-CCG-TTA-CCG-TTA-CGG biotinylé à l'extrémité 5'. Le brin complémentaire possède la séquence : 5'-GGT-TTA-AAA-AAT-TTG -CGG- TAA-CGG-TAA-CGG-TAA-GCC-T marqué à la digoxigénine à l'extrémité 5'. Si le produit à tester possède une affinité pour la séquence d'ADN biotinylée, l'appariement au brin complémentaire sera empêché et le signal obtenu minimal. En absence de produit ou si ce dernier n'a pas d'affinité pour cet ADN, l'appariement se fera et le signal sera maximal.The test used is the same as that described above. Only the oligonucleotides are different, the telomeric strand being replaced by an oligonucleotide having the following sequence: G-GTT-TAA-AAT-AAT- TGA-GGC-TTA-CCG-TTA-CCG-TTA-CGG biotinylated at the end 5 . The complementary strand has the sequence: 5'-GGT-TTA-AAA-AAT-TTG -CGG-TAA-CGG-TAA-CGG-TAA-GCC-T labeled with digoxigenin at the 5 'end. If the product to be tested has an affinity for the biotinylated DNA sequence, the matching to the complementary strand will be prevented and the signal obtained minimal. In the absence of a product or if the latter has no affinity for this DNA, the pairing will be done and the signal will be maximum.
Test d'affinité n°2 : Mesure de la constante de dissociation, exprimée en uM, du complexe entre un produit de l'invention et un oligonucléotide, susceptible de former une structure G-quadruplexe monomérique; par une méthode de fluorescence selon le protocole expérimental est décrit ci-après.Affinity test No. 2: Measurement of the dissociation constant, expressed in μM, of the complex between a product of the invention and an oligonucleotide, capable of forming a monomeric G-quadruplex structure; by a fluorescence method according to the experimental protocol is described below.
Les titrations sont effectuées à 20°C dans une cuve en quartz de 3 ml de volume utile et de section carrée 10x10 mm placée dans le compartiment thermostaté du fluorimètre Spex Fluorolog 3 (Jobin-Yvon). Le tampon utilisé dans toutes les eperiences est un cacolylate de sodium pH 7.2 (10 mM) contenant 100 mM en chlorure de potassium. A une solution en composé de 0.1 μM sont ajoutées des concentrations croissantes en acide nucléique. Après un temps d'équilibration de 3 minutes, un spectre d'émission de fluorescence est enregistré pour chaque point, en utilisant des fentes de 5 nm et une longueur d'onde d'excitation de 340 nm. Chaque aliquote représente un volume additionnel de 3 microlitres. Les effets de dilution sont corrigés à la fin de l'expérience après intégration du signal d'émission. Les courbes représentant l'intensité d'émission en fonction de la concentration en acide nucléique sont ensuites analysées et fittées avec le logiciel Kaleidagaph 3.52 pour Macintosh.The titrations are carried out at 20 ° C. in a quartz cell of 3 ml of useful volume and square section 10 × 10 mm placed in the thermostatically controlled compartment of the Spex Fluorolog 3 fluorimeter (Jobin-Yvon). The buffer used in all experiments is a sodium cacolylate pH 7.2 (10 mM) containing 100 mM in potassium chloride. To a 0.1 μM solution of compound are added increasing concentrations of nucleic acid. After an equilibration time of 3 minutes, a fluorescence emission spectrum is recorded for each point, using 5 nm slits and an excitation wavelength of 340 nm. Each aliquot represents an additional volume of 3 microliters. The dilution effects are corrected at the end of the experiment after integration of the emission signal. The curves representing the emission intensity as a function of the nucleic acid concentration are then analyzed and fitted with Kaleidagaph 3.52 software for Macintosh.
Test de sélectivité n°2 : Mesure de la constante de dissociation, exprimée en uM. du complexe entre un produit de l'invention et un oligonucléotide double brin quelconque, par une méthode de fluorescence selon le protocole expérimental est décrit ci-aprèsSelectivity test No. 2: Measurement of the dissociation constant, expressed in μM. of the complex between a product of the invention and a double oligonucleotide any strand, by a fluorescence method according to the experimental protocol is described below
Les titrations sont effectuées selon un protocole identique à celui employé pour les titrations du test précédent.The titrations are carried out according to a protocol identical to that used for the titrations of the previous test.
Test d'affinité n°3 : Mesure de la stabilisation des G-quadruplexes D Tm . exprimée en °C . par une méthode utilisant la formation d'un complexe avec la fluoresceine dont le protocole expérimental est décrit ci-aprèsAffinity test n ° 3: Measurement of the stabilization of G-quadruplexes D Tm. expressed in ° C. by a method using the formation of a complex with fluorescein, the experimental protocol of which is described below
Oligonucléotidesoligonucleotides
Tous les olignucléotides, modifiés ou non, ont été synthétisés par Eurogentec SA, Seraing, Belgique. L'oligoncleotide FAM + DABCYL porte la référence catalogue, OL-0371-0802. Il possède la séquence: GGGTTAGGGTTAGGGTTAGGG correspondant à 3.5 répétitions du motif télomérique humain (brin riche en G). La fluoresceine est attaché à l'extrémité 5', le DABCYL à l'extrémité 3', par les bras chimiques décrit par Eurogentec. Un oligonucléotide FAM + TAMRA peut également être employé. La concentration des échantillons est vérifiée par spectrophotométrie, en enregistrant le spectre d'absorbance entre 220 et 700 nm et en utilisant le coefficient d'extinction molaire fourni par le fournisseur.All the olignucleotides, modified or not, were synthesized by Eurogentec SA, Seraing, Belgium. The FAM + DABCYL oligoncleotide carries the catalog reference, OL-0371-0802. It has the sequence: GGGTTAGGGTTAGGGTTAGGG corresponding to 3.5 repetitions of the human telomeric motif (strand rich in G). Fluorescein is attached to the 5 'end, DABCYL to the 3' end, by the chemical arms described by Eurogentec. A FAM + TAMRA oligonucleotide can also be used. The concentration of the samples is verified by spectrophotometry, by recording the absorbance spectrum between 220 and 700 nm and using the molar extinction coefficient supplied by the supplier.
Tampons Toutes les expériences ont été réalisées dans un tampon cacodylate de sodium 10 mM pH 7.6 contenant 0.1 M de Chlorure de Lithium (ou de Chlorure de Sodium). L'absence de contamination fluorescente dans le tampon a été préalablement vérifiée. L'oligonucléotide fluorescent est ajouté à la concentration finale de 0.2 μM.Buffers All the experiments were carried out in a 10 mM sodium cacodylate buffer, pH 7.6 containing 0.1 M of Lithium Chloride (or Sodium Chloride). The absence of fluorescent contamination in the buffer has been checked beforehand. The fluorescent oligonucleotide is added to the final concentration of 0.2 μM.
Etude de FluorescenceFluorescence study
Toutes les mesures de fluorescence ont été effectuées sur un appareil Spex Fluorolog DM1 B ou Fluoromax 3, en utilisant une largeur de raie d'excitation de 1.8 nm et une largeur de raie d'émission de 4.5 ou 5 nm. Les échantillons sont placés dans une cuvette en quartz micro de 0.2 x 1 cm. La température de l'échantillon est contrôlée par un bain-marie extérieur. L'oligonucléotide seul a été analysé à 20, 30, 40, 50, 60, 70 et 80°C. Les spectres d'émission sont enregistrés en utilisant une longueur d'onde d'excitation de 470 nm. Les spectres d'excitation sont enregistrés en utilisant soit 515 nm soit 588 nm comme longueur d'onde d'émission. Les spectres sont corrigés de la réponse de l'instrument par des courbes de référence. Une extinction importante (80-90 %) de la fluorescence de la fluoresceine à température ambiante est observée, en accord avec un repli intramoléculaire de l'oligonucléotide à 20°C sous forme d'un G-quadruplex, ce qui induit une juxtaposition de ses extrémités 5' et 3', respectivement liées à la fluoresceine et au DABCYL. Cette juxtaposition entraîne un phénomène déjà décrit d'extinction de fluorescence, utilisé pour les "Molecular Beacons".All the fluorescence measurements were carried out on a Spex Fluorolog DM1 B or Fluoromax 3 device, using an excitation line width of 1.8 nm and an emission line width of 4.5 or 5 nm. The samples are placed in a 0.2 x 1 cm micro quartz cuvette. The temperature of the sample is controlled by an external water bath. The oligonucleotide alone was analyzed at 20, 30, 40, 50, 60, 70 and 80 ° C. The emission spectra are recorded using an excitation wavelength of 470 nm. The excitation spectra are recorded using either 515 nm or 588 nm as the emission wavelength. The spectra are corrected for the response of the instrument by reference curves. A significant extinction (80-90%) of the fluorescence of fluorescein at room temperature is observed, in agreement with an intramolecular fold of the oligonucleotide at 20 ° C. in the form of a G-quadruplex, which induces a juxtaposition of its 5 'and 3' ends, respectively linked to fluorescein and DABCYL. This juxtaposition leads to a phenomenon already described of quenching of fluorescence, used for the "Molecular Beacons".
Tm en fluorescence Une solution stock d'oligonucléotide à la concentration en brin deTm in fluorescence A stock solution of oligonucleotide at the strand concentration of
0.2 μM dans un tampon 0.1 M LiCI 10 mM cacodylate pH 7.6 est préalablement préparée, chauffée brièvement à 90°C et refroidie lentement à 20°C, puis distribuée par aliquots de 600 μl dans les cuves de fluorescence. 3 μl d'eau (pour le contrôle) ou 3 μl du produit à tester (stock à 200 μM, concentration finale 1 μM) sont alors ajoutés et mélangés. Les échantillons sont alors laissés à incuber pendant au moins 1 heure à 20°C avant chaque mesure. L'utilisation de temps d'incubation plus longs (jusqu'à 24 heures) n'a pas d'influence sur le résultat obtenu. Chaque expérience permet la mesure de 1à 4 échantillons. Celui ci est d'abord incubé à une température initiale de 20°C et porté à 80°C en 38 minutes. Durant ce temps, la fluorescence est mesurée simultanément à une (515 nm) ou à deux longueurs d'onde d'émission (515 nm et 588 nm) en utilisant 470 nm comme longueur d'onde d'excitation. Une mesure est effectuée toutes les 30 secondes ou tous les degrés. La température du bain- marie est enregistrée en parallèle, et le profil de fluorescence en fonction de la température est reconstitué à partir de ces valeurs. Les profils de fluorescence sont ensuite normalisés entre 20°C et 80°C, et la température pour laquelle l'intensité d'émission à 515 nm est la moyenne de celles à haute et basse température est appelée Tm. Dans ces conditions, le Tm de l'échantillon de référence sans addition de produit est d'environ 44°C dans un tampon Chlorure de Lithium. Cette température est portée à plus de 55°C dans un tampon Chlorure de Sodium. L'addition d'un composé stabilisant le G-quadruplex induit une augmentation du Tm. Cette augmentation est jugée significative si elle est supérieure à 3°. Test de sélectivité n°3 : Estimation de la répartition à l'équilibre d'un produit de l'invention entre divers oligonucléotides ou structures d'ADN, par une méthode de dialyse selon le protocole expérimental est décrit ci-après.0.2 μM in 0.1 M LiCI 10 mM cacodylate pH 7.6 buffer is previously prepared, briefly heated to 90 ° C and slowly cooled to 20 ° C, then distributed in aliquots of 600 μl in the fluorescence tanks. 3 μl of water (for control) or 3 μl of the product to be tested (stock at 200 μM, final concentration 1 μM) are then added and mixed. The samples are then left to incubate for at least 1 hour at 20 ° C before each measurement. The use of longer incubation times (up to 24 hours) has no influence on the result obtained. Each experiment allows the measurement of 1 to 4 samples. This is first incubated at an initial temperature of 20 ° C and brought to 80 ° C in 38 minutes. During this time, fluorescence is measured simultaneously at one (515 nm) or two emission wavelengths (515 nm and 588 nm) using 470 nm as the excitation wavelength. A measurement is made every 30 seconds or every degree. The temperature of the water bath is recorded in parallel, and the fluorescence profile as a function of the temperature is reconstructed from these values. The fluorescence profiles are then normalized between 20 ° C and 80 ° C, and the temperature for which the emission intensity at 515 nm is the average of those at high and low temperatures is called Tm. Under these conditions, the Tm of the reference sample without addition of product is approximately 44 ° C in a Lithium Chloride buffer. This temperature is brought to more than 55 ° C. in a sodium chloride buffer. The addition of a compound stabilizing G-quadruplex induces an increase in Tm. This increase is considered significant if it is greater than 3 °. Selectivity test No. 3: Estimation of the equilibrium distribution of a product of the invention between various oligonucleotides or DNA structures, by a dialysis method according to the experimental protocol is described below.
Tous les polynucleotides proviennent d'Amersham-Pharmacia. Les Oligonucléotides ont été synthétisés par Eurogentec, Belgique a l'échelle 1 μmole et utilisés sans purification supplémentaire. 19 structures sont testées en parallèle (échantillon numérotés de 1-19, voir table ci-dessous). Les triplexes TC, GA et GT résultent de l'association de deux brins de différentes longueurs (13 and 30 bases) : 5' GAAAGAGAGGAGG et 5' CCTCCTCTCTTTCCCTTCTTTCTCTCCTCC (TC triplexe, échantillon #1);All polynucleotides are from Amersham-Pharmacia. The Oligonucleotides were synthesized by Eurogentec, Belgium on a 1 μmole scale and used without additional purification. 19 structures are tested in parallel (sample numbered from 1-19, see table below). The triplexes TC, GA and GT result from the association of two strands of different lengths (13 and 30 bases): 5 'GAAAGAGAGGAGG and 5' CCTCCTCTCTTTCCCTTCTTTCTCTCCTCC (triplex TC, sample # 1);
5' CCTCCTCTCTTTC et 5' GAAAGAGAGGAGGCCTTGGAGGAGAGAAAG (GA triplexe, échantillon #2); 5' CCTCCTCTCTTTC et 5' GAAAGAGAGGAGGCCTTGGTGGTGTGTTTG (GT triplexe, échantillon #3).5 'CCTCCTCTCTTTC and 5' GAAAGAGAGGAGGCCTTGGAGGAGAGAAAG (GA triplex, sample # 2); 5 'CCTCCTCTCTTTC and 5' GAAAGAGAGGAGGCCTTGGTGGTGTGTTTG (triplex GT, sample # 3).
Le " duplexe " GA (échantillon #5) résulte de rautoappariement de l'oligonucléotide (5' GAGAGAGAGAGAGAGAGAGAGAGA). Le duplexe parallèle (échantillon #6) résulte de l'association de 5'AAAAAAAA TAATTTTAAATATT avec 5' I I I I I I I I I lATTAAAATTTATAA. 24 CTG (échantillon #7) mime 8 répétitions de trinucléotide: 5' CTGCTGCTGCTGCTGCTGCTGCTG. ds26 (échantillon #11) est un duplexe autocomplémentaire de 26 bases 5' CAATCGGATCGAATTCGATCCGATTG. 22CT (échantillon #13) est un oligonucléotide qui mime le brin riche en C des télomères humains: 5' CCCTAACCCTAACCCTAACCCT, tandis que 22AG (échantillon #14) est un oligonucléotide qui mime le brin riche en G des télomères humains: 5' AGGGTTAGGGTTAGGGTTAGGG. 24G20 (T2G20T2, sample #15) peut former un quadruplexe intermoléculaire 5'The GA "duplex" (sample # 5) results from auto-matching of the oligonucleotide (5 'GAGAGAGAGAGAGAGAGAGAGAGAGA). The parallel duplex (sample # 6) results from the association of 5'AAAAAAAA TAATTTTAAATATT with 5 'IIIIIIIII lATTAAAATTTATAA. 24 CTG (sample # 7) mimics 8 repetitions of trinucleotide: 5 'CTGCTGCTGCTGCTGCTGCTGCTG. ds26 (sample # 11) is an autocomplementary duplex of 26 bases 5 'CAATCGGATCGAATTCGATCCGATTG. 22CT (sample # 13) is an oligonucleotide which mimics the C-rich strand of human telomeres: 5 'CCCTAACCCTAACCCTAACCCT, while 22AG (sample # 14) is an oligonucleotide which mimics the G-rich strand of human telomeres: 5' AGGGTTAGGGTTAGGGTTAGGG. 24G20 (T 2 G 20 T 2 , sample # 15) can form a 5 'intermolecular quadruplex
(TTGGGGGGGGGGGGGGGGGGGGTT)4.(TTGGGGGGGGGGGGGGGGGGGGTT) 4 .
Table des Structures des acides nucléiques utilisés en dialyseTable of Structures of Nucleic Acids Used in Dialysis
Numéro Nom Type3 (longueur) Structure Tm (°C)Number Name Type 3 (length) Structure Tm (° C)
1 triplexe TC oligos (30+13) Triplexe 381 triplex TC oligos (30 + 13) Triplex 38
2 triplexe GA oligos (30+13) Triplexe 532 GA oligos triplex (30 + 13) Triplex 53
3 GT triplex oligos (30+13) Triplexe 53 4 poly dA.2polydT poly Triplexe 713 GT triplex oligos (30 + 13) Triplex 53 4 poly dA.2polydT poly Triplex 71
5 duplexe GA oligo (24) " Duplexe "b 375 duplex GA oligo (24) "Duplex" b 37
6 duplexe parallèle oligos (30+30) " Duplexe "b 396 parallel duplex oligos (30 + 30) "Duplex" b 39
7 24CTG oligo (24) " Duplexe "b 647 24CTG oligo (24) "Duplex" b 64
8 poly d(A-T) poly Duplexe 668 poly d (A-T) poly Duplex 66
9 poly d(G-C) poly Duplexe >909 poly d (G-C) poly Duplex> 90
10 CT DNA poly Duplexe 8610 CT DNA poly Duplex 86
11 ds 26 oligo (26) Duplexe 7511 from 26 oligo (26) Duplex 75
12 poly dC poly i-DNA 5112 poly dC poly i-DNA 51
13 22CT oligo (22) ss/i-DNA 1313 22CT oligo (22) ss / i-DNA 13
14 22AG oligo (22) G4 6214 22AG oligo (22) G4 62
15 24G20 oligo (24) G4 >9015 24G20 oligo (24) G4> 90
16 poly dT poly simple-brin -16 poly dT poly single-strand -
17 poly dA poly simple-brin -17 poly dA poly single-strand -
18 poly rU poly simple-brin -18 poly rU poly single-strand -
19 poly rA poly simple-brin - a; poly = polynucleotide; oligo = oligonucléotide; oligos = structure formée par association de deux oligonucléotides différents. Les longueurs sont indiquées entre parenthèses. Les polynucleotides font plus de 100 bases de long. b: Ces duplexes impliquent la formation de paires de bases non canoniques.19 poly rA poly single-strand - a; poly = polynucleotide; oligo = oligonucleotide; oligos = structure formed by the association of two different oligonucleotides. The lengths are indicated in brackets. Polynucleotides are more than 100 bases long. b: These duplexes involve the formation of non-canonical base pairs.
L'activité antitélomérase des produits de l'invention, dépendant spécifiquement de la stabilisation de structure G-guadruplexe, mesurée par la concentration inhibitrice 50 % CI50 exprimée en μM, peut être évaluée selon le protocole ci-dessous :The antitelomerase activity of the products of the invention, which depends specifically on the stabilization of the G-guadruplex structure, measured by the inhibitory concentration 50% IC50 expressed in μM, can be evaluated according to the protocol below:
Préparation de l'extrait enrichi en activité télomérase humainePreparation of the extract enriched in human telomerase activity
La lignée de carcinome pulmonaire A549 est obtenue auprès de l'ATCC (American Type Culture Collection, Rockville USA). Les cellules sont cultivées en couche, en flacon de culture dans du milieu DMEM, additionné de glutamax à 2 mM, Pénicilline 200 U/ml streptomycine 200 μg/ml et de 10 % de sérum fœtal de veau inactivé par la chaleur. Les cellules en phase exponentielles de croissances sont trypsinées, lavées dans du PBS 1X et une aliquote de 106 cellules est centrifugée à 3000xG et le surnageant écarté. Le culot de cellules est resuspendu par plusieurs pipettages successifs dans 200 μl de tampon de lyse contenant CHAPS 0.5 %, Tris-HCI pH 7,5 10 mM, MgCI2 1mM, EGTA 1 mM, β-mercaptoéthanol 5 mM, PMSF 0.1 mM et glycérol 10 % et est conservé dans la glace pendant 30 minutes. Le lysat est centrifugé à 160000xG pendant 20 minutes à 4°C et 160 μl du surnageant est récupéré. Le dosage des protéines de l'extrait est effectué par la méthode de Bradford. L'extrait est conservé à -80°C.The pulmonary carcinoma line A549 is obtained from the ATCC (American Type Culture Collection, Rockville USA). The cells are cultured in a layer, in a culture flask in DMEM medium, supplemented with 2 mM glutamax, Penicillin 200 U / ml streptomycin 200 μg / ml and 10% fetal calf serum inactivated by heat. The cells in the exponential growth phase are trypsinized, washed in 1 × PBS and an aliquot of 10 6 cells is centrifuged at 3000 × G and the supernatant discarded. The cell pellet is resuspended by several successive pipetting in 200 μl of lysis buffer containing CHAPS 0.5%, Tris-HCl pH 7.5 10 mM, 1 mM MgCl 2 , 1 mM EGTA, 5 mM β-mercaptoethanol, 0.1 mM PMSF and 10% glycerol and is kept in ice for 30 minutes. The lysate is centrifuged at 160000xG for 20 minutes at 4 ° C and 160 μl of the supernatant is recovered. The determination of the proteins of the extract is carried out by the Bradford method. The extract is stored at -80 ° C.
Dosage de l'activité télomérase par l'essai TRAP-G4Determination of telomerase activity by the TRAP-G4 assay
L'inhibition de l'activité télomérase est déterminée par un protocole TRAP modifié qui permet de mesurer l'extension de la télomérase à partir d'un oligonucléotide TSG4 (5GGGATTGGGATTGGGATTGGGTT3) pouvant former une structure G-quadruplexe intramoleculaire, en présence d'un extrait cellulaire enrichi en activité télomérase et des composés qui sont ajoutés à différentes concentrations (30, 10, 1, 0.1 et 0,01 μM). La réaction d'extension est suivie d'une amplification PCR des produits d'extension à l'aide de l'oligonucléotide CXext (5GTGCCCTTACCCTTACCCTTACCCTAA3). La sélectivité de l'inhibition est mesurée par l'amplification d'un oligonucléotide contrôle TSNT (5ATTCCGTCGAGCAGAGTTAAAAGGCCGAGAAGCGAT3) par l'oligonucléotide TS (5'AATCGTTCGAGCAGAGTT3) et l'oligonucléotide NT (5ATCGCTTCTCGGCCTTTT3').The inhibition of telomerase activity is determined by a modified TRAP protocol which makes it possible to measure the extension of telomerase from an oligonucleotide TSG4 ( 5 GGGATTGGGATTGGGATTGGGTT 3 ) which can form an intramolecular G-quadruplex structure, in the presence of a cell extract enriched in telomerase activity and compounds which are added at different concentrations (30, 10, 1, 0.1 and 0.01 μM). The extension reaction is followed by PCR amplification of the extension products using the oligonucleotide CXext ( 5 GTGCCCTTACCCTTACCCTTACCCTAA 3 ). The selectivity of inhibition is measured by amplifying an oligonucleotide control TSNT (5 ATTCCGTCGAGCAGAGTTAAAAGGCCGAGAAGCGAT 3) by the TS oligonucleotide (5 'AATCGTTCGAGCAGAGTT 3) and oligonucleotide NT (5 ATCGCTTCTCGGCCTTTT 3').
Le milieu réactionnel est préparé dans un volume final de 50 μL selon la composition suivante :The reaction medium is prepared in a final volume of 50 μL according to the following composition:
Tris HCI pH 8,0 20 mMTris HCI pH 8.0 20 mM
MgCI2 1,5 mMMgCI2 1.5 mM
KCI 63 mMKCI 63 mM
Tween 20 0,005 % (P/V) EGTA 1 mM dATP 50 μM dGTP 50 μM dCTP 50 μM dTTP 50 μM Oligonucléotide TSG4 3,5 picomolesTween 20 0.005% (W / V) EGTA 1 mM dATP 50 μM dGTP 50 μM dCTP 50 μM dTTP 50 μM Oligonucleotide TSG4 3.5 picomoles
Oligonucléotide CXext 22,5 picomolesCXext 22.5 picomole oligonucleotide
Oligonucléotide TSNT 0,01 attomolesOligonucleotide TSNT 0.01 attomoles
Oligonucléotide NT 7.5 picomolesOligonucleotide NT 7.5 picomoles
Oligonucléotide TS 18 picomoles Sérum Albumine bovine 20 μg/ml Taq DNA polymérase 50 U/mlOligonucleotide TS 18 picomoles Serum Bovine albumin 20 μg / ml Taq DNA polymerase 50 U / ml
Extrait télomérase 100 ng sous un volume de 1 μl100 ng telomerase extract in a volume of 1 μl
Produit à tester ou solvant sous un volume de 5 μlTest product or solvent in a volume of 5 μl
Eau bi-distillée QS 50 μl Les oligonucléotides sont obtenus auprès d'Eurogentec Belgique) et sont conservés à -20°C à une concentration stock de 100 μM dans de l'eau distillée stérile sans ribonucléases et désoxyribonucléases.Bi-distilled water QS 50 μl The oligonucleotides are obtained from Eurogentec Belgium) and are stored at -20 ° C at a stock concentration of 100 μM in sterile distilled water without ribonucleases and deoxyribonucleases.
Les échantillons reactionnels sont assemblés dans la glace dans des tubes à PCR de 0.2 ml. Les échantillons reactionnels sont ensuite incubés dans un appareil à PCR de Eppendorf Mastercycler selon les conditions de températures suivantes : 15 minutes à 30°C, 1 minute à 90°C, suivis de 30 cycles de, 30 secondes à 92°C,The reaction samples are assembled in ice in 0.2 ml PCR tubes. The reaction samples are then incubated in an Eppendorf Mastercycler PCR apparatus under the following temperature conditions: 15 minutes at 30 ° C, 1 minute at 90 ° C, followed by 30 cycles of, 30 seconds at 92 ° C,
30 secondes à 52°C, 30 secondes à 72°C, suivis d'un cycle final de 2 minutes à 72°C.30 seconds at 52 ° C, 30 seconds at 72 ° C, followed by a 2 minute final cycle at 72 ° C.
Après l'amplification, 8μL d'un tampon de dépôt de la composition suivante, sont ajoutés aux échantillons :After amplification, 8 μL of a deposition buffer of the following composition are added to the samples:
TBE 5X sucrose 20 % (P/V)TBE 5X sucrose 20% (W / V)
Bleu de bromophénol 0.2 % Xylène cyanol 0.2 %0.2% bromophenol blue Xylene cyanol 0.2%
Les échantillons sont ensuite analysés par electrophorese en gel d'acrylamide/bisacrylamide (19 :1) à 12 % dans un tampon TBE 1X pendant 45 minutes sous une tension de 200 volts, à l'aide d'un système d'électrophorèse Novex.The samples are then analyzed by electrophoresis in 12% acrylamide / bisacrylamide gel (19: 1) in 1 × TBE buffer for 45 minutes at a voltage of 200 volts, using a Novex electrophoresis system.
Les gels sont colorés pendant 15 minutes dans une solution 1X de SYBR Green (Roche) et la fluorescence des produits de PCR est numérisée par une caméra digitale (Bioprint System).The gels are stained for 15 minutes in a 1 × solution of SYBR Green (Roche) and the fluorescence of the PCR products is digitized by a digital camera (Bioprint System).
La disparition de la bande formée par la dimérisation des oligonucléotides TSG4 et Cxext correspond à une stabilisation de la forme G-quadruplexe de l'oligonucléotide TSG4 et correspond à une inhibition de l'extension des répétitions télomériques à partir de l'oligonucléotide TSG4.The disappearance of the band formed by the dimerization of the oligonucleotides TSG4 and Cxext corresponds to a stabilization of the G-quadruplex form of the oligonucleotide TSG4 and corresponds to an inhibition of the extension of telomeric repeats from the oligonucleotide TSG4.
La disparition de la bande formée par l'amplification de l'oligonucléotide contrôle TSNT correspond à une inhibition non spécifique de l'activité de la Taq polymérase.The disappearance of the band formed by the amplification of the control oligonucleotide TSNT corresponds to a non-specific inhibition of the activity of Taq polymerase.
Pour chaque composé, les résultats sont exprimés par le calcul de la concentration (μM) inhibant 50% de la formation de la bande TSG4-Cxext (CI50 TRAP-G4) et par le calcul de la concentration inhibant 50% de la formation de la bande contrôle TSNT (CI50 Taq), par rapport à la valeur de l'échantillon enzymatique sans composé.For each compound, the results are expressed by calculating the concentration (μM) inhibiting 50% of the formation of the TSG4-Cxext band (CI50 TRAP-G4) and by calculating the concentration inhibiting 50% of the formation of the TSNT control band (CI50 Taq), relative to the value of the enzymatic sample without compound.
Le rapport CI50 Taq / CI50 TRAP-G4 indique le facteur de sélectivité de l'inhibition de l'extension de la télomérase par stabilisation de G-quadruplexe par rapport à l'inhibition de la Taq polymérase.The ratio CI50 Taq / CI50 TRAP-G4 indicates the selectivity factor for the inhibition of the extension of telomerase by stabilization of G-quadruplex compared to the inhibition of Taq polymerase.
On considère qu'un composé est actif en tant qu'agent antitélomérase stabilisant l'ADN G-quadruplexe lorsque la CI50 TRAP-G4 est notamment inférieure à 5 μM.It is considered that a compound is active as an antitelomerase agent stabilizing the G-quadruplex DNA when the IC50 TRAP-G4 is in particular less than 5 μM.
On considère que le composé est sélectif en tant qu'agent antitélomérase stabilisant le G-quadruplexe lorsque le rapport CI50 TRAP-G4/CI50 Taq est supérieur à 3.The compound is considered to be selective as an anti -lomerase agent stabilizing the G-quadruplex when the CI50 TRAP-G4 / CI50 Taq ratio is greater than 3.
Les exemples suivants et non limitatifs sont donnés pour illustrer l'inventionThe following nonlimiting examples are given to illustrate the invention
EXEMPLE 1 : Préparation du diodure de l'acide 2,6-pyridine-dicarboxylique- bis-[(1-méthyl-quinolinio-6-yl)amide]EXAMPLE 1 Preparation of the diodide of 2,6-pyridine-dicarboxylic acid-bis - [(1-methyl-quinolinio-6-yl) amide]
Etape 1 : Dans un tricol de 50 mL sous agitation magnétique, on dissous 1 g d'acide 2,6-pyridine-dicarboxylique et 1.81 g de 6-aminoquinoléine dans 30 mL de dichlorométhane et 5 mL de diméthylformamide (DMF), puis on ajoute 2,4 g de chlorhydrate de 1-(3-diméthylaminopropyl)-carbodiimide (EDCI) et 162 mg de 1-hydroxybenzotriazole (HOBT). Un précipité jaune transitoire se forme qui se redissout lentement. Après 1 à 2 heures d'agitation à température ambiante, un précipité blanc abondant apparaît. Après une nuit d'agitation à température ambiante, la réaction est terminée (contrôle par chromatographie liquide couplée à de la spectroscopie de masse LC/MS). Le précipité formé est essoré, lavé successivement par du dichlorométhane et de l'eau, puis séché sous pression réduite en présence d'anhydride phosphorique. On obtient ainsi 2,41 g d'acide 2,6-pyridine-dicarboxylique-bis- [(quinolin-6-yl)amide], sous forme d'une poudre blanche utilisée telle quelle à l'étape suivante.Step 1: In a 50 ml three-necked flask, with magnetic stirring, 1 g of 2,6-pyridine-dicarboxylic acid and 1.81 g of 6-aminoquinoline are dissolved in 30 ml of dichloromethane and 5 ml of dimethylformamide (DMF), then add 2.4 g of 1- (3-dimethylaminopropyl) -carbodiimide hydrochloride (EDCI) and 162 mg of 1-hydroxybenzotriazole (HOBT). A transient yellow precipitate forms which slowly redissolves. After 1 to 2 hours of stirring at room temperature, an abundant white precipitate appears. After stirring overnight at room temperature, the reaction is complete (control by liquid chromatography coupled with LC / MS mass spectroscopy). The precipitate formed is drained, washed successively with dichloromethane and water, then dried under reduced pressure in the presence of phosphoric anhydride. 2.41 g of 2,6-pyridine-dicarboxylic acid-bis- [(quinolin-6-yl) amide] are thus obtained, in the form of a white powder used as it is in the following step.
Etape 2 : Dans un ballon de 25 mL, on dissout 200 mg d'acide 2,6-pyridine- dicarboxylique-bis-[(quinolin-6-yl)amide], obtenu à l'étape précédente, dans 2 mL de méthanol, 4 mL de DMF et 10 mL d'iodométhane, puis on chauffe à 50° pendant 72 heures pendant lesquelles un précipité orange se forme progressivement. Après refroidissement, ce précipité est essoré et lavé au méthanol. Après recristallisation dans un mélange d'éthanol et de DMF (50/50 en volumes), on obtient 288 mg de diodure de l'acide 2,6-pyridine- dicarboxylique-bis-[(1-méthyl-quinolinio-6-yl)amide], sous forme de cristaux jaune-orangés, dont les caractéristiques sont les suivantes :Step 2: In a 25 mL flask, 200 mg of 2,6-pyridine-dicarboxylic acid-bis - [(quinolin-6-yl) amide], obtained in the previous step, are dissolved in 2 mL of methanol , 4 mL of DMF and 10 mL of iodomethane, then the mixture is heated to 50 ° for 72 hours during which an orange precipitate gradually forms. After cooling, this precipitate is drained and washed with methanol. After recrystallization from a mixture of ethanol and DMF (50/50 by volume), 288 mg of diodide of 2,6-pyridine-dicarboxylic acid-bis are obtained - [(1-methyl-quinolinio-6-yl ) amide], in the form of orange-yellow crystals, the characteristics of which are the following:
- Point de fusion (Kofler) > 260°C- Melting point (Kofler)> 260 ° C
- Spectre de RMN ^H (300 MHz, (CD3)2SO d6, δ en ppm) : 4,70 (s large : 6H) ; de 8,15 à 8,30 (mt : 2H) ; de 8,40 à 8,80 (mt : 7H) ; 9,25 (d, J = 2 Hz : 2H) ; 9,37 (d large, J = 8,5 Hz : 2H) ; 9,45 (d large, J = 5,5 Hz : 2H) ; 11 ,64 (s large : 2H).- 1 H NMR spectrum (300 MHz, (CD 3 ) 2 SO d6, δ in ppm): 4.70 (broad s: 6H); from 8.15 to 8.30 (mt: 2H); from 8.40 to 8.80 (mt: 7H); 9.25 (d, J = 2 Hz: 2H); 9.37 (broad d, J = 8.5 Hz: 2H); 9.45 (broad d, J = 5.5 Hz: 2H); 11.64 (broad s: 2H).
EXEMPLE 2 : Préparation du diodure de l'acide 2,6-pyridine-dicarboxylique-EXAMPLE 2 Preparation of the 2,6-pyridine-dicarboxylic acid diodide
2-[(1-méthyl-quinolinio-6-yl)amide]-6-[(4-diméthylamino-1-méthyl-quinaldinio-2 - [(1-methyl-quinolinio-6-yl) amide] -6 - [(4-dimethylamino-1-methyl-quinaldinio-
6-yl)amide].6-yl) -amide].
Etape 1 : Dans un tricol de 50 mL, on dissout, dans 35 mL de dichlorométhane, 1,3 g de monoester n.butylique de l'acide 2,6-pyridine- dicarboxylique, qui peut être obtenu selon Khim. Geterosikl. Soedin 1976(2), 233-7, et 1,17 g de 6-amino-4-diméthylamino-quinaldine, qui peut être obtenue selon WO 0140218, puis on ajoute 1,35 g d'EDCI et 90 mg d'HOBT. Après 2 à 3 heures, un précipité jaune apparaît ; l'agitation est maintenue pendant 36 heures à température ambiante, jusqu'à complétion de la réaction (LC/MS). Le milieu réactionnel est dilué à l'eau, la phase organique est décantée et la phase aqueuse est extraite au dichlorométhane. Les phases organiques jointes sont concentrées à sec sous pression réduite. Le résidu pâteux obtenu est repris sous agitation dans 20 mL d'oxyde de diisopropyle, pour former un solide beige clair qui est essoré et séché à l'air. On obtient ainsi 820 mg d'ester n.butylique de l'acide 2,6-pyridine-dicarboxylique-6-[(4- diméthylamino-quinaldin-6-yl)amide], utilisé tel quel à l'étape suivante. Step 1: In a 50 ml three-necked flask, 1.3 g of n-butyl monoester of 2,6-pyridine-dicarboxylic acid, which can be obtained according to Khim, are dissolved in 35 ml of dichloromethane. Geterosikl. Soedin 1976 (2), 233-7, and 1.17 g of 6-amino-4-dimethylamino-quinaldine, which can be obtained according to WO 0140218, then 1.35 g of EDCI and 90 mg of HOBT are added. . After 2 to 3 hours, a yellow precipitate appears; stirring is continued for 36 hours at room temperature, until the reaction is complete (LC / MS). The reaction medium is diluted with water, the organic phase is decanted and the aqueous phase is extracted with dichloromethane. The combined organic phases are concentrated to dryness under reduced pressure. The pasty residue obtained is taken up with stirring in 20 ml of diisopropyl ether, to form a light beige solid which is drained and air dried. 820 mg of n-butyl ester of 2,6-pyridine-dicarboxylic acid-6 - [(4-dimethylamino-quinaldin-6-yl) amide] are thus obtained, used as such in the following step.
Etape 2 : Dans un ballon de 50 mL, une solution de 820 mg d'ester n.butylique de l'acide 2,6-pyridine-dicarboxylique-6-[(4-diméthylamino- quinaldin-6-yl)amide], obtenu ci-dessus, dans 30 mL de n.butanol est agité 16 heures avec 2 mL d'une solution aqueuse 1M d'hydroxyde potassium. Après concentration sous pression réduite, le résidu est repris dans 10 mL d'eau et neutralisé à pH = 6 par addition d'une solution aqueuse 0.1 M d'acide chlorhydrique. Le précipité formé est essoré, lavé à l'eau et séché sous pression réduite à 60°C en présence d'anhydride phosphorique. On obtient ainsi 760 mg d'acide 2,6-pyridine-dicarboxylique-6-[(4-diméthylamino- quinaldin-6-yl)amide], sous forme d'un solide blanc utilisé tel quel à l'étape suivante.Step 2: In a 50 ml flask, a solution of 820 mg of n-butyl ester of 2,6-pyridine-dicarboxylic acid-6 - [(4-dimethylamino-quinaldin-6-yl) amide], obtained above, in 30 ml of n.butanol is stirred for 16 hours with 2 ml of a 1M aqueous solution of potassium hydroxide. After concentration under reduced pressure, the residue is taken up in 10 ml of water and neutralized to pH = 6 by adding a 0.1 M aqueous solution of hydrochloric acid. The precipitate formed is drained, washed with water and dried under reduced pressure at 60 ° C in the presence of phosphoric anhydride. There is thus obtained 760 mg of 2,6-pyridine-dicarboxylic-6 - [(4-dimethylamino-quinaldin-6-yl) amide], in the form of a white solid used as such in the next step.
Etape 3 : Dans un ballon de 50 mL, on dissout 760 mg d'acide 2,6-pyridine- dicarboxylique-6-[(4-diméthylamino-quinaldin-6-yl)amide], obtenu ci-dessus, et 360 mg de 6-aminoquinoléine dans 15 mL de DMF, puis on ajoute 458 mg d'EDCI et 30 mg d'HOBT. Après 72 heures d'agitation à température ambiante, le solvant est éliminé sous pression réduite. Le résidu est repris à l'eau, et le précipité ainsi formé est lavé à l'eau puis par une solution saturée d'hydrogénocarbonate de sodium. Après séchage sous pression réduite en présence d'anhydride phosphorique, on obtient 852 mg d'acide 2,6-pyridine- dicarboxylique-2-[(quinolin-6-yl)amide]-6-[(4-diméthylamino-quinaldin-6-yl) amide], sous forme d'une poudre beige, utilisée telle quelle à l'étape suivante.Step 3: In a 50 mL flask, 760 mg of 2,6-pyridine-dicarboxylic acid-6 - [(4-dimethylamino-quinaldin-6-yl) amide], obtained above, and 360 mg are dissolved. of 6-aminoquinoline in 15 ml of DMF, then 458 mg of EDCI and 30 mg of HOBT are added. After 72 hours of stirring at room temperature, the solvent is removed under reduced pressure. The residue is taken up in water, and the precipitate thus formed is washed with water and then with a saturated solution of sodium hydrogencarbonate. After drying under reduced pressure in the presence of phosphoric anhydride, 852 mg of 2,6-pyridine-dicarboxylic acid-2 - [(quinolin-6-yl) amide] -6 - [(4-dimethylamino-quinaldin- 6-yl) amide], in the form of a beige powder, used as it is in the next step.
Etape 4 : On opère comme à l'étape 2 de l'exemple 1 , mais à partir de 400 mg d'acide 2,6-pyridine-dicarboxylique-2-[(quinolin-6-yl)amide]-6-[(4- diméthylamino-quinaldin-6-yl)amide], obtenu ci-dessus dans 6 mL de méthanol et 15 mL d'iodométhane. On obtient alors après recristallisation dans l'éthanol, 382 mg de diodure de l'acide 2,6-pyridine-dicarboxylique-2- [(1-méthyl-quinolinio-6-yl)amide]-6-[(4-diméthylamino-1-méthyl-quinaldinio-6- yl)amide], sous forme d'un solide vert-pâle dont les caractéristiques sont les suivantes : - Point de fusion (Kofler) > 260°CStep 4: The procedure is as in step 2 of Example 1, but starting with 400 mg of 2,6-pyridine-dicarboxylic acid-2 - [(quinolin-6-yl) amide] -6- [ (4-dimethylamino-quinaldin-6-yl) amide], obtained above in 6 ml of methanol and 15 ml of iodomethane. After recrystallization from ethanol, 382 mg of diodide of 2,6-pyridine-dicarboxylic acid-2- [(1-methyl-quinolinio-6-yl) amide] -6 - [(4-dimethylamino) are then obtained. -1-methyl-quinaldinio-6-yl) amide], in the form of a pale green solid whose characteristics are the following: - Melting point (Kofler)> 260 ° C
- Spectre de RMN 1 H (300 MHz, (CD3)2SO d6, δ en ppm) : 2,85 (s large : 3H) ; 3,56 (s : 6H) ; 4,11 (s large : 3H) ; 4,71 (s large : 3H) ; 7,12 (s large : 1H) ; 8,20 (dd large, J = 8,5 et 5,5 Hz : 1 H) ; de 8,30 à 8,80 (mt : 7H) ; 9,03 et 9,05 (2 s larges : 2H en totalité) ; 9,36 (d large, J = 8,5 Hz: 1H) ; 9,45 (d large, J = 5,5 Hz : 1 H) ; 11 ,50 (s large : 1 H) ;11 ,64 (s large : 1 H).- 1 H NMR spectrum (300 MHz, (CD 3 ) 2 SO d6, δ in ppm): 2.85 (broad s: 3H); 3.56 (s: 6H); 4.11 (broad s: 3H); 4.71 (br s: 3H); 7.12 (br s: 1H); 8.20 (broad dd, J = 8.5 and 5.5 Hz: 1 H); from 8.30 to 8.80 (mt: 7H); 9.03 and 9.05 (2 s wide: 2H in total); 9.36 (broad d, J = 8.5 Hz: 1H); 9.45 (broad d, J = 5.5 Hz: 1 H); 11.50 (wide s: 1 H); 11.64 (wide s: 1 H).
EXEMPLE 3 : Préparation du diodure de l'acide 2,6-pyrazine-dicarboxylique- bis-[(1-méthyl-quinolinio-6-yl)amide]EXAMPLE 3 Preparation of the diodide of 2,6-pyrazine-dicarboxylic acid bis - [(1-methyl-quinolinio-6-yl) amide]
Etape 1 : On opère comme à l'étape 1 de l'exemple 1, mais à partir de 450 mg d'acide 2,6-pyrazine-dicarboxylique, qui peut être préparé selon J. Med. Chem. (1996), 29, 1452-57, de 450 mg de 6-aminoquinoléine, de 600 mg d'EDCI et de 40 mg d'HOBT dans 15 mL de dichlorométhane et 10 mL de DMF sous agitation pendant 1 nuit à température ambiante. Après purification par LC/MS préparative, on obtient 170 mg d'acide 2,6-pyrazine- dicarboxylique-bis-[(quinolin-6-yl)amide], sous forme d'une poudre blanche utilisée telle quelle à l'étape suivante.Step 1: The procedure is as in step 1 of Example 1, but starting with 450 mg of 2,6-pyrazine-dicarboxylic acid, which can be prepared according to J. Med. Chem. (1996), 29, 1452-57, 450 mg of 6-aminoquinoline, 600 mg of EDCI and 40 mg of HOBT in 15 ml of dichloromethane and 10 ml of DMF with stirring overnight at room temperature. After purification by preparative LC / MS, 170 mg of 2,6-pyrazine-dicarboxylic acid-bis - [(quinolin-6-yl) amide] are obtained, in the form of a white powder used as it is in step next.
Etape 2 : On opère comme à l'étape 2 de l'exemple 1 , mais à partir de 50 mg d'acide 2,6-pyrazine-dicarboxylique-bis-[(quinolin-6-yl)amide], obtenu ci-dessus dans 1 mL de DMF et 5 mL d'iodométhane. On obtient alors après recristallisation dans l'éthanol, 51 mg de diodure de l'acide 2,6-pyrazine- dicarboxylique-bis-[(1-méthyl-quinolinio-6-yl)amide], sous forme d'un solide jaune-pâle dont les caractéristiques sont les suivantes : - Point de fusion (Kofler) > 260°C - Spectre de RMN 1H (300 MHz, (CD3)2SO d6, δ en ppm) : 4,70 (s :Step 2: The procedure is as in step 2 of Example 1, but starting with 50 mg of 2,6-pyrazine-dicarboxylic acid-bis - [(quinolin-6-yl) amide], obtained here- above in 1 mL of DMF and 5 mL of iodomethane. Is then obtained after recrystallization from ethanol, 51 mg of diodide of 2,6-pyrazine-dicarboxylic acid-bis - [(1-methyl-quinolinio-6-yl) amide], in the form of a yellow solid -pale with the following characteristics: - Melting point (Kofler)> 260 ° C - 1 H NMR spectrum (300 MHz, (CD 3 ) 2 SO d6, δ in ppm): 4.70 (s:
6H) ; 8,22 (dd, J = 8,5 et 6 Hz : 2H) ; 8,70 (s : 4H) ; 9,21 (s large : 2H) ; 9,39 (d, J = 8,5 Hz : 2H) ; 9,46 (d, J = 6 Hz : 2H) ; 9,71 (s : 2H) ; 11,62 (s large : 2H).6H); 8.22 (dd, J = 8.5 and 6 Hz: 2H); 8.70 (s: 4H); 9.21 (broad s: 2H); 9.39 (d, J = 8.5 Hz: 2H); 9.46 (d, J = 6 Hz: 2H); 9.71 (s: 2H); 11.62 (broad s: 2H).
EXEMPLE 4 : Préparation du diodure de l'acide 1,3-benzène-dicarboxylique- bis-[(1 -méthyl-quinolinio-6-yl)amide] EXAMPLE 4 Preparation of the diodide of 1,3-benzene-dicarboxylic acid bis - [(1-methyl-quinolinio-6-yl) amide]
Etape 1 ; On opère comme à l'étape 1 de l'exemple 1 , mais à partir de 300 mg d'acide isophtalique, de 521 mg de 6-aminoquinoléine, de 727 mg d'EDCI et de 50 mg d'HOBT dans 10 mL de DMF sous agitation pendant 1 nuit à température ambiante. On obtient 593 mg d'acide 1,3-benzène- dicarboxylique-bis-[(quinolin-6-yl)amide], sous forme d'une poudre blanche, utilisée telle quelle à l'étape suivante.Step 1 ; The procedure is as in step 1 of Example 1, but starting with 300 mg of isophthalic acid, 521 mg of 6-aminoquinoline, 727 mg of EDCI and 50 mg of HOBT in 10 ml of DMF with stirring for 1 night at room temperature. 593 mg of 1,3-benzene-dicarboxylic acid-bis - [(quinolin-6-yl) amide] are obtained in the form of a white powder, used as it is in the following step.
Etape 2 ; On opère comme à l'étape 2 de l'exemple 1 , mais à partir de 100 mg d'acide 1,3-benzèné-dicarboxylique-bis-[(quinolin-6-yl)amide], obtenu ci-dessus dans 1 mL de DMF et 6 mL d'iodométhane. On obtient alors après recristallisation dans l'éthanol, 72 mg de diodure de l'acide 1,3-benzène- dicarboxylique-bis-[(1-méthyl-quinolinio-6-yl)amide], sous forme d'un solide jaune-pâle dont les caractéristiques sont les suivantes : - Point de fusion (Kofler) > 260°C - Spectre de RMN 1H (300 MHz, (CD3)2SO d6, δ en ppm) : 4,63 (s :2nd step ; The operation is carried out as in step 2 of Example 1, but starting with 100 mg of 1,3-benzene-dicarboxylic acid-bis - [(quinolin-6-yl) amide], obtained above in 1 mL of DMF and 6 mL of iodomethane. 72 mg of diodide of 1,3-benzene-dicarboxylic acid-bis - [(1-methyl-quinolinio-6-yl) amide] is then obtained, after recrystallization from ethanol, in the form of a yellow solid. -pale with the following characteristics: - Melting point (Kofler)> 260 ° C - 1 H NMR spectrum (300 MHz, (CD 3 ) 2 SO d6, δ in ppm): 4.63 (s:
6H) ; 7,77 (t, J = 7,5 Hz : 1H) ; 8,07 (dd, J = 8,5 et 6 Hz : 2H) ; 8,29 (d large, J = 7,5 Hz : 2H) ; 8,49 (mt : 4H) ; 8,84 (s large : 1H) ; 8,99 (s large : 2H) ; 9,16 (d, J = 8,5 Hz : 2H) ; 9,28 (d, J = 6 Hz : 2H).6H); 7.77 (t, J = 7.5 Hz: 1H); 8.07 (dd, J = 8.5 and 6 Hz: 2H); 8.29 (broad d, J = 7.5 Hz: 2H); 8.49 (mt: 4H); 8.84 (broad s: 1H); 8.99 (broad s: 2H); 9.16 (d, J = 8.5 Hz: 2H); 9.28 (d, J = 6 Hz: 2H).
EXEMPLE 5 : Préparation du diodure de l'acide 2,6-pyridine-dicarboxylique- bis-[(1 -méthyl-quinaldinio-6-yl)amide]EXAMPLE 5 Preparation of the diodide of 2,6-pyridine-dicarboxylic acid bis - [(1-methyl-quinaldinio-6-yl) amide]
Etape 1 : On opère comme à l'étape 1 de l'exemple 1 , mais à partir de 500 mg d'acide 2,6-pyridine-dicarboxylique, de 945 mg de 6-aminoquinaldine, qui peut être préparée selon EP 286277, de 1,2 g d'EDCI et de 100 mg d'HOBT dans 15 mL de dichlorométhane et 3 mL de DMF sous agitation pendant 24 heures à température ambiante. On obtient 1,47 g d'acide 2,6-pyridine-dicarboxylique-bis-[(quinaldin-6-yl)amide], sous forme d'une poudre blanche utilisée telle quelle à l'étape suivante. Etape 2 : On opère comme à l'étape 2 de l'exemple 1, mais à partir de 150 mg d'acide 2,6-pyridine-dicarboxylique-bis-[(quinaldin-6-yl)amide], obtenu ci-dessus dans 1,5 mL de DMF et 6 mL d'iodométhane. On obtient alors après recristallisation dans l'éthanol, 161 mg de diodure de l'acide 2,6-pyridine-dicarboxylique-bis-[(1-méthyl-quinaldinio-6-yl)amide], sous forme d'un solide jaune dont les caractéristiques sont les suivantes : - Point de fusion (Kofler) > 260°CStage 1: The procedure is carried out as in Stage 1 of Example 1, but starting with 500 mg of 2,6-pyridine-dicarboxylic acid, of 945 mg of 6-aminoquinaldin, which can be prepared according to EP 286277, 1.2 g of EDCI and 100 mg of HOBT in 15 mL of dichloromethane and 3 mL of DMF with stirring for 24 hours at room temperature. 1.47 g of 2,6-pyridine-dicarboxylic acid-bis - [(quinaldin-6-yl) amide] are obtained in the form of a white powder used as it is in the following step. Step 2: The procedure is carried out as in step 2 of Example 1, but starting with 150 mg of 2,6-pyridine-dicarboxylic acid-bis - [(quinaldin-6-yl) amide], obtained below. above in 1.5 mL of DMF and 6 mL of iodomethane. Is then obtained after recrystallization from ethanol, 161 mg of diodide of 2,6-pyridine-dicarboxylic acid-bis - [(1-methyl-quinaldinio-6-yl) amide], in the form of a yellow solid with the following characteristics: - Melting point (Kofler)> 260 ° C
EXEMPLE 6 : Préparation de l'iodure de l'acide 2,6-pyridine-dicarboxylique-2- [(1-méthyl-quinolinio-6-yl)amide]-6-[(4-amino-quinaldinio-6-yl)amide], isolé sous sa forme tautomère imino ci-dessous :EXAMPLE 6 Preparation of Iodide of 2,6-pyridine-dicarboxylic acid-2- [(1-methyl-quinolinio-6-yl) amide] -6 - [(4-amino-quinaldinio-6-yl ) amide], isolated in its imino tautomer form below:
Etape 1 : On opère comme à l'étape 1 de l'exemple 2, mais à partir de 500 mg de monoester n.butylique de l'acide 2,6-pyridine-dicarboxylique, de 388 mg de 4,6-diaminoquinaldine, qui peut être obtenue selon WO 0140218, de 472 mg d'EDCI et de 30 mg d'HOBT dans 10 mL de dichlorométhane et 5 mL de DMF pendant 20 heures à température ambiante. On obtient, après purification par flash-chromatographie sur alumine, en éluant par un mélange de dichlorométhane et de méthanol (95/5 en volumes), 450 mg d'ester n.butylique de l'acide 2,6-pyridine-dicarboxylique-6-[(4-amino-quinaldin-6- yl)amide], utilisé tel quel à l'étape suivante.Stage 1: The procedure is carried out as in Stage 1 of Example 2, but starting from 500 mg of n-butyl monoester of 2,6-pyridine-dicarboxylic acid, of 388 mg of 4,6-diaminoquinaldin, which can be obtained according to WO 0140218, from 472 mg of EDCI and 30 mg of HOBT in 10 ml of dichloromethane and 5 ml of DMF for 20 hours at room temperature. After purification by flash chromatography on alumina, 450 mg of n-butyl ester of 2,6-pyridine-dicarboxylic acid are obtained, eluting with a mixture of dichloromethane and methanol (95/5 by volume). 6 - [(4-amino-quinaldin-6-yl) amide], used as is in the next step.
Etape 2 ; On opère comme à l'étape 2 de l'exemple 2, mais à partir de 450 mg d'ester n.butylique de l'acide 2,6-pyridine-dicarboxylique-6-[(4-amino- quinaldin-6-yl)amide], obtenu ci-dessus, dans 20 mL et 1,19 mL d'une solution aqueuse 1M d'hydroxyde potassium. On obtient ainsi 243 mg d'acide 2,6-pyridine-dicarboxylique-6-[(4-amino-quinaldin-6-yl)amide], sous forme d'un solide beige utilisé tel quel à l'étape suivante.2nd step ; The procedure is as in step 2 of Example 2, but starting with 450 mg of n-butyl ester of 2,6-pyridine-dicarboxylic acid-6 - [(4-amino-quinaldin-6- yl) amide], obtained above, in 20 ml and 1.19 ml of a 1M aqueous solution of potassium hydroxide. 243 mg of 2,6-pyridine-dicarboxylic acid-6 - [(4-amino-quinaldin-6-yl) amide] are thus obtained in the form of a beige solid used as it is in the following step.
Etape 3 ; On opère comme à l'étape 3 de l'exemple 2, mais à partir de 93 mg d'acide 2,6-pyridine-dicarboxylique-6-[(4-amino-quinaldin-6-yl)amide], obtenu ci-dessus, de 41,6 mg de 6-aminoquinoléine, de 61 mg d'EDCI et de 14 mg d'HOBT dans 5 mL de dichlorométhane et 5 mL de DMF pendant 48 heures à température ambiante. On obtient ainsi 101 mg d'acide 2,6-pyridine- dicarboxylique-2-[(quinolin-6-yl)amide]-6-[(4-amino-quinaldin-6-yl)amide], sous forme d'une poudre beige, utilisée telle quelle à l'étape suivante.Step 3; The procedure is as in step 3 of Example 2, but starting from 93 mg of 2,6-pyridine-dicarboxylic acid-6 - [(4-amino-quinaldin-6-yl) amide], obtained here above, 41.6 mg of 6-aminoquinoline, 61 mg of EDCI and 14 mg of HOBT in 5 ml of dichloromethane and 5 ml of DMF for 48 hours at room temperature. 101 mg of 2,6-pyridine acid are thus obtained. dicarboxylic-2 - [(quinolin-6-yl) amide] -6 - [(4-amino-quinaldin-6-yl) amide], in the form of a beige powder, used as it is in the next step.
Etape 4 : On opère comme à l'étape 2 de l'exemple 1 , mais à partir de 65 mg d'acide 2,6-pyridine-dicarboxylique-2-[(quinolin-6-yl)amide]-6-[(4-amino- quinaldin-6-yl)-amide], obtenu ci-dessus, dans 1 mL de DMF et 5 mL d'iodométhane. On obtient alors après recristallisation dans l'éthanol, 58 mg d'iodure de l'acide 2,6-pyridine-dicarboxylique-2-[(1-méthyl-quinolinio-6- yl)amide]-6-[(4-amino-quinaldin-6-yl)amide], isolé sous sa forme tautomère imino, sous forme d'un solide jaune dont les caractéristiques sont les suivantes :Step 4: The procedure is as in step 2 of Example 1, but starting with 65 mg of 2,6-pyridine-dicarboxylic acid-2 - [(quinolin-6-yl) amide] -6- [ (4-amino-quinaldin-6-yl) -amide], obtained above, in 1 ml of DMF and 5 ml of iodomethane. After recrystallization from ethanol, 58 mg of 2,6-pyridine-dicarboxylic acid-2 - [(1-methyl-quinolinio-6-yl) amide] -6 - [(4- amino-quinaldin-6-yl) amide], isolated in its tautomeric imino form, in the form of a yellow solid whose characteristics are the following:
- Point de fusion (Kofler) > 260°C- Melting point (Kofler)> 260 ° C
- Spectre de RMN H (400 MHz, (CD3)2SO d6, à une température de 373K, δ en ppm) : 2,64 (s : 3H) ; 4,70 (s : 3H) ; 6,71 (s : 1H) ; 7,95 (d, J = 9 Hz : 1 H) ; 8,16 (dd large, J = 8,5 et 5,5 Hz : 1H) ; de 8,20 à 8,40 (mf étalé : 1 H) ; 8,29 (d, J = 8,5 Hz : 1 H) ; 8,43 (t, J = 7,5 Hz : 1 H) ; 8,53 (mt : 2H) ; 8,63 (d, J = 9,5 Hz : 1 H) ; 8,76 (d large, J = 9,5 Hz : 1 H) ; 8,86 (s large : 1 H) ; 9,11 (s large : 1H) ; 9,30 (d, J = 8,5 Hz : 1H) ; 9,41 (d, J = 5,5 Hz : 1H) ; 11,18 (s large : 1 H) ; 11 ,44 (s large : 1 H) ; de 13,00 à 13,50 (mf étalé : 1 H).- H NMR spectrum (400 MHz, (CD 3 ) 2 SO d6, at a temperature of 373K, δ in ppm): 2.64 (s: 3H); 4.70 (s: 3H); 6.71 (s: 1H); 7.95 (d, J = 9 Hz: 1 H); 8.16 (broad dd, J = 8.5 and 5.5 Hz: 1H); from 8.20 to 8.40 (mf spread: 1 H); 8.29 (d, J = 8.5 Hz: 1H); 8.43 (t, J = 7.5 Hz: 1 H); 8.53 (mt: 2H); 8.63 (d, J = 9.5 Hz: 1H); 8.76 (broad d, J = 9.5 Hz: 1 H); 8.86 (broad s: 1 H); 9.11 (br s: 1H); 9.30 (d, J = 8.5 Hz: 1H); 9.41 (d, J = 5.5 Hz: 1H); 11.18 (br s: 1 H); 11.44 (broad s: 1 H); from 13.00 to 13.50 (spread mf: 1 H).
EXEMPLE 7 : Préparation du diodure de l'acide 2,6-benzène-dicarboxylique- bis-[(1 -méthyl-quinaldinio-6-yl)amide]EXAMPLE 7 Preparation of the diodide of 2,6-benzene-dicarboxylic acid bis - [(1-methyl-quinaldinio-6-yl) amide]
Etape 1 : On opère comme à l'étape 1 de l'exemple 1 , mais à partir de 100 mg d'acide isophtalique, de 190,5 mg de 6-aminoquinaldine, de 242 mg d'EDCI et de 20 mg d'HOBT dans 5 mL de DMF sous agitation pendant 20 heures à température ambiante. On obtient 265 mg d'acide 2,6-benzène- dicarboxylique-bis-[(quinaldin-6-yl)amide], sous forme d'une poudre beige utilisée telle quelle à l'étape suivante.Step 1: The operation is carried out as in step 1 of Example 1, but starting with 100 mg of isophthalic acid, 190.5 mg of 6-aminoquinaldin, 242 mg of EDCI and 20 mg of HOBT in 5 mL of DMF with stirring for 20 hours at room temperature. 265 mg of 2,6-benzene-dicarboxylic acid-bis - [(quinaldin-6-yl) amide] are obtained in the form of a beige powder used as it is in the following step.
Etape 2 : On opère comme à l'étape 2 de l'exemple 1 , mais à partir de 95 mg d'acide 2,6-benzène-dicarboxylique-bis-[(quinaldin-6-yl)amide], obtenu ci-dessus, dans 1 mL de DMF et 5 mL d'iodométhane. On obtient alors après recristallisation dans l'éthanol, 83 mg de diodure de l'acide 2,6-benzène- dicarboxylique-bis-[(1-méthyl-quinaldinio-6-yl)amide], sous forme d'un solide jaune dont les caractéristiques sont les suivantes :Step 2: The operation is carried out as in step 2 of Example 1, but starting from 95 mg of 2,6-benzene-dicarboxylic acid-bis - [(quinaldin-6-yl) amide], obtained below. above, in 1 mL of DMF and 5 mL of iodomethane. 83 mg of 2,6-benzene acid diodide are then obtained after recrystallization from ethanol. dicarboxylic-bis - [(1-methyl-quinaldinio-6-yl) amide], in the form of a yellow solid, the characteristics of which are the following:
- Point de fusion (Kofler) > 260°C- Melting point (Kofler)> 260 ° C
- Spectre de RMN 1H (300 MHz, (CD3)2SO d6, δ en ppm) : 3,08 (s : 6H) ; 4,47 (s : 6H) ; 7,86 (t, J = 8 Hz : 1H) ; 8,10 (d, J ≈ 8,5 Hz : 2H) ; 8,33 et- 1 H NMR spectrum (300 MHz, (CD 3 ) 2 SO d6, δ in ppm): 3.08 (s: 6H); 4.47 (s: 6H); 7.86 (t, J = 8 Hz: 1H); 8.10 (d, J ≈ 8.5 Hz: 2H); 8.33 and
8,34 (2d, J = 8 Hz : 2H en totalité) ; 8,48 (dd, J = 9,5 et 2,5 Hz : 2H) ; 8,66 (d, J = 9,5 Hz : 2H) ; 8,70 (s large : 1H) ; 8,96 (d, J = 2,5 Hz : 2H) ; 9,13 (d, J = 8,5 Hz : 2H) ; 11.13 (s large : 2H).8.34 (2d, J = 8 Hz: 2H in total); 8.48 (dd, J = 9.5 and 2.5 Hz: 2H); 8.66 (d, J = 9.5 Hz: 2H); 8.70 (br s: 1H); 8.96 (d, J = 2.5 Hz: 2H); 9.13 (d, J = 8.5 Hz: 2H); 11.13 (broad s: 2H).
EXEMPLE 8 : Préparation du diodure de l'acide 2,4-pyridine-dicarboxylique- bis-[(1-méthyl-quinolin-6-yl)amide]EXAMPLE 8 Preparation of the 2,4-pyridine-dicarboxylic acid bis - [(1-methyl-quinolin-6-yl) amide] diodide
Etape 1 : On opère comme à l'étape 1 de l'exemple 1 , mais à partir de 100 mg d'acide 2,4-pyridine-dicarboxylique, de 181 mg de 6-aminoquinaldine, de 241 mg d'EDCI et de 16 mg d'HOBT dans 5 mL de DMF sous agitation pendant 20 heures à température ambiante. On obtient 325 mg d'acide 2,4-pyridine-dicarboxylique-bis-[(quinolin-6-yl)amide], sous forme d'une poudre beige utilisée telle quelle à l'étape suivante.Step 1: The procedure is as in step 1 of Example 1, but starting with 100 mg of 2,4-pyridine-dicarboxylic acid, 181 mg of 6-aminoquinaldin, 241 mg of EDCI and 16 mg of HOBT in 5 mL of DMF with stirring for 20 hours at room temperature. 325 mg of 2,4-pyridine-dicarboxylic acid-bis - [(quinolin-6-yl) amide] are obtained in the form of a beige powder used as it is in the following step.
Etape 2 ; On opère comme à l'étape 2 de l'exemple 1 , mais à partir de 300 mg d'acide 2,4-pyridine-dicarboxylique-bis-[(quinolin-6-yl)amide], obtenu ci-dessus, dans 3 mL de DMF et 10 mL d'iodométhane. On obtient alors après recristallisation dans l'éthanol, 372 mg de diodure de l'acide 2,4-pyridine-dicarboxylique-bis-[(1 -méthyl-quinolin-6-yl)amide], sous forme d'un solide jaune dont les caractéristiques sont les suivantes : - Point de fusion (Kofler) > 260°C - Spectre de RMN 1 H (400 MHz, (CD3)2SO d6, à une température de2nd step ; The procedure is as in step 2 of Example 1, but starting with 300 mg of 2,4-pyridine-dicarboxylic acid-bis - [(quinolin-6-yl) amide], obtained above, in 3 mL of DMF and 10 mL of iodomethane. 372 mg of 2,4-pyridine-dicarboxylic acid-bis - [(1-methyl-quinolin-6-yl) amide] diodide are then obtained after recrystallization from ethanol, in the form of a yellow solid. the characteristics of which are as follows: - Melting point (Kofler)> 260 ° C. - 1 H NMR spectrum (400 MHz, (CD 3 ) 2 SO d6, at a temperature of
373 K, δ en ppm) : 4,61 (s : 3H) ; 4,68 (s : 3H) ; 7,93 (dd, J = 8,5 et 5,5 Hz : 1H) ; 8,11 (dd, J = 8,5 et 5,5 Hz : 1 H) ; 8,33 (mt : 2H) ; 8,43 (d large, J = 9,5 Hz : 1 H) ; 8,56 (d large, J = 9,5 Hz : 1H) ; 8,75 (dd large, J = 9,5 et 1,5 Hz : 1H) ; 8,79 (d, J = 1,5 Hz : 1H) ; 8,89 (s : 1H) ; 8,90 (mt : 1H) ; 8,99 (d large, J = 8,5 Hz : 1H) ; 9,10 (mt : 1H) ; 9,10 (s : 1H) ; 9,23 (d, J = 8,5 Hz : 1H) ; 9,35 (d, J = 5,5 Hz : 1H). EXEMPLE 9 : Préparation de l'iodure de l'acide 2,6-pyridine-dicarboxylique-2- [(1-méthyl-quinolinio-6-yl)amide]-6-[(1-méthyl-quinolinio-3-yl)amide],373 K, δ in ppm): 4.61 (s: 3H); 4.68 (s: 3H); 7.93 (dd, J = 8.5 and 5.5 Hz: 1H); 8.11 (dd, J = 8.5 and 5.5 Hz: 1 H); 8.33 (mt: 2H); 8.43 (broad d, J = 9.5 Hz: 1H); 8.56 (broad d, J = 9.5 Hz: 1H); 8.75 (broad dd, J = 9.5 and 1.5 Hz: 1H); 8.79 (d, J = 1.5 Hz: 1H); 8.89 (s: 1H); 8.90 (mt: 1H); 8.99 (broad d, J = 8.5 Hz: 1H); 9.10 (mt: 1H); 9.10 (s: 1H); 9.23 (d, J = 8.5 Hz: 1H); 9.35 (d, J = 5.5 Hz: 1H). EXAMPLE 9 Preparation of the iodide of 2,6-pyridine-dicarboxylic acid-2- [(1-methyl-quinolinio-6-yl) amide] -6 - [(1-methyl-quinolinio-3-yl )amide],
Etape 1 : Dans un tricol de 25 mL, on dissout 1 ,74 g d'acide 2,6-pyridine- dicarboxylique, 500 mg de 4-aminoquinoléine, 543 μL de chlorhydrate de N-(2-chloroéthyl)diisopropylamine (DIC) et 469 mg d'HOBT dans 15 mL de DMF. Dès la disparition en CCM (plaque de silice 60F254, éluant dichlorométhane/méthanol 90/10), le milieu réactionnel est déposé sur une cartouche de 5 g de résine sulfonique (40μM de modèle Varian Mega Bond Elut SCX). La fraction, éluée par une solution 0,1 M de méthanol ammoniacal, est concentrée sous pression réduite. Le résidu est repris par 5 mL de dichlorométhane, et le précipité formé est essoré puis lavé par une solution aqueuse 1M d'acide chlorhydrique. On obtient ainsi 510 mg d'acide 2,6-pyridine-dicarboxylique-2-[(quinolin-6-yl)amide], utilisé tel quel à l'étape suivante.Step 1: Dissolve 1.74 g of 2,6-pyridine-dicarboxylic acid, 500 mg of 4-aminoquinoline, 543 μL of N- (2-chloroethyl) diisopropylamine hydrochloride (DIC) in a 25 ml three-necked flask and 469 mg of HOBT in 15 mL of DMF. As soon as CCM disappears (silica plate 60F254, eluent dichloromethane / methanol 90/10), the reaction medium is deposited on a cartridge of 5 g of sulphonic resin (40 μM of Varian Mega Bond Elut SCX model). The fraction, eluted with a 0.1 M solution of ammoniacal methanol, is concentrated under reduced pressure. The residue is taken up in 5 ml of dichloromethane, and the precipitate formed is drained and then washed with a 1M aqueous solution of hydrochloric acid. 510 mg of 2,6-pyridine-dicarboxylic acid-2 - [(quinolin-6-yl) amide] are thus obtained, used as such in the following step.
Etape 2 : On opère comme à l'étape 3 de l'exemple 2, mais à partir de 150 mg d'acide 2,6-pyridine-dicarboxylique-2-[(quinolin-6-yl)amide], obtenu ci-dessus, de 74 mg de 3-aminoquinoléine, qui peut être préparée selon Tetrahedron. Lett. 2001, 42, 3251-54, de 109 mg d'EDCI et de 7 mg d'HOBT dans 5 mL de dichlorométhane et 5 mL de DMF pendant 48 heures à température ambiante. On obtient ainsi 180 mg d'acide 2,6-pyridine- dicarboxylique-2-[(quinolin-6-yl)amide]-6-[(quinolin-3-yl)amide], sous forme d'une poudre beige rosée, utilisée telle quelle à l'étape suivante.Step 2: The operation is carried out as in step 3 of Example 2, but starting with 150 mg of 2,6-pyridine-dicarboxylic-2 - [(quinolin-6-yl) amide], obtained below. above, 74 mg of 3-aminoquinoline, which can be prepared according to Tetrahedron. Lett. 2001, 42, 3251-54, 109 mg of EDCI and 7 mg of HOBT in 5 mL of dichloromethane and 5 mL of DMF for 48 hours at room temperature. 180 mg of 2,6-pyridine-dicarboxylic acid-2 - [(quinolin-6-yl) amide] -6 - [(quinolin-3-yl) amide] are thus obtained in the form of a pinkish beige powder. , used as is in the next step.
Etape 3 : On opère comme à l'étape 2 de l'exemple 1 , mais à partir de 150 mg d'acide 2,6-pyridine-dicarboxylique-2-[(quinolin-6-yl)amide]-6-Step 3: The procedure is as in step 2 of Example 1, but starting with 150 mg of 2,6-pyridine-dicarboxylic acid-2 - [(quinolin-6-yl) amide] -6-
[(quinolin-3-yl)-amide], obtenu ci-dessus, dans 1 mL de DMF et 5 mL d'iodométhane. On obtient alors après recristallisation dans l'éthanol, 162 mg d'iodure de l'acide 2,6-pyridine-dicarboxylique-2-[(1-méthyl-quinolinio-6-yl) amide]-6-[(1-méthyl-quinolin-3-yl)amide], sous forme d'un solide jaune dont les caractéristiques sont les suivantes :[(quinolin-3-yl) -amide], obtained above, in 1 ml of DMF and 5 ml of iodomethane. After recrystallization from ethanol, 162 mg of 2,6-pyridine-dicarboxylic acid-2 - [(1-methyl-quinolinio-6-yl) amide] -6 - [(1- methyl-quinolin-3-yl) amide], in the form of a yellow solid, the characteristics of which are the following:
- Point de fusion (Kofler) > 260°C - Spectre de RMN 1H (300 MHz, (CD3)2SO d6, δ en ppm) : 4,68 (s large : 3H) ; 4,78 (s large : 3H) ; 8,07 (t large, J = 7,5 Hz : 1 H) ; de 8,15 à 8,30 (mt : 1 H) ; 8,20 (dd, J = 8,5 et 5,5 Hz : 1 H) ; de 8,40 à 8,65 (mt : 5H) ; 8,65 (d large, J = 9,5 Hz : 1H) ; 8,75 (dd large, J = 9,5 et 2 Hz : 1 H) ; 9,22 (d large, J = 2 Hz : 1H) ; 9,35 (d large, J = 8,5 Hz : 1H) ; 9,43 (d large, J = 5,5 Hz : 1H) ; 9,64 (s large : 1H) ; 10,10 (mf : 1H) ;de 11,10 à 12,50 (mf étalé : 2H).- Melting point (Kofler)> 260 ° C - 1 H NMR spectrum (300 MHz, (CD 3 ) 2 SO d6, δ in ppm): 4.68 (broad s: 3H); 4.78 (br s: 3H); 8.07 (wide t, J = 7.5 Hz: 1 H); 8.15 to 8.30 (mt: 1 H); 8.20 (dd, J = 8.5 and 5.5 Hz: 1 H); from 8.40 to 8.65 (mt: 5H); 8.65 (broad d, J = 9.5 Hz: 1H); 8.75 (broad dd, J = 9.5 and 2 Hz: 1 H); 9.22 (broad d, J = 2 Hz: 1H); 9.35 (broad d, J = 8.5 Hz: 1H); 9.43 (broad d, J = 5.5 Hz: 1H); 9.64 (broad s: 1H); 10.10 (mf: 1H); from 11.10 to 12.50 (spread mf: 2H).
EXEMPLE 10 : Préparation de l'iodure de l'acide 2,6-pyridine-dicarboxylique- 2-[(1-méthyl-quinolinio-6-yl)amide]-6-[(1-méthyl-quinolinio-5-yl)amide]EXAMPLE 10 Preparation of 2,6-pyridine-dicarboxylic acid iodide 2 - [(1-methyl-quinolinio-6-yl) amide] -6 - [(1-methyl-quinolinio-5-yl )amide]
Etape 1 : On opère comme à l'étape 3 de l'exemple 2, mais à partir de 150 mg d'acide 2,6-pyridine-dicarboxylique-2-[(quinolin-6-yl)amide], obtenu à l'étape 1 de l'exemple 9, de 74 mg de 5-aminoquinoléine, de 109 mg d'EDCI et de 7 mg d'HOBT dans 5 mL de dichlorométhane et 5 mL de DMF pendant 48 heures à température ambiante. On obtient ainsi 201 mg d'acide 2,6-pyridine-dicarboxylique-2-[(quinolin-6-yl)amide]-6-[(quinolin-5-yl)amide], sous forme d'une poudre beige, utilisée telle quelle à l'étape suivante.Step 1: The operation is carried out as in step 3 of Example 2, but starting with 150 mg of 2,6-pyridine-dicarboxylic acid-2 - [(quinolin-6-yl) amide], obtained with 1 step 1 of Example 9, 74 mg of 5-aminoquinoline, 109 mg of EDCI and 7 mg of HOBT in 5 ml of dichloromethane and 5 ml of DMF for 48 hours at room temperature. This gives 201 mg of 2,6-pyridine-dicarboxylic acid-2 - [(quinolin-6-yl) amide] -6 - [(quinolin-5-yl) amide], in the form of a beige powder, used as is in the next step.
Etape 2 : On opère comme à l'étape 2 de l'exemple 1 , mais à partir de 180 mg d'acide 2,6-pyridine-dicarboxylique-2-[(quinolin-6-yl)amide]-6- [(quinolin-5-yl)-amide], obtenu ci-dessus, dans 1,5 mL de DMF et 5 mL d'iodométhane. On obtient alors après recristallisation dans l'éthanol, 203 mg d'iodure de l'acide 2,6-pyridine-dicarboxylique-2-[(1-méthyl-quinolinio-6- yl)amide]-6-[(1-méthyl-quinolin-5-yl)amide], sous forme d'un solide jaune dont les caractéristiques sont les suivantes : - Point de fusion (Kofler) > 260°C - Spectre de RMN 1 H (400 MHz, (CD3)2SO d6, à une température deStep 2: The procedure is as in step 2 of Example 1, but starting with 180 mg of 2,6-pyridine-dicarboxylic acid-2 - [(quinolin-6-yl) amide] -6- [ (quinolin-5-yl) -amide], obtained above, in 1.5 ml of DMF and 5 ml of iodomethane. After recrystallization from ethanol, 203 mg of iodide of 2,6-pyridine-dicarboxylic acid-2 - [(1-methyl-quinolinio-6-yl) amide] -6 - [(1- methyl-quinolin-5-yl) amide], in the form of a yellow solid, the characteristics of which are as follows: - Melting point (Kofler)> 260 ° C. - 1 H NMR spectrum (400 MHz, (CD 3 ) 2 SO d6, at a temperature of
373 K, δ en ppm) : 4,69 (s large : 6H) ; 8,08 (dd très large, J = 8,5 et 5 Hz : 1H) ; 8,14 (dd, J = 8,5 et 5 Hz : 1 H) ; 8,23 (mf : 1 H) ; de 8,30 à 8,45 (mt : 2H) ; 8,49 (mt : 2H) ; 8,54 (dd, J = 8 et 0,5 Hz : 1 H) ; 8,61 (d, J = 9,5 Hz : 1 H) ; 8,70 (dd, J = 9,5 et 2,5 Hz : 1 H) ; 9,07 (d, J = 2,5 Hz : 1H) ; 9,26 (d, J = 8,5 Hz : 1 H) ; 9,38 (d, J = 5 Hz : 1 H) ; 9,45 (d large, J ≈ 5 Hz : 1 H) ; 9,60 (d large, J = 8,5 Hz : 1 H). EXEMPLE 11 : Préparation du diodure de l'acide 2,6-pyridine-dicarboxylique- bis-[(1-méthyl-quinolinio-3-yl)amide]373 K, δ in ppm): 4.69 (broad s: 6H); 8.08 (very large dd, J = 8.5 and 5 Hz: 1H); 8.14 (dd, J = 8.5 and 5 Hz: 1 H); 8.23 (mf: 1H); from 8.30 to 8.45 (mt: 2H); 8.49 (mt: 2H); 8.54 (dd, J = 8 and 0.5 Hz: 1 H); 8.61 (d, J = 9.5 Hz: 1H); 8.70 (dd, J = 9.5 and 2.5 Hz: 1 H); 9.07 (d, J = 2.5 Hz: 1H); 9.26 (d, J = 8.5 Hz: 1H); 9.38 (d, J = 5 Hz: 1 H); 9.45 (broad d, J ≈ 5 Hz: 1 H); 9.60 (wide d, J = 8.5 Hz: 1 H). EXAMPLE 11 Preparation of the diodide of 2,6-pyridine-dicarboxylic acid bis - [(1-methyl-quinolinio-3-yl) amide]
Etape 1 : On opère comme à l'étape 1 de l'exemple 1 , mais à partir de 150 mg d'acide 2,6-pyridine-dicarboxylique, de 945 mg de 3-aminoquinoléine, qui peut être préparée selon Tetrahedron. Lett. 2001, 42, 3251-54, de 361 mg d'EDCI et de 24 mg d'HOBT dans 10 mL de DMF sous agitation pendant 18 heures à température ambiante. On obtient 495 mg d'acide 2,6-pyridine- dicarboxylique-bis-[(quinolin-3-yl)amide], sous forme d'une poudre blanche, utilisée telle quelle à l'étape suivante.Step 1: The operation is carried out as in step 1 of Example 1, but starting from 150 mg of 2,6-pyridine-dicarboxylic acid, from 945 mg of 3-aminoquinoline, which can be prepared according to Tetrahedron. Lett. 2001, 42, 3251-54, 361 mg of EDCI and 24 mg of HOBT in 10 mL of DMF with stirring for 18 hours at room temperature. 495 mg of 2,6-pyridine-dicarboxylic acid-bis - [(quinolin-3-yl) amide] are obtained in the form of a white powder, used as it is in the following step.
Etape 2 ; On opère comme à l'étape 2 de l'exemple 1, mais à partir de 200 mg d'acide 2,6-pyridine-dicarboxylique-bis-[(quinolin-3-yl)amide], obtenu ci-dessus dans 3 mL de DMF et 10 mL d'iodométhane. On obtient alors après recristallisation dans l'éthanol, 231 mg de diodure de l'acide 2,6-pyridine- dicarboxylique-bis-[(1-méthyl-quinolinio-3-yl)amide], sous forme d'un solide jaune dont les caractéristiques sont les suivantes :2nd step ; The procedure is as in step 2 of Example 1, but starting with 200 mg of 2,6-pyridine-dicarboxylic acid-bis - [(quinolin-3-yl) amide], obtained above in 3 mL of DMF and 10 mL of iodomethane. 231 mg of diodide of 2,6-pyridine-dicarboxylic acid-bis - [(1-methyl-quinolinio-3-yl) amide] is then obtained after recrystallization from ethanol, in the form of a yellow solid. with the following characteristics:
- Point de fusion (Kofler) > 260°C- Melting point (Kofler)> 260 ° C
- Spectre de RMN 1H (300 MHz, (CD3)2SO d6, δ en ppm) : 4,82 (s large : 6H) ; 8,12 (t large, J = 8 Hz : 2H) ; 8,27 (t large, J = 8 Hz : 2H) ; de 8,45 à 8,65 (mt : 7H) ; 9,68 (s large : 2H) ; 10,14 (s large : 2H) ; 11,93 (mf : 2H).- 1 H NMR spectrum (300 MHz, (CD 3 ) 2 SO d6, δ in ppm): 4.82 (broad s: 6H); 8.12 (wide t, J = 8 Hz: 2H); 8.27 (wide t, J = 8 Hz: 2H); 8.45 to 8.65 (mt: 7H); 9.68 (broad s: 2H); 10.14 (br s: 2H); 11.93 (mf: 2H).
EXEMPLE 12 : Préparation du diodure de l'acide 2,6-pyridine-dicarboxylique- 2-[(1 -méthyl-quinolinio-6-yl)amide]-6-[2(-1 -méthyl-pipéridinio-1 -yl)éthylamide]EXAMPLE 12 Preparation of the diodide of 2,6-pyridine-dicarboxylic acid-2 - [(1 -methyl-quinolinio-6-yl) amide] -6- [2 (-1 -methyl-piperidinio-1 -yl ) ethylamide]
Etape 1 : On opère comme à l'étape 3 de l'exemple 2, mais à partir de 140 mg d'acide 2,6-pyridine-dicarboxylique-2-[(quinolin-6-yl)amide], obtenu à l'étape 1 de l'exemple 9, de 73 μL de 1-(2-aminoéthyl)pipéridine, de 100 mg d'EDCI et de 7 mg d'HOBT dans 5 mL de dichlorométhane et 5 mL de DMF pendant 48 heures à température ambiante. On obtient ainsi, après purification par flash-chromatographie sur gel de silice, en éluant par un mélange de dichlorométhane et de méthanol (80/20 en volumes), 200 mg d'acide 2,6-pyridine-dicarboxylique-2-[(quinolin-6-yl)amide]-6-[2-(pipéridin-1- yl)éthylamide], sous forme d'une huile jaune, utilisée telle quelle à l'étape suivante. Step 1: The operation is carried out as in step 3 of Example 2, but starting from 140 mg of 2,6-pyridine-dicarboxylic-2 - [(quinolin-6-yl) amide], obtained with 1 step 1 of Example 9, 73 μL of 1- (2-aminoethyl) piperidine, 100 mg of EDCI and 7 mg of HOBT in 5 ml of dichloromethane and 5 ml of DMF for 48 hours at temperature room. We thus obtain, after purification by flash chromatography on silica gel, eluting with a mixture of dichloromethane and methanol (80/20 by volume), 200 mg of 2,6-pyridine-dicarboxylic-2 - [(quinolin-6-yl ) amide] -6- [2- (piperidin-1- yl) ethylamide], in the form of a yellow oil, used as it is in the next step.
Etape 2 : On opère comme à l'étape 2 de l'exemple 1, mais à partir de 200 mg d'acide 2,6-pyridine-dicarboxylique-2-[(quinolin-6-yl)amide]-6-[2- (pipéridin-l-yl)-éthylamide], obtenu ci-dessus, dans 2 mL de DMF et 6 mL d'iodométhane. On obtient alors après recristallisation dans l'éthanol, 73 mg d'iodure de l'acide 2,6-pyridine-dicarboxylique-2-[(1-méthyl-quinolinio-6- yl)amide]-6-[2-(1-méthyl-pipéridin-1-yl)éthylamide], sous forme d'un solide jaune dont les caractéristiques sont les suivantes - Point de fusion (Kofler) > 260°CStep 2: The procedure is as in step 2 of Example 1, but starting with 200 mg of 2,6-pyridine-dicarboxylic acid-2 - [(quinolin-6-yl) amide] -6- [ 2- (piperidin-1-yl) -ethylamide], obtained above, in 2 ml of DMF and 6 ml of iodomethane. After recrystallization from ethanol, 73 mg of 2,6-pyridine-dicarboxylic acid-2 - [(1-methyl-quinolinio-6-yl) amide] -6- [2- ( 1-methyl-piperidin-1-yl) ethylamide], in the form of a yellow solid, the characteristics of which are the following - Melting point (Kofler)> 260 ° C.
EXEMPLE 13 : Préparation de l'iodure de l'acide 2,6-pyridine-dicarboxylique- 2-[(1-méthyl-quinolinio-3-yl)amide]-6-[quinolin-3-yl)amide]EXAMPLE 13 Preparation of the iodide of 2,6-pyridine-dicarboxylic acid-2 - [(1-methyl-quinolinio-3-yl) amide] -6- [quinolin-3-yl) amide]
106 mg d'acide 2,6-pyridine-dicarboxylique-bis-[(quinolin-3-yl)amide], obtenus à l'étape 1 de l'exemple 11 , sont dissous dans 3 mL de DMF, on ajoute alors 36,6 mg d'iodure de méthyle puis on chauffe dans un tube scellé de 10 mL, pendant 5 heures à 80°. Après refroidissement, on ajoute 10 mL d'oxyde de diéthyle. Le précipité obtenu est essoré, lavé à l'oxyde de diéthyle, puis puis purifié par chromatographie LC/MS en utilisant une colonne de silice C18 Waters Xterra 3.5 μM, de diamètre 3 mm et de longueur 50 mm, en éluant par un gradient linéaire d'élution constitué au temps initial (tO = 0 mn) par de l'eau additionnée de 0,05 % de TFA et au temps final (tf = 4 mn) par de l'acétonitrile contenant 0,05 % de TFA. En recueillant la fraction éluée à 2,63 mn, on obtient 98 mg d'iodure de l'acide 2,6-pyridine-dicarboxylique-2- [(1-méthyl-quinolinio-3-yl)amide]-6-[quinolin-3-yl)amide], sous forme d'un solide jaune dont les caractéristiques sont les suivantes : - Point de fusion (Kofler) > 260°C106 mg of 2,6-pyridine-dicarboxylic acid-bis - [(quinolin-3-yl) amide], obtained in step 1 of Example 11, are dissolved in 3 ml of DMF, 36 are then added , 6 mg of methyl iodide and then heated in a sealed 10 ml tube for 5 hours at 80 °. After cooling, 10 ml of diethyl ether are added. The precipitate obtained is drained, washed with diethyl ether, then purified by LC / MS chromatography using a 3.5 μM Waters Xterra C18 silica column, 3 mm in diameter and 50 mm in length, eluting with a linear gradient. of elution constituted at the initial time (tO = 0 min) with water added with 0.05% TFA and at the final time (tf = 4 min) with acetonitrile containing 0.05% TFA. By collecting the fraction eluted at 2.63 min, 98 mg of iodide of 2,6-pyridine-dicarboxylic acid-2- [(1-methyl-quinolinio-3-yl) amide] -6- are obtained. quinolin-3-yl) amide], in the form of a yellow solid, the characteristics of which are the following: - Melting point (Kofler)> 260 ° C.
EXEMPLE 14 : Préparation du diodure de l'acide 2,6-pyridine-dicarboxylique- 2-[(1-méthyl-quinolinio-3-yl)amide]-6-[1-(2-hydroxyéthyl)quinolinio-3-yl)amide] EXAMPLE 14 Preparation of the 2,6-pyridine-dicarboxylic acid diodide 2 - [(1-methyl-quinolinio-3-yl) amide] -6- [1- (2-hydroxyethyl) quinolinio-3-yl )amide]
Dans un tricol de 25 mL, on met en suspension 112,3 mg d'iodure de l'acide 2,6-pyridine-dicarboxylique-2-[(1-méthyl-quinolinio-3-yl)amide]-6-[quinolin-3- yl)amide], obtenus comme à l'exemple 13, dans 5 mL d'acétonitrile, on ajoute 1 mL de 2-iodoéthanol, puis on chauffe au reflux pendant 72 heures. L'insoluble rouge obtenu est essoré, lavé à l'acétonitrile, puis par un mélange d'acétonitrile et d'éthanol (50-50 en volumes), puis purifié par chromatographie LC/MS en utilisant une colonne de silice C18 Waters Xterra 3.5 μM, de diamètre 3 mm et de longueur 50 mm, en éluant par un gradient linéaire d'élution constitué au temps initial (tO = 0 mn) par de l'eau additionnée de 0,05 % de TFA et au temps final (tf = 4 mn) par de l'acétonitrile contenant 0,05 % de TFA. En recueillant la fraction éluée à 2,20 mn, on obtient 30 mg de diodure de l'acide 2,6-pyridine-dicarboxylique- 2-[(1-méthyl-quinolinio-3-yl)amide]-6-[1-(2-hydroxyéthyl)quinolinio-3-yl) amide], sous forme d'un solide beige dont les caractéristiques sont les suivantes :112.3 mg of 2,6-pyridine-dicarboxylic acid-2 - [(1-methyl-quinolinio-3-yl) amide] -6- [ quinolin-3-yl) amide], obtained as in Example 13, in 5 ml of acetonitrile, 1 ml of 2-iodoethanol is added, then the mixture is heated at reflux for 72 hours. The insoluble red obtained is drained, washed with acetonitrile, then with a mixture of acetonitrile and ethanol (50-50 by volume), then purified by LC / MS chromatography using a column of C18 silica Waters Xterra 3.5 μM, with a diameter of 3 mm and a length of 50 mm, eluting with a linear elution gradient formed at the initial time (tO = 0 min) with water with 0.05% TFA added and at the final time (tf = 4 min) with acetonitrile containing 0.05% TFA. By collecting the fraction eluted at 2.20 min, 30 mg of diodide of 2,6-pyridine-dicarboxylic acid- 2 - [(1-methyl-quinolinio-3-yl) amide] -6- [1 - (2-hydroxyethyl) quinolinio-3-yl) amide], in the form of a beige solid, the characteristics of which are the following:
- Point de fusion (Kofler) > 260°C- Melting point (Kofler)> 260 ° C
Exemple 15 : Préparation du diodure de l'acide 4-bromo-2,6-pyridine- dicarboxylique-bis-[(1-méthyl-quinolinio-3-yl)amide]Example 15 Preparation of the 4-bromo-2,6-pyridine-dicarboxylic-bis - [(1-methyl-quinolinio-3-yl) amide] diodide
BrBr
^ OON rTΛNY oACifKOS r ' '^ OON rTΛ N Y oAC i fKOS r ''
Etape 1 : On opère comme à l'étape 1 de l'exemple 1 , mais à partir de 502 mg d'acide 4-bromo-2,6-pyridine-dicarboxylique, qui peut être préparé selon Tetrahedron lett. 2001, 42, 4849-51, et de 588 mg de 3-aminoquinoléine, qui peut être préparée selon Tetrahedron. Lett. 2001 , 42, 3251-54, de 821 mg d'EDCI et de 55 mg d'HOBT dans 23 mL de DMF sous agitation pendant 20 heures à température ambiante. On obtient 935 mg d'acide 4-bromo-2,6-pyridine-dicarboxylique-bis-[(quinolin-3-yl)amide], sous forme d'une poudre gris-vert, utilisée telle quelle à l'étape suivante. Etape 2 : On opère comme à l'étape 2 de l'exemple 1 , mais à partir de 300 mg d'acide 4-bromo-2,6-pyridine-dicarboxylique-bis-[(quinolin-3- yl)amide], obtenu ci-dessus dans 8 mL de DMF et 12,63 mL d'iodométhane. On obtient alors après recristallisation dans l'éthanol, 296 mg de diodure de l'acide 4-bromo-2,6-pyridine-dicarboxylique-bis-[(1 -méthyl-quinolinio-3-yl) amide], sous forme d'un solide jaune dont les caractéristiques sont les suivantes :Step 1: The procedure is as in step 1 of Example 1, but starting from 502 mg of 4-bromo-2,6-pyridine-dicarboxylic acid, which can be prepared according to Tetrahedron lett. 2001, 42, 4849-51, and 588 mg of 3-aminoquinoline, which can be prepared according to Tetrahedron. Lett. 2001, 42, 3251-54, 821 mg of EDCI and 55 mg of HOBT in 23 ml of DMF with stirring for 20 hours at room temperature. 935 mg of 4-bromo-2,6-pyridine-dicarboxylic acid-bis - [(quinolin-3-yl) amide] is obtained in the form of a gray-green powder, used as it is in the following step . Step 2: The procedure is as in step 2 of Example 1, but starting with 300 mg of 4-bromo-2,6-pyridine-dicarboxylic-bis - [(quinolin-3-yl) amide] acid] , obtained above in 8 mL of DMF and 12.63 mL of iodomethane. Then obtained after recrystallization from ethanol, 296 mg of diodide of 4-bromo-2,6-pyridine-dicarboxylic acid-bis - [(1-methyl-quinolinio-3-yl) amide], in the form d '' a yellow solid with the following characteristics:
- Point de fusion (Kofler) > 260°C- Melting point (Kofler)> 260 ° C
EXEMPLE 16 : COMPOSITION PHARMACEUTIQUE : On a préparé des comprimés répondant à la formule suivante:EXAMPLE 16 PHARMACEUTICAL COMPOSITION Tablets corresponding to the following formula were prepared:
Produit de l'exemple 1 .... 0,2 gProduct of Example 1 .... 0.2 g
Excipient pour un comprimé terminé à 1 gExcipient for one tablet finished at 1 g
(détail de l'excipient : lactose, talc, amidon, stéarate de magnésium).(detail of excipient: lactose, talc, starch, magnesium stearate).
EXEMPLE 17 : COMPOSITION PHARMACEUTIQUE :EXAMPLE 17 PHARMACEUTICAL COMPOSITION:
On a préparé des comprimés répondant à la formule suivante :Tablets corresponding to the following formula were prepared:
Produit de l'exemple 12 0,2 gProduct of Example 12 0.2 g
Excipient pour un comprimé terminé à 1 gExcipient for one tablet finished at 1 g
(détail de l'excipient : lactose, talc, amidon, stéarate de magnésium). (detail of excipient: lactose, talc, starch, magnesium stearate).

Claims

REVENDICATIONS
1 - Composés fixant la structure G-quadruplex d'ADN ou d'ARN caractérisés en ce qu'ils répondent à la formule générale (IB) suivante :1 - Compounds fixing the G-quadruplex structure of DNA or RNA characterized in that they correspond to the following general formula (IB):
cycle aromatique azoté possédant un atome d'azote sous forme quaternaire - (NR3)p - CO- répartiteur - (CO)m - (NR'3)q - X - cycle aromatique ou non aromatiquearomatic nitrogen cycle having a nitrogen atom in quaternary form - (NR 3 ) p - CO- distributor - (CO) m - (NR ' 3 ) q - X - aromatic or non-aromatic cycle
(IB)(IB)
avec m, p et q identiques ou différents représentent l'entier 0 ou 1 , dans laquelle « le cycle aromatique azoté possédant un atome quaternaire, représente :with m, p and q identical or different represent the integer 0 or 1, in which "the nitrogenous aromatic ring having a quaternary atom, represents:
0 une quinoléine éventuellement substituée par au moins0 a quinoline optionally substituted by at least
- un groupe N(Ra)(Rb) dans lequel Ra et Rb, identiques ou différents représentent l'hydrogène ou un radical alkyle en C1-C4 ouan N (Ra) (Rb) group in which Ra and Rb, which are identical or different, represent hydrogen or a C1-C4 alkyl radical or
- un groupe alkyle ou alkoxy à chaîne courte en C1- C4 ou- a C1-C4 short chain alkyl or alkoxy group or
0 et dont l'atome d'azote est quaternarisé par une chaîne alkyle en C1-C4, éventuellement substituée par un radical hydroxy, carboxy, alkoxy en C1-C4, alkylthio en C1-C4, amino, alkylamino en0 and whose nitrogen atom is quaternized by a C1-C4 alkyl chain, optionally substituted by a hydroxy, carboxy, C1-C4 alkoxy, C1-C4 alkylthio, amino, alkylamino radical
C1-C4, dialkylamino en C1-C4 pour chaque groupe alkyle, • le cycle aromatique ou non aromatique représenteC1-C4, C1-C4 dialkylamino for each alkyl group, • the aromatic or non-aromatic ring represents
0 une quinoléine éventuellement substituée par au moins0 a quinoline optionally substituted by at least
- un groupe N(Ra)(Rb) dans lequel Ra et Rb, identiques ou différents représentent l'hydrogène ou un radical alkyle en C1-C4 ouan N (Ra) (Rb) group in which Ra and Rb, which are identical or different, represent hydrogen or a C1-C4 alkyl radical or
- un groupe alkyle ou alkoxy à chaîne courte en C1-C4 ou- a C1-C4 short chain alkyl or alkoxy group or
0 une quinoléine possédant un atome d'azote sous forme quaternaire ou0 a quinoline having a nitrogen atom in quaternary form or
0 une benzamidine ou 0 une pyridine ou0 a benzamidine or 0 a pyridine or
0 un noyau phényle éventuellement substitué par un groupement halogène, alkoxy en C1-C4, cyano, carbonylamino éventuellement substitué par un ou plusieurs groupes alkyle en C1-C4, guanyl, alkylthio en C1-C4, amino, alkylamino en C1-C4, dialkylamino en C1- C4 pour chaque groupe alkyle, nitro, alkylèneamino en C1 -C4 ou alkénylèneamino en C2-C4 ou0 a phenyl ring optionally substituted by a halogen group, C1-C4 alkoxy, cyano, carbonylamino optionally substituted by one or more C1-C4 alkyl, guanyl, C1-C4 alkylthio, amino, C1-C4 alkylamino, C1-C4 dialkylamino for each alkyl, nitro, C1-C4 alkyleneamino or alkenyleneamino group C2-C4 or
0 un noyau heterocyclique aromatique ou non aromatique mono ou bi ou tricyclique comportant 0 à 2 hétéroatome par cycle à la condition qu'au moins un hétéroatome soit présent dans au moins un cycle éventuellement substitué par un ou plusieurs groupes alkyle en C1-C4 ou par des groupes alkylène en C1-C4 ou alkénylène en C2-C4, et dont l'hétéroatome, lorsqu'il représente un atome d'azote, peut être éventuellement sous forme quaternaire.0 a mono or bi or tricyclic aromatic or non-aromatic heterocyclic ring comprising 0 to 2 heteroatoms per cycle provided that at least one heteroatom is present in at least one ring optionally substituted by one or more C1-C4 alkyl groups or by C1-C4 alkylene or C2-C4 alkenylene groups, the heteroatom of which, when it represents a nitrogen atom, may optionally be in quaternary form.
• R3 et R'3, identiques ou différents, représentent indépendamment l'un de l'autre l'hydrogène ou un radical alkyle en C1-C4 ou aralkyle dont la partie alkyle est en C1-C4,R3 and R'3, identical or different, independently of one another represent hydrogen or a C1-C4 or aralkyl alkyl radical, the alkyl part of which is C1-C4,
• X représente une simple liaison, un radical alkyle en C1-C4, un radical alkényle en C2-C4, alkynyle en C2-C4 ou phényle,X represents a single bond, a C1-C4 alkyl radical, a C2-C4 alkenyl, C2-C4 alkynyl or phenyl radical,
• le répartiteur représente : 0 un radical heterocyclique renfermant 5 à 6 chaînons renfermant un atome de soufre, d'oxygène ou d'azote 0 un radical phényle, ou 0 un groupe diazine ou triazine, les radicaux hétérocycliques, phényle, diazine ou triazine étant éventuellement substitués par un ou plusieurs radicaux choisis parmi les atomes d'halogène, les radicaux alkyle ayant 1 à 4 atomes de carbone et les radicaux thio, oxy ou amino eux mêmes éventuellement substitués par une ou plusieurs chaînes alkyle à chaîne courte contenant 1 à 4 atomes de carbone, étant entendu que pour les produits de formule (IB) dans laquelle X représente une simple liaison, lorsque le répartiteur représente phényle éventuellement substitué par NH2, que m, p et q représentent 1 et R3 et R3' représentent hydrogène alors le cycle aromatique azoté et le cycle aromatique ne représentent pas tous deux une quinoléine non substituée ou substituée sur son atome d'azote par un radical alkyle renfermant 1 à 6 atomes de carbone, ou un de ses sels et lorsque le répartiteur représente une triazine et p et q représentent tous deux l'entier 1 alors m ne représente pas l'entier 0. lesdits produits de formule (IB) étant sous toutes les formes isomères possibles racemiques, enantiomeres et diastéréo-isomeres, ainsi que les sels d'addition avec les acides minéraux et organiques ou avec les bases minérales et organiques desdits produits de formule (IB).• the distributor represents: 0 a heterocyclic radical containing 5 to 6 links containing a sulfur, oxygen or nitrogen atom 0 a phenyl radical, or 0 a diazine or triazine group, the heterocyclic, phenyl, diazine or triazine radicals being optionally substituted by one or more radicals chosen from halogen atoms, alkyl radicals having 1 to 4 carbon atoms and thio, oxy or amino radicals themselves optionally substituted by one or more short-chain alkyl chains containing 1 to 4 carbon atoms, it being understood that for the products of formula (IB) in which X represents a single bond, when the distributor represents phenyl optionally substituted by NH2, that m, p and q represent 1 and R3 and R3 'represent hydrogen then the the nitrogen aromatic ring and the aromatic ring do not both represent an unsubstituted or substituted quinoline on its nitrogen atom by a radical al alkyl containing 1 to 6 carbon atoms, or a salt thereof and when the distributor represents a triazine and p and q both represent the whole 1 then m does not represent the whole 0. the said products of formula (IB) being in all the isomeric forms possible racemics, enantiomers and diastereoisomers, as well as addition salts with mineral and organic acids or with mineral and organic bases of the said products of formula (IB).
2 - Composés fixant la structure G-quadruplex des télomères caractérisés en ce qu'ils répondent à la formule générale telle que définie à la revendication 1.2 - Compounds fixing the G-quadruplex structure of telomeres characterized in that they correspond to the general formula as defined in claim 1.
3 - Composés comme ligands hautement spécifiques d'ADN en G-quadruplexe caractérisés en ce qu'ils répondent à la formule générale telle que définie à la revendication 1.3 - Compounds as highly specific ligands of G-quadruplex DNA characterized in that they correspond to the general formula as defined in claim 1.
4 - Composés selon l'une quelconque des revendications précédentes caractérisés en ce que les groupes hétérocycliques parmi lesquels le répartiteur peut être choisi sont les groupes thienyle et pyridyle.4 - Compounds according to any one of the preceding claims, characterized in that the heterocyclic groups from which the distributor can be chosen are thienyl and pyridyl groups.
5 - Composés selon les revendications 1 à 3 caractérisés en ce que le répartiteur est choisi parmi les groupes hétérocycliques, tels que par exemple pyridyle ou thienyle, un radical phényle, une diazine ou une triazine tels que définis à la revendication 1.5 - Compounds according to claims 1 to 3 characterized in that the distributor is chosen from heterocyclic groups, such as for example pyridyl or thienyl, a phenyl radical, a diazine or a triazine as defined in claim 1.
6 - Composés selon l'une quelconque des revendications précédentes caractérisés en ce que les groupes diazines sont des pyrazines.6 - Compounds according to any one of the preceding claims, characterized in that the diazine groups are pyrazines.
7 - Composés selon l'une quelconque des revendications précédentes caractérisés en ce que le répartiteur est méta-disubstitué par les groupements « cycle aromatique azoté possédant un atome d'azote sous forme quaternaire - (NR3)p - CO » et « (CO)m - (NR'3)q - cycle aromatique ou non aromatique » tels que définis à la revendication 1 et le répartiteur est de plus éventuellement substitué par un atome d'halogène.7 - Compounds according to any one of the preceding claims, characterized in that the distributor is meta-disubstituted by the groups "nitrogen aromatic ring having a nitrogen atom in quaternary form - (NR 3 ) p - CO" and "(CO ) m - (NR ' 3 ) q - aromatic or non-aromatic ring "as defined in claim 1 and the distributor is further optionally substituted by a halogen atom.
8 - Composés selon l'une quelconque des revendications précédentes caractérisés en ce que l'hétérocycle sous forme quaternaire est une quinoléine. 9 - Composés selon l'une quelconque des revendications précédentes caractérisés en ce que le répartiteur représente une pyridine-2,6-disubstituée ou une pyrazine-2-6-disubstituée par les groupements « cycle aromatique azoté possédant un atome d'azote quaternaire sous forme quaternaire -(NR3)p - CO » et « (CO)m - (NR'3)q - cycle aromatique ou non aromatique » et dont l'hétérocycle quaternarisé est un N-méthyl-quinolinium, et le répartiteur est de plus éventuellement substitué par un atome d'halogène.8 - Compounds according to any one of the preceding claims, characterized in that the heterocycle in quaternary form is a quinoline. 9 - Compounds according to any one of the preceding claims, characterized in that the distributor represents a pyridine-2,6-disubstituted or a pyrazine-2-6-disubstituted by the groups "aromatic nitrogen cycle having a quaternary nitrogen atom under quaternary form - (NR 3 ) p - CO "and" (CO) m - (NR ' 3 ) q - aromatic or non-aromatic ring "and in which the quaternized heterocycle is an N-methyl-quinolinium, and the distributor is more optionally substituted by a halogen atom.
10 - Composés selon l'une quelconque des revendications précédentes caractérisés en ce que p et q représentent l'entier 1.10 - Compounds according to any one of the preceding claims, characterized in that p and q represent the integer 1.
11 - Composés selon l'une quelconque des revendications précédentes caractérisés en ce que m, p et q représentent l'entier 1.11 - Compounds according to any one of the preceding claims, characterized in that m, p and q represent the integer 1.
12 - Composés selon la revendication 1 caractérisés en ce qu'ils répondent à la formule (la) ci-dessous :12 - Compounds according to Claim 1, characterized in that they correspond to the formula (la) below:
avec m, p et q identiques ou différents représentent l'entier 0 ou 1 • A représente: with m, p and q identical or different represent the integer 0 or 1 • A represents:
0 un radical heterocyclique renfermant 5 à 6 chaînons renfermant un atome de soufre, d'oxygène ou d'azote0 a heterocyclic radical containing 5 to 6 links containing a sulfur, oxygen or nitrogen atom
0 un radical phényle, ou0 a phenyl radical, or
0 un groupe diazine ou triazine, les radicaux hétérocycliques, phényle, diazine ou triazine étant éventuellement substitués par un ou plusieurs radicaux choisis parmi les atomes d'halogène, les radicaux alkyle ayant 1 à 4 atomes de carbone et les radicaux thio, oxy ou amino eux mêmes éventuellement substitués par une ou plusieurs chaînes alkyle à chaîne courte contenant 1 à 4 atomes de carbone,0 a diazine or triazine group, the heterocyclic, phenyl, diazine or triazine radicals being optionally substituted by one or more radicals chosen from halogen atoms, alkyl radicals having 1 to 4 carbon atoms and thio, oxy or amino radicals themselves optionally substituted by one or more short-chain alkyl chains containing 1 to 4 carbon atoms,
- Ari et Ar2 identiques ou différents représentent quand An et Ar2 sont identiques, ils représentent un cycle aromatique azoté possédant un atome quaternaire représenté par une quinoléine éventuellement substituée par au moins- Ari and Ar 2 identical or different represent when An and Ar 2 are identical, they represent a nitrogen aromatic cycle having a quaternary atom represented by a quinoline optionally substituted by at least
- un groupe N(Ra)(Rb) dans lequel Ra et Rb, identiques ou différents représentent l'hydrogène ou un radical alkyle en C1 -C4 ouan N (Ra) (Rb) group in which Ra and Rb, which are identical or different, represent hydrogen or a C1 -C4 alkyl radical or
- un groupe alkyle ou alkoxy à chaîne courte en C1- C4 ou- a C1-C4 short chain alkyl or alkoxy group or
0 et dont l'atome d'azote est quaternarisé par une chaîne alkyle en C1-C4, éventuellement substituée par un radical hydroxy, carboxy, alkoxy en C1-C4, alkylthio en C1-C4, amino, alkylamino en0 and whose nitrogen atom is quaternized by a C1-C4 alkyl chain, optionally substituted by a hydroxy, carboxy, C1-C4 alkoxy, C1-C4 alkylthio, amino, alkylamino radical
C1-C4, dialkylamino en C1-C4 pour chaque groupe alkyle, quand An et Ar2 sont différents An représente l'une des possibilités ci-dessus et Ar2 représenteC1-C4, C1-C4 dialkylamino for each alkyl group, when An and Ar 2 are different An represents one of the above possibilities and Ar 2 represents
* un noyau phényle éventuellement substitué par un groupement halogène, alkoxy en C1-C4, cyano, carbonylamino éventuellement substitué par un ou plusieurs groupes alkyle en C1-C4, guanyl, alkylthio en C1-C4, amino, alkylamino en C1-C4, dialkylamino en C1 -C4 pour chaque groupe alkyle, nitro, alkylèneamino en C1-C4 ou alkénylèneamino en C2-C4* a phenyl ring optionally substituted by a halogen group, C1-C4 alkoxy, cyano, carbonylamino optionally substituted by one or more C1-C4 alkyl groups, guanyl, C1-C4 alkylthio, amino, C1-C4 alkylamino, dialkylamino in C1 -C4 for each alkyl, nitro, C1-C4 alkyleneamino or C2-C4 alkenyleneamino
* une benzamidine * un noyau pyridyle* a benzamidine * a pyridyl ring
* un noyau heterocyclique aromatique ou non aromatique mono ou bi ou tricyclique comportant 0 à 2 hétéroatome par cycle à la condition qu'au moins un hétéroatome soit présent dans au moins un cycle éventuellement substitué par un ou plusieurs groupes alkyle en C1-C4 ou par des groupes alkylène en C1-C4 ou alkénylène en C2-C4,* a heterocyclic aromatic or non-aromatic mono or bi or tricyclic ring comprising 0 to 2 heteroatoms per cycle provided that at least one heteroatom is present in at least one cycle optionally substituted by one or more C1-C4 alkyl groups or by C1-C4 alkylene or C2-C4 alkenylene groups,
• R3 et R'3, identiques ou différents, représentent indépendamment l'un de l'autre l'hydrogène ou un radical alkyle en C1-C4 ou aralkyle dans lequel le radical alkyle est C1-C4,R3 and R'3, identical or different, independently of one another represent hydrogen or a C1-C4 or aralkyl alkyl radical in which the alkyl radical is C1-C4,
• X représente une simple liaison, un radical alkyle en C1-C4, un radical alkényle ou alkynyle en C2-C4 ou un radical phényle, lesdits produits de formule (la) étant sous toutes les formes isomères possibles racemiques, enantiomeres et diastéréo-isomeres, ainsi que les sels d'addition avec les acides minéraux et organiques ou avec les bases minérales et organiques desdits produits de formule (la). 13 - Produits de formule (la) telle que définie à la revendication 12 dans laquelle X représente un radical alkyle en C1-C4, les autres substituants des produits de formule (la) étant choisis parmi les valeurs indiquées à la revendication 12, lesdits produits de formule (la) étant sous toutes les formes isomères possibles racemiques, enantiomeres et diastéréo-isomeres, ainsi que les sels d'addition avec les acides minéraux et organiques ou avec les bases minérales et organiques desdits produits de formule (la).• X represents a single bond, a C1-C4 alkyl radical, a C2-C4 alkenyl or alkynyl radical or a phenyl radical, said products of formula (la) being in all the possible racemic, enantiomeric and diastereomeric isomeric forms , as well as the addition salts with mineral and organic acids or with mineral and organic bases of said products of formula (la). 13 - Products of formula (la) as defined in claim 12 in which X represents a C1-C4 alkyl radical, the other substituents of the products of formula (la) being chosen from the values indicated in claim 12, said products of formula (la) being in all the possible racemic, enantiomeric and diastereoisomeric isomeric forms, as well as the addition salts with mineral and organic acids or with mineral and organic bases of the said products of formula (la).
14 - Composés selon la revendication 12 caractérisés en ce que A est choisi parmi les groupes hétérocycliques, tels que par exemple pyridyle ou thienyle, un radical phényle, une diazine ou une triazine tels que définis à la revendication 1.14 - Compounds according to claim 12 characterized in that A is chosen from heterocyclic groups, such as for example pyridyl or thienyl, a phenyl radical, a diazine or a triazine as defined in claim 1.
15 - Composés selon l'une quelconque des revendications précédentes caractérisés en ce que les groupes diazines que peut représenter A sont des pyrazines.15 - Compounds according to any one of the preceding claims, characterized in that the diazine groups that A can represent are pyrazines.
16 - Composés selon l'une quelconque des revendications précédentes caractérisés en ce que A est méta-disubstitué par les groupements « cycle aromatique azoté possédant un atome d'azote sous forme quaternaire -(NR3)p - CO » et « (CO)m - (NR'3)q - cycle aromatique ou non aromatique » tels que définis à la revendication 1 et A est de plus éventuellement substitué par un atome d'halogène.16 - Compounds according to any one of the preceding claims, characterized in that A is meta-disubstituted by the groups "nitrogen aromatic ring having a nitrogen atom in quaternary form - (NR 3 ) p - CO" and "(CO) m - (NR ' 3 ) q - aromatic or non-aromatic ring "as defined in claim 1 and A is additionally optionally substituted by a halogen atom.
17 - Composés selon l'une quelconque des revendications précédentes caractérisés en ce que l'hétérocycle sous forme quaternaire est une quinoléine.17 - Compounds according to any one of the preceding claims, characterized in that the heterocycle in quaternary form is a quinoline.
18 - Composés selon l'une quelconque des revendications précédentes caractérisés en ce que A représente une pyridine-2,6-disubstituée ou une pyridazine-2-6- disubstituée par les groupements « cycle aromatique azoté possédant un atome d'azote quaternaire sous forme quaternaire - (NR3)p - CO » et « (CO)m - (NR'3)q - cycle aromatique ou non aromatique » et dont l'hétérocycle quaternarisé est un N-méthyl-quinolinium, et A est de plus éventuellement substitué par un atome d'halogène. 19 - Composés selon les revendications précédentes caractérisés en ce que m, p et q représentent l'entier 1.18 - Compounds according to any one of the preceding claims, characterized in that A represents a pyridine-2,6-disubstituted or a pyridazine-2-6- disubstituted by the groups "aromatic nitrogen cycle having a quaternary nitrogen atom in the form quaternary - (NR 3 ) p - CO "and" (CO) m - (NR ' 3 ) q - aromatic or non-aromatic ring "and whose quaternized heterocycle is an N-methyl-quinolinium, and A is optionally substituted by a halogen atom. 19 - Compounds according to the preceding claims, characterized in that m, p and q represent the integer 1.
20 - Composés selon l'une quelconque des revendications précédentes caractérisés en ce que p et q représentent l'entier 1.20 - Compounds according to any one of the preceding claims, characterized in that p and q represent the integer 1.
21 - Composés selon l'une quelconque des revendications précédentes caractérisés en ce que Ar2 représentent un groupe choisi parmi les groupes suivants : 4-amino- ou 4-méthylamino-, 4-diméthylamino- ou 4-alcoxy- quinolyl ou quinolinium dont le noyau quinolinium est éventuellement substitué par un ou deux groupe(s) méthyle.21 - Compounds according to any one of the preceding claims, characterized in that Ar 2 represents a group chosen from the following groups: 4-amino- or 4-methylamino-, 4-dimethylamino- or 4-alkoxy-quinolyl or quinolinium, the quinolinium nucleus is optionally substituted by one or two methyl group (s).
22 - Composés selon l'une quelconque des revendications précédentes caractérisés en ce que R3 et R3' représentent l'hydrogène.22 - Compounds according to any one of the preceding claims, characterized in that R3 and R3 'represent hydrogen.
23 - Composés de formule (I) choisis parmi :23 - Compounds of formula (I) chosen from:
- le diodure de l'acide 2,6-pyridine-dicarboxylique-bis-[(1-méthyl-quinolinio-6- yl)amide] - le diodure de l'acide 2,6-pyridine-dicarboxylique-2-[(1-méthyl-quinolinio-6- yl)amide]-6-[(4-diméthylamino-1-méthyl-quinaldinio-6-yl)amide].- the diodide of 2,6-pyridine-dicarboxylic-bis - [(1-methyl-quinolinio-6-yl) amide] - the diodide of 2,6-pyridine-dicarboxylic-2 - [( 1-methyl-quinolinio-6-yl) amide] -6 - [(4-dimethylamino-1-methyl-quinaldinio-6-yl) amide].
- le diodure de l'acide 2,6-pyrazine-dicarboxylique-bis-[(1-méthyl-quinolinio-6- yl)amide]- the diodide of 2,6-pyrazine-dicarboxylic acid-bis - [(1-methyl-quinolinio-6-yl) amide]
- le diodure de l'acide 1,3-benzène-dicarboxylique-bis-[(1-méthyl-quinolinio-6- yl)amide]- the diodide of 1,3-benzene-dicarboxylic-bis - [(1-methyl-quinolinio-6-yl) amide]
- le diodure de l'acide 2,6-pyridine-dicarboxylique-bis-[(1-méthyl-quinaldinio-6- yl)amide]- 2,6-pyridine-dicarboxylic acid-bis diodide - [(1-methyl-quinaldinio-6-yl) amide]
- l'iodure de l'acide 2,6-pyridine-dicarboxylique-2-[(1-méthyl-quinolinio-6- yl)amide]-6-[(4-amino-quinaldinio-6-yl)amide], isolé sous sa forme tautomère imino ci-dessous- 2,6-pyridine-dicarboxylic acid-2 iodide - [(1-methyl-quinolinio-6-yl) amide] -6 - [(4-amino-quinaldinio-6-yl) amide], isolated in its imino tautomer form below
- le diodure de l'acide 2,6-benzène-dicarboxylique-bis-[(1-méthyl-quinaldinio- 6-yl)amide]- the diodide of 2,6-benzene-dicarboxylic acid-bis - [(1-methyl-quinaldinio-6-yl) amide]
- le diodure de l'acide 2,4-pyridine-dicarboxylique-bis-[(1-méthyl-quinolin-6- yl)amide] - l'iodure de l'acide 2,6-pyridine-dicarboxylique-2-[(1-méthyl-quinolinio-6- yl)amide]-6-[(1-méthyl-quinolinio-3-yl)amide]- 2,4-pyridine-dicarboxylic acid-bis diodide - [(1-methyl-quinolin-6-yl) amide] - 2,6-pyridine-dicarboxylic acid-2- iodide (1-methyl-quinolinio-6-yl) amide] -6 - [(1-methyl-quinolinio-3-yl) amide]
- l'iodure de l'acide 2,6-pyridine-dicarboxylique-2-[(1-méthyl-quinolinio-6- yl)amide]-6-[(1-méthyl-quinolinio-5-yl)amide] - le diodure de l'acide 2,6-pyridine-dicarboxylique-bis-[(1-méthyl-quinolinio-3- yl)amide]- 2,6-pyridine-dicarboxylic acid-2 iodide - [(1-methyl-quinolinio-6-yl) amide] -6 - [(1-methyl-quinolinio-5-yl) amide] - the diodide of 2,6-pyridine-dicarboxylic-bis - [(1-methyl-quinolinio-3-yl) amide]
- le diodure de l'acide 2,6-pyridine-dicarboxylique-2-[(1-méthyl-quinolinio-6- yl)amide]-6-[2(-1-méthyl-pipéridinio-1-yl)éthylamide] - l'iodure de l'acide 2,6- pyridine-dicarboxylique-2-[(1-méthyl-quinolinio-3-yl)amide]-6-[quinolin-3- yl)amide]- 2,6-pyridine-dicarboxylic acid-2 diodide - [(1-methyl-quinolinio-6-yl) amide] -6- [2 (-1-methyl-piperidinio-1-yl) ethylamide] - 2,6-pyridine-dicarboxylic acid-2 iodide - [(1-methyl-quinolinio-3-yl) amide] -6- [quinolin-3-yl) amide]
- le diodure de l'acide 2,6-pyridine-dicarboxylique-2-[(1-méthyl-quinolinio-3- yl)amide]-6-[1-(2-hydroxyéthyl)quinolinio-3-yl)amide]- the diodide of 2,6-pyridine-dicarboxylic-2 - [(1-methyl-quinolinio-3-yl) amide] -6- [1- (2-hydroxyethyl) quinolinio-3-yl) amide]
- le diodure de l'acide 4-bromo-2,6-pyridine-dicarboxylique-bis-[(1-méthyl- quinolinio-3-yl)amide] ou les sels ou d'autres sels de ces composés, lesdits produits de formule (I) étant sous toutes les formes isomères possibles racemiques, enantiomeres et diastéréo-isomeres, ainsi que les sels d'addition avec les acides minéraux et organiques ou avec les bases minérales et organiques desdits produits de formule (I).- the diodide of 4-bromo-2,6-pyridine-dicarboxylic-bis - [(1-methyl-quinolinio-3-yl) amide] or the salts or other salts of these compounds, said products of formula (I) being in all the possible racemic, enantiomeric and diastereoisomeric isomeric forms, as well as the addition salts with mineral and organic acids or with mineral and organic bases of the said products of formula (I).
24 - Composés selon la revendication précédente choisis parmi :24 - Compounds according to the preceding claim chosen from:
- le diodure de l'acide 2,6-pyridine-dicarboxylique-bis-[(1-méthyl-quinolinio-6- yl)amide]- the diodide of 2,6-pyridine-dicarboxylic-bis - [(1-methyl-quinolinio-6-yl) amide]
- le diodure de l'acide 2,6-pyridine-dicarboxylique-2-[(1-méthyl-quinolinio-6- yl)amide]-6-[(4-diméthylamino-1-méthyl-quinaldinio-6-yl)amide].- the diodide of 2,6-pyridine-dicarboxylic acid-2 - [(1-methyl-quinolinio-6-yl) amide] -6 - [(4-dimethylamino-1-methyl-quinaldinio-6-yl) amide].
- le diodure de l'acide 2,6-pyrazine-dicarboxylique-bis-[(1-méthyl-quinolinio-6- yl)amide]- the diodide of 2,6-pyrazine-dicarboxylic acid-bis - [(1-methyl-quinolinio-6-yl) amide]
- le diodure de l'acide 1,3-benzène-dicarboxylique-bis-[(1-méthyl-quinolinio-6- yl)amide] - le diodure de l'acide 2,6-pyridine-dicarboxylique-bis-[(1-méthyl-quinaldinio-6- yl)amide]- the diodide of 1,3-benzene-dicarboxylic acid-bis - [(1-methyl-quinolinio-6-yl) amide] - the diodide of 2,6-pyridine-dicarboxylic acid-bis - [( 1-methyl-quinaldinio-6-yl) amide]
- l'iodure de l'acide 2,6-pyridine-dicarboxylique-2-[(1-méthyl-quinolinio-6- yl)amide]-6-[(4-amino-quinaldinio-6-yl)amide], isolé sous sa forme tautomère imino ci-dessous - le diodure de l'acide 2,6-benzène-dicarboxylique-bis-[(1-méthyl-quinaldinio- 6-yl)amide]- 2,6-pyridine-dicarboxylic acid-2 iodide - [(1-methyl-quinolinio-6-yl) amide] -6 - [(4-amino-quinaldinio-6-yl) amide], isolated in its imino tautomeric form below - 2,6-benzene-dicarboxylic acid-bis diodide - [(1-methyl-quinaldinio- 6-yl) amide]
- le diodure de l'acide 2,4-pyridine-dicarboxylique-bis-[(1-méthyl-quinolin-6- yl)amide] - l'iodure de l'acide 2,6-pyridine-dicarboxylique-2-[(1-méthyl-quinolinio-6- yl)amide]-6-[(1-méthyl-quinolinio-3-yl)amide]- 2,4-pyridine-dicarboxylic acid-bis diodide - [(1-methyl-quinolin-6-yl) amide] - 2,6-pyridine-dicarboxylic acid-2 iodide - [(1-methyl-quinolinio-6-yl) amide] -6 - [(1-methyl-quinolinio-3-yl) amide]
- l'iodure de l'acide 2,6-pyridine-dicarboxylique-2-[(1-méthyl-quinolinio-6- yl)amide]-6-[(1-méthyl-quinolinio-5-yl)amide] - le diodure de l'acide 2,6-pyridine-dicarboxylique-bis-[(1-méthyl-quinolinio-3- yl)amide] - l'iodure de l'acide 2,6-pyridine-dicarboxylique-2-[(1-méthyl- quinolinio-3-yl)amide]-6-[quinolin-3-yl)amide]- 2,6-pyridine-dicarboxylic acid-2 iodide - [(1-methyl-quinolinio-6-yl) amide] -6 - [(1-methyl-quinolinio-5-yl) amide] - 2,6-pyridine-dicarboxylic acid-bis diodide - [(1-methyl-quinolinio-3-yl) amide] - 2,6-pyridine-dicarboxylic acid-2 iodide - [( 1-methyl-quinolinio-3-yl) amide] -6- [quinolin-3-yl) amide]
- le diodure de l'acide 2,6-pyridine-dicarboxylique-2-[(1-méthyl-quinolinio-3- yl)amide]-6-[1-(2-hydroxyéthyl)quinolinio-3-yl)amide] - le diodure de l'acide 4-bromo-2,6-pyridine-dicarboxylique-bis-[(1-méthyl- quinolinio-3-yl)amide] ou les sels ou d'autres sels de ces composés lesdits produits de formule (I) étant sous toutes les formes isomères possibles racemiques, enantiomeres et diastéréo-isomeres, ainsi que les sels d'addition avec les acides minéraux et organiques ou avec les bases minérales et organiques desdits produits de formule (I).- 2,6-pyridine-dicarboxylic acid-2 diodide - [(1-methyl-quinolinio-3-yl) amide] -6- [1- (2-hydroxyethyl) quinolinio-3-yl) amide] - the diodide of 4-bromo-2,6-pyridine-dicarboxylic-bis - [(1-methyl-quinolinio-3-yl) amide] or the salts or other salts of these compounds, the said products of formula (I) being in all the possible racemic, enantiomeric and diastereoisomeric isomeric forms, as well as the addition salts with mineral and organic acids or with mineral and organic bases of the said products of formula (I).
25 - Le diodure de l'acide 2,6-pyridine-dicarboxylique-2-[(1-méthyl-quinolinio- 6-yl)amide]-6-[2(-1 -méthyl-pipéridinio-1 -yl)éthylamide] ce produit de formule (I) étant sous toutes les formes isomères possibles racemiques, enantiomeres et diastéréo-isomeres, ainsi que les sels d'addition avec les acides minéraux et organiques ou avec les bases minérales et organiques25 - The diodide of 2,6-pyridine-dicarboxylic acid-2 - [(1-methyl-quinolinio-6-yl) amide] -6- [2 (-1 -methyl-piperidinio-1 -yl) ethylamide ] this product of formula (I) being in all the possible racemic, enantiomeric and diastereoisomeric isomeric forms, as well as the addition salts with mineral and organic acids or with mineral and organic bases
26 - Composés selon l'une quelconque des revendications précédentes caractérisés en ce qu'ils ont une activité inhibitrice des télomérases. 27 - Composés selon l'une quelconque des revendications précédentes caractérisés en ce qu'ils ont une activité anticancéreuse.26 - Compounds according to any one of the preceding claims, characterized in that they have a telomerase inhibiting activity. 27 - Compounds according to any one of the preceding claims, characterized in that they have an anticancer activity.
28 - A titre de médicaments, les produits de formule (IB) telle que définie aux revendications 1 à 27, ainsi que leurs prodrugs, lesdits produits de formule (IB) étant sous toutes les formes isomères possibles racemiques, enantiomeres et diastéréo-isomeres, ainsi que les sels d'addition avec les acides minéraux et organiques ou avec les bases minérales et organiques pharmaceutiquement acceptables desdits produits de formule (I).28 - As medicaments, the products of formula (IB) as defined in claims 1 to 27, as well as their prodrugs, said products of formula (IB) being in all the isomeric, racemic, enantiomeric and diastereoisomeric forms, as well as addition salts with mineral and organic acids or with pharmaceutically acceptable mineral and organic bases of the said products of formula (I).
29 - A titre de médicaments, les produits de formule (la) telle que définie aux revendications précédentes ainsi que leurs prodrugs, lesdits produits de formule (la) étant sous toutes les formes isomères possibles racemiques, enantiomeres et diastéréo-isomeres, ainsi que les sels d'addition avec les acides minéraux et organiques ou avec les bases minérales et organiques pharmaceutiquement acceptables desdits produits de formule (la).29 - As medicaments, the products of formula (la) as defined in previous claims as well as their prodrugs, said products of formula (la) being in all the possible racemic isomeric forms, enantiomers and diastereoisomers, as well as addition salts with mineral and organic acids or with mineral and organic bases pharmaceutically acceptable of said products of formula (la).
30 - A titre de médicaments, les produits telle que définie à l'une quelconque des revendications 23 à 25 ainsi que leurs prodrugs, ainsi que les sels d'addition avec les acides minéraux et organiques ou avec les bases minérales et organiques pharmaceutiquement acceptables de ces produits.30 - As medicaments, the products as defined in any one of claims 23 to 25 as well as their prodrugs, as well as the addition salts with mineral and organic acids or with pharmaceutically acceptable mineral and organic bases of these products.
31 - Les compositions pharmaceutiques contenant à titre de principe actif, l'un au moins des médicaments tels que définis aux revendications 28 à 30.31 - Pharmaceutical compositions containing, as active principle, at least one of the medicaments as defined in claims 28 to 30.
32 - Les compositions pharmaceutiques contenant à titre de principe actif, l'un au moins des médicaments tels que définis à la revendication 30.32 - Pharmaceutical compositions containing, as active principle, at least one of the medicaments as defined in claim 30.
33 - Compositions pharmaceutiques telles que définies aux revendications précédentes contenant en plus, des principes actifs d'autres médicaments de chimiothérapie contre le cancer.33 - Pharmaceutical compositions as defined in the preceding claims additionally containing active principles of other chemotherapy drugs against cancer.
34 - Compositions pharmaceutiques selon l'une quelconque des revendications précédentes caractérisées en ce qu'elles sont utilisées comme médicaments, en particulier pour la chimiothérapie de cancers.34 - Pharmaceutical compositions according to any one of the preceding claims, characterized in that they are used as medicaments, in particular for the chemotherapy of cancers.
35 - Utilisation des composés des 12 à 27 comme produit pharmaceutique à usage humain.35 - Use of the compounds of 12 to 27 as a pharmaceutical product for human use.
36 - Associations thérapeutiques constituées d'un composé selon la revendication 1 et d'un autre composé anticancéreux.36 - Therapeutic combinations consisting of a compound according to claim 1 and another anticancer compound.
37 - Associations selon la revendication 38 caractérisées en ce que le composé anticancéreux est choisi parmi les agents alkylants, les dérivés du platine, les agents antibiotiques, les agents antimicrotubules, les anthracyclines, les topoisomérases des groupes I et II, les fluoropyrimidines, les analogues de cytidine, les analogues d'adénosine, les enzymes et composés divers tels que la L-asparaginase, l'hydroxyuree, l'acide trans- rétinoique, la suramine, l'irinotecan, le topotecan, la dexrazoxane, l'amifostine, l'herceptin ainsi que les hormones oetrogéniques, androgéniques, les agents antivasculaires.37 - Associations according to claim 38 characterized in that the anticancer compound is chosen from alkylating agents, platinum derivatives, antibiotic agents, antimicrotubule agents, anthracyclines, topoisomerases of groups I and II, fluoropyrimidines, analogs cytidine, adenosine analogs, enzymes and various compounds such as L-asparaginase, hydroxyuree, trans-retinoic acid, suramin, irinotecan, topotecan, dexrazoxane, amifostine, herceptin as well as oetrogenic and androgenic hormones, anti-vascular agents.
38 - Association thérapeutique constituée d'un composé selon la revendication 1 et de radiations.38 - Therapeutic combination consisting of a compound according to claim 1 and radiation.
39 - Associations selon l'une quelconque des revendications 36 à 38 caractérisées en ce que chacun des composés ou des traitements est administré simultanément, séparément ou séquentiellement.39 - Associations according to any one of claims 36 to 38 characterized in that each of the compounds or treatments is administered simultaneously, separately or sequentially.
40 - Utilisation de produits de formule (IB) telle que définie à l'une quelconque des revendications précédentes ou de sels pharmaceutiquement acceptables desdits produits de formule (I) pour la préparation d'un médicament destiné à traiter des cancers, des maladies génétiques ou des maladies de pilosité.40 - Use of products of formula (IB) as defined in any one of the preceding claims or of pharmaceutically acceptable salts of said products of formula (I) for the preparation of a medicament intended to treat cancers, genetic diseases or hair diseases.
41 - Utilisation de produits de formule (IB) telle que définie à l'une quelconque des revendications précédentes ou de sels pharmaceutiquement acceptables desdits produits de formule (I) pour la préparation d'un médicament destiné à traiter des cancers.41 - Use of products of formula (IB) as defined in any one of the preceding claims or of pharmaceutically acceptable salts of said products of formula (I) for the preparation of a medicament intended for treating cancers.
42 - Utilisation de produits de formule (IB) telle que définie à l'une quelconque des revendications précédentes ou de sels pharmaceutiquement acceptables desdits produits de formule (IB) pour la préparation d'un médicament destiné à traiter des maladies génétiques telles que les syndromes de Bloom, de Werner, de Rothmund-Thomson ou d'ataxie télangiectaxie.42 - Use of products of formula (IB) as defined in any one of the preceding claims or of pharmaceutically acceptable salts of said products of formula (IB) for the preparation of a medicament intended to treat genetic diseases such as syndromes Bloom, Werner, Rothmund-Thomson or ataxia telangiectaxis.
43 - Utilisation de produits de formule (IB) telle que définie à l'une quelconque des revendications précédentes ou de sels pharmaceutiquement acceptables desdits produits de formule (IB) pour la préparation d'un médicament destiné à traiter les hyperpilosités.43 - Use of products of formula (IB) as defined in any one of the preceding claims or of pharmaceutically acceptable salts of said products of formula (IB) for the preparation of a medicament intended to treat hyperpilosities.
44 - Utilisation de produits de formule (IB) telle que définie à l'une quelconque des revendications précédentes ou de sels pharmaceutiquement acceptables desdits produits de formule (IB) pour la préparation d'un médicament destiné à traiter des cancers parmi lesquels les cancers du sein, de l'estomac, du colon, des poumons, des ovaires, de l'utérus, du cerveau, du rein, du larynx, du système lymphatique, de la thyroïde, du tractus uro-génital, du tractus incluant vésicule et prostate, du cancer des os, du pancréas, les mélanomes. 45 - Utilisation de produits de formule (IB) selon la revendication précédente dans laquelle la maladie à traiter est un cancer du sein, du colon ou des poumons.44 - Use of products of formula (IB) as defined in any one of the preceding claims or of pharmaceutically acceptable salts of said products of formula (IB) for the preparation of a medicament intended to treat cancers among which cancers of the breast, stomach, colon, lungs, ovaries, uterus, brain, kidney, larynx, lymphatic system, thyroid, urogenital tract, tract including vesicle and prostate , bone cancer, pancreas, melanomas. 45 - Use of products of formula (IB) according to the preceding claim in which the disease to be treated is breast, colon or lung cancer.
46 - Utilisation de produits de formule (IB) telle que définie à l'une quelconque des revendications précédentes ou de sels pharmaceutiquement acceptables desdits produits de formule (IB) pour la préparation d'un médicament destiné à la chimiothérapie de cancers.46 - Use of products of formula (IB) as defined in any one of the preceding claims or of pharmaceutically acceptable salts of said products of formula (IB) for the preparation of a medicament intended for the chemotherapy of cancers.
47 - Utilisation de produits de formule (IB) telle que définie à l'une quelconque des revendications précédentes ou de sels pharmaceutiquement acceptables desdits produits de formule (IB) pour la préparation de médicaments destinés à la chimiothérapie de cancers utilisés seuls ou en association.47 - Use of products of formula (IB) as defined in any one of the preceding claims or of pharmaceutically acceptable salts of said products of formula (IB) for the preparation of medicaments intended for the chemotherapy of cancers used alone or in combination.
48 - Utilisation de produits de formule (IB) telle que définie à l'une quelconque des revendications précédentes ou de sels pharmaceutiquement acceptables desdits produits de formule (IB) pour la préparation de médicaments destinés à être utilisés seuls ou en association avec chimiothérapie ou radiothérapie ou alternativement en association avec d'autres agents thérapeutiques.48 - Use of products of formula (IB) as defined in any one of the preceding claims or of pharmaceutically acceptable salts of said products of formula (IB) for the preparation of medicaments intended to be used alone or in combination with chemotherapy or radiotherapy or alternatively in combination with other therapeutic agents.
49 - Utilisation de produits de formule (IB) selon la revendication précédente dans laquelle les agents thérapeutiques peuvent être des agents antitumoraux utilisés communément. 49 - Use of products of formula (IB) according to the preceding claim in which the therapeutic agents can be commonly used antitumor agents.
EP04708378A 2003-02-07 2004-02-05 Chemical derivatives binding very specifically with g-quadruplex dna structures and use thereof as a specific anti-cancer agent Withdrawn EP1603898A2 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
FR0301478A FR2850970B1 (en) 2003-02-07 2003-02-07 CHEMICAL DERIVATIVES BINDING VERY SPECIFIC TO G-QUADRUPLEX DNA STRUCTURES AND THEIR APPLICATION AS A SPECIFIC ANTICANCER AGENT
FR0301478 2003-02-07
PCT/FR2004/000260 WO2004072027A2 (en) 2003-02-07 2004-02-05 Chemical derivatives binding very specifically with g-quadruplex dna structures and use thereof as a specific anti-cancer agent

Publications (1)

Publication Number Publication Date
EP1603898A2 true EP1603898A2 (en) 2005-12-14

Family

ID=32731875

Family Applications (1)

Application Number Title Priority Date Filing Date
EP04708378A Withdrawn EP1603898A2 (en) 2003-02-07 2004-02-05 Chemical derivatives binding very specifically with g-quadruplex dna structures and use thereof as a specific anti-cancer agent

Country Status (8)

Country Link
EP (1) EP1603898A2 (en)
JP (1) JP2006518726A (en)
AU (1) AU2004210753A1 (en)
BR (1) BRPI0407320A (en)
CA (1) CA2514105A1 (en)
FR (1) FR2850970B1 (en)
MX (1) MXPA05007648A (en)
WO (1) WO2004072027A2 (en)

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6887873B2 (en) 2001-03-23 2005-05-03 Aventis Pharma S.A. Triazine derivatives and their application as antitelomerase agents
US8293716B2 (en) 2005-05-26 2012-10-23 Ramot At Tel Aviv University Ltd. Method of treating cancer by modulation of mortalin
JP2010505750A (en) * 2006-09-14 2010-02-25 ラモット・アット・テル・アビブ・ユニバーシテイ・リミテッド Mixed therapy for tumor disease treatment
GB0706932D0 (en) * 2007-04-10 2007-05-16 Univ London Pharmacy Ureylene derivatives
WO2009040819A2 (en) 2007-09-25 2009-04-02 Ramot At Tel Aviv University Ltd. DOWN-REGULATION OF MORTALIN BY siRNA
WO2009144914A1 (en) 2008-05-27 2009-12-03 パナソニック株式会社 G-quadruplex detection method, g-quadruplex dna detection method, and telomerase activity measurement method
JP4510929B1 (en) 2009-04-09 2010-07-28 パナソニック株式会社 Telomerase reaction inhibition method and telomerase reaction inhibitor used therefor
CN108066341B (en) * 2016-11-10 2020-10-30 中国科学院化学研究所 Application of compound in preparation of anti-cancer drugs
CN108066340B (en) * 2016-11-10 2020-10-27 中国科学院化学研究所 Pharmaceutical composition
WO2018211148A1 (en) * 2017-05-19 2018-11-22 Universite De Bretagne Occidentale Bisquinolium derivatives for preventing or treating ebv-related cancers
CA3110311A1 (en) * 2018-08-24 2020-02-27 Biomedical Research Foundation Of The Academy Of Athens (Brfaa) 2,6-bis(((1 h-benzo[d]imidazol-2-yl)thio)methyl)pyridine and n2,n6-dibenzylpyridine-2,6-dicarboxamide derivatives and related compounds as phosphoinositide 3-kinase (pi3k) inhibitors for treating cancer

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
HUP0204429A2 (en) * 1999-11-29 2003-04-28 Aventis Pharma S.A. Arylamine derivatives and their use as anti-telomerase agent
FR2819255B1 (en) * 2001-01-09 2003-02-28 Aventis Pharma Sa CHEMICAL DERIVATIVES AND THEIR APPLICATION AS ANTITELOMERASE AGENT
FR2821355A1 (en) * 2001-02-23 2002-08-30 Aventis Pharma Sa CHEMICAL DERIVATIVES AND THEIR APPLICATION AS ANTITELOMERASE AGENT
CO5380035A1 (en) * 2001-03-23 2004-03-31 Aventis Pharma Sa CHEMICAL DERIVATIVES AND THEIR APPLICATION AS AN ANTITELOMERASA AGENT
AU2002314252A1 (en) * 2001-05-28 2002-12-09 Aventis Pharma S.A. Chemical derivatives and the use thereof as an anti-telomerase agent

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2004072027A2 *

Also Published As

Publication number Publication date
WO2004072027A3 (en) 2004-09-23
BRPI0407320A (en) 2006-02-21
MXPA05007648A (en) 2006-12-15
CA2514105A1 (en) 2004-08-26
AU2004210753A1 (en) 2004-08-26
FR2850970B1 (en) 2006-07-07
JP2006518726A (en) 2006-08-17
WO2004072027A2 (en) 2004-08-26
FR2850970A1 (en) 2004-08-13

Similar Documents

Publication Publication Date Title
EP1244650B1 (en) Arylamine derivatives and their use as anti-telomerase agent
Sissi et al. Tri-, tetra-and heptacyclic perylene analogues as new potential antineoplastic agents based on DNA telomerase inhibition
US20060199840A1 (en) Chemical derivatives and their application as antitelomerase agent
EP1603898A2 (en) Chemical derivatives binding very specifically with g-quadruplex dna structures and use thereof as a specific anti-cancer agent
WO2002076975A1 (en) Chemical derivatives and their use as anti-telomerase agent
US20030087931A1 (en) Chemical derivatives and their application as antitelomerease agent
US20070232572A1 (en) Chemical derivatives as antitelomerase agents which bind specifically to the G-quadruplex DNA structures and their application as a specific anticancer agent
WO2002012194A1 (en) Phenantridine derivatives and their use as anti-telomerase agent
Desai et al. Synthesis, characterization, molecular docking studies and biological activity ofcoumarin linked 2-pyridone heterocycles
EP1351957A1 (en) Chemical derivatives and their use as anti-telomerase agent
WO2002068408A1 (en) Chemical derivatives and the use thereof as an anti-elomerase agent
FR2825090A1 (en) New compounds as telomerase inhibitors that fix the G-quadruplex structure of DNA or RNA, useful in the treatment of cancers
FR2812634A1 (en) USE OF POLYCYCLIC AROMATIC COMPOUNDS FOR MANUFACTURING MEDICAMENTS CAPABLE OF INHIBITING TELOMERASE
FR2822468A1 (en) New arylamino-substituted triazine or diazine derivatives, used as telomerase inhibiting anticancer agents, by fixing the G-quadruplex structure of DNA or RNA
JP4629993B2 (en) Pyrazolone derivatives and telomerase inhibitors
FR2801588A1 (en) Diarylamino diazine and triazine derivatives are telomerase inhibitors and G-quadruplex stabilizers, useful in the treatment of cancers
Silva G-Quadruplex Ligands for Cancer Therapy
Sonyanaik et al. Green Construction of Aryl-1, 8-Naphthyridine-Thiazole Scaffolds and in Vitro-Antimicrobial Evaluation, Dna-Binding Interactions, Viscosity Measurements, Molecular Modeling Studies, and Adme Properties
EP3148997A1 (en) Helquats with heteroaromatic substituents, preparation thereof, and use thereof as g-quadruplex stabilizers

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20050907

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK

DAX Request for extension of the european patent (deleted)
RIN1 Information on inventor provided before grant (corrected)

Inventor name: BELMOKHTAR, CHAFKE

Inventor name: GOMEZ, DENNIS

Inventor name: RIOU, JEAN-FRANCOIS

Inventor name: GUITTAT, LIONEL

Inventor name: MERGNY, JEAN-LOUIS

Inventor name: MANDINE, ELIANE

Inventor name: BOUCHARD, HERVE

Inventor name: MAILLIET, PATRICK

Inventor name: CAULFIELD, THOMAS

Inventor name: HITTINGER, AUGUSTIN

17Q First examination report despatched

Effective date: 20070817

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Effective date: 20090317