FR2821355A1 - CHEMICAL DERIVATIVES AND THEIR APPLICATION AS ANTITELOMERASE AGENT - Google Patents
CHEMICAL DERIVATIVES AND THEIR APPLICATION AS ANTITELOMERASE AGENT Download PDFInfo
- Publication number
- FR2821355A1 FR2821355A1 FR0102461A FR0102461A FR2821355A1 FR 2821355 A1 FR2821355 A1 FR 2821355A1 FR 0102461 A FR0102461 A FR 0102461A FR 0102461 A FR0102461 A FR 0102461A FR 2821355 A1 FR2821355 A1 FR 2821355A1
- Authority
- FR
- France
- Prior art keywords
- group
- alkyl
- carbon atoms
- amino
- dialkylamino
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
- C07D401/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
- C07D401/12—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings linked by a chain containing hetero atoms as chain links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
Abstract
Description
<Desc/Clms Page number 1> <Desc / Clms Page number 1>
DERIVES CHIMIQUES ET LEUR APPLICATION COMME AGENT
ANTITELOMERASE
La présente invention est relative à la thérapie du cancer et concerne de nouveaux agents anticancéreux ayant un mécanisme d'action bien particulier. Elle concerne aussi de nouveaux composés chimiques ainsi que leur application thérapeutique chez l'homme. CHEMICAL DERIVATIVES AND THEIR APPLICATION AS AGENT
antitelomerase
The present invention relates to cancer therapy and relates to novel anticancer agents having a very particular mechanism of action. It also concerns new chemical compounds as well as their therapeutic application in humans.
La présente invention concerne l'utilisation de nouveaux composés chimiques non nucléotidiques qui interagissent avec des structures spécifiques de l'acide désoxyribonucléique (ADN) ou de l'acide ribonucléique (ARN). Ces nouveaux composés sont constitués d'un agent répartiteur lié à un groupe aminoaromatique. Ces nouveaux composés sont utiles dans le traitement des cancers et agissent en particulier en tant qu'agents inhibiteurs de la télomérase. Ils sont particulièrement utiles pour stabiliser l'ADN en structure G-quadruplexe (tétrades de guanines). L'application thérapeutique de l'inhibition de la télomérase via la stabilisation de ces G-quadruplexes est l'arrêt de la mitose cellulaire et la mort des cellules à division rapide telles que les cellules cancéreuses et éventuellement l'induction de la sénescence des cellules cancéreuses. The present invention relates to the use of novel non-nucleotide chemical compounds that interact with specific structures of deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). These new compounds consist of a distribution agent linked to an aminoaromatic group. These new compounds are useful in the treatment of cancers and act in particular as telomerase inhibiting agents. They are particularly useful for stabilizing DNA in G-quadruplex structure (guanine tetrads). The therapeutic application of telomerase inhibition via the stabilization of these G-quadruplexes is the arrest of cell mitosis and the death of rapidly dividing cells such as cancer cells and possibly the induction of cell senescence. cancerous.
Les composés de la présente invention présentent l'avantage du point de vue thérapeutique de bloquer la télomérase. Du point de vue biologique, la télomérase permet l'ajout de séquences d'ADN répétées du type T T A G G G, dites séquences télomériques, à l'extrémité du télomère, lors de la division cellulaire. Par cette action la télomérase rend la cellule immortelle. En effet, en l'absence de cette activité enzymatique, la cellule perd à chaque division 100 à 150 bases, ce qui la rend rapidement senescente. Lors de l'apparition de cellules cancéreuses à division rapide, il est apparu que ces cellules présentaient des télomères maintenus à une longueur stable au cours de la division cellulaire. Dans ces cellules cancéreuses il est apparu que la télomérase était fortement activée et qu'elle permettait l'addition de motifs répétés de séquences télomériques à la fin du télomère et permettait donc la conservation de la longueur du télomère dans les cellules cancéreuses. Il est apparu depuis quelques temps que plus de 85 % des cellules cancéreuses présentaient des tests positifs à la présence de télomérase alors que les cellules somatiques ne présentent pas cette caractéristique. The compounds of the present invention have the therapeutic advantage of blocking telomerase. From a biological point of view, telomerase allows the addition of T-GG G-type repeats of DNA sequences, called telomeric sequences, at the end of the telomere, during cell division. By this action telomerase makes the cell immortal. Indeed, in the absence of this enzymatic activity, the cell loses each division 100 to 150 bases, which makes it quickly senescente. During the appearance of rapidly dividing cancer cells, it appeared that these cells had telomeres maintained at a stable length during cell division. In these cancerous cells it was found that telomerase was highly activated and that it allowed the addition of repeated motifs of telomeric sequences at the end of the telomere and thus allowed the preservation of telomere length in cancer cells. It has been known for some time that more than 85% of cancer cells have tests positive for the presence of telomerase while somatic cells do not have this characteristic.
<Desc/Clms Page number 2> <Desc / Clms Page number 2>
Ainsi la télomérase est une cible très convoitée pour traiter les cellules cancéreuses. La première approche évidente pour bloquer la télomérase a été l'utilisation de structures nucléotidiques (Chen et al., Proc. Natl. Acad. Sei. USA 93 (7), 2635-2639). Parmi les composés non nucléotidiques qui ont été utilisées dans l'art antérieur on peut citer les diaminoanthraquinones (Sun et al. J. Med. Chem. Thus telomerase is a very coveted target for treating cancer cells. The first obvious approach to block telomerase has been the use of nucleotide structures (Chen et al., Proc Natl Acad Sci USA 93 (7), 2635-2639). Among the non-nucleotide compounds that have been used in the prior art are diaminoanthraquinones (Sun et al., J. Med Chem.
40 (14), 2113-6) ou les diethyloxadicarbocyanines (Wheelhouse R. T. Et al. J. Am. 40 (14), 2113-6) or diethyloxadicarbocyanines (Wheelhouse R.T. et al., J. Am.
Chem. Soc. 1998 (120) 3261-2). Chem. Soc. 1998 (120) 3261-2).
Le brevet WO 99/40087 décrit l'utilisation de composés qui interagissent avec les structures G-quadruplexes qui sont des composés pérylènes et des carbocyanines contenant au moins sept cycles dont deux hétérocycles. The patent WO 99/40087 describes the use of compounds which interact with G-quadruplex structures which are perylenes compounds and carbocyanines containing at least seven rings including two heterocycles.
Il est apparu de façon tout-à-fait surprenante que des structures simples permettaient d'obtenir un résultat au moins équivalent avec des structures beaucoup moins compliquées du point de vue chimique. Les composés de la présente invention qui répondent à l'objectif visé c'est-à-dire qui fixent la structure G-quadruplex d'ADN ou d'ARN et notamment la structure G-quadruplex des télomères par ce fait présentent une activité inhibitrice des télomérases et répondent à la formule générale suivante : cycle aromatique azoté-NR3- répartiteur-0-ou-S-chaîne hydrocarbonée non aromatique ou cycle aromatique azoté dans laquelle * le cycle aromatique azoté, représente : o une quinoléine éventuellement substituée par au moins un groupe N (Ra) (Rb) dans lequel Ra et Rb, identiques ou différents représentent l'hydrogène ou un radical alkyle en CI-C4 ou bien par un groupe ORa dans lequel Ra est défini comme précédemment o une quinoléine possédant un atome d'azote sous forme quaternaire ou o une benzamidine ou o une pyridine * le répartiteur représente : 0 un groupe triazine éventuellement substitué par un radical alkyle ayant 1 à 4 atomes de carbone, un radical thio, oxy ou amino It has become quite surprising that simple structures make it possible to obtain at least equivalent results with structures that are much less complicated from the chemical point of view. The compounds of the present invention which serve the intended purpose, that is to say which bind the G-quadruplex structure of DNA or RNA and in particular the G-quadruplex structure of the telomeres thereby have an inhibitory activity. telomerases and correspond to the following general formula: aromatic ring nitrogen-NR3-non-aromatic hydrocarbon-distribution-O-or-S-chain or nitrogenous aromatic cycle in which * the nitrogenous aromatic cycle, represents: o a quinoline optionally substituted by at least a group N (Ra) (Rb) in which Ra and Rb, which are identical or different, represent hydrogen or a C1-C4 alkyl radical or else a group ORa in which Ra is defined as above, a quinoline having a d nitrogen in the form of quaternary or benzamidine or a pyridine * the dispatcher represents: a triazine group optionally substituted with an alkyl radical having 1 to 4 carbon atoms, a radical t hio, oxy or amino
<Desc/Clms Page number 3><Desc / Clms Page number 3>
eux mêmes éventuellement substitués par une ou plusieurs chaines alkyle à chaine courte contenant 1 à 4 atomes de carbone ou encore un atome d'halogène ou 0 un groupe carbonyle ou 0 un groupe C (=NH)-NH-C (=NH) ou 0 un groupe alkylediyle contenant 3 à 7 atomes de carbone ou 0 un groupe diazine éventuellement substitué par les mêmes groupes que la triazine e R3 représente l'hydrogène ou un radical alkyle en C1-C4 ou un de ses sels. themselves optionally substituted by one or more short-chain alkyl chains containing 1 to 4 carbon atoms or alternatively a halogen atom or a carbonyl group or a C (= NH) -NH-C (= NH) group or An alkylediyl group containing 3 to 7 carbon atoms or a diazine group optionally substituted with the same groups as the triazine R 3 represents hydrogen or a C 1 -C 4 alkyl radical or a salt thereof.
On entend au sens de la formule ci-dessus par chaîne hydrocarbonée non aromatique une chaîne alkyle (C1-C4), alkényle (C2-C4), linéaire ou ramifiée, cycloalkyle (C3-C18), cycloalkényle (C3-C18), hétérocycloalkyle (C3-Cl8). Le groupe hétérocycloalkyle inclut éventuellement l'atome d'azote de radicaux amino, alkylamino et/ou arylamino, dialkylamino, diarylamino. For the purposes of the above formula, the term "non-aromatic hydrocarbon chain" means a (C 1 -C 4) alkyl chain, (C 2 -C 4) alkenyl, linear or branched, (C 3 -C 18) cycloalkyl, (C 3 -C 18) cycloalkenyl, heterocycloalkyl (C3-Cl8). The heterocycloalkyl group optionally includes the nitrogen atom of amino, alkylamino and / or arylamino, dialkylamino or diarylamino radicals.
Il est évidemment entendu que la chaîne hydrocarbonée non aromatique peut être éventuellement substituée par un ou plusieurs atomes ou radicaux choisis parmi les atomes d'halogène, les radicaux hydroxy, aryle, hétéroaryle, alkyloxy, aryloxy, thio, alkylthio, arylthio, amino, alkylamino et/ou arylamino, dialkylamino, diarylamino, amidino, guanidino, alkylcarbonylamino, ou arylcarbonylamino, carboxyle, alkyloxycarbonyle ou aryloxycarbonyle, aminocarbonyle, alkylaminocarbonyle et/ou arylaminocarbonyle, dialkylaminocarbonyle, alkylcarbonyl ou arylcarbonyl, cyano et trifluorométhyle. It is of course understood that the nonaromatic hydrocarbon chain may be optionally substituted with one or more atoms or radicals chosen from halogen atoms, hydroxy, aryl, heteroaryl, alkyloxy, aryloxy, thio, alkylthio, arylthio, amino and alkylamino radicals. and / or arylamino, dialkylamino, diarylamino, amidino, guanidino, alkylcarbonylamino, or arylcarbonylamino, carboxyl, alkyloxycarbonyl or aryloxycarbonyl, aminocarbonyl, alkylaminocarbonyl and / or arylaminocarbonyl, dialkylaminocarbonyl, alkylcarbonyl or arylcarbonyl, cyano and trifluoromethyl.
Les chaînes alkyle des substituants éventuels de la chaîne hydrocarbonée contiennent de préférence 1 à 4 atomes de carbone et les groupes aryles des substituants éventuels de la chaîne hydrocarbonée contiennent de préférence 5 à 18 atomes de carbone. The alkyl chains of the optional substituents of the hydrocarbon chain preferably contain 1 to 4 carbon atoms and the aryl groups of the optional substituents of the hydrocarbon chain preferably contain 5 to 18 carbon atoms.
On préfère parmi l'ensemble des composés ci-dessus inclus utiliser ceux comportant comme répartiteur un groupe triazine ou diazine. Parmi les groupes diazines on préfère utiliser les pyrimidines ou les quinazolines. Parmi les chaînes hydrocarbonée on préfère les chaînes alkyle contenant 2 à 3 atomes de carbone, les Among all the above-mentioned compounds, it is preferred to use those comprising, as a distributor, a triazine or diazine group. Among the diazine groups it is preferred to use pyrimidines or quinazolines. Among the hydrocarbon chains, alkyl chains containing 2 to 3 carbon atoms are preferred.
<Desc/Clms Page number 4><Desc / Clms Page number 4>
chaînes hétérocycloalkyles ou cycloalkyles contenant 5 à 7 atomes de carbone et notamment 4 à 7 atomes de carbone. heterocycloalkyl or cycloalkyl chains containing 5 to 7 carbon atoms and in particular 4 to 7 carbon atoms.
Parmi les triazines on préfère les composés répondant aux formules (I) ci-dessous :
dans laquelle : - A représente tun groupe amino de formule NRIR2 dans lequel RI et R2 identiques ou différents représentent l'hydrogène ou un groupe alkyle droit ou ramifié contenant 1 à 4 atomes de carbone ou 'un groupe ORI ou SRI dans lequel RI a la même signification que précédemment ou # un groupe alkyle contenant 1 à 4 atomes de carbone ou ou un groupe trifluorométhyle ou # un atome d'hydrogène ou # un atome d'halogène choisi parmi le fluor, le chlore, le brome ou l'iode - R3 représente l'hydrogène ou un radical alkyle en CI-C4. Among the triazines, the compounds of formula (I) below are preferred:
wherein: A represents an amino group of the formula NRIR2 in which R1 and R2 are identical or different and represent hydrogen or a straight or branched alkyl group containing 1 to 4 carbon atoms or an ORI or SR1 group in which R1 has the same meaning as above or # an alkyl group containing 1 to 4 carbon atoms or a trifluoromethyl group or # a hydrogen atom or # a halogen selected from fluorine, chlorine, bromine or iodine - R3 represents hydrogen or a C1-C4 alkyl radical.
- Ar] et Ar2 identiques ou différents représentent : o une quinoléine éventuellement substituée par au moins un groupe N (Ra) (Rb) dans lequel Ra et Rb, identiques ou différents
représentent l'hydrogène ou un radical alkyle en CI-C4 ou bien par un groupe ORa dans lequel Ra est défini comme précédemment o une quinoléine possédant un atome d'azote sous forme quaternaire ou o une benzamidine ou Ar 1 and Ar 2, which are identical or different, represent: a quinoline, optionally substituted by at least one N (Ra) (Rb) group, in which Ra and Rb, which may be identical or different,
represent hydrogen or a C1-C4 alkyl radical or else an ORa group in which Ra is defined as above, a quinoline having a nitrogen atom in quaternary form or a benzamidine or
<Desc/Clms Page number 5><Desc / Clms Page number 5>
o une pyridine attachée en position-4 ou fusionnée avec un groupe aryle ou hétéroaryle éventuellement substituée par un groupe alkyle en Cl-C4 - Alk représente une chaîne hydrocarbonée, éventuellement substituée, non aromatique, choisie parmi les chaîne alkyle (C1-C4), alkényle (C2-C4), linéaires ou ramifiées, cycloalkyle (C3-C18), cycloalkényle (C3-C18), hétérocycloalkyle (C3-C18) incluant éventuellement l'atome d'azote de radicaux amino, alkylamino et/ou arylamino, dialkylamino, diarylamino ou un de ses sels. a pyridine attached at the 4-position or fused with an aryl or heteroaryl group optionally substituted with a C1-C4 alkyl-Alk group represents an optionally substituted, non-aromatic hydrocarbon-based chain selected from the (C1-C4) alkyl chain, (C2-C4) alkenyl, linear or branched, (C3-C18) cycloalkyl, (C3-C18) cycloalkenyl, (C3-C18) heterocycloalkyl optionally including the amino nitrogen atom, alkylamino and / or arylamino, dialkylamino , diarylamino or a salt thereof.
Dans les composés définis ci-dessus Alk représente notamment o un motif alkyle contenant 1 à 4 atomes de carbone linéaire ou ramifié éventuellement substitué par un radical amino, alkylamino et/ou arylamino, dialkylamino ou diarylamino o un motif alkényle contenant 2 à 4 atomes de carbone, linéaire ou ramifié éventuellement substitué par un radical amino, alkylamino et/ou arylamino, dialkylamino ou diarylamino o un motif cycloalkyle contenant de 3 à 18 atomes de carbone o un motif cycloalkényle contenant de 3 à 18 atomes de carbone, o un motif hétérocycloalkyle contenant de 3 à 18 atomes de carbone incluant éventuellement l'atome d'azote de radicaux amino, alkylamino et/ou arylamino, dialkylamino, diarylamino ou un de ses sels. In the compounds defined above, Alk represents in particular a linear or branched alkyl unit containing 1 to 4 carbon atoms optionally substituted with an amino, alkylamino and / or arylamino, dialkylamino or diarylamino radical, or an alkenyl unit containing 2 to 4 carbon atoms. carbon, linear or branched optionally substituted by an amino, alkylamino and / or arylamino radical, dialkylamino or diarylamino o a cycloalkyl unit containing from 3 to 18 carbon atoms o a cycloalkenyl unit containing from 3 to 18 carbon atoms, o a heterocycloalkyl unit containing from 3 to 18 carbon atoms optionally including the nitrogen atom of amino, alkylamino and / or arylamino, dialkylamino, diarylamino radicals or a salt thereof.
Dans les composés définis ci-dessus Alk représente tout particulièrement o un motif alkyle contenant 2 à 3 atomes de carbone linéaire ou ramifié substitué par un radical amino, alkylamino et/ou arylamino, dialkylamino ou diarylamino o un motif alkényle contenant 2 à 3 atomes de carbone, substitué par un radical amino, alkylamino et/ou arylamino, dialkylamino ou diarylamino In the compounds defined above, Alk represents very particularly an alkyl unit containing 2 to 3 carbon atoms, linear or branched substituted with an amino, alkylamino and / or arylamino, dialkylamino or diarylamino radical, or an alkenyl unit containing 2 to 3 carbon atoms. carbon, substituted with amino, alkylamino and / or arylamino, dialkylamino or diarylamino radical
<Desc/Clms Page number 6><Desc / Clms Page number 6>
o un motif hétérocycloalkyle contenant de 4 à 7 atomes de carbone incluant l'atome d'azote de radicaux amino, alkylamino et/ou arylamino, dialkylamino, diarylamino ou un de ses sels. a heterocycloalkyl unit containing from 4 to 7 carbon atoms, including the nitrogen atom of amino, alkylamino and / or arylamino, dialkylamino or diarylamino radicals or a salt thereof.
Comme motif hétérocycloalkyle, on peut citer par exemple le radical pipéridyle. As the heterocycloalkyl unit, there may be mentioned, for example, the piperidyl radical.
Il est évident que les motifs quinoléines peuvent être substitués par tout autre groupe n'intervenant pas dans l'application visée, ainsi des groupes acridines ou isoquinoléines ou quinazolines ou quinoxalines ou phtalazines ou benzothiazines ou benzoxazines ou phénoxazines ou phénothiazines sont inclus dans la définition des groupes quinoléines. It is obvious that the quinoline units may be substituted by any other group not involved in the intended application, so acridine or isoquinoline groups or quinazoline or quinoxaline or phthalazine or benzothiazine or benzoxazine or phenoxazine or phenothiazine are included in the definition of quinoline groups.
On préfère parmi les composés de formule (I) ci-dessus ceux pour lesqels Arl et/ou Ar2 est choisi parmi les groupes 4-aminoquinolyl, 4-alkyl-ou 4-dialkylamino- quinolyl, 4-aminoquinolinium ou quinolinium dont le noyau quinolinium est éventuellement substitué par un groupe méthyle. Among the compounds of formula (I) above, those for which Ar1 and / or Ar2 are chosen are chosen from 4-aminoquinolyl, 4-alkyl- or 4-dialkylaminoquinolyl, 4-aminoquinolinium or quinolinium including the quinolinium nucleus. is optionally substituted with a methyl group.
En ce qui concerne les groupes A, ils représentent de préférence le radical méthylthio, amino, alkylamino ou dialkylamino radicaux dans lesquels les groupes alkyle possèdent 1 à 4 atomes de carbone. As regards the groups A, they preferably represent the radical methylthio, amino, alkylamino or dialkylamino radicals in which the alkyl groups have 1 to 4 carbon atoms.
En ce qui concerne la chaîne hydrocarbonée non aromatique Alk, elle
représente de préférence une chaîne 2- (dialkylamino) éthyl, 3- (dialkylamino) propyl, 2- (N-alkyl-N-arylamino) éthyl, 3- (N-alkyl-N-arylamino) propyl, Nalkylpipéridyle ou Narylpipéridyle dans lesquels les groupes alkyle contiennent de préférence 1 à 4 atomes de carbone, encore plus préférentiellement 1 à 2 atomes de carbone et les groupes aryle contiennent de préférence 5 à 18 atomes de carbone, encore plus préférentiellement 6 atomes de carbone. With regard to the non-aromatic hydrocarbon chain Alk, it
preferably represents a 2- (dialkylamino) ethyl, 3- (dialkylamino) propyl, 2- (N-alkyl-N-arylamino) ethyl, 3- (N-alkyl-N-arylamino) propyl, Nalkylpiperidyl or Narylpiperidyl chain in which the alkyl groups preferably contain 1 to 4 carbon atoms, more preferably 1 to 2 carbon atoms and the aryl groups preferably contain 5 to 18 carbon atoms, more preferably 6 carbon atoms.
Un autre objet de la présente invention concerne les composés de formule (I) en tant que produits chimiques nouveaux. Il concerne donc les produits nouveaux caractérisés en ce qu'ils répondent à la formule générale suivante : cycle aromatique azoté-NRg-répartiteur-0-ou-S-chaîne hydrocarbonée non aromatique ou cycle aromatique azoté dans laquelle e le cycle aromatique azoté représente : Another object of the present invention is to provide the compounds of formula (I) as novel chemicals. It therefore relates to new products characterized in that they correspond to the following general formula: aromatic nitrogen cycle-NRg-distributor-O-or-S-hydrocarbon-based non-aromatic chain or nitrogenous aromatic ring in which e the aromatic ring nitrogen represents:
<Desc/Clms Page number 7><Desc / Clms Page number 7>
o une quinoléine éventuellement substituée par au moins un groupe N (Ra) (Rb) dans lequel Ra et Rb, identiques ou différents représentent l'hydrogène ou un radical alkyle en CI-C4 ou bien par un groupe ORa dans lequel Ra est défini comme précédemment o une quinoléine possédant un atome d'azote sous forme quaternaire ou o une benzamidine ou o une pyridine a R3 représente l'hydrogène ou un radical alkyle en CI-C4 le répartiteur représente : 0 un groupe triazine éventuellement substitué par un radical alkyle ayant 1 à 4 atomes de carbone, un radical thio, oxy ou amino eux même éventuellement substitués par un ou plusieurs chaines alkyle à chaine courte contenant 1 à 4 atomes de carbone ou un atome d'halogène ou
0 un groupe diazine éventuellement substitué par les mêmes groupes que la triazine la chaîne hydrocarbonée non aromatique est choisie parmi les chaînes alkyle (C1-C4), alkényle (C2-C4), linéaires ou ramifiées, cycloalkyle (C3-CI8), cycloalkényle (C3-CI8), hétérocycloalkyle (C3-C18) incluant éventuellement l'atome d'azote de radicaux amino, alkylamino et/ou arylamino, dialkylamino, diarylamino, ou un de ses sels,
La présente invention concerne plus particulièrement les produits nouveaux répondant à la formule (I) suivante :
dans laquelle : a quinoline optionally substituted by at least one N (Ra) (Rb) group in which Ra and Rb, which are identical or different, represent hydrogen or a C1-C4 alkyl radical or else an ORa group in which Ra is defined as previously, a quinoline having a nitrogen atom in quaternary form or a benzamidine or a pyridine having R 3 represents hydrogen or a C 1 -C 4 alkyl radical, the tundish represents: a triazine group optionally substituted by an alkyl radical having 1 to 4 carbon atoms, a thio, oxy or amino radical, themselves optionally substituted by one or more short chain alkyl chains containing 1 to 4 carbon atoms or a halogen atom or
A diazine group optionally substituted with the same groups as the triazine, the nonaromatic hydrocarbon chain is chosen from linear (C 1 -C 4) alkyl, (C 2 -C 4) alkenyl, cycloalkyl (C 3 -C 8) and cycloalkenyl ( C3-C18), heterocycloalkyl (C3-C18) optionally including the nitrogen atom of amino, alkylamino and / or arylamino, dialkylamino, diarylamino radicals, or a salt thereof,
The present invention relates more particularly to novel products corresponding to the following formula (I):
in which :
<Desc/Clms Page number 8> <Desc / Clms Page number 8>
- A représente e un groupe amino de formule NR1R2 dans lequel RI et R2 identiques ou différents représentent un atome d'hydrogène ou un groupe alkyle droit ou ramifié contenant 1 à 4 atomes de carbone ou e un groupe ORI ou SRI dans lequel RI représente l'hydrogène ou a la même signification que précédemment ou ob un groupe alkyle contenant 1 à 4 atomes de carbone ou un groupe trifluorométhyle ou * un atome d'hydrogène ou * un atome d'halogène choisi parmi le fluor, le chlore, le brome ou l'iode - R3 représente un atome d'hydrogène ou un groupe alkyle en CI-C4 - Arl et Ar2 identiques ou différents représentent : o une quinoléine éventuellement substituée par au moins un groupe N (Ra) (Rb) dans lequel Ra et Rb, identiques ou différents représentent l'hydrogène ou un radical alkyle en CI-C4 ou un groupe
ORa dans lequel Ra est défini comme précédemment, o une quinoléine possédant un atome d'azote sous forme quaternaire ou o une benzamidine ou une pyridine attachée en position-4 ou fusionnée avec un groupe aryle ou hétéroaryle éventuellement substituée par un groupe alkyle en CI-C4- - Alk représente une chaîne hydrocarbonée, éventuellement substituée, non aromatique, choisie parmi les chaîne alkyle (CI-C4), alkényle (C2-C4), linéaires ou ramifiées, cycloalkyle (C3-CI8), cycloalkényle (C3-CI8), hétérocycloalkyle (C3-CI8) incluant éventuellement l'atome d'azote de radicaux amino, alkylamino et/ou arylamino, dialkylamino, diarylamino, ou un de ses sels.
Dans les composés nouveaux ci-dessus, Alk peut prendre les valeurs déjà indiquées ci-dessus et notamment Alk représente
A represents an amino group of formula NR 1 R 2 in which R 1 and R 2, which are identical or different, represent a hydrogen atom or a straight or branched alkyl group containing 1 to 4 carbon atoms or an ORI or SR 1 group in which R 1 represents hydrogen or has the same meaning as above or ob an alkyl group containing 1 to 4 carbon atoms or a trifluoromethyl group or a hydrogen atom or a halogen selected from fluorine, chlorine, bromine or the iodine - R3 represents a hydrogen atom or a C1-C4 alkyl group - Ar1 and Ar2, which may be identical or different, represent: o a quinoline optionally substituted with at least one N (Ra) (Rb) group in which Ra and Rb , identical or different, represent hydrogen or a C 1 -C 4 alkyl radical or a group
ORa wherein Ra is defined as above, a quinoline having a nitrogen atom in quaternary form or a benzamidine or pyridine attached at the 4-position or fused with an aryl or heteroaryl group optionally substituted with a C 1 -C 6 alkyl group; C4- Alk represents an optionally substituted, non-aromatic hydrocarbon-based chain selected from linear or branched (C 1 -C 4) alkyl, (C 2 -C 4) alkenyl, (C 3 -C 8) cycloalkyl and (C 3 -C 8) cycloalkenyl chains; heterocycloalkyl (C3-Cl8) optionally including the nitrogen atom of amino, alkylamino and / or arylamino, dialkylamino or diarylamino radicals, or a salt thereof.
In the above novel compounds, Alk can take the values already indicated above and in particular Alk represents
<Desc/Clms Page number 9><Desc / Clms Page number 9>
o un motif alkyle contenant 2 à 3 atomes de carbone linéaire ou ramifié substitué par un radical amino, alkylamino et/ou arylamino, dialkylamino, ou diarylamino o un motif alkényle contenant 2 à 3 atomes de carbone, substitué par un radical amino, alkylamino et/ou arylamino, dialkylamino ou diarylamino o un motif cycloalkyle ou hétérocycloalkyle contenant de 5 à 7 atomes de carbone incluant l'atome d'azote de radicaux amino, alkylamino et/ou arylamino, dialkylamino, diarylamino, ou un de ses sels. an alkyl unit containing 2 to 3 linear or branched carbon atoms substituted by an amino, alkylamino and / or arylamino, dialkylamino or diarylamino radical; an alkenyl unit containing 2 to 3 carbon atoms, substituted by an amino, alkylamino and and / or arylamino, dialkylamino or diarylamino o a cycloalkyl or heterocycloalkyl unit containing from 5 to 7 carbon atoms, including the nitrogen atom of amino, alkylamino and / or arylamino, dialkylamino or diarylamino radicals, or a salt thereof.
Les composés de formule (I) qui sont préférés sont ceux pour lesquels Ar, représente un groupe choisi parmi les motifs suivants : 4-amino-ou 4-méthylamino-ou 4-diméthylamino-quinolyl ou quinolinium dont le noyau quinolinium est éventuellement substitué par un groupe méthyle. The compounds of formula (I) which are preferred are those for which Ar represents a group chosen from the following units: 4-amino or 4-methylamino or 4-dimethylamino-quinolyl or quinolinium, the quinolinium ring of which is optionally substituted by a methyl group.
Les composés de formule générale (I) qui sont préférés sont ceux pour lesquels A représente un groupe amino ou diméthylamino ou plus préférentiellement méthylthio. The compounds of general formula (I) which are preferred are those for which A represents an amino or dimethylamino group or, more preferably, methylthio.
Les composés de formule générale (I) qui sont préférés sont ceux pour lesquels la chaine hydrocarbonée non aromatique Alk est choisie parmi les chaînes alkyle contenant 2 à 3 atomes de carbone et les chaînes cycloalkyles ou hétérocycloalkyles contenant 5 à 7 atomes de carbone, ces chaînes portant elles-mêmes un radical amino, alkylamino et/ou arylamino, dialkylamino ou diarylamino, dans lesquels les groupes alkyle contiennent 1 à 4 atomes de carbone et les groupes aryle contiennent 5 à 18 atomes de carbone. The compounds of general formula (I) which are preferred are those for which the non-aromatic hydrocarbon chain Alk is chosen from alkyl chains containing 2 to 3 carbon atoms and cycloalkyl or heterocycloalkyl chains containing 5 to 7 carbon atoms, these chains themselves carrying an amino, alkylamino and / or arylamino, dialkylamino or diarylamino radical, in which the alkyl groups contain 1 to 4 carbon atoms and the aryl groups contain 5 to 18 carbon atoms.
Les composés de formule générale (I) qui sont particulièrement préférés sont
ceux pour lesquels la chaîne hydrocarbonée non aromatique Alk représente une chaîne 2- (dialkylamino) éthyl, 3- (dialkylamino) propyl, 2- (N-alkyl-N-arylamino) éthyl, 3- (Nalkyl-N-arylamino) propyl, Nalkylpipéridyle ou Narylpipéridyle dans lesquels les groupes alkyle contiennent 1 à 4 atomes de carbone, notamment 1 à 2 atomes de carbone et les groupes aryle contiennent 5 à 18 atomes de carbone, notamment 6 atomes de carbone. The compounds of general formula (I) which are particularly preferred are
those for which the nonaromatic hydrocarbon chain Alk represents a 2- (dialkylamino) ethyl, 3- (dialkylamino) propyl, 2- (N-alkyl-N-arylamino) ethyl, 3- (Nalkyl-N-arylamino) propyl chain, Nalkylpiperidyl or Narylpiperidyl wherein the alkyl groups contain 1 to 4 carbon atoms, especially 1 to 2 carbon atoms and the aryl groups contain 5 to 18 carbon atoms, especially 6 carbon atoms.
L'invention concerne tout particulièrement les composés suivants : The invention particularly relates to the following compounds:
<Desc/Clms Page number 10> <Desc / Clms Page number 10>
N6- [6- (2-diméthylamino-éthoxy)-4-méthylsuHanyl- [l, 3, 5] triazin-2-yl]-2-méthylquinoline-4, 6-diamine N6- [6- (3-diméthylamino-propoxy)-4-méthylsulfanyl- [1, 3, 5] triazin-2-yl]-2méthyl-quinoline-4, 6-diamine N6- [6- (l-méthyl-piperidm-4-yloxy)-4-méthylsulianyl- [l, 3, 5] tnazm-2-yl]-2méthyl-quinoline-4, 6-diamine N6- [6- (2-diméthylamino-éthylsulfanyl)-4-méthylsulfanyl- [1, 3, 5] triazin-2-yl]-2méthyl-quinoline-4, 6-diamine Un autre objet de la présente invention concerne l'utilisation des composés de la formule (I) comme produit pharmaceutique à usage humain.
N6- [6- (2-dimethylamino-ethoxy) -4-methylsHanyl- [1,3,5] triazin-2-yl] -2-methylquinoline-4,6-diamine N6- [6- (3-dimethylamino) -N- propoxy) -4-methylsulfanyl- [1,3,5] triazin-2-yl] -2-methyl-quinoline-4,6-diamine N6- [6- (1-methyl-piperid-4-yloxy) -4-methylsulanyl) [1,3,5-tnazm-2-yl] -2-methyl-quinoline-4,6-diamine N6- [6- (2-dimethylamino-ethylsulfanyl) -4-methylsulfanyl- [1,3,5] triazin- Another object of the present invention is the use of the compounds of formula (I) as a pharmaceutical product for human use.
Les procédés de préparation des composés de formule (1)
sont décrits ci-après.
are described below.
Dans le cas où Ar, et Alk sont présents, la triazine de formule générale (A) peut être obtenue par déplacement séquentiel des atomes d'halogène, très généralement des atomes de chlore, des produits de formule générale (B) par les amines AriNHR3 de formule générale (C) puis par des alcools ou des phénols ou des thiols ou des thoiphénols de formule générale (E) ou (E') ou inversement réaction de (B) avec (E) ou (E') puis de l'intermédiaire obtenu avec (C) selon le schéma 1 : In the case where Ar and Alk are present, the triazine of general formula (A) can be obtained by sequential displacement of the halogen atoms, very generally chlorine atoms, of the products of general formula (B) by the amines AriNHR3 of general formula (C) and then with alcohols or phenols or thiols or thoiphenols of general formula (E) or (E ') or conversely reaction of (B) with (E) or (E') and then with intermediate obtained with (C) according to scheme 1:
<Desc/Clms Page number 11> <Desc / Clms Page number 11>
Schéma 1
Dans les composés (B), (D) et (A) du schéma 1, R représente les valeurs de A telles que définies ci-dessus dans les composés de formule (I) : si nécessaire, les fonctions éventuellement réactives de A peuvent être éventuellement protégées selon les méthodes usuelles connues de l'homme du métier. Diagram 1
In the compounds (B), (D) and (A) of scheme 1, R represents the values of A as defined above in the compounds of formula (I): if necessary, the optionally reactive functions of A may be optionally protected according to the usual methods known to those skilled in the art.
Arl, Ar2, Alk et R3 ont les significations indiquées ci-dessus pour les composés de formule (I). Ar 1, Ar 2, Alk and R 3 have the meanings indicated above for the compounds of formula (I).
Généralement, pour préparer l'intermédiaire D, on opère avec 1 mole de dihalogéno-s-
triazine, ou trihalogéno-s-triazine, et 1 mole d'amine Art. On préfère opérer dans un solvant inerte tel que l'acétone éventuellement aqueux ou un alcool éventuellement aqueux, comme l'éthanol, ou un solvant halogéné, tel que le dichlorométhane, ou un éther tel que l'oxyde de diéthyle ou le dioxane, ou un solvant aprotique polaire tel que le DMF le DMSO ou la NMP. Selon une meilleure manière de mettre en oeuvre l'invention on opère à une température comprise entre 20 C et 50 C. Generally, to prepare the intermediate D, one operates with 1 mole of dihalogeno-s-
triazine, or trihalo-s-triazine, and 1 mole of amine Art. It is preferred to operate in an inert solvent such as optionally aqueous acetone or an optionally aqueous alcohol, such as ethanol, or a halogenated solvent, such as dichloromethane, or an ether such as diethyl ether or dioxane, or a polar aprotic solvent such as DMF, DMSO or NMP. According to a better way of implementing the invention, the reaction is carried out at a temperature of between 20 ° C. and 50 ° C.
Le produit de formule générale (D) est avantageusement isolé et purifié.
Ensuite on ajoute 1 mole d'alcool Alk-OH ou de thiol Alk-SH ou de phénol Ar2-OH ou de thiophénol Ar2-SH au produit de formule générale (D), qui peut être éventuellement isolé. On opère notamment à une température comprise entre 50 C et Then 1 mol of alcohol Alk-OH or thiol Alk-SH or phenol Ar2-OH or thiophenol Ar2-SH is added to the product of general formula (D), which can optionally be isolated. It operates in particular at a temperature between 50 C and
<Desc/Clms Page number 12> <Desc / Clms Page number 12>
le reflux à sec ou dans solvant comme un éther tel que le dioxane, ou un solvant aprotique polaire tel que le DMF le DMSO ou la NMP. Avantageusement, on peut opérer en faisant réagir les alcoolates Alk-ONa ou les thiolates Alk-SNa ou les phénates Ar2-ONa ou les thiophénates Ar2-SNa correspondants, préparés préalablement ou extemporanément par action de sodium ou d'hydrure de sodium sur les alcools ou les thiols ou par action d'hydrure ou d'hydroxyde de sodium sur les phénols ou les thiophénols dans le solvant utilisé pour la réaction avec le produit de formule générale (D). Il a été trouvé particulièrement avantageux d'opérer en chauffant le mélange constitué d'une mole du produit de formule générale (D) avec 1 mole d'alcool Alk-OH ou de thiol Alk-SH ou de phénol Ar2-OH ou de thiophénol Ar2-SH, sans solvant, par irradiation microonde. On opère de préférence à une température comprise 80 et 150 C.
dry reflux or in solvent such as an ether such as dioxane, or a polar aprotic solvent such as DMF, DMSO or NMP. Advantageously, it is possible to operate by reacting the alcoholates Alk-ONa or the thiolates Alk-SNa or the phenates Ar2-ONa or the corresponding Ar2-SNa thiophenates, prepared beforehand or extemporaneously by action of sodium or sodium hydride on the alcohols or thiols or by action of hydride or sodium hydroxide on phenols or thiophenols in the solvent used for the reaction with the product of general formula (D). It has been found particularly advantageous to operate by heating the mixture consisting of one mole of the product of general formula (D) with 1 mole of alcohol Alk-OH or thiol Alk-SH or phenol Ar 2 -OH or thiophenol Ar2-SH, solvent-free, by microwave irradiation. It is preferably carried out at a temperature of 80 and 150 C.
La présente invention a ainsi également pour objet un procédé de préparation des composés de formule (I) selon le schéma 1 caractérisé en ce que le produit de formule générale (D) telle que définie ci-dessus dans laquelle X représente un atome d'halogène et R, R3 et Arl ont les significations indiquées ci-dessus, est mis en réaction avec l'alcool Alk-OH ou le thiol Alk-SH ou le phénol Ar2-OH ou le thiophénol Ar2-SH sans solvant par irradiation microonde. The subject of the present invention is therefore also a process for the preparation of the compounds of formula (I) according to Scheme 1, characterized in that the product of general formula (D) as defined above in which X represents a halogen atom. and R, R3 and Arl have the meanings indicated above, is reacted with alcohol Alk-OH or thiol Alk-SH or phenol Ar2-OH or thiophenol Ar2-SH without solvent by microwave irradiation.
La présente invention a plus précisément pour objet un tel procédé caractérisé en ce
que l'on opère à une température comprise 80 et 150 C. The present invention more specifically relates to such a method characterized in that
that one operates at a temperature between 80 and 150 C.
Méthode générale 2
Selon une seconde méthode les produits de formule générale (A) dans lesquels Ar sont définis tels que précédemment et R représente un groupe NR1R2 ou OR1 ou SRI peuvent être également préparés par déplacement nucléophile d'un atome d'halogène, généralement un atome de chlore, d'un produit de formule générale (A) dans lequel R représente un atome d'halogène selon le schéma 2 :
R = CI (ou F ou Br ou 1) R= NR ou ORi ou SR,
Schéma 2 General method 2
According to a second method, the products of general formula (A) in which Ar are defined as previously and R represents a group NR1R2 or OR1 or SRI may also be prepared by nucleophilic displacement of a halogen atom, generally a chlorine atom. of a product of general formula (A) in which R represents a halogen atom according to scheme 2:
R = CI (or F or Br or 1) R = NR or ORi or SR,
Figure 2
<Desc/Clms Page number 13> <Desc / Clms Page number 13>
On opère généralement en condensant 1 mole de produit de formule générale (A) dans lequel R représente un atome d'halogène, préférentiellement un atome de chlore, avec 1 mole d'amine R1R2NH ou d'alcoolate RIO-ou de thioalcoolate RIS. La réaction a lieu en milieu inerte dans les conditions de la réaction. On peut citer parmi les solvants inertes l'acétone éventuellement aqueux ou un alcool éventuellement aqueux comme l'éthanol ou un solvant halogéné tel que le dichlorométhane, ou un éther tel que l'oxyde de diéthyle ou le dioxane, ou un solvant aprotique polaire tel que le DMF le DMSO ou la NMP. Lorsque le groupe entrant représente un groupe RIR2NH, on opère de préférence à une température comprise entre 20 C et le reflux, en présence notamment d'une base organique, telle que la triéthylamine, ou minérale, telle que la soude ou le carbonate de sodium ou de potassium. Il est également possible de ne pas utiliser de base lors de la réaction d'amination, et d'isoler un chlorhydrate du produit de formule générale (A), dont la base peut ensuite être libérée. Lorsque le groupe entrant représente un groupe RIOou RI S- on opère préférentiellement avec un alcoolate ou un thioalcoolate alcalin ou alcalinoterreux, tel qu'un sel de sodium ou de potassium ou de lithium ou d'ammonium ou de césium ou de baryum, dans un solvant aprotique polaire tel que le DMF ou le DMSO ou la NMP, à une température comprise entre 50 C et le reflux. The procedure is generally carried out by condensing 1 mole of product of general formula (A) in which R represents a halogen atom, preferably a chlorine atom, with 1 mole of amine R 1 R 2 NH or of alcoholate R 10 or thioalkoxide RIS. The reaction takes place in an inert medium under the conditions of the reaction. Among the inert solvents, the optionally aqueous acetone or an optionally aqueous alcohol such as ethanol or a halogenated solvent such as dichloromethane, or an ether such as diethyl ether or dioxane, or a polar aprotic solvent such as that DMF the DMSO or the NMP. When the input group represents a RIR2NH group, the reaction is preferably carried out at a temperature of between 20 ° C. and reflux, in the presence in particular of an organic base, such as triethylamine, or mineral, such as sodium hydroxide or sodium carbonate. or potassium. It is also possible not to use a base during the amination reaction, and isolate a hydrochloride of the product of general formula (A), the base can then be released. When the entering group represents a group RIO or RI S-one operates preferentially with an alkali or alkaline earth alcoholate or thioalcoholate, such as a salt of sodium or of potassium or of lithium or of ammonium or of cesium or barium, in a polar aprotic solvent such as DMF or DMSO or NMP, at a temperature between 50 C and reflux.
Méthode générale 3
Il est entendu que les s-triazines de formule générale peuvent être obtenues sous forme de librairies, en appliquant les méthodes décrites dans les schémas 1 ou 2 en chimie parallèle et/ou combinatoire en phase liquide ou en phase solide, étant entendu que, lorsqu'on travaille en phase solide, l'un quelconque des réactifs est préalablement fixé sur un support solide, choisi en fonction de la réaction chimique mise en jeu, et que ladite réaction chimique est suivie d'une opération de clivage du produit de la réaction du support solide. General method 3
It is understood that the s-triazines of general formula can be obtained in the form of libraries, by applying the methods described in Schemes 1 or 2 in parallel and / or combinatorial chemistry in the liquid phase or in the solid phase, it being understood that, when one works in solid phase, any one of the reagents is fixed beforehand on a solid support, chosen according to the chemical reaction involved, and that said chemical reaction is followed by a cleavage operation of the product of the reaction solid support.
La présente invention concerne aussi les compositions thérapeutiques contenant un composé selon l'invention, en association avec un support pharmaceutiquement acceptable selon le mode d'administration choisi. La composition pharmaceutique peut se présenter sous forme solide, liquide ou de liposomes. The present invention also relates to therapeutic compositions containing a compound according to the invention, in combination with a pharmaceutically acceptable carrier according to the chosen mode of administration. The pharmaceutical composition may be in solid, liquid or liposome form.
Parmi les compositions solides on peut citer les poudres, les gélules, les comprimés. Parmi les formes orales on peut aussi inclure les formes solides protégées vis-à-vis du milieu acide de l'estomac. Les supports utilisés pour les formes solides sont constitués notamment de supports minéraux comme les phosphates, les Among the solid compositions include powders, capsules, tablets. Oral forms may also include solid forms protected from the acidic environment of the stomach. The supports used for the solid forms consist in particular of mineral supports such as phosphates,
<Desc/Clms Page number 14><Desc / Clms Page number 14>
carbonates ou de supports organiques comme le lactose, les celluloses, l'amidon ou les polymères. Les formes liquides sont constituées de solutions de suspensions ou de dispersions. Elles contiennent comme support dispersif soit l'eau, soit un solvant organique (éthanol, NMP ou autres) ou de mélanges d'agents tensioactifs et de solvants ou d'agents complexants et de solvants. carbonates or organic carriers such as lactose, celluloses, starch or polymers. The liquid forms consist of solutions of suspensions or dispersions. They contain as dispersive carrier either water, or an organic solvent (ethanol, NMP or others) or mixtures of surfactants and solvents or complexing agents and solvents.
La dose administrée des composés de l'invention sera adaptée par le praticien en fonction de la voie d'administration du patient et de l'état de ce dernier. The administered dose of the compounds of the invention will be adapted by the practitioner according to the route of administration of the patient and the state of the latter.
Les composés de la présente invention peuvent être administrés seuls ou en mélange avec d'autres anticancéreux. Parmi les associations possibles on peut citer e les agents alkylants et notamment le cyclophosphamide, le melphalan, l'ifosfamide, le chlorambucil, le busulfan, le thiotepa, la prednimustine, la carmustine, la lomustine, la semustine, la steptozotocine, la decarbazine, la témozolomide, la procarbazine et Fhexamethylmélamine e les dérivés du platine comme notamment le cisplatine, le carboplatine ou l'oxaliplatine e les agents antibiotiques comme notamment la bléomycine, la mitomycine, la dactinomycine, e les agents antimicrotubules comme notamment la vinblastine, la vincristine, la vindésine, la vinorelbine, les taxoides (paclitaxel et docétaxel) e les anthracyclines comme notamment la doxorubicine, la daunorubicine, l'idarubicine, l'épirubicine, la mitoxantrone, la losoxantrone e les topoisomérases des groupes 1 et II telles. que l'étoposide, le teniposide, l'amsacrine, l'irinotecan, le topotecan et le tomudex, e les fluoropyrimidines telles que le 5-fluorouracile, l'UFT, la floxuridine, e les analogues de cytidine telles que la 5-azacytidine, la cytarabine, la gemcitabine, la 6-mercaptomurine, la 6-thioguanine e les analogues d'adénosine telles que la pentostatine, la cytarabine ou le phosphate de fludarabine e le methotrexate et l'acide folinique The compounds of the present invention may be administered alone or in admixture with other anticancer agents. Among the possible combinations, mention may be made of alkylating agents and in particular cyclophosphamide, melphalan, ifosfamide, chlorambucil, busulfan, thiotepa, prednimustine, carmustine, lomustine, semustine, steptozotocine, decarbazine, temozolomide, procarbazine and hexamethylmelamine and platinum derivatives such as cisplatin, carboplatin or oxaliplatin and antibiotic agents such as bleomycin, mitomycin, dactinomycin and antimicrotubules such as vinblastine, vincristine, vindesine, vinorelbine, taxoids (paclitaxel and docetaxel) and anthracyclines such as doxorubicin, daunorubicin, idarubicin, epirubicin, mitoxantrone, losoxantrone and topoisomerases of groups 1 and II such. etoposide, teniposide, amsacrine, irinotecan, topotecan and tomudex, and fluoropyrimidines such as 5-fluorouracil, UFT, floxuridine, and cytidine analogs such as 5-azacytidine , cytarabine, gemcitabine, 6-mercaptomurine, 6-thioguanine and adenosine analogs such as pentostatin, cytarabine or fludarabine phosphate, methotrexate and folinic acid
<Desc/Clms Page number 15><Desc / Clms Page number 15>
e les enzymes et composés divers tels que la L-asparaginase, l'hydroxyurée, l'acide trans-rétinoique, la suramine, la dexrazoxane, l'amifostine, l'herceptin ainsi que les hormones oetrogéniques, androgéniques. e various enzymes and compounds such as L-asparaginase, hydroxyurea, trans-retinoic acid, suramin, dexrazoxane, amifostine, herceptin as well as androgenic, androgenic hormones.
Il est également possible d'associer aux composés de la présente invention un traitement par les radiations. Ces traitements peuvent être administrés simultanément, séparément, séquentiellement. Le traitement sera adapté au malade à traiter par le praticien. It is also possible to associate the compounds of the present invention with radiation treatment. These treatments can be administered simultaneously, separately, sequentially. The treatment will be adapted to the patient to be treated by the practitioner.
L'activité de stabilisation des G-quadruplexes peut être déterminée par une méthode utilisant la formation d'un complexe avec la fluoresceine dont le protocole expérimental est décrit ci-après. The stabilization activity of G-quadruplexes can be determined by a method using the formation of a complex with fluorescein, the experimental protocol of which is described below.
Oligonucléotides
Tous les olignucléotides, modifiés ou non, ont été synthétisés par Eurogentec SA, Seraing, Belgique. L'oligoncléotide FAM + DABCYL porte la référence catalogue, OL-0371-0802. Il possède la séquence : GGGTTAGGGTTAGGGTTAGGG correspondant à 3.5 répétitions du motif télomérique humain (brin riche en G). La fluorésceine est attaché à l'extrémité 5', le DABCYL à l'extrémité 3', par les bras chimiques décrit par Eurogentec. La concentration des échantillons est vérifiée par spectrophotométrie, en enregistrant le spectre d'absorbance entre 220 et 700 nm et en utilisant le coefficient d'extinction molaire fourni par le fournisseur. oligonucleotides
All olignucleotides, modified or unmodified, were synthesized by Eurogentec SA, Seraing, Belgium. The oligonucleotide FAM + DABCYL carries the reference catalog, OL-0371-0802. It has the sequence: GGGTTAGGGTTAGGGTTAGGG corresponding to 3.5 repetitions of the human telomeric motif (strand rich in G). Fluorescein is attached to the 5 'end, DABCYL at the 3' end, by the chemical arms described by Eurogentec. The concentration of the samples is checked spectrophotometrically, recording the absorbance spectrum between 220 and 700 nm and using the molar extinction coefficient provided by the supplier.
Tampons
Toutes les expériences ont été réalisées dans un tampon cacodylate de sodium 10 mM pH 7.6 contenant 0.1 M de Chlorure de Lithium (ou de Chlorure de Sodium). tampons
All experiments were performed in 10 mM sodium cacodylate pH 7.6 buffer containing 0.1 M Lithium Chloride (or Sodium Chloride).
L'absence de contamination fluorescente dans le tampon a été préalablement vérifiée. The absence of fluorescent contamination in the buffer was previously verified.
L'oligonucléotide fluorescent est ajouté à la concentration finale de 0.2 (J. M. The fluorescent oligonucleotide is added to the final concentration of 0.2 (J.M.
Etude de Fluorescence
Toutes les mesures de fluorescence ont été effectuées sur un appareil Spex Fluorolog DM1B, en utilisant une largeur de raie d'excitation de 1.8 nm et une largeur de raie d'émission de 4.5 nm. Les échantillons sont placés dans une cuvette en quartz micro de 0.2 x 1 cm. La température de l'échantillon est contrôlée par un bain-marie extérieur. L'oligonucléotide seul a été analysé à 20,30, 40,50, 60,70 et 80 C. Les Fluorescence study
All fluorescence measurements were made on a Spex Fluorolog DM1B apparatus, using an excitation line width of 1.8 nm and an emission bandwidth of 4.5 nm. The samples are placed in a 0.2 x 1 cm micro quartz dish. The temperature of the sample is controlled by an external water bath. The oligonucleotide alone was analyzed at 20.30, 40.50, 60.70 and 80 C.
<Desc/Clms Page number 16><Desc / Clms Page number 16>
spectres d'émission sont enregistrés en utilisant une longueur d'onde d'excitation de 470 nm. Les spectres d'excitation sont enregistrés en utilisant soit 515 nm soit 588 nm comme longueur d'onde d'émission. Les spectres sont corrigés de la réponse de l'instrument par des courbes de référence. Une extinction importante (80-90 %) de la fluorescence de la fluoresceine à température ambiante est observée, en accord avec
un repli intramoléculaire de l'oligonucléotide à 20 C sous forme d'un G-quadruplex, ce qui induit une juxtaposition de ses extrémités 5'et 3', respectivement liées à la fluoresceine et au DABCYL. Cette juxtaposition entraîne un phénomène déjà décrit d'extinction de fluorescence, utilisé pour les"Molecular Beacons". Emission spectra are recorded using an excitation wavelength of 470 nm. Excitation spectra are recorded using either 515 nm or 588 nm as the emission wavelength. The spectra are corrected for the response of the instrument by reference curves. A significant extinction (80-90%) of fluorescein fluorescence at room temperature is observed, in agreement with
an intramolecular fold of the oligonucleotide at 20 C in the form of a G-quadruplex, which induces a juxtaposition of its 5'and 3 'ends, respectively bound to fluorescein and DABCYL. This juxtaposition results in a previously described phenomenon of fluorescence quenching, used for "Molecular Beacons".
Tm en fluorescence :
Une solution stock d'oligonucléotide à la concentration en brin de 0.2 M dans un tampon 0.1 M LiCI 10 mM cacodylate pH 7.6 est préalablement préparée,
chauffée brièvement à 90 C et refroidie lentement à 20 C, puis distribuée par aliquots de 600 itl dans les cuves de fluorescence. 3 al d'eau (pour le contrôle) ou 3 ul du produit à tester (stock à 200 uM, concentration finale 1 uM) sont alors ajoutés et mélangés. Les échantillons sont alors laissés à incuber pendant au moins 1 heure à 20 C avant chaque mesure. L'utilisation de temps d'incubation plus longs (jusqu'à 24 heures) n'a pas d'influence sur le résultat obtenu. Tm in fluorescence:
An oligonucleotide stock solution with a strand concentration of 0.2 M in a 0.1 M 10 mM LiCl cacodylate pH 7.6 buffer is pre-prepared.
heated briefly at 90 ° C. and cooled slowly to 20 ° C., then distributed in aliquots of 600 μl in the fluorescence cells. 3 μl of water (for control) or 3 μl of the product to be tested (stock at 200 μM, final concentration 1 μM) are then added and mixed. The samples are then incubated for at least 1 hour at 20 C before each measurement. The use of longer incubation times (up to 24 hours) has no influence on the result obtained.
Chaque expérience ne permet que la mesure d'un seul échantillon. Celui-ci est d'abord incubé à une température initiale de 20 C, porté à 80 C en 38 minutes, laissé 5 minutes à 80 C, puis refroidi à 20 C en 62 minutes. Durant ce temps, la fluorescence est mesurée simultanément à deux longueurs d'onde d'émission (515 nm et 588 nm) en utilisant 470 nm comme longueur d'onde d'excitation. Une mesure est effectuée toutes les 30 secondes. La température du bain-marie est enregistrée en parallèle, et le profil de fluorescence en fonction de la température est reconstitué à partir de ces valeurs. Each experiment only allows the measurement of a single sample. This is first incubated at an initial temperature of 20 ° C., brought to 80 ° C. in 38 minutes, left for 5 minutes at 80 ° C. and then cooled to 20 ° C. in 62 minutes. During this time, the fluorescence is measured simultaneously at two emission wavelengths (515 nm and 588 nm) using 470 nm as the excitation wavelength. A measurement is performed every 30 seconds. The temperature of the water bath is recorded in parallel, and the fluorescence profile as a function of temperature is reconstituted from these values.
Les profils de fluorescence sont ensuite normalisés entre 20 C et 80 C, et la température pour laquelle l'intensité d'émission à 515 nm est la moyenne de celles à haute et basse température est appelée Tm. Dans ces conditions, le Tm de l'échantillon de référence sans addition de produit est de 44 C dans un tampon Chlorure de Lithium. Cette température est portée à plus de 55 C dans un tampon Chlorure de Sodium. L'addition d'un composé stabilisant le G-quadruplex induit une augmentation du Tm. Cette augmentation est jugée significative si elle est supérieure à 3 . The fluorescence profiles are then normalized between 20 C and 80 C, and the temperature for which the emission intensity at 515 nm is the average of those at high and low temperature is called Tm. Under these conditions, the Tm of the Reference sample without product addition is 44 C in Lithium Chloride buffer. This temperature is increased to more than 55 C in a Sodium chloride buffer. The addition of a G-quadruplex stabilizing compound induces an increase in Tm. This increase is judged significant if it is greater than 3.
L'activité biologique antitélomérase est déterminée par le protocole expérimental suivant : The biological activity antitélomerase is determined by the following experimental protocol:
<Desc/Clms Page number 17><Desc / Clms Page number 17>
Préparation de l'extrait enrichi en activité télomérase humaine La lignée de leucémie HL60 est obtenue auprès de l'ATCC (Americam Type Culture Collection, Rockville USA). Les cellules sont cultivées en suspension dans du milieu RPMI 1640 contenant, L-Glutamine à 2 mM, Penicilline 200 U/ml, streptomycine 200 g/ml, gentamycine 50 g/ml et additionné de 10 % de sérum foetal de veau inactivé par la chaleur. Preparation of the extract enriched in human telomerase activity The leukemia line HL60 is obtained from the ATCC (Americam Type Culture Collection, Rockville USA). The cells are cultured in suspension in RPMI 1640 medium containing 2 mM L-Glutamine, Penicillin 200 U / ml, streptomycin 200 g / ml, gentamycin 50 g / ml and supplemented with 10% inactivated fetal calf serum by heat.
Une aliquote de 105 cellules est centrifugée à 3000xG et le surnageant écarté.
Le culot de cellules est resuspendu par plusieurs pipettages successifs dans 200 u. l de tampon de lyse contenant CHAPS 0. 5 %, Tris-HCl pH 7, 5 10 mM, MgClx 1 mM, EGTA 1 mM, ss-mercaptoethanol 5 mM, PMSF 0. 1 mM et glycérol 10 % et est conservé dans la glace pendant 30 minutes. Le lysat est centrifugé à 16 OOOOxG pendant 20 minutes à 4 C et 160 l du surnageant est récupéré. Le dosage des protéines de l'extrait est effectué par la méthode de Bradford. L'extrait est conservé à - 80 C. The cell pellet is resuspended by several successive pipettings in 200 μl. 1 lysis buffer containing CHAPS 0.5%, Tris-HCl pH 7.5, 10 mM, 1 mM MgClx, 1 mM EGTA, 5 mM S-mercaptoethanol, 1 mM PMSF and 10% glycerol and is stored in the ice for 30 minutes. The lysate is centrifuged at 16,000xg for 20 minutes at 4 ° C. and 160 μl of the supernatant is recovered. The protein assay of the extract is carried out by the Bradford method. The extract is stored at - 80 C.
Dosage de l'activité télomérase
L'inhibition de l'activité télomérase est déterminée par un protocole d'extension de l'oligonucléotide TS (AATCGTTCGAGCAGAGTT'), en présence d'un extrait cellulaire enrichi en activité télomérase et des composés qui sont ajoutés à différentes concentrations (10,1, 0. 1 et 0, 01 g/ml). La réaction d'extension est suivie d'une amplification PCR des produits d'extension à l'aide des oligonucléotides TS et CXext (5@GTGCCCTTACCCTTACCCTTACCCTAA3'). Assay of telomerase activity
The inhibition of telomerase activity is determined by an extension protocol of the oligonucleotide TS (AATCGTTCGAGCAGAGTT ™), in the presence of a cell extract enriched in telomerase activity and compounds which are added at different concentrations (10.1 0.1 and 0.01 g / ml). The extension reaction is followed by PCR amplification of the extension products using oligonucleotides TS and CXext (GTGCCCTTACCCTTACCCTTACCCTAA3 ').
Le milieu réactionnel est préparé selon la composition suivante :
Tris HCl pH 8,3 20 mM MgC12 1,5 mM
Tween 20 0,005 % (P/V)
EGTA 1 mM dATP 50 po dGTP 50 M dCTP 50 IlM dTTP 50 uM Oligonucléotide TS 2 u-g/ml The reaction medium is prepared according to the following composition:
Tris HCl pH 8.3 20 mM MgC12 1.5 mM
Tween 20 0.005% (w / v)
EGTA 1mM dATP 50g dGTP 50M dCTP 50mM dTTP 50μM Oligonucleotide TS 2μg / ml
<Desc/Clms Page number 18> <Desc / Clms Page number 18>
Oligonucléotide CXext 2 ug/ml
Sérum Albumine bovine 0, 1 mg/ml
Taq DNA polymérase 1 U/ml alpha 32P dCTP (3000 Ci/mmole) 0. 5 l
Extrait télomérase 200 ng sous un volume de 10 al
Produit à tester ou solvant sous un volume de 5 III
Eau bi-distillée QS 50 ul
Les oligonucléotides sont obtenus auprès d'Eurogentec (Belgique) et sont conservés à -20 C à une concentration stock de 1 mg/ml dans de l'eau distillée. Oligonucleotide CXext 2 μg / ml
Bovine albumin serum 0, 1 mg / ml
Taq DNA polymerase 1 U / ml alpha 32P dCTP (3000 Ci / mmol) 0.5 l
Extract telomerase 200 ng under a volume of 10 al
Test product or solvent in a volume of 5 III
Bi-distilled water QS 50 ul
The oligonucleotides are obtained from Eurogentec (Belgium) and are stored at -20 ° C. at a stock concentration of 1 mg / ml in distilled water.
Les échantillons réactionnels sont assemblés dans des tubes à PCR de 0.2 ml et une goutte d'huile de paraffine est déposée sur chacune des réactions de l'expérience avant la fermeture des tubes. The reaction samples are assembled in 0.2 ml PCR tubes and a drop of paraffin oil is deposited on each of the reactions of the experiment before the closure of the tubes.
Les échantillons réactionnels sont ensuite incubés dans un appareil à PCR de type Cetus 4800 selon les conditions de températures suivantes :
15 minutes à 3 OOC,
1 minute à 90 C, suivis de 30 cycles de,
30 secondes à 94 C,
30 secondes à 50 C, et 1 minute 30 secondes à noc, suivis d'un cycle final de 2 minutes à 72 C. The reaction samples are then incubated in a Cetus 4800 PCR apparatus according to the following temperature conditions:
15 minutes to 3 OOC,
1 minute at 90 C, followed by 30 cycles of,
30 seconds at 94 C,
30 seconds at 50 C, and 1 minute 30 seconds at noon, followed by a final cycle of 2 minutes at 72 C.
Pour chacun des échantillons, une aliquote de 10 ul est pipettée sous la couche d'huile et mélangée avec 5 l d'un tampon de dépôt contenant :
TBE 3X glycérol 32 % (P/V)
Bleu de bromophénol 0. 03 %
Xylène cyanol 0. 03 % For each of the samples, a 10 μl aliquot is pipetted under the oil layer and mixed with 5 μl of a depot buffer containing:
TBE 3X glycerol 32% (w / v)
Bromophenol blue 0. 03%
Xylene cyanol 0. 03%
<Desc/Clms Page number 19> <Desc / Clms Page number 19>
Les échantillons sont ensuite analysés par électrophorèse en gel d'acrylamide 12 % dans un tampon TBE IX pendant 1 heure sous une tension de 200 volts, à l'aide d'un système d'électrophorèse Novex.
The samples are then analyzed by electrophoresis in 12% acrylamide gel in an IX TBE buffer for 1 hour at a voltage of 200 volts, using a Novex electrophoresis system.
Les gels d'acrylamides sont ensuite séchés sur une feuille de papier whatmann 3MM à 80 C pendant 1 heure. The acrylamide gels are then dried on a 3MM whatmann paper at 80 C for 1 hour.
L'analyse et la quantification des produits de la réaction sont effectuées à l'aide d'un appareil InstantImager (Pacard). Analysis and quantification of the reaction products is done using an InstantImager (Pacard) device.
Pour chaque concentration de composé testée, les résultats sont exprimés en pourcentage d'inhibition de la réaction et calculés à partir du contrôle enzymatique non traité et de l'échantillon sans enzyme (blanc) selon la formule suivante : (Valeur Composé-valeur blanc/Valeur contrôle enzymatique-valeur blanc) x 100. For each concentration of test compound, the results are expressed as percent inhibition of the reaction and calculated from the untreated enzymatic control and the sample without enzyme (white) according to the following formula: (Compound value-white value / Enzyme control value - white value) x 100.
La concentration de composé induisant une inhibition de 50 % de la réaction télomérase (IC50) est déterminée à l'aide d'une représentation graphique semi logarithmique des valeurs d'inhibition obtenues en fonction de chacune des concentrations de composé testée. The concentration of compound inducing a 50% inhibition of the telomerase reaction (IC50) is determined using a semi-log plot of the inhibition values obtained as a function of each of the concentrations of test compound.
On considère qu'un composé est actif en tant qu'agent antitélomérase lorsque la quantité inhibant 50 % de la réaction télomérase est notamment inférieure à 5 p. M. It is considered that a compound is active as an antitelomerase agent when the amount inhibiting 50% of the telomerase reaction is especially less than 5%. Mr.
L'activité biologique cytotoxique sur des lignées de tumeur humaines est déterminée selon le protocole expérimental suivant : Les lignées de cellules humaines KB et A549 sont originaires de l'ATCC (Americam Type Culture Collection, Rockville USA). Les cellules A549 sont cultivées en couche en flacon de culture dans du milieu RPMI 1640, L-Glutamine à 2 mM, Penicilline 200 U/ml, streptomycine 200 g/ml et additionné de 10 % de sérum fcetal de veau inactivé par la chaleur. Les cellules KB sont cultivées en couche en flacon de culture dans du milieu de Dulbelco's contenant, L-Glutamine à 2 mM, Penicilline 200 U/ml, streptomycine 200 gg/n-d et additionné de 10 % de sérum foetal de veau inactivé par la chaleur. The cytotoxic biological activity on human tumor lines is determined according to the following experimental protocol: The human cell lines KB and A549 originate from the ATCC (Americam Type Culture Collection, Rockville USA). A549 cells are cultured in a culture flask in RPMI 1640 medium, 2 mM L-glutamine, 200 U / ml Penicillin, 200 g / ml streptomycin and 10% heat-inactivated fetal calf serum. The KB cells are cultured in a culture flask in Dulbelco's medium containing 2 mM L-Glutamine, 200 U / ml Penicillin, 200 g / ml streptomycin and 10% heat inactivated fetal calf serum added. .
Les cellules en phase exponentielles de croissances sont trypsinées, lavées dans du PBS IX et sont ensemencées en microplaques 96 puits (Costar) à raison de 4x1O4 cellules/ml pour A549 et de 1, 5x104 cellules/ml (0. 2ml/puit) puis incubées pendant 96 heures en présence de concentrations variables de produit à étudier (10, 1, The cells in the exponential phase of growth are trypsinized, washed in IX PBS and are seeded in 96-well microplates (Costar) at a rate of 4x104 cells / ml for A549 and 1.5 × 10 4 cells / ml (0.2 ml / well) and then incubated for 96 hours in the presence of varying concentrations of product to be studied (10, 1,
<Desc/Clms Page number 20> <Desc / Clms Page number 20>
0. 1 et 0. 01 p-g/ml, chaque point en quadruplicata). 16 heures avant la fin de l'incubation, 0. 02 % final de rouge neutre est ajouté dans chaque puits. A la fin de l'incubation, les cellules sont lavées par du PBS IX et lysées par 1 % de lauryl sulfate de sodium. L'incorporation cellulaire du colorant, qui reflète la croissance cellulaire, est évaluée par spectrophotométrie à une longueur d'onde de 540 nm pour chaque échantillon à l'aide d'un appareil de lecture Dynatech MR5000.
0. 1 and 0. 01 pg / ml, each point in quadruplicate). 16 hours before the end of the incubation, 0. 02% final of neutral red is added in each well. At the end of the incubation, the cells are washed with IX PBS and lysed with 1% sodium lauryl sulfate. Cellular incorporation of the dye, which reflects cell growth, is evaluated spectrophotometrically at a wavelength of 540 nm for each sample using a Dynatech MR5000 reading device.
Pour chaque concentration de composé testé, les résultats sont exprimés en pourcentage d'inhibition de croissance cellulaire et calculés à partir du contrôle non traité et du milieu de culture sans cellules (blanc) selon la formule suivante : (Valeur Composé-valeur blanc/Valeur contrôle cellules-valeur blanc) x 100. For each concentration of test compound, the results are expressed as a percentage of cell growth inhibition and calculated from the untreated control and the cell-free culture medium (white) according to the following formula: (Value Compound-value white / Value cell-value white control) x 100.
La concentration de composé induisant une inhibition de 50 % de la croissance (IC50) est déterminée à l'aide d'une représentation graphique semi logarithmique des valeurs d'inhibition obtenues en fonction de chacune des concentrations de composé testée. The compound concentration inducing a 50% inhibition of growth (IC50) is determined using a semi-log plot of the inhibition values obtained as a function of each of the concentrations of test compound.
On considère qu'un composé est actif comme agent cytotoxique si la concentration inhibitrice de 50 % de la croissance des cellules tumorales testées est notamment inférieure à 10 uM. It is considered that a compound is active as a cytotoxic agent if the inhibitory concentration of 50% of the growth of the tumor cells tested is in particular less than 10 .mu.M.
Les exemples suivants et non limitatifs sont donnés pour illustrer l'invention. The following nonlimiting examples are given to illustrate the invention.
Exemple 1 : Synthèse de N6- [6- (2-diméthylamino-éthoxy)-4-méthylsulfanyl- [1, 3, 5] triazin-2-yl]-2-méthyl-quinoline-4, 6-diamine Préparation de la N6- (6-chloro-4-méthylsulfanyl- [U. 5] tnazin-2-y-2-méthyl- quinoline-4. 6-diamine Dans un tricol de 1 litre, à une solution de 5 g (25 mmoles) de 2,6-dichloro-6- méthylsulfanyl-[1, 3, 5] triazine, qui peut être préparée selon J. Amer. Chem. Soc., 1945,67, 662, dans 400 ml de tétrahydrofurane, on ajoute successivement 4,4 g (25 mmoles) de 2-méthyl-quinoline-4, 6-diamine, qui peut être préparée selon J. Med. Example 1 Synthesis of N6- [6- (2-dimethylaminoethoxy) -4-methylsulfanyl- [1,3,5] triazin-2-yl] -2-methyl-quinoline-4,6-diamine Preparation of N6- (6-chloro-4-methylsulfanyl- [U. 5] tnazin-2-y-2-methyl-quinolin-4, 6-diamine In a 1 liter tricol, to a solution of 5 g (25 mmol) 2,6-dichloro-6-methylsulfanyl- [1,3,5] triazine, which can be prepared according to J. Amer Chem Soc., 1945, 67, 662, in 400 ml of tetrahydrofuran, is added successively 4 4 g (25 mmol) of 2-methyl-quinoline-4,6-diamine, which can be prepared according to J. Med.
Chem. 1992,35, 252, et 2,8 g (25 mmoles) de carbonate de sodium. Le mélange réactionnel est chauffé à reflux pendant 16 heures. Après évaporation du tétrahydrofurane, le résidu est repris par 400 ml d'un mélange d'eau et de dichorométhane (50-50 en volumes). La phase organique est décantée, séchée sur sulfate de sodium et concentrée à sec sous pression réduite. On obtient alors 7,5 g Chem. 1992, 35, 252, and 2.8 g (25 mmol) of sodium carbonate. The reaction mixture is refluxed for 16 hours. After evaporation of the tetrahydrofuran, the residue is taken up in 400 ml of a mixture of water and dichoromethane (50-50 by volume). The organic phase is decanted, dried over sodium sulfate and concentrated to dryness under reduced pressure. 7.5 g is then obtained
<Desc/Clms Page number 21> <Desc / Clms Page number 21>
(88 %) de N6- (6-chloro-4-méthylsulfanyl-triazin-2-yl)-2-méthyl-quinoline-4, 6diamine, sous forme d'un solide jaune pâle dont les caractéristiques sont les suivantes : - point de fusion = 294C - spectre de RMN'H (300 MHz, (CD3) 2SO d6, 8 en ppm) : 2, 43 (s : 3H) ; 2, 52 (s : 3H) ; 6, 47 (s : lH) ; 6, 61 (mf : 2H) ; 7, 62 (d large, J = 9 Hz : IH) ; 7, 69 (d, J = 9 Hz : 1H) ; 8, 32 (mf : 1H) ; 10, 80 (mf : 1H).
(88%) N6- (6-chloro-4-methylsulfanyl-triazin-2-yl) -2-methyl-quinoline-4, 6-diamine, as a pale yellow solid, having the following characteristics: - mp = 294C - 1H NMR spectrum (300MHz, (CD3) 2SO d6, 8 ppm): 2.43 (s: 3H); 2.25 (s: 3H); 6, 47 (s: 1H); 6, 61 (mf: 2H); 7, 62 (broad, J = 9 Hz: 1H); 7, 69 (d, J = 9 Hz: 1H); 8, 32 (mf: 1H); 10.80 (mf: 1H).
Préparation de la N6- [6- (2-diméthylamino-éthyloxy')-4-méthyl-sulfanyl- [U, 5] triazin- 2-yl]-2-méthyl-quinoline-4. 6-diamine (exemple 1) Dans un réacteur micro-onde en quartz de 12 ml, de type Synthewave 402 Prolabo, on introduit 25 mg (0,075 mmole) de N6- (6-amino-4-méthylsulfanyl-[1, 3, 5] triazin-2-yl)- 2-méthylquinoline-4, 6-diamine et 27 l (0,27 mmole) de 2-diméthylaminoéthanol. On chauffe pendant 2 heures sous irradiation micro-onde à une température voisine de 80 c. Après refroidissement, le contenu du tube est repris au méthanol et évaporé sous pression réduite. Le résidu est cristallisé dans le toluène. On obtient ainsi 26 mg (rdt 90 %) de N6- [6- (2-diméthylamino-éthyloxy)-4-méthyl-sulfanyl- [1, 3, 5] triazin-2- yl]-2-méthyl-quinoline-4, 6-diamine, sous forme d'une poudre jaune abricot dont la caractéristique est la suivante : - spectre de masse (EI/DCI) = 385 (MHl Exemple 2 : Synthèse de N6- [6- (3-diméthylamino-propoxy)-4-méthylsulfanyl-
[l, 3, 5] triazin-2-yl]-2-méthyl-quinoline-4, 6-diamine Dans un réacteur micro-onde en quartz de 12 ml, de type Synthewave 402 Prolabo, on introduit 25 mg (0,075 mmole) de N6- (6-amino-4-méthylsulfanyl- [1, 3, 5] triazin-2-yl)- 2-méthylquinoline-4,6-diamine, préparé comme à l'exemple 1, et 35 l (0,3 mmole) de 3-diméthylaminopropanol. On chauffe pendant 5 minutes sous irradiation micro-onde à une température voisine de 125 C. Après refroidissement, le contenu du tube est repris au méthanol et évaporé sous pression réduite. Le résidu est cristallisé dans le toluène.
[1, 3, 5] triazin-2-yl] -2-methyl-quinoline-4,6-diamine In a 12 ml micron quartz reactor, of the Synthewave 402 Prolabo type, 25 mg (0.075 mmol) are introduced. ) N6- (6-amino-4-methylsulfanyl- [1,3,5] triazin-2-yl) -2-methylquinoline-4,6-diamine, prepared as in Example 1, and 3 mmol) of 3-dimethylaminopropanol. The mixture is heated for 5 minutes under microwave irradiation at a temperature in the region of 125 ° C. After cooling, the contents of the tube are taken up in methanol and evaporated under reduced pressure. The residue is crystallized in toluene.
On obtient ainsi 25 mg (rdt 83 %) de N6- [6- (2-diméthylamino-éthyloxy)-4-méthylsulfanyl-[1, 3, 5] triazm-2-yl]-2-méthyl-qumolme-4, 6-diamine, sous forme d'une poudre jaune abricot dont les caractéristiques sont les suivantes : - spectre de masse (EI/ECI) = 399 (MHI 25 mg (83% yield) of N6- [6- (2-dimethylaminoethyloxy) -4-methylsulfanyl- [1,3,5] triazin-2-yl] -2-methyl-qumolme-4 are thus obtained. 6-diamine, in the form of an apricot yellow powder whose characteristics are as follows: - mass spectrum (EI / ECI) = 399 (MHI)
<Desc/Clms Page number 22> <Desc / Clms Page number 22>
Exemple 3 : Synthèse de N6- [6- (l-méthyl-piperidin-4-yloxy)-4-méthylsulfanyl- [1, 3, 5] triazin-2-yl]-2-méthyl-quinoline-4, 6-diamine Dans un réacteur micro-onde en quartz de 12 ml, de type Synthewave 402 Prolabo, on introduit 25 mg (0,075 mmole) de N6- (6-amino-4-méthylsulfanyl-[1, 3, 5] triazin-2-yl)- 2-méthylquinoline-4, 6-diamine, préparé comme à l'exemple 1,35 mg (0,3 mmole) de 4-hydroxy-1-méthylpipéridine et 0,5 g d'alumine. On chauffe pendant 10 minutes sous irradiation micro-onde à une température voisine de 148 C. Après refroidissement, le contenu du tube est repris au méthanol et évaporé sous pression réduite. Le résidu est
cristallisé dans le toluène. On obtient ainsi 22 mg (rdt 71 %) de N6-[6- (l-méthylpipéridin-4-yloxy)-4-méthyl-sulfanyl- [l, 3, 5] triazin-2-yl]-2-méthyl-quinoline-4, 6- diamine, sous forme d'une poudre jaune pâle dont les caractéristiques sont les suivantes :
- spectre de masse (EI/DCI) = 411 (MHl Exemple 4 : Synthèse de N6- [6- (2-diméthylamino-éthylsulfanyl)-4-méthylsulfanyl- [1, 3, 5] triazin-2-yl]-2-méthyl-quino line-4, 6- diamine Dans un tricol de 10 ml, on introduit successivement 2, 5 ml de dioxane 50 al (0, 31 mmole) de chlorhydrate de 2-méthylaminoéthanethiol, 50 ul d'une solution ION d'hydroxyde de sodium et 25 mg (0, 075 mmole) de N6- (6-amino-4-méthylsulfànyl- [1, 3, 5] triazin-2-yl)-2-méthylquinoline-4, 6-diamine, préparé comme à l'exemple 1. On chauffe pendant 16 heures au reflux. Après refroidissement, le précipité formé est essoré et cristallisé dans l'oxyde de diéthyle. On obtient ainsi 17 mg (rdt 57 %) de N6- [6- (2-diméthylamino-éthylsulfanyl)-4-méthylsulfanyl- [1, 3, 5] triazin-2-yl]-2-méthyl- quinoline-4,6-diamine, sous forme d'une poudre beige dont les caractéristiques sont les suivantes : - spectre de masse (EI/DCI) = 401 (MH)
Tableau de résultats biologiques
Example 3 Synthesis of N6- [6- (1-methyl-piperidin-4-yloxy) -4-methylsulfanyl- [1,3,5] triazin-2-yl] -2-methyl-quinoline-4,6 In a 12 ml micron quartz reactor, of the Synthewave 402 Prolabo type, 25 mg (0.075 mmol) of N6- (6-amino-4-methylsulfanyl- [1,3,5] triazin-2- yl) -2-methylquinoline-4,6-diamine, prepared as in the example of 1.35 mg (0.3 mmol) of 4-hydroxy-1-methylpiperidine and 0.5 g of alumina. The mixture is heated for 10 minutes under microwave irradiation at a temperature in the region of 148 ° C. After cooling, the contents of the tube are taken up in methanol and evaporated under reduced pressure. The residue is
crystallized in toluene. 22 mg (71% yield) of N6- [6- (1-methylpiperidin-4-yloxy) -4-methyl-sulfanyl- [1,3,5] triazin-2-yl] -2-methyl are thus obtained. 4-diaminoline, 6-diamine, in the form of a pale yellow powder, the characteristics of which are as follows:
mass spectrum (EI / DCI) = 411 (MH1) Example 4: Synthesis of N6- [6- (2-dimethylaminoethylsulfanyl) -4-methylsulfanyl- [1,3,5] triazin-2-yl] -2 In a 10 ml three-necked flask, 2.5 ml of dioxane 50 μl (0.31 mmol) of 2-methylaminoethanethiol hydrochloride, 50 μl of an ION solution, are successively added. sodium hydroxide and 25 mg (0.075 mmol) of N6- (6-amino-4-methylsulfandyl- [1,3,5] triazin-2-yl) -2-methylquinoline-4,6-diamine prepared As in Example 1, the mixture is refluxed for 16 hours and, after cooling, the precipitate formed is filtered off and crystallized from diethyl ether to give 17 mg (57% yield) of N6- [6- (2%). dimethylaminoethylsulfanyl) -4-methylsulfanyl- [1,3,5] triazin-2-yl] -2-methylquinoline-4,6-diamine in the form of a beige powder, the characteristics of which are as follows: - mass spectrum (EI / DCI) = 401 (MH)
Table of biological results
<tb>
<tb> TRAP <SEP> G-4 <SEP> Cytotoxicité
<tb> télomérase <SEP> Delta <SEP> Tm <SEP> A549
<tb> IC50) <SEP> M <SEP> C <SEP> IC50 <SEP> M
<tb> 1 <SEP> 3,3 <SEP> 2.6
<tb> 2 <SEP> 2 <SEP> 6.2
<tb> 3 <SEP> 0.87 <SEP> 4.5 <SEP> 6.0
<tb> 4 <SEP> 0.66 <SEP> 4. <SEP> 1
<tb> <Tb>
<tb> TRAP <SEP> G-4 <SEP> Cytotoxicity
<tb> Telomerase <SEP> Delta <SEP> Tm <SEP> A549
<tb> IC50) <SEP> M <SEP> C <SEP> IC50 <SEP> M
<tb> 1 <SEP> 3.3 <SEP> 2.6
<tb> 2 <SEP> 2 <SEP> 6.2
<tb> 3 <SEP> 0.87 <SEP> 4.5 <SEP> 6.0
<tb> 4 <SEP> 0.66 <SEP> 4. <SEP> 1
<Tb>
Claims (31)
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| FR0102461A FR2821355A1 (en) | 2001-02-23 | 2001-02-23 | CHEMICAL DERIVATIVES AND THEIR APPLICATION AS ANTITELOMERASE AGENT |
| PCT/FR2002/000645 WO2002068408A1 (en) | 2001-02-23 | 2002-02-21 | Chemical derivatives and the use thereof as an anti-elomerase agent |
| US10/079,500 US20030013711A1 (en) | 2001-02-23 | 2002-02-22 | Chemical derivatives and their application as antitelomerase agents |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| FR0102461A FR2821355A1 (en) | 2001-02-23 | 2001-02-23 | CHEMICAL DERIVATIVES AND THEIR APPLICATION AS ANTITELOMERASE AGENT |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| FR2821355A1 true FR2821355A1 (en) | 2002-08-30 |
Family
ID=8860350
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| FR0102461A Withdrawn FR2821355A1 (en) | 2001-02-23 | 2001-02-23 | CHEMICAL DERIVATIVES AND THEIR APPLICATION AS ANTITELOMERASE AGENT |
Country Status (2)
| Country | Link |
|---|---|
| FR (1) | FR2821355A1 (en) |
| WO (1) | WO2002068408A1 (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6887873B2 (en) | 2001-03-23 | 2005-05-03 | Aventis Pharma S.A. | Triazine derivatives and their application as antitelomerase agents |
| FR2850970B1 (en) * | 2003-02-07 | 2006-07-07 | Aventis Pharma Sa | CHEMICAL DERIVATIVES BINDING VERY SPECIFIC TO G-QUADRUPLEX DNA STRUCTURES AND THEIR APPLICATION AS A SPECIFIC ANTICANCER AGENT |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH0649062A (en) * | 1992-07-31 | 1994-02-22 | Mitsui Toatsu Chem Inc | Pyrimidinylamino-or triazinylaminoquinoline derivative and its production and agricultural and horticultural germicide containing the same as active ingredient |
| WO1999040087A2 (en) * | 1998-02-04 | 1999-08-12 | The Board Of Regents, The University Of Texas System | Inhibition of human telomerase by a g-quadruplex-interaction compound |
| WO2001040218A1 (en) * | 1999-11-29 | 2001-06-07 | Aventis Pharma S.A. | Arylamine derivatives and their use as anti-telomerase agent |
-
2001
- 2001-02-23 FR FR0102461A patent/FR2821355A1/en not_active Withdrawn
-
2002
- 2002-02-21 WO PCT/FR2002/000645 patent/WO2002068408A1/en not_active Application Discontinuation
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH0649062A (en) * | 1992-07-31 | 1994-02-22 | Mitsui Toatsu Chem Inc | Pyrimidinylamino-or triazinylaminoquinoline derivative and its production and agricultural and horticultural germicide containing the same as active ingredient |
| WO1999040087A2 (en) * | 1998-02-04 | 1999-08-12 | The Board Of Regents, The University Of Texas System | Inhibition of human telomerase by a g-quadruplex-interaction compound |
| WO2001040218A1 (en) * | 1999-11-29 | 2001-06-07 | Aventis Pharma S.A. | Arylamine derivatives and their use as anti-telomerase agent |
Non-Patent Citations (1)
| Title |
|---|
| PATENT ABSTRACTS OF JAPAN vol. 018, no. 282 (C - 1205) 30 May 1994 (1994-05-30) * |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2002068408A1 (en) | 2002-09-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1244650B1 (en) | Arylamine derivatives and their use as anti-telomerase agent | |
| FI106960B (en) | A process for the preparation of therapeutically active 1-phenylpyrido [2,3-d] pyrimidine-2,4-dione and 2-one derivatives | |
| EP1401833A2 (en) | Chemical derivatives and the use thereof as an anti-elomerase agent | |
| EP1373252A1 (en) | Chemical derivatives and their use as anti-telomerase agent | |
| US7482352B2 (en) | Chemical derivatives and their application as antitelomerase agents | |
| FR2850970A1 (en) | New quaternary aromatic nitrogen heterocycle derivatives that fix the G-quadruplex structure of DNA or RNA are telomerase inhibitors, useful in the treatment of cancers and some genetic disorders | |
| FR2821355A1 (en) | CHEMICAL DERIVATIVES AND THEIR APPLICATION AS ANTITELOMERASE AGENT | |
| US7179816B2 (en) | Chemical derivatives and their application as antitelomerase agents | |
| US20040053966A1 (en) | Chemical derivatives and their application as antitelomerase agent | |
| FR2819255A1 (en) | CHEMICAL DERIVATIVES AND THEIR APPLICATION AS ANTITELOMERASE AGENT | |
| CA2381968A1 (en) | Pharmaceutical compositions comprising 4-quinolones for treating cancers | |
| FR2822468A1 (en) | New arylamino-substituted triazine or diazine derivatives, used as telomerase inhibiting anticancer agents, by fixing the G-quadruplex structure of DNA or RNA | |
| US20030013711A1 (en) | Chemical derivatives and their application as antitelomerase agents | |
| WO2002012194A1 (en) | Phenantridine derivatives and their use as anti-telomerase agent | |
| FR2801588A1 (en) | Diarylamino diazine and triazine derivatives are telomerase inhibitors and G-quadruplex stabilizers, useful in the treatment of cancers | |
| FR2825090A1 (en) | New compounds as telomerase inhibitors that fix the G-quadruplex structure of DNA or RNA, useful in the treatment of cancers | |
| US20040034023A1 (en) | Use of polycyclic aromatic compounds for making medicines capable of inhibiting telomerase |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| ST | Notification of lapse |