EP1373252A1 - Chemical derivatives and their use as anti-telomerase agent - Google Patents

Chemical derivatives and their use as anti-telomerase agent

Info

Publication number
EP1373252A1
EP1373252A1 EP02720068A EP02720068A EP1373252A1 EP 1373252 A1 EP1373252 A1 EP 1373252A1 EP 02720068 A EP02720068 A EP 02720068A EP 02720068 A EP02720068 A EP 02720068A EP 1373252 A1 EP1373252 A1 EP 1373252A1
Authority
EP
European Patent Office
Prior art keywords
alkyl
radical
optionally substituted
amino
methyl
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP02720068A
Other languages
German (de)
French (fr)
Inventor
Patrick Mailliet
Abdelazize Laoui
Jean-François RIOU
Gilles Doerflinger
Jean-Louis Mergny
François HAMY
Thomas Caulfield
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Aventis Pharma SA
Original Assignee
Aventis Pharma SA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from FR0103916A external-priority patent/FR2822468B1/en
Application filed by Aventis Pharma SA filed Critical Aventis Pharma SA
Publication of EP1373252A1 publication Critical patent/EP1373252A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/14—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing three or more hetero rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/53—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with three nitrogens as the only ring hetero atoms, e.g. chlorazanil, melamine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/12—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings linked by a chain containing hetero atoms as chain links
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D405/00—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
    • C07D405/14—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing three or more hetero rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D453/00—Heterocyclic compounds containing quinuclidine or iso-quinuclidine ring systems, e.g. quinine alkaloids
    • C07D453/02—Heterocyclic compounds containing quinuclidine or iso-quinuclidine ring systems, e.g. quinine alkaloids containing not further condensed quinuclidine ring systems

Definitions

  • the present invention relates to cancer therapy and relates to new anticancer agents having a very specific mechanism of action. It also relates to new chemical compounds as well as their therapeutic application in humans.
  • the present invention relates to the use of new non-nucleotide chemical compounds that interact with ' "specific structures of deoxyribonucleic acid (DNA) or ribonucleic acid
  • RNA RNA
  • RNA RNA
  • RNA RNA
  • RNA RNA
  • telomerase inhibiting agents a distributing agent linked to two aminoaromatic groups.
  • telomerase inhibiting agents a distributing agent linked to two aminoaromatic groups.
  • They are particularly useful for stabilizing DNA in a G-quadruplex structure (guanine tetrads).
  • the therapeutic application of telomerase inhibition via the stabilization of these G-quadruplexes is the arrest of cell mitosis and the death of rapidly dividing cells such as cancer cells and possibly the induction of cell senescence cancerous.
  • telomerase makes it possible to add repeated DNA sequences of the TTAGGG type, called telomeric sequences, at the end of the telomer, during cell division.
  • telomerase makes the cell immortal.
  • the cell loses 100 to 150 bases each division, which makes it rapidly sinking.
  • telomeres maintained at a stable length during cell division.
  • telomerase was highly activated and that it allowed the addition of repeating motifs of telomeric sequences at the end of the telomer and therefore allowed the conservation of the length of the telomer in cancer cells. It has been shown for some time that more than 85% of cancer cells have positive tests for the presence of telomerase while somatic cells do not have this characteristic.
  • telomerase is a highly renowned target for treating cancer cells.
  • the first obvious approach to blocking telomerase was the use of nucleotide structures (Chen et al., Proc. Natl. Acad. Sci. USA 93 (7), 2635-2639).
  • nucleotide structures Chon et al., Proc. Natl. Acad. Sci. USA 93 (7), 2635-2639.
  • G-quadruplexes which are perylenic compounds and carbocyanines containing at least seven rings including two heterocycles.
  • the compounds of the present invention which meet the objective that is to say, securing the G-quadruplex structure of DNA or RNA and in particular the G-quadruplex structure of telomers and thereby 'have a activity inhibitor of ' telomerases correspond to the following general formula: nitrogen aromatic cycle - NR 3 - distributor - NR' 3 - aromatic cycle in which
  • a quinoline or isoquinoline optionally substituted by at least one radical chosen from a group N (Ra) (Rb) in which Ra and Rb, identical or different, represent hydrogen or a C1-C4 alkyl radical, and one or more group (s) C1-C4 alkoxy or short chain alkyl linked to a carbon or nitrogen atom of the quinoline or isoquinoline ring or a quinoline or isoquinoline having a nitrogen atom in quaternary form or
  • the aromatic ring represents 0 a quinoline or isoquinoline optionally substituted by at least one radical chosen from a group N (Ra) (Rb) in which Ra and Rb, identical or different represent hydrogen or a C1-C4 alkyl radical, and one or more alkoxy or short chain C1-C4 alkyl group (s) linked to a carbon or nitrogen atom of the quinoline or isoquinoline ring or
  • C1-C4 amino, C1-C4 alkylamino, C1-C4 dialkylamino for each alkyl group and the alkyl parts of which can together form a C3-C8, nitro ring; C1-C4 alkyleneeamino; alkenylene ino in C2-C4;
  • the distributor represents: a triazine group optionally substituted by an aromatic ring as defined above or by a radical XR1 (R2) in which X represents a nitrogen atom N to form NR1R2, a linear or branched alkyl radical in C1 -C6 to form alkRlR2, an oxygen atom 0 to form
  • OR1 or a sulfur atom S to form SRI, with RI and R2 - identical or different are chosen from the hydrogen atom; a C1-C8 alkyl radical optionally substituted by one or more identical or different radicals; an aromatic ring as defined above optionally substituted; a quinuclidine radical; a pyrrolidinyl radical itself optionally substituted by an alkyl or phenylalkyl radical with alkyl C1-C4; a piperazinyl radical or
  • Homopiperazinyl itself optionally substituted by an alkyl, cycloalkyl or phenylalkyl radical; a morpholinyl radical; a pyridyl, piperidinyl radical or a piperidyl radical
  • alkyl or phenylalkyl radicals with C1-C4 alkyl; an indazolyl radical; a naphthyl radical; a benzotriazole radical; a radical
  • Benzoimidazolyl a pyrimidinyl radical optionally substituted by one or more alkyl with C1-C4 alkyl; an acenaphthene radical; an amino radical itself optionally substituted by a
  • RI and R2 do not represent one hydrogen and the other unsubstituted C1-C4 alkyl or when X represents N or alkyl, RI and R2 form, together with X to which they are linked, a monocyclic radical of 3 to 6 members or bicyclic of 8 to 10 members saturated or unsaturated optionally containing one or two identical or different hetero atoms chosen from N, 0 or S, this radical being optionally substituted, - a diazine group optionally substituted by the same groups as triazine or one of its salts, these compounds being in all the possible racemic, enantiomeric and diastereoisomeric isomer forms.
  • the subject of the present invention is the compounds as defined above, characterized in that they correspond to the following general formula: nitrogen aromatic cycle - NR 3 - distributor - NR ' 3 - aromatic cycle in which
  • a quinoline or isoquinoline optionally substituted by at least one radical chosen from a group N (Ra) (Rb) in which Ra and
  • Rb identical or different, represent hydrogen or a C1-C4 alkyl radical, and a C1-C4 short chain alkoxy or alkyl group or 0 a quinoline or isoquinoline having a nitrogen atom in quaternary form or 0 a benzamidine or
  • quinoline optionally substituted by at least one radical chosen from a group
  • Ra and Rb which are identical or different, represent hydrogen or a C1-C4 alkyl radical, and an alkoxy or short-chain C1-C4 alkyl group or 0 a quinoline having a d atom '' nitrogen in quaternary form or
  • C4 cyano; carbonylamino optionally substituted with one or more C1-C4 alkyl groups; guanyl; C1-C4 alkylthio; a ino, C1-C4 alkylamino, C1-C4 dialkylamino for each alkyl group and the alkyl parts of which can together form a C3-C8 ring, nitro; C1-C4 alkyleneeamino; C2-C4 alkenyleneamino; 0 a heterocyclic mono or bi or tricyclic ring comprising 0 to 2 heteroatoms per cycle provided that at least one heteroatom is present in at least one ring optionally substituted by one or more C1-C4 alkyl groups or by alkylene groups C1-C4 or C2-C4 alkenylene • R3 and R'3, identical or different, independently of one another represent hydrogen or a C1-C4 alkyl radical
  • the distributor represents: - a triazine group optionally substituted by an aromatic ring as defined above or by an XR1 (R2) radical in which X represents a nitrogen atom N to form NR1R2, a linear or branched alkyl radical in C1-C6 to form alkRlR2, an oxygen atom 0 to form OR1 or a sulfur atom S to form SRI, with Ri and R2 identical or different are chosen from the hydrogen atom; a C1-C8 alkyl radical optionally substituted by one or more identical or different radicals; an aromatic cycle as defined above; a quinuclidine radical; a pyrrolidinyl radical itself optionally substituted by an alkyl or phenylalkyl radical with C1-C4 alkyl; a piperazinyl radical itself optionally substituted by an alkyl, cycloalkyl or phenylalkyl radical; a morpholinyl radical; a pyridyl radical or a
  • RI and R2 identical do not both represent hydrogen or C1-C4 unsubstituted alkyl and Ri and R2 different do not represent one hydrogen and the other C1-C4 alkyl unsubstituted or when X represents N or alkyl ,
  • RI and R2 together with X to which they are linked form a 3 to 6-membered monocyclic or 8 to 10-membered bicyclic radical, saturated or unsaturated, optionally containing one or two identical or different heteroatoms chosen from N, 0 or S, an optionally diazine group substituted by the same groups as triazine or one of its salts, these compounds being in all the possible racemic, enantiomeric and diastereoisomeric isomer forms.
  • R1 and R2 represents (s) a C1-C8 alkyl radical optionally substituted by one or several identical or different radicals
  • these radicals are chosen from the following radicals: the amino radical itself optionally substituted by one or two identical or different radicals chosen from the alkyl, hydroxyalkyl, alkoxyalkyl, alkylphenylalkyl radicals, phenylalkyl, carboxyalkyl, hydroxycarboxyalkyl, acyl naphthyl, phenyl and alkylphenyl; the trialkylammonio radical; hydroxy radicals; C1-C4 alkoxy; thioalkoxy; trifluoromethyl; acyl; free, salified, esterified or amidified carboxy; imidazolyl; pyrrolidinyl optionally substituted with C1-C4 alkyl; piperidyl and piperaz
  • the distributor represents: a triazine group optionally substituted by an aromatic ring as defined above or by a radical XR1 (R2) in which X represents a nitrogen atom
  • N to form NR1R2, a linear or branched C1-C6 alkyl radical to form alkRlR2, an oxygen atom 0 to form 0R1 or a sulfur atom S to form ' SRI, with Ri and R2 identical or different are chosen from l 'hydrogen atom; C1-C8 alkyl optionally substituted by one or more radicals chosen from amino, alkyla ino, dialkyla ino, alkoxyalkylamino, dialcoxyalkylamino, hydroxyalkylamino, dihydroxyalkylamino, hydroxycarboxyalkylamino, trial ylamino +, naphtyla ino, phenyla ino radicals, acylamino (alkyl) (phenylalkyl) amino, (phenyl) (alkyl) amino,
  • alkylphenyl (alkyl) (alkyl) amino, hydroxy, C1-C4 alkoxy, C1-C4 thioalkoxy, trifluoromethyl, acyl, free, salified, esterified or amidated carboxy, imidazolyl, pyrrolidinyl optionally substituted by C1-C4 alkyl, piperidyl, piperazinyl and possible homopiperazinyl-
  • Morpholinyl a pyridyl radical or a piperidyl radical optionally substituted by one or more alkyl or phenylalkyl radicals with C1-C4 alkyl; an indazolyl radical; a radical
  • Naphthyl a benzotriazole radical; a pyrimidinyl radical optionally substituted by one or more alkyl with C1-C4 alkyl; an acenaphthene radical, it being understood that when XR1R2 represents 35 NR1R2, then RI and R2 identical do not not both represent hydrogen or C1-C4 unsubstituted alkyl and RI and R2 different do not represent one hydrogen and the other C1-C4 alkyl unsubstituted or else when X represents N or alkyl, RI and R2 form together with X to which they are linked a radical chosen from the following radicals: piperazinyl or homopiperazinyl optionally substituted by one or more identical or different radicals / pyrrolidinyl optionally substituted by C1-C4 alkyl or alkoxy, hydroxy, acylamino, pyrrolidinylalkyl, pyridinyl and pyridyl
  • XR1 is such that when X represents N, either one of RI and R2 represents the hydrogen atom or a C1-C4 alkyl radical optionally substituted by amino, alkylamino, dialkylamino or phenyl, and the other of RI and R2 is chosen from the values defined for RI and R2 in any one of claims 1 to 5, either RI and R2 together with the nitrogen atom to which they are linked a cyclic radical chosen from the following radicals: a piperazinyl or homopiperazinyl is optionally substituted by one or more radicals selected from alkyl, aminoalkyl, alkylaminoalkyl, dialkyla inoalkyle, phenylalkyl, alkoxyalkyl , hydroxyal
  • RI and R2 represents (s) a C1-C8 alkyl radical optionally substituted by one or more identical or different radicals, these radicals are chosen from the amino radical itself optionally substituted by one or two identical or different radicals chosen from the alkyl, hydroxyalkyl, alkoxyalkyl, phenylalkyl, carboxyalkyl, hydroxycarboxyalkyl, acyl, naphthyl, phenyl and alkylphenyl radicals; the trialkylam onio radical; hydroxy radicals; C1-C4 alkoxy; thioalkoxy; trifluoromethyl; free, salified, esterified or amidified carboxy; pyrrolidinyl optionally substituted with C1-C4 alkyl; piperidyl; piperazinyl optionally substituted by alkyl or phenylalkyl with C1-C4 alkyl;
  • the distributor represents: a triazine group optionally substituted by an aromatic ring such as - defined above or by a radical XR1 (R2) in which X represents a nitrogen atom N to form NR1R2, a linear or branched C1-C6 alkyl radical to form alkRlR2, an oxygen atom O to form ORl or a sulfur atom S to form SRI, with RI and R2 identical or different are chosen from the hydrogen atom;
  • C1-C8 alkyl optionally substituted by one or more radicals chosen from amino, alkylamino, dialkylamino, dialkoxyalkylamino, dihydroxyalkylamino, alkoxyalkylamino, hydroxyalkylamino,
  • alkylamino and dialkylamino an aromatic cycle as defined above; a quinuclidine radical; a pyrrolidinyl radical itself optionally substituted by an alkyl radical or
  • RI and R2 form, together with X to which they are linked, a radical chosen from the following radicals: piperazinyl optionally substituted by one or
  • pyrrolidinyl optionally substituted with C1-C4 alkyl or alkoxy, hydroxy, acylamino, pyrrolidinylalkyl and pyridyl; 1, 2, 3, 4-tetrahydroiso-
  • Alkyl Alkyl; morpholinyl; imidazolinyl optionally substituted with alkyl, or a diazine group optionally substituted with the same groups as triazine or a salt thereof, these compounds being in all the possible racemic, enantiomeric and diastereoisomeric isomeric forms.
  • XR1 is such that when X represents N, either one of RI and R2 represents the hydrogen atom or an alkyl radical in C1 -C4 optionally substituted with an amino, alkylamino, dialkylamino or phenyl radical and the other of RI and R2 is chosen from the values defined for RI and R2 in any one of claims 1 to 8, either Ri and R2 form together with l nitrogen atom to which they are linked a piperazinyl radical optionally substituted by one or more radicals chosen from alkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, phenylalkyl, alkoxyalkyl, hydroxyalkyl, hydroxyalkoxyalkyl with C3-C8 cycloalkyl, pyrazinyl , pyrimidinyl, pyridyl, furylcarbonyl, furfurycarbonyl
  • the subject of the present invention is the compounds fixing the G-quadruplex structure of telomeres characterized in that they correspond to the general formula as defined above.
  • the present invention thus relates to compounds as defined above, characterized in that they correspond to the following general formula: nitrogen aromatic cycle - NR 3 - distributor - NR ' 3 - aromatic cycle in which
  • a quinoline optionally substituted by at least one N (Ra) (Rb) group in which Ra and Rb, which are identical or different, represent hydrogen or a C1-C4 alkyl radical, (or) an alkoxy or short-chain alkyl group in C1-C4 or
  • Rb identical or different, represent hydrogen or a C1-C4 alkyl radical, (or) a C1-C4 short chain alkoxy or alkyl group or 0 a quinoline having a nitrogen atom in quaternary form or
  • C4 cyano; carbonyla ino possibly substituted with one or more C1-C4 alkyl groups; guanyl; C1-C4 alkylthio; amino, C1-C4 alkylamino, C1-C4 dialkylamino for each alkyl group and the alkyl parts of which can together form a C3-C8, nitro ring; C1-C4 alkyleneeamino; C2-C4 alkenyleneamino,
  • heterocyclic ring mono or bi or tricyclic, comprising 0 to 2 heteroatoms per cycle, provided that at least one heteroatom is present in at least one ring optionally substituted by one or more C1-C4 alkyl groups or by alkylene groups C1-C4 or C2-C4 alkenylene
  • R3 and R'3, identical or different, independently of one another represent hydrogen or a C1-C4 alkyl radical
  • the distributor represents: a triazine group optionally substituted by an XR1 (R2) radical in which X represents a nitrogen atom N to form NR1R2, a linear or branched C1-C6 alkyl radical to form alkRlR2, an oxygen atom O to form ORl or a sulfur atom S to form SRI, with RI and R2 identical or different are chosen from the hydrogen atom;
  • C1-C8 alkyl optionally substituted by an amino, alkylamino, dialkylamino, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino, C1- alkoxy radical C4, C1-C4 thioalkoxy, trifluoromethyl, pyrrolidinyl, piperidyl, piperazinyl, morpholinyl, pyridyl or pheny
  • RI and R2 together with X to which they are linked form a 3 to 6-membered monocyclic or 8 to 10-membered bicyclic radical, saturated or unsaturated, optionally containing one or two identical or different heteroatoms chosen from N, 0 or S, an optionally diazine group substituted by the same groups as triazine or one of its salts, these compounds being in all the possible racemic, enantiomeric and diastereoisomeric isomer forms.
  • nitrogen aromatic cycle means a heterocycle comprising at least one nitrogen atom or an aromatic group not comprising a heteroatom in the cycle but containing at least one nitrogen atom in a hydrocarbon chain linked to the ring such as for example a guanidino or guanyl chain.
  • the aromatic ring represents in particular a quinaldine, quinoline, benzamidine, pyridine and phenyl radical as defined above and optionally substituted as indicated above.
  • C3-C8 ring which the alkyl parts of the dialkylamino radicals defined above can form mention may, for example, be made of them.
  • alkyl radical designates linear or branched radicals in particular methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, hexyl, isohexyl and also heptyl, octyl, nonyl and decyl radicals as well as their linear or branched position isomers
  • radical - alkoxy designates linear or branched radicals in particular - methoxy, ethoxy, propoxy, isopropoxy, linear, secondary or tertiary butoxy, pentoxy or hexoxy radicals as well as their linear position isomers or branched
  • radical - alkoxy designates linear or branched radicals in particular - methoxy, ethoxy, propoxy, isopropoxy, linear, secondary or tertiary butoxy, pentoxy or hexoxy radicals as well
  • halogen atom designates the chlorine, fluorine, bromine or iodine atoms, and in particular chlorine and fluorine atoms
  • cycloalkyl radical designates the cyclohexyl, cyclopropyl, cyclobutyl radicals and also the cycloheptyl and cyclooctyl radicals
  • alkylphenyl denotes a phenyl radical substituted by one or more alkyl radicals as defined above linear or branched preferably containing at most 4 carbon atoms
  • NH (alk) and N (alk) (alk) denote a radical amino substituted respectively by one or two alkyl radicals, such alkyl radicals being linear or branched and preferably containing at most 4 carbon atoms
  • acylamino designates the radicals -C (0) -NH2, -C (0) -NH ( alk) and -C (O) -N (alk) (alk)
  • acyl denotes a radical RC (O) - in which R represents a radical chosen from the hydrogen atom, linear or branched alkyl radicals containing at most 8 carbon atoms or a saturated or unsaturated carbocyclic or heterocyclic radical, chosen for example from the aromatic or non-aromatic rings defined above: the term acyl thus denotes for example the formyl, acetyl, propionyl, butanoyl, pentanoyl, hexanoyl, benzoyl, pyrrolidinylcarbonyl, pyrazinylcarbonyl, piperazinylcarbonyl, furylcarbonyl or furfurylcarbonyl radicals.
  • the carboxy radical (s) of the products of formula (I) can be salified or esterified by various groups known to those skilled in the art, among which there may be mentioned, for example:
  • mineral bases such as, for example, an equivalent of sodium, potassium, lithium, calcium, magnesium or ammonium or organic bases such as, for example, methylamine, propylamine, trimethylamine, diethylamine, triethylamine, N, N-dimethylethan ⁇ lamine, tris (hydroxymethyl) amino methane, ethanolamine, pyridine, picoline, dicyclohexylamine, morpholine, benzylamine, procaine, lysine, arginine, histidine, N- methylglucamine
  • the alkyl radicals to form alkoxy carbonyl groups such as, for example, methoxycarbonyl, ethoxycarbonyl, tert-butoxycarbonyl or benzyloxycarbonyl, these alkyl radicals being able to be substituted by radicals chosen for example from atoms of halogen, hydroxyl, alkoxy, acyl, acyloxy, alkylthio, amino or aryl radicals, such as, for example, in chloromethyl, hydroxypropyl, methoxymethyl, propionyloxy ethyl, methylthiomethyl, dimethylaminoethyl, benzyl or phenethyl groups.
  • the addition salts with mineral or organic acids of the products of formula (I) can be, for example, the salts formed with hydrochloric, hydrobromic, hydroiodic, nitric, sulfuric, phosphoric, propionic, acetic, trifluoroacetic, formic acids, benzoic, maleic, fu aric, succinic, tartaric, citric, oxalic, glyoxylic, aspartic, ascorbic, alkylmonosulfonic acids such as for example methanesulfonic acid, ethanesulfonic acid, propanesulfonic acid such as for example methanedisulfonic acid, alpha acid, beta-ethane disulfonic acid, arylmonosulfonic acids such as benzenesulfonic acid and aryldisulfonic acids.
  • salts of acceptable products of formula (I) are in particular usable, non-toxic salts: such salts of products of formula (I) as defined above can be obtained by the ordinary methods known to a person skilled in the art, for example by combining a compound of formula (I) with an organic or inorganic acid or a base in a solvent or a dispersant or from another salt by cation or anion exchange.
  • stereoisomerism can be defined in its broad sense as the isomerism of compounds having the same developed formulas, but whose different groups are arranged differently in space, such as in particular in monosubstituted cyclohexanes whose substituent can be in an axial or equatorial position, and the different possible rotational conformations of the ethane derivatives.
  • stereoisomerism due to the different spatial arrangements of substituents attached, either on double bonds or on rings, which is often called geometric isomerism or cis-trans isomerism.
  • stereoisomers is used in the present application in its broadest sense and therefore relates to all of the compounds indicated above.
  • the subject of the present invention is in particular the compounds as defined above, characterized in that the distributor represents: - a triazine group optionally substituted by a radical XR1 (R2) in which X represents a nitrogen atom N to form NR1R2 , an oxygen atom O to form OR1 or a sulfur atom S to form SRI, with Ri and R2 identical or different are chosen from the hydrogen atom; C1-C8 alkyl optionally substituted by an amino radical, alkylamino, dialkylamino, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino, C1-C4 alkoxy, by a pyrrolidinyl, pyridyl radical or by a phenyl radical; an aromatic ring as defined above 7 a quinuclidine radical, a pyrrolidinyl radical or a piperidyl radical optionally substituted with C1-C4 alkyl, it being understood that identical Ri and
  • the present invention particularly relates to the compounds as defined above, characterized in that the diazine groups are pyrimidines or quinazolines.
  • a more particular subject of the present invention is the compounds as defined above, characterized in that XR1 (R2) is such that when X represents N, that is one of Ri and R2 represents the hydrogen atom and the other of Ri and R2 is chosen from the values defined for RI and R2, that is to say RI and R2 form, together with the nitrogen atom to which they are linked, a piperazinyl, pyrrolidinyl, piperidyl or morpholino radical.
  • the present invention particularly relates to compounds as defined above, characterized in that they correspond to formula (I) below:
  • A represents a radical XR1 (R2) in which X represents a nitrogen, oxygen or sulfur atom or a C1-C6 alkyl radical to form one of the following radicals:
  • NR1R2 with RI and R2 identical or different are chosen from the hydrogen atom; a C1-C8 alkyl radical optionally substituted by one or more identical or different radicals; an aromatic cycle as defined above; a quinuclidine radical; a pyrrolidinyl radical itself optionally substituted by an alkyl or phenylalkyl radical with C1-C4 alkyl; a piperazinyl or homopiperazinyl radical itself optionally substituted by an alkyl, cycloalkyl or phenylalkyl radical; a radical morpholinyl; a pyridyl, piperidinyl or a piperidyl radical optionally substituted by one or more alkyl or phenylalkyl radicals with C1-C4 alkyl; an indazolyl radical; a naphthyl radical; a benzotriazole radical; a benzimidazolyl radical; a pyrimidinyl radical optional
  • R3 and R'3 identical or different, independently of one another represent hydrogen or a C1-C4 alkyl group
  • a quinoline or isoquinoline motif optionally substituted by at least one radical chosen from a group N (Ra) (Rb) in which Ra and Rb, which are identical or different, represent hydrogen or a C1-C4 alkyl radical, and one or more C1-C4 alkoxy or short chain alkyl group (s) linked to a carbon or nitrogen atom of the quinoline or isoquinoline ring or
  • • Ari and Ar 2 both represent one of the possibilities mentioned above for • Ari represents one of the possibilities above and Ar 2 represents * a phenyl ring optionally substituted by a halogen group, C1-C4 alkoxy, cyano, carbonylamino optionally substituted by one or more C1-C4 alkyl groups, guanyl, C1-C4 alkylthio, amino, C1-C4 alkylamino, dialkylamino in C1-C4 for each alkyl, nitro, C1-C4 alkyleneamino, (or) alkenylene-amino in C2-C4, or a piperazinyl radical optionally substituted by a C1-C4 alkyl radical,
  • RI and R2 represents (s) a C1-C8 alkyl radical optionally substituted by a or more identical or different radicals, these radicals are chosen from the amino radical itself optionally substituted by one or two identical or different radicals chosen from the alkyl, hydroxyalkyl, alkoxyalkyl, phenylalkyl, carboxyalkyl, hydroxycarboxyalkyl, acyl, naphthyl, phenyl and alkylphenyl; the trialkylammonio radical; hydroxy radicals; alkoxy; thioalkoxy; trifluoromethyl; acyl; free, salified, esterified or identified carboxy; ' imidazolyle; pyrrolidinyl optionally substituted with C1-C4 alkyl; piperidyl and piperazinyl optionally substituted by alkyl or phenylalky
  • XR1 is such that when X represents N, that is one of RI and R2 represents the atom of hydrogen and the other of RI and R2 is chosen from the values defined above for RI and R2, ie RI and R2 form, together with the nitrogen atom to which they are linked, a piperazinyl, homopiperazinyl, pyrrolidinyl, piperidyl radical , pyridinyl, morpholinyl, thiomorpholinyl, imidazolinyl, diazepine, 1, 2, 3, 4-tetrahydroquinoline or 1, 2, 3, 4-tetrahydroisoquinoline, all these radicals being optionally substituted by one or more radicals as defined above.
  • A represents an aromatic ring as defined above or a radical XR1 (R2) in which X represents an atom d nitrogen N to form NR1R2, a linear or branched alkyl radical C1-C6 for forming alkRlR2 a dpf oxygen O to form ENT or S sulfur atom to form SRI with RI and the same or different R 2 are selected from the hydrogen atom;
  • C1-C8 alkyl optionally substituted by one or more radicals chosen from amino, alkylamino, dialkylamino, dialkoxyalkylamino, dihydroxyalkylamino, alkoxyalkylamino, hydroxyalkylamino, hydroxycarboxyalkylamino, trialkylammonium, naphthylamino, phenylamino, acylamino) alkyl (phenylalkyl) radicals ) amino, alkylamino, dialkylamino, dialkoxyalkylamino, dihydroxyalky
  • XR1 is such that when X represents N, either one of RI and R2 represents the atom d hydrogen or a C1-C4 alkyl radical optionally substituted by an amino, alkylamino, dialkylamino or phenyl radical and the other of RI and R2 is chosen from the values defined for RI and R2 in any one of Claims 1 to 8 either Ri and R2 form, together with the nitrogen atom to which they are linked, a piperazinyl or homopiperazinyl radical optionally substituted by one or more radicals chosen from alkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, phenylalkyl, alkoxyalkyl, hydroxyalkyl, dihydroxyalkyl, hydroxyalkoxyalkyl with C1-C6 alkoxy, imidazolyl-aminoalkyl, imi
  • the present invention particularly relates to compounds of formula (I) as defined above, characterized in that they correspond to the following formula:
  • A represents a radical XR1 (R2) in which X represents a nitrogen, oxygen or sulfur atom or a C1-C6 alkyl radical to form one of the following radicals:
  • NR1R2 with RI and R2 identical or different are chosen from the hydrogen atom; C1-C8 alkyl optionally substituted by one or more identical or different radicals; an aromatic cycle as defined above; a quinuclidine radical; a pyrrolidinyl radical itself optionally substituted by an alkyl or phenylalkyl radical with C1-C4 alkyl; a piperazinyl radical itself optionally substituted by an alkyl, cycloalkyl or phenylalkyl radical; a morpholinyl radical; a pyridyl radical or a piperidyl radical optionally substituted by one or more alkyl or phenylalkyl radicals with C1-C4 alkyl; an indazolyl radical; a naphthyl radical; a benzotriazole radical; a pyrimidinyl radical optionally substituted by one or more alkyl with C1-C4 alkyl; an acenap
  • RI and R2 do not both represent hydrogen or unsubstituted C1-C4 alkyl and different RI and R2 do not represent one hydrogen and the other unsubstituted C1-C4 alkyl or when X represents N or alkyl,
  • Ri and R2 form, together with X to which they are linked, a 3 to 6-membered monocyclic or 8 to 10-membered bicyclic radical, saturated or unsaturated, optionally containing one or two identical or different heteroatoms chosen from N, O or S,
  • Ri has the same meaning as above, it being understood that RI does not represent hydrogen or unsubstituted C1-C4 alkyl, or • an alkyl group containing 1 to 6 carbon atoms substituted by Ri R2 as defined above
  • R3 and R'3 identical or different, independently of one another represent hydrogen or a C1-C4 alkyl group
  • a quinoline unit optionally substituted by at least one N (Ra) (Rb) group in which Ra and Rb, which are identical or different, represent hydrogen or a C1-C4 alkyl radical, (or) a short-chain alkoxy or alkyl group containing 1 to 4 carbon atoms or • a quinoline having a nitrogen atom in quaternary form or
  • a phenyl ring optionally substituted by a halogen group, C1-C4 alkoxy, cyano, carbonylamino optionally substituted by one or more C1-C4 alkyl groups, guanyl, C1-C4 alkylthio, amino, C1-C4 alkylamino, dialkylamino in C1-C4 for each alkyl, nitro, C1-C4 alkyleneamino, (or) C2-C4 alkenyleneamino, or a piperazinyl radical optionally substituted by a C1-C4 alkyl radical,
  • the present invention relates in particular to the compounds as defined above, characterized in that when one or both of R1 and R2 represents (s) a C1-C8 alkyl radical optionally substituted by one or more identical or different radicals, these radicals are chosen from the amino radical itself optionally substituted by one or two identical or different radicals chosen from the alkyl, hydroxyalkyl, alkoxyalkyl, phenylalkyl, carboxyalkyl, hydroxycarboxyalkyl, acyl, naphthyl, phenyl and alkylphenyl radicals; the trialkyla monio radical; hydroxy radicals; alkoxy; thioalkoxy; trifluoromethyl; free, salified, esterified or amidified carboxy; pyrrolidinyl optionally substituted with C1-C4 alkyl; piperidyl; piperazinyl optionally substituted by alkyl or phenylalkyl with C1-C4 alkyl; morpholinyl
  • the present invention thus relates to the compounds as defined above, characterized in that XR1 (R2) is such that when X represents N, either one of Ri and R2 represents the hydrogen atom and the other of Ri and R2 is chosen from the values defined for RI and R2, ie Ri and R2 form, together with the nitrogen atom to which they are linked, a piperazinyl, pyrrolidinyl, piperidyl, morpholinyl, thiomorpholinyl, i idazolinyl, diazepine or 1,2 radical, 3, 4-tetrahydro-isoquinoline, all these radicals being optionally substituted by one or more radicals.
  • A represents an aromatic ring as defined above or a radical XR1 (R2) in which X represents a nitrogen atom N to form NR1R2, a linear or branched C1-C6 alkyl radical to form alkRlR2, an oxygen atom O to form OR1 or a sulfur atom S to form SRI, with RI and R2 identical or different are chosen from the hydrogen atom;
  • C1-C8 alkyl optionally substituted by one or more radicals chosen from amino, alkylamino, dialkylamino, dialkoxyalkylamino, dihydroxyalkylamino, alkoxyalkylamino, hydroxyalkylamino, hydroxycarboxy-alkylamino, trialkylammonio, naphthylamino, phenylamino, alkyl) amino radicals , (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino radicals , (phenyl) (alkyl) amino
  • XR1 is such that when X represents N, either one of RI and R2 represents the hydrogen atom or an alkyl radical in C1 -C4 optionally substituted with an amino, alkylamino, dialkylamino or phenyl radical and the other of RI and R2 is chosen from the values defined for RI and R2 in any one of claims 1 to 8, either RI and R2 form together with l nitrogen atom to which they are linked a piperazinyl radical optionally substituted by one or more radicals chosen from alkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, phenylalkyl, alkoxyalkyl, hydroxyalkyl, hydroxyalkoxyalkyl with alkoxy, pyrrolidinylalkyl, cycloalkyl C3-C8, pyrazinyl, pyrimidinyl, pyridyl
  • the present invention thus relates to the compounds defined above fixing the G-quadruplex structure of telomeres characterized in that they correspond to formula (I) below:
  • A represents a radical XR1 (R2) in which X represents a nitrogen, oxygen or sulfur atom or a C1-C6 alkyl radical to form one of the following radicals:
  • NR1R2 with RI and R2 identical or different are chosen from the hydrogen atom; C1-C8 alkyl optionally substituted by an amino, alkylamino, dialkylamino, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino radical, C1-C4 alkoxy, C1-C4 thioalkoxy, trifluoromethyl, pyrrolidinyl, piperidyl, piperazinyl, morpholinyl, pyridyl or phenyl; an aromatic ring as defined in claim 1; a quinuclidine radical, a pyrrolidinyl, piperazinyl, morpholinyl, pyridyl radical or a piperidyl radical optionally substituted with C1-C4 alkyl, it being understood that identical RI and R2 do not both represent hydrogen or unsubstituted C1-C4 alkyl and RI and R2 are different do not represent
  • R3 and R'3 identical or different, independently represent one of the other 1 'hydrogen and a C1-C4 alkyl group
  • a quinoline motif optionally substituted by at least one N (Ra) (Rb) group in which Ra and Rb are identical or different represent hydrogen or a C1-C4 alkyl radical, (or) a short-chain alkoxy or alkyl group containing 1 to 4 carbon atoms or • a quinoline having a nitrogen atom in quaternary form or
  • the present invention also relates to the new compounds characterized in that they correspond to formula (I) below:
  • A represents a radical XR1 (R2) in which X represents a nitrogen, oxygen or sulfur atom or a C1-C6 alkyl radical to form one of the following radicals:
  • NR1R2 with RI and R2 identical or different are chosen from the hydrogen atom; C1-C8 alkyl optionally substituted by amino, alkylamino, dialkylamino, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino, C1-C4 alkoxy, C1-C4 thioalkoxy, trifluoromethyl, pyrrolidinyl, piperidyl, piperazinyl , morpholinyl, pyridyl or phenyl; an aromatic ring as defined in claim 1; a quinuclidine radical, a pyrrolidinyl, piperazinyl, morpholinyl, pyridyl radical or a piperidyl radical optionally substituted by C1-C4 alkyl it being understood that identical RI and R2 do not both represent hydrogen or unsubstituted C1-C4 alkyl and different RI and R2 do not represent one hydrogen and
  • R3 and R'3 identical or different, independently of one another represent hydrogen or a C1-C4 alkyl group
  • a quinoline unit optionally substituted by at least one N (Ra) (Rb) group in which Ra and Rb, which are identical or different, represent hydrogen or a C1-C4 alkyl radical, (or) a short-chain alkoxy or alkyl group containing 1 to 4 carbon atoms or
  • A represents a radical XRl (R2) in which X represents a nitrogen atom N to form NR1R2, an oxygen atom O for form OR1 or a sulfur atom S to form SRI as follows: • NR1R2 with RI and R2 identical or different are chosen from the hydrogen atom; C1-C8 alkyl optionally substituted by an amino, alkylamino, dialkylamino, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino, C1-C4 alkoxy radical, by a pyrrolidinyl, pyridyl radical or by a phenyl radical; an aromatic ring as defined in claim 1; a quinuclidine radical, a pyrrolidinyl radical or a piperidyl radical optionally substituted by C1-C4 alkyl, it being understood that identical RI and R2 do not
  • R1 and R2 can form, together with the nitrogen atom to which they are linked, a piperazinyl, homopiperazinyl, pyrrolidinyl, piperidyl or morpholinyl radical which may be substituted, for example by alkyl or piperidyl.
  • the present invention relates more precisely to the compounds of formula (I) as defined above in which when A represents NR1R2 either one of RI and R2 represents the hydrogen atom and the other of RI and R2 is chosen among the values defined for RI and R2, that is to say RI and R2 form together with the nitrogen atom to which they are linked a piperazinyl, pyrrolidinyl, piperidyl or morpholinyl radical.
  • a subject of the present invention is also the compounds defined above, characterized in that Ari and Ar 2 represent a group chosen from the following groups: 4-amino- or 4-methylamino- or 4-dimethylamino-quinolyl, -isoquinolyl, quinolinium or isoquinolinium in which the quinolyl, isoquinolyl, quinolinium or isoquinolinium nucleus is optionally substituted by one or more methyl group (s) linked to a carbon or nitrogen atom in the ring; or phenyl optionally substituted by one or more halogen atoms.
  • Ari and Ar 2 represent a group chosen from the following groups: 4-amino- or 4-methylamino- or 4-dimethylamino-quinolyl, -isoquinolyl, quinolinium or isoquinolinium in which the quinolyl, isoquinolyl, quinolinium or isoquinolinium nucleus is optionally substituted by one or more methyl group (s) linked to
  • the present invention thus relates to the compounds defined above, characterized in that the group A represents: either an amino radical substituted by a radical chosen from the following groups: 4-amino- or 4-methylamino- or 4-dimethylamino- quinolyl, -isoquinolyl, quinolinium or isoquinolinium in which the quinolyl, isoquinolyl, quinolinium or isoquinolinium nucleus is optionally substituted by one or more methyl group (s) linked to a carbon or nitrogen atom in the ring; pyridyle; phenyl optionally substituted by one or more halogen atoms or by a piperazinyl or alkylpiperazinyl radical; C1-C4 alkyl substituted by an amino, alkylamino or dialkylamino, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino, C2-alkoxy, alkoxy radical by an alkylpiperaziny
  • a pyrrolidinyl radical either a morpholino radical or a piperazinyl radical optionally substituted by a C1-C4 alkyl or piperidyl radical, or an 0-phenyl, O-pyridyl, or O-alkyl radical substituted by an amino, alkylamino or dialkylamino radical
  • a subject of the present invention is thus the compounds defined above, characterized in that when Ari and Ar 2 are identical, Ari and Ar 2 represent a group chosen from the groups 4-amino- or 4-methylamino- or 4-dimethylamino-quinolyl , -isoquinolyl, quinolinium or isoquinolinium in which the quinolyl, isoquinolyl, quinolinium or isoquinolinium nucleus is optionally substituted by one or more methyl group (s) linked to a carbon or nitrogen atom in the ring.
  • the present invention relates even more precisely to the compounds of formula (I) as defined above in which the group A represents: or an amino radical substituted by a radical chosen from the following groups: 4-amino- or 4-methylamino- or 4-dimethylamino-quinolyl or quinolinium in which the quinolinium ring is optionally substituted by a methyl group; pyridyle; phenyl optionally substituted by one or more halogen atoms or by a piperazinyl or alkylpiperazinyl radical; C1-C4 alkyl substituted by an amino, alkylamino or dialkylamino, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino, C2-C4 alkoxy radical, by a pyrrolidinyl radical or by a phenyl radical, radicals in which alkyl groups have 1 to 4 carbon atoms; a pyrrolidinyl radical; a piperidyl
  • ri and Ar 2 represent a group chosen from the following groups: 4-amino- or 4-methylamino- or 4-dimethylamino-quinolyl or quinolinium whose nucleus quinolinium is optionally substituted with a methyl group; or phenyl optionally substituted by one or more halogen atoms.
  • group A represents: or an amino radical substituted by a radical chosen from the following groups: 4-amino- or 4-methylamino- or 4-dimethylamino-quinolyl or quinolinium in which the quinolinium ring is optionally substituted by a methyl group; pyridyle; phenyl optionally substituted by one or more halogen atoms or by a piperazinyl or alkylpiperazinyl radical; C1-C4 alkyl substituted by an amino, alkylamino or dialkylamino, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino, C2-C4 alkoxy radical, by a pyrrolidinyl radical or by a phenyl radical, radicals in which alkyl groups have 1 to 4 carbon atoms; a pyrrolidinyl radical; a piperidyl radical optionally substitute
  • Ari and Ar 2 represent a group chosen from the groups 4-amino- or 4-methylamino- or 4-dimethylamino - quinolyl or quinolinium, the quinolinium nucleus of which is optionally substituted by a methyl group.
  • Ari represents: • a quinoline unit substituted by at least one N (Ra) (Rb) group in which Ra and Rb, which are identical or different, represent hydrogen or a C1-C4 alkyl radical or a short-chain alkoxy or alkyl group containing 1 to 4 carbon atom or
  • a phenyl nucleus optionally substituted by a halogen, methoxy, cyano, carbonylamino, guanyl, methylthio, amino, methylamino, dimethylamino, morpholine, C1-C4 alkyleneamino or C2-C4 alkenyleneamino group
  • A represents an amino radical substituted by a radical chosen from the following groups: 4-amino- or 4-methylamino- or 4-dimethylamino-quinolyl or quinolinium radicals in which the quinolinium ring is optionally substituted by a methyl group; C1-C4 alkyl radicals substituted by an amino, alkylamino, dialkylamino, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino, pyrrolidinyl or pyridyl radical; or the quinuclidine radical.
  • A represents either an amino radical substituted by one or more radicals as defined above or a piperazinyl, homopiperazinyl, piperidinyl or pyrrolidinyl radical optionally substituted (s) by one or more radicals as defined above.
  • A represents either an amino radical substituted by a pyridyl radical; phenyl optionally substituted with a piperazinyl or alkylpiperazinyl radical; a piperidyl radical optionally substituted by a C1-C4 alkyl radical or a piperazinyl radical optionally substituted by a C1-C4 alkyl radical.
  • A represents an O (or S) - aromatic ring radical or an O (or S) -alkyl radical with optionally substituted alkyl.
  • A represents an O-phenyl, O-pyridyl, O-pyrimidinyl or O-alkyl radical substituted by an amino, alkylamino or dialkylamino or else an S-phenyl, S-pyridyl, S-pyrimidyl or S-quinoleinyl radical.
  • A represents an O-phenyl, O-pyridyl or O-alkyl radical substituted by an amino, alkylamino or dialkylamino radical.
  • quinoline units can be substituted by any other group which does not intervene in the intended application, thus groups acridines or isoquinolines or quinazolines or quinoxalines or phthalazines or benzothiazines or benzoxazines or phenoxazines or phenothiazines are included in the definition of quinoline groups.
  • Preferred among the compounds of formula (I) above are those which comprise two heterocycles chosen from the 4-aminoquinolyl, 4-aminoquinolinium or quinolinium groups in which the quinolinium nucleus is optionally substituted by a methyl group.
  • Another object of the present invention relates to the use of the compounds of formula (I) as a pharmaceutical product for human use.
  • the present invention relates very particularly to pharmaceutical compositions comprising, by way of active ingredient a product of formula (I) as defined above.
  • the present invention relates very particularly to pharmaceutical compositions comprising, as active principle, a product of formula (I) in Table 1 below.
  • the present invention relates very particularly to pharmaceutical compositions comprising, as active ingredient, a product of formula (I) chosen from those whose names are cited above.
  • the invention therefore extends to pharmaceutical compositions containing as active principle at least one of the medicaments as defined above.
  • compositions can be administered by the oral route, by the parenteral route or by the local route as a topical application to the skin and the mucous membranes or by injection by the intravenous or intramuscular route.
  • compositions can be solid or liquid and can be presented in all the pharmaceutical forms commonly used in human medicine such as, for example, simple or coated tablets, pills, tablets, capsules, drops, granules, injectable preparations, ointments, creams or gels; they are prepared according to the usual methods.
  • the active ingredient can be incorporated therein into excipients usually used in these pharmaceutical compositions, such as talc, gum arabic, lactose, starch, magnesium stearate, cocoa butter, aqueous vehicles or not, fatty substances of animal or vegetable origin, paraffinic derivatives, glycols, various agents wetting, dispersing or emulsifying, preservatives.
  • the reaction takes place in an inert medium under the reaction conditions. Mention may be made, among the inert solvents, of optionally aqueous acetone or an optionally aqueous alcohol such as ethanol, or a halogenated solvent such as dichloromethane, or an ether such as diethyl ether or dioxane, or a polar aprotic solvent. such as DMF, DMSO or NMP.
  • the operation is preferably carried out at a temperature of between 20 ° C.
  • the dihalo or trihalo-s-triazines of general formula (B) are either commercial or known, and can be obtained under the conditions described in the literature.
  • the aromatic or heteroaromatic amines of general formula (C) are either known or can be easily prepared by known methods for the synthesis of aromatic or heteroaromatic amines.
  • the triazine of general formula (A) can be obtained by sequential displacement of the halogen atoms, very generally chlorine atoms, of the products of general formula (B) by the amines Ar ⁇ NHR 3 then Ar 2 NHR ' 3 of general formula (C) according to scheme 2:
  • an inert solvent such as optionally aqueous acetone or an optionally aqueous alcohol, such as ethanol, or a halogenated solvent, such as dichloromethane, or an ether such as diethyl ether or dioxane, or a polar aprotic solvent such as DMF, DMSO or NMP.
  • the operation is carried out at a temperature between 20 ° C and 50 ° C.
  • 1 mole of amine Ar 2 NHR ' 3 is added to the product of general formula (D), which can be optionally isolated.
  • the products of general formula (A) in which Ar ⁇ NHR 3 and Ar 2 NHR ' 3 are defined as above and R represents a group NR1R2 or ORl or SRI or alkRlR2 can also be prepared by nucleophilic displacement of an atom of halogen, generally a chlorine atom, of a product of general formula (A) in which R represents a halogen atom according to scheme 3:
  • R Cl (or F or Br or 1)
  • R NR., R 2 or OR., Or SR n or R., R 2 alk
  • the operation is preferably carried out at a temperature between 20 ° C. and reflux, in the presence in particular of an organic base, such as triethylamine, or an inorganic base, such as sodium hydroxide or carbonate. sodium or potassium.
  • an organic base such as triethylamine
  • an inorganic base such as sodium hydroxide or carbonate. sodium or potassium.
  • the incoming group represents an RIO “ or RIS " group
  • an alkali or alkaline earth alcoholate or thioalcoholate such as a sodium or potassium or lithium or ammonium or cesium or barium salt
  • a polar aprotic solvent such as DMF or DMSO or NMP
  • the operation is very preferably in an ether such as diethyl ether or. dioxane or tetrahydrofuran at a temperature between -70 ° C and the reflux of the reaction medium.
  • the s-triazines of general formula can be obtained in the form of libraries, by applying the methods described in diagrams 1, 2, or 3 in parallel and / or combinatorial chemistry in the liquid phase or in the solid phase, it being understood that, when working in the solid phase, any of the reactants is previously fixed on a solid support, chosen as a function of the chemical reaction involved, and that said chemical reaction is followed by a cleavage operation of the reaction product of the solid support.
  • the present invention also relates to therapeutic compositions containing a compound according to the invention, in combination with a pharmaceutically acceptable carrier according to the mode of administration chosen.
  • the pharmaceutical composition can be in solid, liquid or liposome form.
  • solid compositions mention may be made of powders, capsules, tablets.
  • oral forms it is also possible to include the solid forms protected from the acid environment of the stomach.
  • the supports used for the solid forms consist in particular of mineral supports such as phosphates, carbonates or organic supports such as lactose, celluloses, starch or polymers.
  • Liquid forms are made up of solutions of suspensions or dispersions. They contain as dispersive support either water or an organic solvent (ethanol, NMP or others) or mixtures of surfactants and solvents or complexing agents and solvents.
  • the administered dose of the compounds of the invention will be adapted by the practitioner according to the route of administration of the patient and the state of the latter.
  • the compounds of the present invention can be administered alone or in admixture with other anticancer agents.
  • anticancer agents include anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents, anticancer agents
  • alkylating agents and in particular cyclophosphamide, melphalan, ifosfamide, chlorambucil, busulfan, thiotepa, prednimustine, carmustine, lomustine, semustine, steptozotocin, decarbazine, temozolomide, procarbazine and hexamethylmelamine
  • platinum derivatives such as cisplatin, carboplatin or oxaliplatin
  • antibiotic agents such as bleomycin, mitomycin, dactinomycin
  • antimicrotubule agents such as vinblastine, vincristine, vindesine, vinorelbine, taxoides (paclitaxel and docetaxel)
  • anthracyclines such as doxorubicin, daunorubicin, idarubicin, epirubicin, mitoxantrone, losoxantrone • topoisomerases of groups I and II such. as etoposide, teniposide, amsacrine, irinotecan, topotecan and tomudex,
  • fluoropyrimidines such as 5-fluorouracil, UFT, floxuridine,
  • cytidine analogues such as 5-azacytidine, cytarabine, gemcitabine, 6-mercaptomurine, 6-thioguanine
  • adenosine analogs such as pentostatin, cytarabine or fludarabine phosphate
  • enzymes and various compounds such as L-asparaginase, hydroxyurea, trans-retinoic acid, suramin, dexrazoxane, amifostine, herceptin as well as the oestrogenic and androgenic hormones • anti-vascular agents such as combretastatin or colchicine derivatives and their pro-drugs.
  • the stabilization activity of the G-quadruplexes can be determined by a method using the formation of a complex with fluorescein, the experimental protocol of which is described below.
  • Oligonucleotides All olignucleotides, modified or not, have been synthesized by Eurogentec SA, Seraing, Belgium.
  • the oligonucleotide FAM + DABCYL carries the catalog reference, OL-0371-0802. It has the sequence: GGGTTAGGGTTAGGGTTAGGG corresponding to 3.5 repetitions of the human telomeric motif (strand rich in G). Fluorescein is attached to the 5 'end, DABCYL to the 3' end, by the chemical arms described by Eurogentec. The concentration of the samples is verified by spectrophotometry, recording the absorbance spectrum between 220 and 700 nm and using the molar extinction coefficient provided by the supplier.
  • the absence of fluorescent contamination in the buffer has been previously checked.
  • the fluorescent oligonucleotide is added to the final concentration of 0.2 ⁇ M.
  • oligonucleotide stock solution with a strand concentration of 0.2 ⁇ M in a 0.1 M LiCl 10 mM cacodylate buffer pH 7.6 is previously prepared, briefly heated to 90 ° C and slowly cooled to 20 ° C, then distributed in aliquots of 600 ⁇ l in fluorescence cells. 3 ⁇ l of water (for control) or 3 ⁇ l of the product to be tested (stock at 200 ⁇ M, final concentration 1 ⁇ M) are then added and mixed. The samples are then left to incubate for at least 1 hour at 20 ° C before each measurement. The use of longer incubation times (up to 24 hours) has no influence on the result obtained.
  • the Tm of the reference sample without addition of product is 44 ° C. in a Lithium Chloride buffer. This temperature is brought to more than 55 ° C. in a sodium chloride buffer.
  • the addition of a G-quadruplex stabilizing compound induces an increase in Tm. This increase is considered significant if it is greater than 3 °.
  • the biological activity, antitelomerase is determined by the following experimental protocol:
  • the HL60 leukemia line is obtained from the ATCC (Americam Type Culture Collection, Rockville USA). Cells are grown in suspension in medium RPMI 1640 containing, 2 mM L-Glutamine, Penicillin 200 U / ml, streptomycin 200 ⁇ g / ml, gentamycin 50 ⁇ g / ml and supplemented with 10% fetal calf serum inactivated by heat. An aliquot of 10 5 cells is centrifuged at 3000xG and the supernatant discarded.
  • the cell pellet is resuspended by several successive pipetting in 200 ⁇ l of lysis buffer containing 0.5% CHAPS, Tris-HCl pH 7.5 10 mM, MgCl 2 ImM, EGTA 1 mM, ⁇ -mercaptoethanol 5 mM, PMSF 0.1 mM and glycerol 10% and is kept in ice for 30 minutes.
  • the lysate is centrifuged at 16 OOOOxG for 20 minutes at 4 ° C and 160 ⁇ l of the supernatant is recovered.
  • the determination of the proteins of the extract is carried out by the Bradford method.
  • the extract is stored at -80 ° C.
  • telomerase activity is determined by a protocol for extending the oligonucleotide TS ( 5 'AATCGTTCGAGCAGAGTTTT ' ), in the presence of a cellular extract enriched in telomerase activity and of compounds which are added at different concentrations ( 10, 1, 0.1 and 0.01 ⁇ M).
  • the extension reaction is followed by PCR amplification of the extension products using the oligonucleotides TS and CXext ( 5 'GTGCCCTTACCCTTACCCTTACCCTAA 3' ).
  • the reaction medium is prepared according to the following composition:
  • Bovine albumin serum 0.1 mg / ml
  • the oligonucleotides are obtained from Eurogentec (Belgium) and are stored at -20 ° C at a stock concentration of 1 mg / ml in distilled water.
  • reaction samples are assembled in 0.2 ml PCR tubes and a drop of paraffin oil is placed on each of the reactions of the experiment before the tubes are closed.
  • the reaction samples are then incubated in a Cetus 4800 type PCR apparatus under the following temperature conditions:
  • the samples are then analyzed by 12% acrylamide gel electrophoresis in TBE IX buffer for 1 hour at a voltage of 200 volts, using a Novex electrophoresis system.
  • the acrylamide gels are then dried on a sheet of Whatmann 3 mm paper at 80 ° C. for 1 hour.
  • the analysis and quantification of the reaction products are carried out using an Instantlmager device (Pacard).
  • Compound value - blank value / Enzyme control value - blank value x 100.
  • concentration of compound inducing a 50% inhibition of the telomerase reaction (IC50) is determined using a semi logarithmic graphical representation of the d values 'inhibition obtained as a function of' each of the concentrations of compound tested.
  • a compound is considered to be active as an antelomerase agent when the amount inhibiting 50% telomerase reaction is notably less than 5 ⁇ M.
  • the cytotoxic biological activity on human tumor lines is determined according to the following experimental protocol:
  • the A549 human cell lines originate from the ATCC (American Type Culture Collection, Rockville USA).
  • the A549 cells are cultured in a layer in a culture flask in RPMI 1640 medium, L-Glutamine at 2 mM, Penicillin 200 U / ml, streptomycin 200 ⁇ g / ml and supplemented with 10% fetal calf serum inactivated by heat.
  • KB cells are cultured in a culture flask layer in Dulbelco's medium containing, 2 mM L-Glutamine, Penicillin 200 U / ml, streptomycin 200 ⁇ g / ml and supplemented with 10% fetal calf serum inactivated by heat .
  • the cells in the exponential growth phase are trypsinized, washed in PBS IX and are seeded in 96-well microplates (Costar) at a rate of 4 ⁇ 10 4 cells / ml for A549 and 1.5 ⁇ 10 4 cells / ml
  • the concentration of compound inducing a 50% inhibition of growth is determined using a semi logarithmic graphical representation of the inhibition values obtained as a function of each of the concentrations of compound tested.
  • a compound is considered to be active as a cytotoxic agent if the inhibitory concentration of 50% of the growth of the tumor cells tested is notably less than 10 ⁇ M.
  • the following nonlimiting examples are given to illustrate the invention.
  • Table 1 gives the chemical structures as well as the G-quartet, antitelomerase and cytotoxic activities of 202 products which constitute, in chronological order as this table lists them, Examples 1 to 202 of the present invention which illustrate the present invention without however limiting it.
  • Table 1 gives the chemical structures as well as the G-quartet, antitelomerase and cytotoxic activities of 202 products which constitute, in chronological order as this table lists them, Examples 1 to 202 of the present invention which illustrate the present invention without however limiting it.
  • Examples 1 to 28 described in Table 1 can be prepared by parallel synthesis in liquid medium:
  • a magnetic heating reactor with Zy ark condenser of the STEM RS2050 type containing 25 wells in parallel provided with a 50 ml glass tube, 50 mg of a product corresponding to the following formula is introduced:
  • Example 20 4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (4-methyl-piperazin-1-yl) - [1, 3, 5] triazine , can also be advantageously prepared as follows:
  • Examples 29 to 33 Examples 29 to 33 described in Table 1 can be prepared by parallel synthesis in liquid medium:
  • Examples 34 to 108 can be obtained by operating as described above for Examples 1 to 28.
  • Examples 103 to 115 and Example 196 can be obtained by operating as described above for Examples 29 to 33.
  • Examples 116 to 133, 177 and 183 can be obtained by operating as described above for Examples 29 to 33, but by replacing RIOH with R1SH.
  • the example can be obtained by operating as follows •: 1 g of 2, -dichloro-6-phenyl- [1, 3, 5] -triazine which can be obtained by operating according to Tetrahedron 2000, 56, 9705, is dissolved in 100 ml of dioxane in 100 ml of dioxane -9711. Then 0.9 of 4-dimethylamino-2-methyl-quinoline-6-amine and 1.2 g of potassium carbonate are added, then the reaction medium is heated at 80 ° C. for 18 hours. After cooling, the solvent is evaporated under reduced pressure and the residue is taken up in 100 L of water. The precipitate formed is drained, washed with water and dried under reduced pressure.
  • Example 178 can be obtained by operating as in Example 134 but starting with 2,4-dichloro-6-phenylmethyl- [1, 3, 5] -triazine which can be obtained by operating according to Tetrahedron 2000, 56, 9705-9711.
  • Examples 135 to 176, 178 to 182, 184, 187 to 195 and 197 to 202 can be obtained by operating as described above for Examples 1 to 28, except that the volume of DMF is reduced from 5 to 2 mL and the heating temperature is increased from 80 to 108-110 ° C.
  • Example 186 2, 4-bis- ((4-dimethylamino-2-methyl-quinolin-6-yl) amino) -6- (4-cyclopentyl-piperazin-1-yl) - [1, 3, 5 ] triazine, can advantageously be prepared as follows:
  • - B represents an Ar ⁇ NR 3 radical, a radical chosen from the radicals:
  • C ' represents - an Ar 2 NR 3 radical chosen from the radicals:
  • Amines, alcohols or phenols and thiols or thiophenols, necessary for the introduction of radicals of type B, C or A of the products of general formula (Ib), are:
  • amines are introduced into a 24-well, stirred, pressurizable, stainless steel reactor: 0.094 g of isopropylamine 0.173 g of diethylamine hydrochloride 0.120 g of 2-methoxyethylamine 0.091 g of azetidine 0.114 g of pyrrolidine
  • Step 2 Reduction in parallel of 6-nitroquinolines
  • the products described above are each distributed in 4 wells. Their reduction is carried out in the apparatus described above, by introducing into each well 0.050 g of 10% palladium on carbon and 1.5 ml of a methanol / dichloromethane solution (80/20 by volume). After obturation and inerting, the mixture is stirred for 6 hours at 20 ° C. under 6 bars of hydrogen.
  • the solutions of the wells of the same composition are combined, the catalyst is filtered and then rinsed with 5 ml of methanol. The filtrate is then concentrated under reduced pressure.
  • the products are purified by LCMS under the conditions described in step 1. This gives the following:
  • o 2,4-bis (dimethylamino) -quinoline-6-amine (A4 / B4 / C4) can be prepared by operating as follows:
  • 2,4-bis (dimethylamino) -6-nitro-quinoline can be prepared as follows: 300 mg of 2,4-dichloro-6-nitro-quinoline is dissolved in 12 ml of DMF in the presence of 853 mg of potassium carbonate and 1 g of dimethylammonium hydrochloride. The reaction mixture is stirred at 100 ° C for 3 hours. After returning to room temperature, the insoluble material is removed by filtration and the filtrate is concentrated under reduced pressure. The residue is hydrolyzed by adding water and the precipitate obtained is recovered by filtration and then dried under reduced pressure. 180 mg of 2,4-bis (dimethylamino) -6-nitro-quinoline are thus obtained in the form of a yellow powder, the mass spectrum of which is as follows:
  • 2,4-dichloro-6-nitro-quinoline can be prepared as follows: A solution of 500 mg of 6-nitro-quinoline-2,4-diol in 10 ml of P0C1 3 is brought to reflux for 3 hours . After returning to ambient temperature, the reaction mixture is concentrated under reduced pressure and then taken up with water. The pH of the aqueous phase is brought to 8 by adding a 28% aqueous ammonia solution and the aqueous phase is extracted with dichloromethane. The organic phase is then dried over magnesium sulfate and then concentrated under reduced pressure.
  • 4-Dimethylamino-2-methylamino-6-nitro-quinoline can be prepared as follows: 188 mg of 4-chloro-2-methylamino-6-nitro-quinoline is dissolved in 8 L of DMF in the presence of 546 mg of potassium carbonate and 645 mg of dimethylammonium hydrochloride. The reaction mixture is stirred at 100 ° C for 10 hours. After returning to ambient temperature, it is hydrolyzed by adding water and the aqueous phase thus obtained is extracted with dichloromethane. The organic phase is dried over magnesium sulfate and then concentrated under reduced pressure. 150 mg of 4-dimethylamino-2-methylamino-6-nitro-quinoline are thus obtained in the form of a yellow powder, the mass spectrum of which is as follows:
  • 4-chloro-2-methylamino-6-nitro-quinoline can be prepared as follows: 600 mg of 2,4-dichloro-6-nitro-quinoline is dissolved in 10 mL of THF in the presence of 2.15 mL of a 2M solution of dimethylamine in THF. The reaction mixture is stirred at 90 ° C for 3 hours. After returning to ambient temperature, the reaction medium is concentrated under reduced pressure. A fraction of the residue obtained is purified by HPLC on a Chromasil column (C18, 5 ⁇ M, 100x20mm) with a water-acetonitrile mixture containing 0.07% TFA (gradient 95/5 to 60/40 by volume in 20 minutes at a flow rate of 20 L / min) as eluent. 188 mg of (4-chloro-2-methylamino-6-nitroquinoline) are obtained in the form of a yellow powder, the mass spectrum of which is as follows:
  • 2,4-dichloro-6-nitro-quinoline can be prepared as described in the previous example.
  • 4-dimethylamino-2-methyl-quinoline-7-amine (A6 / B6 / C6) can be prepared by operating as follows:
  • N7-benzhydrylidene-4-dimethylamino-2-methyl-quinoline-7-amino can be prepared in the following way: 100 mg of 7-chloro-4-dimethylamino-2-methyl-quinoline in mixture with 5-chloro- 4-dimethylamino-2-methyl-quinoline in proportions 70/30 (in mole), in solution in 2 ml of 1, 2-dimethoxyethane is added to a mixture of 41.2 mg of tris (dibenzylideneacetone) dipalladium, 35.4 mg of 2 -cyclohexylphosphino-2 '(N, N-dimethylamino) -biphenyl and 221.2 mg of cesium carbonate under argon.
  • 7-chloro-4-dimethylamino-2-methyl-quinoline can be prepared as follows: 500 mg of 4, 7-dichloro-2-methyl-quinoline mixed with 4, 5-dichloro-2-methyl-quinoline in the proportions 70/30 (in mole), is dissolved in 12 ml of DMF in the presence of 1.63 g of potassium carbonate and 1.96 g of dimethylammonium hydrochloride. The reaction mixture is stirred at 100 ° C for 3 hours. After returning to ambient temperature, the insoluble material is removed by filtration and the filtrate is concentrated under reduced pressure. The residue is hydrolyzed by adding water and the aqueous phase thus obtained is extracted with dicholoromethane.
  • 7-dichloro-2-methyl-quinoline can be prepared as follows: A 500 mg solution of 7-chloro-2-methyl-quinolin-4-ol, mixed with 5-chloro-2- methyl-quinolin-4-ol in proportions 70/30 (in mole), in 7.6 mL of P0C1 3 is brought to reflux for 3 hours. After returning to ambient temperature, the reaction mixture is concentrated under reduced pressure and then taken up with water. The pH of the aqueous phase is brought to 8 by adding a saturated aqueous solution of sodium hydrogencarbonate and the precipitate thus obtained is recovered by filtration, washed with water and then dried under reduced pressure.
  • o 6-dimethylamino-phenanthridin-2-amine (Cl4) can be prepared by operating as follows:
  • 6-chloro-2-nitro-phenanthridine can be prepared as follows: A solution of 200 mg of
  • o • l-Dimethylamino-isoquinoline-7-amine (C15) can be prepared by operating as follows:
  • L-dimethylamino-7-nitro-isoquinoline can be prepared as follows: 375 mg of l-chloro-7-nitro-isoquinoline in mixture with l-chloro-5-nitro-isoquinoline in proportions 40/60 ( in moles) is dissolved in 6 ml of DMF in the presence of 1.24 g of potassium carbonate and 1.46 g of dimethylammonium hydrochloride. The reaction mixture is stirred at 100 ° C for 3 hours. After returning to ambient temperature, it is hydrolyzed by adding water and the aqueous phase thus obtained is extracted with dichloromethane. The organic phase is dried over magnesium sulfate and then concentrated under reduced pressure.
  • L-chloro-7-nitro-isoquinoline can be prepared as follows: A solution of 580 mg of 7-nitro-isoquinolin-1-ol, mixed with 5-nitro-isoquinolin-1-ol in proportions 40/60 (in moles), in 6 mL of POCI 3 is brought to reflux for 3 hours. After returning to room temperature, the reaction mixture is added with cyclohexane until a precipitate is obtained which is recovered by filtration and then taken up with water. The pH of the aqueous phase thus obtained is brought to 8 - by adding an aqueous solution of 28% ammonia and the resulting precipitate is recovered by filtration, washed with water and then dried under reduced pressure.
  • 7-nitro-isoquinolin-1-ol can be prepared as follows: 500 mg of 1-isoquinolinol are placed in solution in 5 ml of concentrated sulfuric acid at 0 ° C. 348 mg of potassium nitrate is then added and the reaction mixture is stirred at 0 ° C for 1 hour and then overnight at room temperature. It is then thrown into a water-ice mixture and the pH of the aqueous solution thus obtained is brought to pH 8 by addition of a 28% aqueous ammonia solution. The precipitate obtained is recovered by filtration, washed with water and then dried under reduced pressure.
  • 4-dimethylamino-2-methyl-quinoline-6-N-methyl-acetamide can be prepared as follows: 250 mg of 4-dimethylamino-2-methyl-quinoline-6-acetamide in solution in 2 mL of DMF at 0 ° C., 45 mg of 60% sodium hydride in oil are added. After 20 minutes of stirring at room temperature, the reaction medium is again cooled to 0 ° C. and 77 ⁇ L of methyl iodide are added. After 2 hours of stirring at room temperature, water is added and the aqueous phase is extracted with dichloromethane. The organic phase is dried over magnesium sulfate and concentrated under reduced pressure.
  • 4-Dimethylamino-2-methyl-quinoline-6-acetamide can be prepared as follows: at 300 mg of
  • 4-Dimethylamino-2-methyl-quinoline-6-amine can be prepared as described in patent WO 0140218. o 4-dimethylamino-2-phenyl-quinoline-6-amine (C17) can be prepared by operating as follows:
  • the ' 4-dimethylamino-2-phenyl-quinoline-6-acetamide can be prepared as follows: 400 mg of 4-chloro-2-phenyl-quinoline-6-acetamide is dissolved in 15 ml of DMF in the presence 1.86 g of potassium carbonate and '1.10 g of dimethylammonium hydrochloride. The reaction mixture is stirred at 150 ° C for 6 hours. After returning to ambient temperature, it is hydrolyzed by adding water and the aqueous phase thus obtained is extracted with dichloromethane. The organic phase is dried over magnesium sulfate and then concentrated under reduced pressure. 360 mg of 4-dimethylamino-2-phenyl-quinoline-6-acetamide are thus obtained in the form of a brown oil, the mass spectrum of which is as follows:
  • the 4-chloro-2-phenyl-quinoline-6-acetamide can be prepared as follows: A solution of 380 mg of 4-hydroxy-2-phenyl-quinoline-6-acetamide in 2 ml of P0C1 3 is brought to the reflux for 3 hours. After returning to room temperature, the reaction mixture is added with cyclohexane until a precipitate is obtained which is recovered by filtration and then taken up with water. The pH of the aqueous phase thus obtained is brought to 8 by adding a 28% aqueous ammonia solution and the resulting precipitate is recovered by filtration, washed with water and then dried under reduced pressure. 400 mg of 4-chloro-2-phenyl-quinoline-6-acetamide are thus obtained in the form of a yellow powder, the mass spectrum of which is as follows:
  • the 4-hydroxy-2-phenyl-quinoline-6-acetamide can be prepared as follows: 1 g of ethyl 3- (4-acetylamino-phenylamino) -3-phenyl-acrylate is poured into 20 ml of dowtherm Has reflux. After 45 minutes, it returns to ambient temperature and the reaction medium is supplemented with cyclohexane until formation of a precipitate which is recovered by filtration, washed with cyclohexane and then dried under reduced pressure. 688 mg of 4-hydroxy-2-phenyl-quinoline-6-acetamide are thus obtained in the form of an ocher powder, the mass spectrum of which is as follows:
  • Ethyl 3- (4-acetylamino-phenylamino) -3-phenyl-acrylate can be prepared as follows:
  • 4-dimethylamino-2-isopropyl-6-nitro-quinoline can be prepared as follows: 450 mg of 4-chloro-2-isopropyl-6-nitro-quinoline mixed with 4-chloro-2-isopropyl- 8-nitro-quinoline in proportions 8.5 / 1.5 is dissolved in 12 mL of DMF in the presence of 1.2 g of potassium carbonate and 1.47 g of dimethylammonium hydrochloride. The reaction mixture is stirred at 100 ° C for 3 hours. After returning to ambient temperature, it is hydrolyzed by adding water and the aqueous phase thus obtained is extracted with dichloromethane. The organic phase is dried over magnesium sulfate and then concentrated under reduced pressure.
  • 4-chloro-2-isopropyl-6-nitro-quinoline can be prepared as follows: A solution of 475 mg of 2-isopropyl-6-nitro-quinolin-4-ol, mixed with 2-isopropyl- 8-nitro-quinolin-4-ol in proportions 8.5 / 1.5 (in moles), in 4 mL of P0C1 3 is brought to reflux for 3 hours. After returning to ambient temperature, the reaction mixture is added with water and cyclohexane and the pH of the aqueous phase is brought to 8. addition of an aqueous solution of 28% monique. A precipitate is formed which is recovered by filtration and the aqueous phase is extracted with dichloromethane.
  • 2-isopropyl-6-nitro-quinolin-4-ol can be prepared as follows: 450 mg of 2-isopropyl-1H-quinolin-4-one are placed in solution in 5 ml of acid concentrated sulfuric at 0 ° C. 243 mg of potassium nitrate is then added and the reaction mixture is stirred at 0 ° C for 1 hour and then overnight at room temperature. It is then thrown into a water-ice mixture and the pH of the aqueous solution thus obtained is brought to pH 8 by addition of a 28% aqueous ammonia solution. A precipitate forms which is collected by filtration and dried under reduced pressure.
  • 2-isopropyl-1H-quinolin-4-one can be prepared as follows: 4.09g of benzyl 2-isopropyl-4-triisopr ⁇ ylsilanyloxy-2H-quinoline-1-carboxylate in solution in 115 ml of methanol is placed under hydrogen atmosphere (5 bar) in the presence of 400 mg of 10% palladium on carbon for 12 hours. After filtration on celite, the filtrate is concentrated under reduced pressure.
  • Benzyl 4-oxo-4H-quinoline-1-carboxylate can be prepared as follows: to 179 mg of 4-hydroxyquinoline in 3 ml of tert-butanol at 30 ° C. are added 179 mg of sodium hydride to 60% in oil then the reaction mixture is heated to 50 ° C until the end of gas evolution. It then returns to room temperature and 673 ⁇ L of benzyl chloroformate is added dropwise then the mixture is stirred for 3 hours. The reaction medium is then hydrolyzed with 10 ml of water and the pH is brought to 4 by addition of a 0.5 M aqueous solution of hydrochloric acid.
  • the 2,7-dimethyl-4-dimethylamino-6-nitro-quinoline-6-amine can be prepared as follows: 500 mg of 4-chloro-2, 7-dimethyl-6-nitro-quinoline in mixture with the 4-chloro-2, 7-dimethyl-8-nitro-quinoline in proportions 35/65 (in moles) is dissolved in 8 ml of DMF in the presence of 1.46 g of potassium carbonate and 1.72 g of hydrochloride dimethyl. The reaction mixture is stirred at 100 ° C for 3 hours. After returning to ambient temperature, it is hydrolyzed by adding water and the aqueous phase thus obtained is extracted with dichloromethane. The organic phase is dried over magnesium sulfate and then concentrated under reduced pressure.
  • 4-chloro-2, 7-dimethyl-6-nitro-quinoline can be prepared as follows: A solution of 660 mg of 2, 7-dimethyl-6-nitro-quinolin-4-ol, mixed with 2, 7-dimethyl-8-nitro-quinolin-4-ol in proportions 35/65 (in moles), in 5 ml of P0C1 3 is brought to reflux for 3 hours. After returning to ambient temperature, the reaction mixture is added with cyclohexane until a precipitate is obtained which is recovered by filtration and then taken up with water. The pH of the aqueous phase thus obtained is brought to 8 by adding a 28% aqueous ammonia solution and the resulting precipitate is recovered by filtration, washed with water and then dried under reduced pressure.
  • 2, 7-dimethyl-6-nitro-quinolin-4-ol can be prepared as follows: 625 mg of 2, 7-dimethyl-quinolin-4-ol are placed in solution in 6 mL of concentrated sulfuric acid at 0 ° C. 365 mg of potassium nitrate is then added and the reaction mixture is stirred at 0 ° C for 1 hour and then overnight at room temperature. It is then thrown into a water-ice mixture and the pH of the aqueous solution thus obtained is brought to pH 7 by adding a 28% aqueous ammonia solution. The precipitate obtained is recovered by filtration, washed with water and then dried under reduced pressure.
  • the 2, 7-dimethyl-quinolin-4-ol can be prepared in the following way: 3.54 g of ethyl 3-m-tolylamino-but-2-enoate is thrown into 30 ml of dowtherm A at reflux. After 45 minutes, it returns to ambient temperature and the reaction medium is supplemented with cyclohexane until a precipitate is formed which is recovered by filtration, washed with cyclohexane and then dried under reduced pressure.
  • 3-m-tolylamino-but-2-enoic acid ethyl ester can be prepared as follows: 2 mL of m-toluidine in 8 mL of absolute ethanol are added 2.59 ml of ethyl acetoacetate, '24 drops of acetic acid and 6.29 g of drierite. The reaction mixture is brought to reflux for 48 hours. After returning to ambient temperature, the insoluble material is removed by filtration and the filtrate is concentrated under reduced pressure. 3.54 g of ethyl 3-m-tolylamino-but-2-enoate are thus obtained in the form of a colorless oil, the mass spectrum of which is as follows:
  • 2-dimethylamino-5-nitro-1H-benzoimidazole can be prepared as follows: 500 mg of 2-chloro-5-nitro-1H-benzoimidazole in solution in 4 ml of DMF in the presence of 825 mg of dimethylmmonium hydrochloride and 395 mg of p-toluene sulfonic acid is heated at 100 ° C for 20 hours. After return to temperature ambient, water is added and the aqueous phase is extracted with dichloromethane. The organic phase is washed with an aqueous IN sodium hydroxide solution, dried over magnesium sulphate and concentrated under reduced pressure. 239 mg of 2-dimethylamino-5-nitro-1H-benzoimidazole is thus obtained in the form of a brown solid, the mass spectrum of which is as follows:
  • 2-chloro-5-nitro-1H-benzoimidazole can be prepared as described in the literature (Jung, F.; Delvare, C.; Boucherot, D.; Ha on, A. ' J. Med. Chem. 1991, 34 (3), 1110-1116
  • o 2-dimethylamino-3-methyl-3H-benzoimidazol-5-amine (C22) can be prepared by operating as follows: 314 mg of 2-dimethylamino-5-nitro-1H-benzoimidazole is added to a solution of 122 mg of 60% sodium hydride in oil in 6 mL of DMF. After the addition of 110 ⁇ L of iodomethane, the reaction mixture is stirred at ambient temperature for 3 hours then added with a saturated aqueous solution of ammonium chloride. The aqueous phase is extracted with dichloromethane. The organic phase is dried over magnesium sulfate and concentrated under reduced pressure.
  • 2-Dimethylamino-5-nitro-1H-benzoimidazole can be prepared as described in the previous example.
  • o L-dimethylamino-3-methyl-isoquinoline-7-amine (C24) can be prepared by operating as follows:
  • L-dimethylamino-3-methyl-7-nitro-isoquinoline can be prepared as follows: 810 mg of 2- (l-acetyl-2-oxo-propyl) -5-nitro-benzonitrile is heated to 40 ° C for 16 hours in 10 mL of a 40% aqueous dimethylamine solution. After returning to ambient temperature, 30 ml of a 2.5N aqueous hydrochloric acid solution are added and then the aqueous phase is washed with ethyl acetate. The aqueous phase is brought back to pH 9 by addition of a 5N aqueous sodium hydroxide solution and the resulting precipitate is recovered by filtration and dried under reduced pressure.
  • the 9-phenoxy-acridin-2-amine can be prepared as follows: 494 mg of 9-phenoxy-acridin-2-trifluoroacetamide in solution in 50 ml of methanol is added with 3 ml of water and 940 mg of potassium carbonate. The reaction medium is brought to reflux for 5 hours. After returning to ambient temperature and concentration under reduced pressure, water is added and the aqueous phase is extracted with dichloromethane. The organic phase is dried over magnesium sulfate and concentrated under reduced pressure. 385 mg of 9-phenoxy-acridin-2-amine are thus obtained in the form of an orange mouse, the mass spectrum of which is as follows:
  • the 9-phenoxy-acridin-2-trifluoroacetamide can be prepared as follows: 770 mg of 9-chloro-acridin-2-trifluoroacetamide is heated at 100 ° C. for 15 hours in 2.23 g of phenol. ambient, dichloromethane is added and the organic phase is washed successively with an aqueous solution of IN sodium hydroxide and water, then is dried over magnesium sulphate and concentrated under reduced pressure. 594 mg of 9-phenoxy-acridin-2-trifluoroacetamide are thus obtained in the form of a red powder, the mass spectrum of which is as follows:
  • 9-chloro-acridin-2-trifluoroacetamide can be prepared as follows: A solution of 725 mg of 2-trifluoroacetamido-acridone in 7 ml of P0C1 3 is brought to reflux for 30 minutes. After returning to ambient temperature and concentration under reduced pressure, a saturated aqueous solution of sodium hydrogencarbonate is added and the resulting precipitate is recovered by filtration, washed with water and then dried under reduced pressure. 770 mg 9-chloro-acridin-2- is thus obtained trifluoroacetamide in the form of a yellow powder with a mass spectrum as follows:
  • 2-trifluoroacetamido-acridone can be prepared as follows: to 400 mg of 2-aminoacridone in solution in 6.5 mL of dichloromethane at 0 ° C, are added 535 ⁇ L of triethylamine, 405 ⁇ L of trifluoroacetic anhydride and 13 mg of DMAP. The reaction mixture is stirred at room temperature for 15 hours. After concentration under reduced pressure, water is added and the resulting precipitate is recovered by filtration and then dried under reduced pressure.
  • o L-dimethyiamino-3-methyl-isoquinoline-7-amine (C24) can be prepared by operating as follows:
  • L-dimethylamino-3-methyl-7-nitro-isoquinoline can be prepared as follows: 810 mg of 2- (l-acetyl-2-oxo-propyl) -5-nitro-benzonitrile is heated to 40 ° C for 16 hours in 10 mL of a 40% aqueous dimethylamine solution. After returning to ambient temperature, 30 ml of a 2.5N aqueous hydrochloric acid solution are added and then the aqueous phase is washed with ethyl acetate. The aqueous phase is brought back to pH 9 by addition of a 5N aqueous sodium hydroxide solution and the resulting precipitate is recovered by filtration and dried under reduced pressure. 190 mg of l-dimethylamino-3-methyl-7-nitro-isoquinoline are thus obtained in the form of an orange powder, the mass spectrum of which is as follows:
  • the 5-nitro-1- (2-tert-butyldimethylsilyloxy-ethyl) - indole can be prepared as follows: To a suspension of 1.1 mmol of sodium hydride in 2 ml of DMF under argon is added 1 mmol of 5 -nitroindole. The reaction mixture is stirred at ambient temperature until the evolution of gas has ended and then 1.2 mmol of
  • reaction mixture Upon completion of the reaction, the reaction mixture is hydrolyzed with a saturated aqueous solution of ammonium chloride.
  • the aqueous phase thus obtained is extracted with dichloromethane and the organic phase is dried over magnesium sulfate and then concentrated under reduced pressure.
  • 5-nitro-1- (2-tert-butyldimethylsilyloxyethyl) -indole is thus obtained after purification on silica.
  • amines necessary for the introduction of type A radicals of general formula (lb) are • either commercial: o 1- (2-pyrrolidinoethyl) piperazine (A14) o 1- (2-morpholinoethyl) piperazine (A25) o 1- (3-morpholinopropy) piperazine (A27)
  • the G-quartet, antitelomerase and cytotoxic activities of the various compounds exemplified 1 to 176, given in Table 1 are determined according to the operating protocols described above.

Abstract

The invention concerns cancer therapy and novel anti-cancer agents having a very particular mechanism of activity. The invention also concerns novel chemical compounds and their therapeutic use in humans.

Description

DERIVES CHIMIQUES ET LEUR APPLICATION COMME AGENT CHEMICAL DERIVATIVES AND THEIR APPLICATION AS AN AGENT
ANTITELOMERASEantitelomerase
La' présente invention est relative à la thérapie du cancer et concerne de nouveaux agents anticancéreux ayant un mécanisme d'action bien particulier. El.le concerne aussi de nouveaux composés chimiques ainsi que leur application thérapeutique chez l'homme.The present invention relates to cancer therapy and relates to new anticancer agents having a very specific mechanism of action. It also relates to new chemical compounds as well as their therapeutic application in humans.
La présente invention concerne l'utilisation de nouveaux composés chimiques non nucléotidiques qui interàgissent avec' des" structures spécifiques de l'acide désoxyribonucléique (ADN) ou de l'acide ribonucléiqueThe present invention relates to the use of new non-nucleotide chemical compounds that interact with ' "specific structures of deoxyribonucleic acid (DNA) or ribonucleic acid
(ARN) . Ces nouveaux composés sont constitués d'un agent répartiteur lié à deux groupes aminoaromatiques . Ces nouveaux composés sont utiles dans le traitement des cancers et agissent en particulier en tant qu'agents inhibiteurs de la télomérase. Ils sont particulièrement utiles pour stabiliser l'ADN en structure G-quadruplexe (tétrades de guanines) . L'application thérapeutique de l'inhibition de la télomérase via la stabilisation de ces G-quadruplexes est l'arrêt de la mitose cellulaire et la mort des cellules à division rapide telles que les cellules cancéreuses et éventuellement l'induction de la sénescence des cellules cancéreuses.(RNA). These new compounds consist of a distributing agent linked to two aminoaromatic groups. These new compounds are useful in the treatment of cancer and act in particular as telomerase inhibiting agents. They are particularly useful for stabilizing DNA in a G-quadruplex structure (guanine tetrads). The therapeutic application of telomerase inhibition via the stabilization of these G-quadruplexes is the arrest of cell mitosis and the death of rapidly dividing cells such as cancer cells and possibly the induction of cell senescence cancerous.
Les composés de la présente invention présentent l'avantage du point de vue thérapeutique de bloquer la télomérase. Du point de vue biologique, la télomérase permet l'ajout de séquences d'ADN répétées du type T T A G G G, dites séquences télomériques, à l'extrémité du télomère, lors de la division cellulaire. Par cette action la télomérase rend la cellule immortelle. En effet, en l'absence de cette activité enzymatique, la cellule perd à chaque division 100 à 150 bases, ce qui la rend rapidement senescente. Lors de l'apparition de cellules cancéreuses à division rapide, il est apparu que ces cellules présentaient des télomères maintenus à une longueur stable au cours de la division cellulaire. Dans ces cellules cancéreuses il est apparu que la télomérase était fortement activée et qu'elle permettait l'addition de motifs répétés de séquences télomériques à la fin du télomère et permettait donc la conservation de la longueur du télomère dans les cellules cancéreuses. Il est apparu depuis quelques temps que plus de 85 % des cellules cancéreuses présentaient des tests positifs à la présence de télomérase alors que les cellules somatiques ne présentent pas cette caractéristique.The compounds of the present invention have the therapeutic advantage of blocking telomerase. From a biological point of view, telomerase makes it possible to add repeated DNA sequences of the TTAGGG type, called telomeric sequences, at the end of the telomer, during cell division. By this action telomerase makes the cell immortal. In fact, in the absence of this enzymatic activity, the cell loses 100 to 150 bases each division, which makes it rapidly sinking. When rapidly dividing cancer cells appeared, it appeared that these cells displayed telomeres maintained at a stable length during cell division. In these cancer cells it appeared that telomerase was highly activated and that it allowed the addition of repeating motifs of telomeric sequences at the end of the telomer and therefore allowed the conservation of the length of the telomer in cancer cells. It has been shown for some time that more than 85% of cancer cells have positive tests for the presence of telomerase while somatic cells do not have this characteristic.
Ainsi la télomérase est une cible très convoitée pour traiter les cellules cancéreuses. La première approche évidente pour bloquer la télomérase a été l'utilisation de structures nucléotidiques (Chen et al., Proc. Natl. Acad. Sci. USA 93(7), 2635-2639). Parmi les composés non nucléotidiques qui ont été utilisées dans l'art antérieur on peut citer les diaminoanthraquinones (Sun et al. J. Med. Che . 40(14), 2113-6) ou les diethyloxadicarbocyanines (Wheelhouse R. T. Et al. J. A . Chem. Soc. 1998(120) 3261-2).Thus telomerase is a highly coveted target for treating cancer cells. The first obvious approach to blocking telomerase was the use of nucleotide structures (Chen et al., Proc. Natl. Acad. Sci. USA 93 (7), 2635-2639). Among the non-nucleotide compounds which have been used in the prior art, mention may be made of diaminoanthraquinones (Sun et al. J. Med. Che. 40 (14), 2113-6) or diethyloxadicarbocyanines (Wheelhouse RT Et al. J. A. Chem. Soc. 1998 (120) 3261-2).
Le brevet WO 99/40087 décrit l'utilisation de composés qui interagissent avec les structuresWO 99/40087 describes the use of compounds which interact with structures
G-quadruplexes qui sont des composés perylenes et des carbocyanines contenant au moins sept cycles dont deux heterocycles .G-quadruplexes which are perylenic compounds and carbocyanines containing at least seven rings including two heterocycles.
Il est apparu de façon tout à fait surprenante que des structures simples permettaient d' obtenir un résultat au moins équivalent avec des structures beaucoup moins compliquées du point de vue chimique. Les composés de la présente invention qui répondent à l'objectif visé c'est-à-dire qui fixent la structure G-quadruplex d'ADN ou d'ARN et notamment la structure G-quadruplex des télomères et par ce fait ' présentent une activité inhibitrice des ' télomérases répondent à la formule générale suivante : cycle aromatique azoté - NR3 - répartiteur - NR'3 - cycle aromatique dans laquelleIt appeared quite surprisingly that simple structures made it possible to obtain an at least equivalent result with structures much less complicated from the chemical point of view. The compounds of the present invention which meet the objective that is to say, securing the G-quadruplex structure of DNA or RNA and in particular the G-quadruplex structure of telomers and thereby 'have a activity inhibitor of ' telomerases correspond to the following general formula: nitrogen aromatic cycle - NR 3 - distributor - NR' 3 - aromatic cycle in which
• le cycle aromatique azoté, représente :• the nitrogen aromatic cycle, represents:
0 une quinoléine ou isoquinoléine éventuellement substituée par au moins un radical choisi parmi un groupe N(Ra) (Rb) dans lequel Ra et Rb, identiques ou différents représentent l'hydrogène ou un radical alkyle en C1-C4, et un ou plusieurs groupe (s) alkoxy ou alkyle à chaîne courte en C1-C4 lié (s) à un atome de carbone ou d'azote du cycle quinoléine ou isoquinoléine ou 0 une quinoléine ou isoquinoléine possédant un atome d'azote sous forme quaternaire ou0 a quinoline or isoquinoline optionally substituted by at least one radical chosen from a group N (Ra) (Rb) in which Ra and Rb, identical or different, represent hydrogen or a C1-C4 alkyl radical, and one or more group (s) C1-C4 alkoxy or short chain alkyl linked to a carbon or nitrogen atom of the quinoline or isoquinoline ring or a quinoline or isoquinoline having a nitrogen atom in quaternary form or
0 une benzamidine ou0 a benzamidine or
0 une pyridine0 a pyridine
• le cycle aromatique représente 0 une quinoléine ou isoquinoléine éventuellement substituée par au moins un radical choisi parmi un groupe N(Ra) (Rb) dans lequel Ra et Rb, identiques ou différents représentent l'hydrogène ou un radical alkyle en C1-C4, et un ou plusieurs groupe (s) alkoxy ou alkyle à chaîne courte en C1-C4 lié (s) à un atome de carbone ou ' d'azote du cycle quinoléine ou isoquinoléine ouThe aromatic ring represents 0 a quinoline or isoquinoline optionally substituted by at least one radical chosen from a group N (Ra) (Rb) in which Ra and Rb, identical or different represent hydrogen or a C1-C4 alkyl radical, and one or more alkoxy or short chain C1-C4 alkyl group (s) linked to a carbon or nitrogen atom of the quinoline or isoquinoline ring or
0 une quinoléine ou isoquinoléine possédant un atome d'azote sous forme quaternaire ou • 0 une benzamidine ou0 a quinoline or isoquinoline having a nitrogen atom in quaternary form or • 0 a benzamidine or
0 une pyridine ou 0 un noyau phényle éventuellement substitué par un groupement halogène ; alkoxy en Cl-0 a pyridine or 0 a phenyl ring optionally substituted by a halogen group; alkoxy in Cl-
C4 ; cyano ; carbonylamino éventuellement substitué par un ou plusieurs groupes • alkyle en C1-C4 ; guanyl ; alkylthio enC4; cyano; carbonylamino optionally substituted by one or more groups • C1-C4 alkyl; guanyl; alkylthio in
C1-C4 ; amino, alkylamino en C1-C4, dialkylamino en C1-C4 pour chaque groupe alkyle et dont les parties alkyles peuvent ensemble former un cycle en C3-C8, nitro ; alkylèneamino en C1-C4 ; alkénylènea ino en C2-C4 ;C1-C4; amino, C1-C4 alkylamino, C1-C4 dialkylamino for each alkyl group and the alkyl parts of which can together form a C3-C8, nitro ring; C1-C4 alkyleneeamino; alkenylene ino in C2-C4;
0 un noyau hétérocyclique mono ou bi ou tricyclique comportant 0 à 2 hétéroatome par cycle à la condition qu'au moins un hétéroatome soit présent dans au moins un cycle éventuellement substitué par un- ou plusieurs groupes alkyle en C1-C4 ou par des groupes alkylène en C1-C4 ou alkénylène en C2-C4 • R3 et R'3, identiques ou différents, représentent indépendamment l'un de l'autre l'hydrogène ou un radical alkyle en C1-C40 a mono or bi or tricyclic heterocyclic ring having 0 to 2 heteroatoms per cycle provided that at least one heteroatom is present in at least one ring optionally substituted by one or more C1-C4 alkyl groups or by alkylene groups in C1-C4 or alkenylene in C2-C4 • R3 and R'3, identical or different, represent independently of each other hydrogen or a C1-C4 alkyl radical
• le répartiteur représente : un groupe triazine éventuellement substitué par un cycle aromatique tel que défini ci-dessus ou par un radical XR1(R2) dans lequel X représente un atome d' azote N pour former NR1R2, un radical alkyle linéaire ou ramifié en C1-C6 pour former alkRlR2, un atome d'oxygène 0 pour former• the distributor represents: a triazine group optionally substituted by an aromatic ring as defined above or by a radical XR1 (R2) in which X represents a nitrogen atom N to form NR1R2, a linear or branched alkyl radical in C1 -C6 to form alkRlR2, an oxygen atom 0 to form
OR1 ou un atome de soufre S pour former SRI, avec RI et R2 - identiques ou différents sont choisis parmi l'atome d'hydrogène ; un radical alkyle en C1-C8 éventuellement substitué par un ou plusieurs radicaux identiques ou différents; un cycle aromatique tel que défini ci-dessus 5 éventuellement substitué ; un radical quinuclidine ; un radical pyrrolidinyle lui-même éventuellement substitué par un radical alkyle ou phénylalkyle avec alkyle en ' C1-C4 ; un radical pipérazinyle ouOR1 or a sulfur atom S to form SRI, with RI and R2 - identical or different are chosen from the hydrogen atom; a C1-C8 alkyl radical optionally substituted by one or more identical or different radicals; an aromatic ring as defined above optionally substituted; a quinuclidine radical; a pyrrolidinyl radical itself optionally substituted by an alkyl or phenylalkyl radical with alkyl C1-C4; a piperazinyl radical or
10 homopipérazinyle lui-même éventuellement substitué par un radical alkyle, cycloalkyle ou phénylalkyle ; un radical morpholinyle ; un radical pyridyle, pipéridinyle ou un radical pipéridyleHomopiperazinyl itself optionally substituted by an alkyl, cycloalkyl or phenylalkyl radical; a morpholinyl radical; a pyridyl, piperidinyl radical or a piperidyl radical
15 éventuellement substitués par un ou plusieurs radicaux alkyle ou phénylalkyle avec alkyle C1-C4 ; un radical indazolyle ; un radical naphtyle ; un radical benzotriazole ; un radicalOptionally substituted by one or more alkyl or phenylalkyl radicals with C1-C4 alkyl; an indazolyl radical; a naphthyl radical; a benzotriazole radical; a radical
20 benzoimidazolyle ; un radical pyrimidinyle éventuellement substitué par un ou plusieurs alkyle avec alkyle en C1-C4 ; un radical acénaphtène ; un radical amino lui-même éventuellement substitué par unBenzoimidazolyl; a pyrimidinyl radical optionally substituted by one or more alkyl with C1-C4 alkyl; an acenaphthene radical; an amino radical itself optionally substituted by a
25 deux radicaux identiques ou différents choisis parmi alkyle, phénylalkyle, alkylaminoalkyle et dialkylaminoalkyle, étant entendu que lorsque XR1R2 représente25 two identical or different radicals chosen from alkyl, phenylalkyl, alkylaminoalkyl and dialkylaminoalkyl, it being understood that when XR1R2 represents
NR1R2, alors RI et R2 identiques neNR1R2, then RI and R2 identical do not
30 représentent pas tous deux hydrogène ou alkyle C1-C4 non substitué et RI et R2 différents ne représentent pas l'un hydrogène et l'autre alkyle C1-C4 non substitué ou bien lorsque X représente N ou alkyle, RI et R2 forment ensemble avec X auquel ils sont liés un radical monocyclique de 3 à 6 chaînons ou bicyclique de 8 à 10 chaînons saturé ou insaturé renfermant éventuellement un ou deux hétéroato es identiques ou différents choisis parmi N, 0 ou S, ce radical étant éventuellement substitué, - un groupe diazine éventuellement substitué par les mêmes groupes que la triazine ou un de ses sels, ces composés étant sous toutes les formes isomères possibles racemiques, enantiomeres et diastéréo-isomères .30 do not both represent hydrogen or unsubstituted C1-C4 alkyl and different RI and R2 do not represent one hydrogen and the other unsubstituted C1-C4 alkyl or when X represents N or alkyl, RI and R2 form, together with X to which they are linked, a monocyclic radical of 3 to 6 members or bicyclic of 8 to 10 members saturated or unsaturated optionally containing one or two identical or different hetero atoms chosen from N, 0 or S, this radical being optionally substituted, - a diazine group optionally substituted by the same groups as triazine or one of its salts, these compounds being in all the possible racemic, enantiomeric and diastereoisomeric isomer forms.
La présente invention a pour objet les composés tels que définis ci-dessus caractérisés en ce qu'ils répondent à la formule générale suivante : cycle aromatique azoté - NR3 - répartiteur - NR'3 - cycle aromatique dans laquelleThe subject of the present invention is the compounds as defined above, characterized in that they correspond to the following general formula: nitrogen aromatic cycle - NR 3 - distributor - NR ' 3 - aromatic cycle in which
• le cycle aromatique azoté, représente :• the nitrogen aromatic cycle, represents:
0 une quinoléine ou isoquinoléine éventuellement substituée par au moins un radical choisi parmi un groupe N(Ra) (Rb) dans lequel Ra et0 a quinoline or isoquinoline optionally substituted by at least one radical chosen from a group N (Ra) (Rb) in which Ra and
Rb, identiques ou différents représentent l'hydrogène ou un radical alkyle en C1-C4, et un groupe alkoxy ou alkyle à chaîne courte en C1-C4 ou 0 une quinoléine ou isoquinoléine possédant un atome d' azote sous forme quaternaire ou 0 une benzamidine ouRb, identical or different, represent hydrogen or a C1-C4 alkyl radical, and a C1-C4 short chain alkoxy or alkyl group or 0 a quinoline or isoquinoline having a nitrogen atom in quaternary form or 0 a benzamidine or
0 une pyridine0 a pyridine
• le cycle aromatique représente• the aromatic cycle represents
0 une quinoléine éventuellement substituée par au moins un radical choisi parmi un groupe0 a quinoline optionally substituted by at least one radical chosen from a group
N(Ra) (Rb) dans lequel Ra et Rb, identiques ou différents représentent l'hydrogène ou un radical alkyle en C1-C4, et un groupe alkoxy ou alkyle à chaîne courte en C1-C4 ou 0 une quinoléine possédant un atome d' azote sous forme quaternaire ouN (Ra) (Rb) in which Ra and Rb, which are identical or different, represent hydrogen or a C1-C4 alkyl radical, and an alkoxy or short-chain C1-C4 alkyl group or 0 a quinoline having a d atom '' nitrogen in quaternary form or
0 une benzamidine ou0 a benzamidine or
0 une .pyridine ou0 a .pyridine or
0 un noyau phényle éventuellement substitué par un groupement halogène ; alkoxy en Cl-0 a phenyl ring optionally substituted by a halogen group; alkoxy in Cl-
C4 ; cyano ; carbonylamino éventuellement substitué par un ou plusieurs groupes alkyle en C1-C4 ; guanyl ; alkylthio en C1-C4 ; a ino, alkylamino en C1-C4, dialkylamino en C1-C4 pour chaque groupe alkyle et dont les parties alkyles peuvent ensemble former un cycle en C3-C8, nitro ; alkylèneamino en C1-C4 ; alkénylèneamino en C2-C4 ; 0 un noyau hétérocyclique mono ou bi ou tricyclique comportant 0 à 2 hétéroatome par cycle à la condition qu'au moins un hétéroatome soit présent dans au moins un cycle éventuellement substitué par un ou plusieurs groupes alkyle en C1-C4 ou par des groupes alkylène en C1-C4 ou alkénylène en C2-C4 • R3 et R'3, identiques ou différents, représentent indépendamment l'un de l'autre l'hydrogène ou un radical alkyle en C1-C4C4; cyano; carbonylamino optionally substituted with one or more C1-C4 alkyl groups; guanyl; C1-C4 alkylthio; a ino, C1-C4 alkylamino, C1-C4 dialkylamino for each alkyl group and the alkyl parts of which can together form a C3-C8 ring, nitro; C1-C4 alkyleneeamino; C2-C4 alkenyleneamino; 0 a heterocyclic mono or bi or tricyclic ring comprising 0 to 2 heteroatoms per cycle provided that at least one heteroatom is present in at least one ring optionally substituted by one or more C1-C4 alkyl groups or by alkylene groups C1-C4 or C2-C4 alkenylene • R3 and R'3, identical or different, independently of one another represent hydrogen or a C1-C4 alkyl radical
• le répartiteur représente : - un groupe triazine éventuellement substitué par un cycle aromatique tel que défini ci-dessus ou par un radical XR1(R2) dans lequel X représente un atome d' azote N pour former NR1R2, un radical alkyle linéaire ou ramifié en C1-C6 pour former alkRlR2, un atome d'oxygène 0 pour former 0R1 ou un atome de soufre S pour former SRI, avec Ri et R2 identiques ou différents sont choisis parmi l'atome d'hydrogène ; un radical alkyle en C1-C8 éventuellement substitué par un ou plusieurs radicaux identiques ou différents ; un cycle aromatique tel que défini ci-dessus; un radical quinuclidine ; un radical pyrrolidinyle lui-même éventuellement substitué par un radical alkyle ou phénylalkyle avec alkyle en C1-C4 ; un radical pipérazinyle lui-même éventuel- lement substitué par un radical alkyle, cycloalkyle ou phénylalkyle ; un radical morpholinyle ; un radical pyridyle ou un radical pipéridyle éventuellement substitués par un ou plusieurs radicaux alkyle ou phénylalkyle avec alkyle C1-C4 ; un radical indazolyle ; un radical naphtyle ; un radical benzotriazole; un radical pyrimidinyle éventuellement substitué par un ou plusieurs alkyle avec alkyle en C1-C4 ; un radical acénaphtène, étant entendu que lorsque XR1R2 représente• the distributor represents: - a triazine group optionally substituted by an aromatic ring as defined above or by an XR1 (R2) radical in which X represents a nitrogen atom N to form NR1R2, a linear or branched alkyl radical in C1-C6 to form alkRlR2, an oxygen atom 0 to form OR1 or a sulfur atom S to form SRI, with Ri and R2 identical or different are chosen from the hydrogen atom; a C1-C8 alkyl radical optionally substituted by one or more identical or different radicals; an aromatic cycle as defined above; a quinuclidine radical; a pyrrolidinyl radical itself optionally substituted by an alkyl or phenylalkyl radical with C1-C4 alkyl; a piperazinyl radical itself optionally substituted by an alkyl, cycloalkyl or phenylalkyl radical; a morpholinyl radical; a pyridyl radical or a piperidyl radical optionally substituted by one or more alkyl or phenylalkyl radicals with C1-C4 alkyl; an indazolyl radical; a naphthyl radical; a benzotriazole radical; a pyrimidinyl radical optionally substituted by one or more alkyl with C1-C4 alkyl; an acenaphthene radical, it being understood that when XR1R2 represents
NR1R2, alors RI et R2 identiques ne représentent pas tous deux hydrogène ou alkyle C1-C4 non substitué et Ri et R2 différents ne représentent pas l'un hydrogène et l'autre alkyle C1-C4 non substitué ou bien lorsque X représente N ou alkyle,NR1R2, then RI and R2 identical do not both represent hydrogen or C1-C4 unsubstituted alkyl and Ri and R2 different do not represent one hydrogen and the other C1-C4 alkyl unsubstituted or when X represents N or alkyl ,
RI et R2 forment ensemble avec X auquel ils sont liés un radical monocyclique de 3 à 6 chaînons ou bicyclique de 8 à 10 chaînons saturé ou insaturé renfermant éventuellement un ou deux hétéroatomes identiques ou différents choisis parmi N, 0 ou S, un groupe diazine éventuellement substitué par les mêmes groupes que la triazine ou un de ses sels, ces composés étant sous toutes les formes isomères possibles racemiques, enantiomeres et diastéréo-isomères .RI and R2 together with X to which they are linked form a 3 to 6-membered monocyclic or 8 to 10-membered bicyclic radical, saturated or unsaturated, optionally containing one or two identical or different heteroatoms chosen from N, 0 or S, an optionally diazine group substituted by the same groups as triazine or one of its salts, these compounds being in all the possible racemic, enantiomeric and diastereoisomeric isomer forms.
Parmi les composés de la présente invention, on peut citer les composés tels que définis ci-dessus caractérisés en ce que lorsque l'un ou les deux de RI et R2 représente (nt) un radical alkyle en C1-C8 éventuellement substitué par un ou plusieurs radicaux identiques ou différents-, ces radicaux sont choisis parmi les radicaux suivants : le radical amino lui-même éventuellement substitué par un ou deux radicaux identiques ou différents choisis parmi les radicaux alkyle, hydroxyalkyle, alcoxyalkyle, alkylphénylalkyle, phénylalkyle, carboxyalkyle, hydroxycarboxyalkyle, acyle naphtyle, phényle et alkylphényle ; le radical trialkylammonio ; les radicaux hydroxy ; alcoxy en C1-C4; thioalcoxy ; trifluorométhyle ; acyle ; carboxy libre, salifié, estérifié ou amidifié ; imidazolyle ; pyrrolidinyle éventuellement substitué par alkyle en Cl- C4 ; pipéridyle et pipérazinyle éventuellement substitué (s) par alkyle ou phénylalkyl avec alkyl en Cl- C4 ; orpholinyle ; pyridyle ; naphtyle ou phényle lui-même éventuellement substitué par un ou plusieurs radicaux choisis parmi les radicaux alcoxy en C1-C4, halogène ou le radical amino éventuellement substitué comme défini ci-dessus.Among the compounds of the present invention, mention may be made of the compounds as defined above, characterized in that when one or both of R1 and R2 represents (s) a C1-C8 alkyl radical optionally substituted by one or several identical or different radicals, these radicals are chosen from the following radicals: the amino radical itself optionally substituted by one or two identical or different radicals chosen from the alkyl, hydroxyalkyl, alkoxyalkyl, alkylphenylalkyl radicals, phenylalkyl, carboxyalkyl, hydroxycarboxyalkyl, acyl naphthyl, phenyl and alkylphenyl; the trialkylammonio radical; hydroxy radicals; C1-C4 alkoxy; thioalkoxy; trifluoromethyl; acyl; free, salified, esterified or amidified carboxy; imidazolyl; pyrrolidinyl optionally substituted with C1-C4 alkyl; piperidyl and piperazinyl optionally substituted by alkyl or phenylalkyl with C1-C4 alkyl; orpholinyl; pyridyle; naphthyl or phenyl itself optionally substituted by one or more radicals chosen from C1-C4 alkoxy, halogen or optionally substituted amino radical as defined above.
Parmi les composés de la présente invention, on peut citer les composés tels que définis ci-dessus caractérisés en ce que le répartiteur représente : un groupe triazine éventuellement substitué par un cycle aromatique tel que défini ci-dessus ou par un radical XR1(R2) dans lequel X représente un atome d' azoteAmong the compounds of the present invention, mention may be made of the compounds as defined above, characterized in that the distributor represents: a triazine group optionally substituted by an aromatic ring as defined above or by a radical XR1 (R2) in which X represents a nitrogen atom
N pour former NR1R2, un radical alkyle linéaire ou ramifié en C1-C6 pour former alkRlR2, un atome d'oxygène 0 pour former 0R1 ou un atome de soufre S pour former ' SRI, avec Ri et R2 identiques ou différents sont choisis parmi l'atome d'hydrogène ; alkyle C1-C8 éventuellement substitué par un ou plusieurs radicaux choisis parmi les radicaux amino, alkyla ino, dialkyla ino, alcoxyalkylamino, dialcoxyalkylamino, hydroxyalkylamino, dihydroxyalkylamino, hydroxycarboxyalkylamino, trial ylamino+, naphtyla ino, phényla ino, acylamino, (alkyl) (phénylalkyl) amino, (phényl) (alkyl) amino,N to form NR1R2, a linear or branched C1-C6 alkyl radical to form alkRlR2, an oxygen atom 0 to form 0R1 or a sulfur atom S to form ' SRI, with Ri and R2 identical or different are chosen from l 'hydrogen atom; C1-C8 alkyl optionally substituted by one or more radicals chosen from amino, alkyla ino, dialkyla ino, alkoxyalkylamino, dialcoxyalkylamino, hydroxyalkylamino, dihydroxyalkylamino, hydroxycarboxyalkylamino, trial ylamino +, naphtyla ino, phenyla ino radicals, acylamino (alkyl) (phenylalkyl) amino, (phenyl) (alkyl) amino,
(alkylphényl) (alkyl) amino, hydroxy, alcoxy en C1-C4, thioalcoxy en C1-C4, 5 trifluorométhyle, acyle, carboxy libre, salifié, estérifié ou amidifié, imidazolyle, pyrrolidinyle éventuellement substitué par alkyle en C1-C4, pipéridyle, pipérazinyle et homopipérazinyle éventuel-(alkylphenyl) (alkyl) amino, hydroxy, C1-C4 alkoxy, C1-C4 thioalkoxy, trifluoromethyl, acyl, free, salified, esterified or amidated carboxy, imidazolyl, pyrrolidinyl optionally substituted by C1-C4 alkyl, piperidyl, piperazinyl and possible homopiperazinyl-
10 le ent substitué (s) par alkyle ou phénylalkyle - avec alkyle en C1-C4, morpholinyle, pyridyle, naphtyle ou phényle éventuellement substitué (s) par un ou plusieurs radicaux choisis parmi les10 ent substituted (s) by alkyl or phenylalkyl - with C1-C4 alkyl, morpholinyl, pyridyl, naphthyl or phenyl optionally substituted by one or more radicals chosen from
15 radicaux alcoxy en C1-C4, halogène, amino, alkylamino et dialkylamino ; un cycle aromatique tel que défini ci-dessus ; un radical quinuclidine ; un radical pyrrolidinyle lui-même éventuellementC1-C4 alkoxy, halogen, amino, alkylamino and dialkylamino radicals; an aromatic cycle as defined above; a quinuclidine radical; a pyrrolidinyl radical itself optionally
20 substitué par un radical alkyle ou phénylalkyle avec alkyle en C1-C4 ; un radical pipérazinyle lui-même éventuellement substitué par un radical alkyle, cycloalkyle ou phénylalkyle ; un radicalSubstituted by an alkyl or phenylalkyl radical with C1-C4 alkyl; a piperazinyl radical itself optionally substituted by an alkyl, cycloalkyl or phenylalkyl radical; a radical
25 morpholinyle ; un radical pyridyle ou un radical pipéridyle éventuellement substitués par un ou plusieurs radicaux alkyle ou phénylalkyle avec alkyle C1-C4 ; un radical indazolyle ; un radicalMorpholinyl; a pyridyl radical or a piperidyl radical optionally substituted by one or more alkyl or phenylalkyl radicals with C1-C4 alkyl; an indazolyl radical; a radical
30 naphtyle, un radical benzotriazole; un radical pyrimidinyle éventuellement substitué par un ou plusieurs alkyle avec alkyle en C1-C4 ; un radical acénaphtène, étant entendu que lorsque XR1R2 représente 35 NR1R2, alors RI et R2 identiques ne représentent pas tous deux hydrogène ou alkyle C1-C4 non substitué et RI et R2 différents ne représentent pas l'un hydrogène et l'autre alkyle C1-C4 non substitué ou bien lorsque X représente N ou alkyle, RI et R2 forment ensemble avec X auquel ils sont liés un radical choisi parmi les radicaux suivants : pipérazinyle ou homopipérazinyle éventuellement substitué par un ou plusieurs radicaux identiques ou différents/ pyrrolidinyle éventuellement substitué par alkyle ou alcoxy en C1-C4, hydroxy, acylamino, pyrrolidinylalkyl, pyridinyle et pyridyle ; 1, 2, 3, 4-tétra- hydroquinoléinyle et 1, 2, 3, -tétrahydro- isoquinoléinyle ; diazépine éventuellement substitué par alkyle ou pyrrolidinyl-alkyl ; pipéridyle ou piperidinyle éventuellement substitué par un ou plusieurs radicaux choisis parmi alkyle, alcoxy, alcoxyalkyle, pyrrolyl- alkyle, piperidinyle, pipéridyle, hydroxy et cycloalkyl-alkyle ; morpholinyle ; thiomorpholinyle ; imidazolinyle éventuellement substitué par alkyle, ou un groupe diazine éventuellement substitué par les mêmes groupes que la triazine ou. un de ses sels, ces composés étant sous toutes les formes isomères possibles racemiques, enantiomeres et diastéréo-isomères . Parmi les composés de la présente invention, on peut citer les composés tels que définis ci-dessus caractérisés en ce que XR1(R2) est tel que lorsque X représente N, soit l'un de RI et R2 représente l'atome d'hydrogène ou un radical alkyle en C1-C4 éventuellement substitué par amino, alkylamino, dialkylamino ou phényle, et l'autre de RI et R2 est choisi parmi les valeurs définies pour RI et R2 à l'une quelconque des revendications 1 à 5 soit RI et R2 forment ensemble avec l'atome d'azote auxquels ils sont liés un' radical cyclique choisi parmi les radicaux suivants :un radical pipérazinyle ou homopipérazinyle éventuellement substitué par un ou plusieurs radicaux choisis parmi alkyle, aminoalkyle, alkylaminoalkyle, dialkyla inoalkyle, phénylalkyle, alcoxyalkyle, hydroxyalkyl, dihydroxyalkyle, hydroxyalcoxyalkyle avec alcoxy, imidazolylaminoalkyle, imidazolylalkylaminoalkyle, imidazolylhydroxyalkylaminoalkyle, pyridylalkyle, pyridinylalkyle, i idazopyridinylalkyle, pyrrolidinylalkyle, imidazolylalkyle éventuellement substitué par un ou plusieurs radicaux alkyle ou phényle, morpholinylalkyle, benzoimidazolalkyle éventuellement substitué par alkyle ou hydroxyalkyle, cycloalkyle en C3-C8, pyrazinyle, pyrimidinyle, pyridyle, pipéridyle, furylcarbonyle, furfurycarbonyle, quinolyle ou isoquinolyle ; un radical pyrrolidinyle éventuellement substitué par alkyle ou alcoxy en C1-C4, hydroxy, acylamino, pyrrolidinylalkyl, pyridinyle et pyridyle ; un radical 1, 2, 3, 4-tétrahydroquinoléinyle 1,2,3,4- ou tétrahydroisoquinoléinyle ; un radical diazépine éventuellement substitué par alkyle ou - pyrrolidinylalkyl ; un radical pipéridyle éventuellement substitué par un ou plusieurs radicaux choisis parmi -les radicaux alkyle, alcoxy, alcoxyalkyle, pyrrolylalkyle, piperidinyle, hydroxy, cycloalkylalkyle et pipéridyle ; un radical piperidinyle éventuellement substitué par piperidinyle ; un radical morpholinyle ou thio morpholinyle ; un radical i idazolinyle éventuellement substitué par alkyle.Naphthyl, a benzotriazole radical; a pyrimidinyl radical optionally substituted by one or more alkyl with C1-C4 alkyl; an acenaphthene radical, it being understood that when XR1R2 represents 35 NR1R2, then RI and R2 identical do not not both represent hydrogen or C1-C4 unsubstituted alkyl and RI and R2 different do not represent one hydrogen and the other C1-C4 alkyl unsubstituted or else when X represents N or alkyl, RI and R2 form together with X to which they are linked a radical chosen from the following radicals: piperazinyl or homopiperazinyl optionally substituted by one or more identical or different radicals / pyrrolidinyl optionally substituted by C1-C4 alkyl or alkoxy, hydroxy, acylamino, pyrrolidinylalkyl, pyridinyl and pyridyl; 1, 2, 3, 4-tetra-hydroquinoline and 1, 2, 3, -tetrahydro-isoquinoline; diazepine optionally substituted by alkyl or pyrrolidinyl-alkyl; piperidyl or piperidinyl optionally substituted by one or more radicals chosen from alkyl, alkoxy, alkoxyalkyl, pyrrolylalkyl, piperidinyl, piperidyl, hydroxy and cycloalkylalkyl; morpholinyl; thiomorpholinyl; imidazolinyl optionally substituted with alkyl, or a diazine group optionally substituted with the same groups as triazine or . one of its salts, these compounds being in all the possible racemic, enantiomeric and diastereoisomeric isomeric forms. Among the compounds of the present invention, mention may be made of the compounds as defined above, characterized in that XR1 (R2) is such that when X represents N, either one of RI and R2 represents the hydrogen atom or a C1-C4 alkyl radical optionally substituted by amino, alkylamino, dialkylamino or phenyl, and the other of RI and R2 is chosen from the values defined for RI and R2 in any one of claims 1 to 5, either RI and R2 together with the nitrogen atom to which they are linked a cyclic radical chosen from the following radicals: a piperazinyl or homopiperazinyl is optionally substituted by one or more radicals selected from alkyl, aminoalkyl, alkylaminoalkyl, dialkyla inoalkyle, phenylalkyl, alkoxyalkyl , hydroxyalkyl, dihydroxyalkyl, hydroxyalkoxyalkyl with alkoxy, imidazolylaminoalkyle, imidazolylalkylaminoalkyle, imidazolylhydroxyalkylaminoalkyle, pyridylalkyle, pyridinylalkyle, i idazopyridinylalkyle, pyrrolidinylalkyl, imidazolylalkyl optionally substituted by one or more alkyl or phenyl radicals, morpholinylalkyl, benzoimidazolalkyl optionally substituted by alkyl or hydroxyalkyl, C3-C8 cycloalkyl, pyrazinyl, pyrimidinyl, pyridyl, piperidyl, furylcarbonyl, furfurycarbonyl, furfurycarbonyl; a pyrrolidinyl radical optionally substituted by C1-C4 alkyl or alkoxy, hydroxy, acylamino, pyrrolidinylalkyl, pyridinyl and pyridyl; a 1,2,3,4,4-tetrahydroquinolinyl 1,2,3,4- or tetrahydroisoquinolinyl radical; a diazepine radical optionally substituted by alkyl or - pyrrolidinylalkyl; a piperidyl radical optionally substituted by one or more radicals chosen from -alkyl, alkoxy, alkoxyalkyl, pyrrolylalkyl, piperidinyl, hydroxy, cycloalkylalkyl and piperidyl radicals; a piperidinyl radical optionally substituted by piperidinyl; a morpholinyl or thio morpholinyl radical; an idazolinyl radical optionally substituted by alkyl.
Parmi les composés définis ci-dessus, on peut citer les composés caractérisés en ce que lorsque l'un ou les deux de RI et R2 représente (nt) un radical alkyle en C1-C8 éventuellement substitué par un ou plusieurs radicaux identiques ou différents, ces radicaux sont choisis parmi le radical amino lui-même éventuellement substitué par un ou deux radicaux identiques ou différents choisis parmi les radicaux alkyle, hydroxyalkyle, alcoxyalkyle, phénylalkyle, carboxyalkyle, hydroxycarboxyalkyle, acyle, naphtyle, phényle et alkylphényle ; le radical trialkylam onio ; les radicaux hydroxy ; alcoxy en C1-C4; thioalcoxy ; trifluorométhyle ; carboxy libre, salifié, estérifié ou amidifié ; pyrrolidinyle éventuellement substitué par alkyle en C1-C4 ; pipéridyle ; pipérazinyle éventuellement substitué par alkyle ou phénylalkyl avec alkyl en C1-C4 ; morpholinyle ; pyridyle ; naphtyle ou phényle lui-même éventuellement substitué par un ou plusieurs radicaux choisis parmi les radicaux alcoxy en C1-C4, • halogène ou le radical amino éventuellement substitué comme défini ci-dessus. Parmi les composés définis- ci-dessus, on peut notamment citer les composés caractérisés en ce que le répartiteur représente : un groupe triazine éventuellement substitué par un cycle aromatique tel que - défini ci-dessus ou par un radical XR1(R2) dans lequel X représente un atome d' azote N pour former NR1R2, un radical alkyle linéaire ou ramifié en C1-C6 pour former alkRlR2, un atome d'oxygène O pour former ORl ou un atome de soufre S pour former SRI, avec RI et R2 identiques ou différents sont choisis parmi l'atome d'hydrogène ;Among the compounds defined above, mention may be made of the compounds characterized in that when one or both of RI and R2 represents (s) a C1-C8 alkyl radical optionally substituted by one or more identical or different radicals, these radicals are chosen from the amino radical itself optionally substituted by one or two identical or different radicals chosen from the alkyl, hydroxyalkyl, alkoxyalkyl, phenylalkyl, carboxyalkyl, hydroxycarboxyalkyl, acyl, naphthyl, phenyl and alkylphenyl radicals; the trialkylam onio radical; hydroxy radicals; C1-C4 alkoxy; thioalkoxy; trifluoromethyl; free, salified, esterified or amidified carboxy; pyrrolidinyl optionally substituted with C1-C4 alkyl; piperidyl; piperazinyl optionally substituted by alkyl or phenylalkyl with C1-C4 alkyl; morpholinyl; pyridyle; naphthyl or phenyl itself optionally substituted by one or more radicals chosen from C 1 -C 4 alkoxy radicals, • halogen or the amino radical optionally substituted as defined above. Among the compounds defined above, mention may in particular be made of the compounds characterized in that the distributor represents: a triazine group optionally substituted by an aromatic ring such as - defined above or by a radical XR1 (R2) in which X represents a nitrogen atom N to form NR1R2, a linear or branched C1-C6 alkyl radical to form alkRlR2, an oxygen atom O to form ORl or a sulfur atom S to form SRI, with RI and R2 identical or different are chosen from the hydrogen atom;
5 alkyle C1-C8 éventuellement substitué par un ou plusieurs radicaux choisis parmi les radicaux amino, alkylamino, dialkylamino, dialcoxyalkylamino, dihydroxyalkylamino, alcoxyalkylamino, hydroxyalkylamino,5 C1-C8 alkyl optionally substituted by one or more radicals chosen from amino, alkylamino, dialkylamino, dialkoxyalkylamino, dihydroxyalkylamino, alkoxyalkylamino, hydroxyalkylamino,
10 hydroxycarboxyalkylamino, trialkylamino, naphtylamino, p énylamino, acylamino, (alkyl) (phénylalkyl) amino, (phényl) (alkyl) amino, (alkylphényl) (alkyl) amino, hydroxy, alcoxy en C1-C4, thioalcoxy en C1-C4,10 hydroxycarboxyalkylamino, trialkylamino, naphthylamino, p enylamino, acylamino, (alkyl) (phenylalkyl) amino, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino, hydroxy, C1-C4 alkoxy, C1-C4 thoxyalkoxy,
15 trifluorométhyle, carboxy libre, salifié, estérifié ou amidifié, pyrrolidinyle éventuellement substitué par alkyle en Cl- C4, pipéridyle, pipérazinyle éventuellement substitué par alkyle ouTrifluoromethyl, free, salified, esterified or amidated carboxy, pyrrolidinyl optionally substituted with C1-C4 alkyl, piperidyl, piperazinyl optionally substituted with alkyl or
20 phénylalkyle avec alkyle en C1-C4, morpholinyle, pyridyle, naphtyle ou phényle éventuellement substitué par un ou plusieurs radicaux choisis parmi les radicaux alcoxy en C1-C4, halogène, amino,Phenylalkyl with C1-C4 alkyl, morpholinyl, pyridyl, naphthyl or phenyl optionally substituted by one or more radicals chosen from C1-C4 alkoxy, halogen, amino,
25 . alkylamino et dialkylamino ; un cycle aromatique tel que défini ci-dessus; un radical quinuclidine ; un radical pyrrolidinyle lui-même éventuellement substitué par un radical alkyle ou25. alkylamino and dialkylamino; an aromatic cycle as defined above; a quinuclidine radical; a pyrrolidinyl radical itself optionally substituted by an alkyl radical or
30 phénylalkyle avec alkyle en C1-C4 ; un radical pipérazinyle . lui-même éventuellement substitué par un radical alkyle, cycloalkyle ou phénylalkyle ; un radical -morpholinyle ; un radical pyridyle ou un 35 radical pipéridyle éventuellement substitués par un ou plusieurs radicaux alkyle ou phénylalkyle avec alkyle C1-C4 ; un radical indazolyle ; un radical naphtyle, un radical benzotriazole ; un 5 radical pyrimidinyle éventuellement substitué par un ou plusieurs alkyle avec alkyle en C1-C4 ; un radical acénaphtène, étant entendu que lorsque XR1R2 représentePhenylalkyl with C1-C4 alkyl; a piperazinyl radical. itself optionally substituted by an alkyl, cycloalkyl or phenylalkyl radical; a -morpholinyl radical; a pyridyl radical or a piperidyl radical optionally substituted by one or more alkyl or phenylalkyl radicals with C1-C4 alkyl; an indazolyl radical; a naphthyl radical, a benzotriazole radical; a pyrimidinyl radical optionally substituted by one or more alkyl with C1-C4 alkyl; an acenaphthene radical, it being understood that when XR1R2 represents
NR1R2, alors RI et R2 identiques neNR1R2, then RI and R2 identical do not
10 représentent pas tous deux hydrogène ou alkyle C1-C4 non substitué et RI et R2 différents ne représentent pas l'un hydrogène et- l'autre alkyle C1-C4 non substitué10 do not both represent hydrogen or C1-C4 unsubstituted alkyl and RI and R2 are different do not represent one hydrogen and- the other C1-C4 alkyl unsubstituted
15 ou bien lorsque X représente N ou alkyle,Or else when X represents N or alkyl,
RI et R2 forment ensemble avec X auquel ils sont liés un radical choisi parmi les radicaux suivants : pipérazinyle éventuellement substitué par un ouRI and R2 form, together with X to which they are linked, a radical chosen from the following radicals: piperazinyl optionally substituted by one or
20 plusieurs radicaux identiques ou différents ; pyrrolidinyle éventuellement substitué par alkyle ou alcoxy en C1-C4, hydroxy, acylamino, pyrrolidinylalkyl et pyridyle ; 1, 2, 3, 4-tétrahydroiso-20 several identical or different radicals; pyrrolidinyl optionally substituted with C1-C4 alkyl or alkoxy, hydroxy, acylamino, pyrrolidinylalkyl and pyridyl; 1, 2, 3, 4-tetrahydroiso-
25 quinoléinyle ; diazépine éventuellement substitué par alkyle ou pyrrolidinylalkyl ; pipéridyle éventuellement substitué par alkyle, alcoxy ou alcoxyalkyle, hydroxy et cycloalkyl-Quinolinyl; diazepine optionally substituted by alkyl or pyrrolidinylalkyl; piperidyl optionally substituted by alkyl, alkoxy or alkoxyalkyl, hydroxy and cycloalkyl-
30 alkyle ; morpholinyle ; imidazolinyle éventuellement substitué par alkyle, ou un groupe diazine éventuellement substitué par les mêmes groupes que la triazine ou un de ses sels, ces composés étant sous toutes les formes isomères possibles racemiques, enantiomeres et diastéréo-isomères .Alkyl; morpholinyl; imidazolinyl optionally substituted with alkyl, or a diazine group optionally substituted with the same groups as triazine or a salt thereof, these compounds being in all the possible racemic, enantiomeric and diastereoisomeric isomeric forms.
Parmi les composés définis ci-dessus, on peut citer les composés caractérisés en ce que XR1(R2) est tel que lorsque X représente N, soit l'un de RI et R2 représente l'atome d'hydrogène ou un radical alkyle en C1-C4 éventuellement substitué par un radical amino, alkylamino, dialkylamino ou phényl et l'autre de RI et R2 est choisi parmi les valeurs définies pour RI et R2 à l'une quelconque des revendications 1 à 8 soit Ri et R2 forment ensemble avec l'atome d'azote auxquels ils sont liés un radical pipérazinyle éventuellement substitué par un ou plusieurs radicaux choisis parmi alkyle, aminoalkyle, alkylaminoalkyle, dialkylaminoalkyle, phénylalkyle, alcoxyalkyle, hydroxyalkyl, hydroxyalcoxy- alkyle avec alcoxy, pyrrolidinylalkyle, cycloalkyle en C3-C8, pyrazinyle, pyrimidinyle, pyridyle, furylcarbonyle, furfurycarbonyle, quinolyle ; pyrrolidinyle éventuellement substitué par alkyle ou alcoxy en C1-C4, hydroxy, acylamino, pyrrolidinylalkyl et pyridyle ; 1, 2, 3, 4-tétrahydroisoquinoléinyle ; diazépine éventuellement substitué par alkyle ou pyrrolidinylalkyl ; pipéridyle éventuellement substitué par alkyle, alcoxy ou alcoxyalkyle, hydroxy et cycloalkylalkyle ; morpholinyle ; imidazolinyle éventuellement substitué par alkyle.Among the compounds defined above, mention may be made of the compounds characterized in that XR1 (R2) is such that when X represents N, either one of RI and R2 represents the hydrogen atom or an alkyl radical in C1 -C4 optionally substituted with an amino, alkylamino, dialkylamino or phenyl radical and the other of RI and R2 is chosen from the values defined for RI and R2 in any one of claims 1 to 8, either Ri and R2 form together with l nitrogen atom to which they are linked a piperazinyl radical optionally substituted by one or more radicals chosen from alkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, phenylalkyl, alkoxyalkyl, hydroxyalkyl, hydroxyalkoxyalkyl with C3-C8 cycloalkyl, pyrazinyl , pyrimidinyl, pyridyl, furylcarbonyl, furfurycarbonyl, quinolyl; pyrrolidinyl optionally substituted with C1-C4 alkyl or alkoxy, hydroxy, acylamino, pyrrolidinylalkyl and pyridyl; 1, 2, 3, 4-tetrahydroisoquinolinyl; diazepine optionally substituted by alkyl or pyrrolidinylalkyl; piperidyl optionally substituted with alkyl, alkoxy or alkoxyalkyl, hydroxy and cycloalkylalkyl; morpholinyl; imidazolinyl optionally substituted with alkyl.
La présente invention a pour objet les composés fixant la structure G-quadruplex des télomères caractérisés en ce qu'ils répondent à la formule générale telle que définie ci-dessus. La présente invention concerne ainsi des composés tels que définis ci-dessus caractérisés en ce qu'ils répondent à la formule générale suivante : cycle aromatique azoté - NR3 - répartiteur - NR'3 - cycle aromatique dans laquelleThe subject of the present invention is the compounds fixing the G-quadruplex structure of telomeres characterized in that they correspond to the general formula as defined above. The present invention thus relates to compounds as defined above, characterized in that they correspond to the following general formula: nitrogen aromatic cycle - NR 3 - distributor - NR ' 3 - aromatic cycle in which
• le cycle aromatique azoté, représente :• the nitrogen aromatic cycle, represents:
0 une quinoléine éventuellement substituée par au moins un groupe N(Ra) (Rb) dans lequel Ra et Rb, identiques ou différents représentent l'hydrogène ou un radical alkyle en C1-C4, (ou) un groupe alkoxy ou alkyle à chaîne courte en C1-C4 ou0 a quinoline optionally substituted by at least one N (Ra) (Rb) group in which Ra and Rb, which are identical or different, represent hydrogen or a C1-C4 alkyl radical, (or) an alkoxy or short-chain alkyl group in C1-C4 or
0 une quinoléine possédant un atome d'azote sous forme quaternaire ou0 a quinoline having a nitrogen atom in quaternary form or
0 une benzamidine ou0 a benzamidine or
0 une pyridine0 a pyridine
•' le cycle aromatique représente• ' the aromatic cycle represents
0 une quinoléine éventuellement substituée par au moins un groupe N(Ra) (Rb) dans lequel Ra et0 a quinoline optionally substituted by at least one N (Ra) (Rb) group in which Ra and
Rb, identiques ou différents représentent l'hydrogène ou un radical alkyle en C1-C4, (ou) un groupe alkoxy ou alkyle à chaîne courte en C1-C4 ou 0 une quinoléine possédant un atome d'azote sous forme quaternaire ouRb, identical or different, represent hydrogen or a C1-C4 alkyl radical, (or) a C1-C4 short chain alkoxy or alkyl group or 0 a quinoline having a nitrogen atom in quaternary form or
0 une benzamidine ou0 a benzamidine or
0 une pyridine ou0 a pyridine or
0 un noyau phényle éventuellement substitué par un groupement halogène ; alkoxy en Cl-0 a phenyl ring optionally substituted by a halogen group; alkoxy in Cl-
C4 ; cyano ; carbonyla ino éventuellement substitué par un ou plusieurs groupes alkyle en C1-C4 ; guanyl ; alkylthio en C1-C4 ; amino, alkylamino en C1-C4, dialkylamino en C1-C4 pour chaque groupe alkyle et dont les parties alkyles peuvent ensemble former un cycle en C3-C8, nitro ; alkylèneamino en C1-C4 ; alkénylèneamino en C2-C4,C4; cyano; carbonyla ino possibly substituted with one or more C1-C4 alkyl groups; guanyl; C1-C4 alkylthio; amino, C1-C4 alkylamino, C1-C4 dialkylamino for each alkyl group and the alkyl parts of which can together form a C3-C8, nitro ring; C1-C4 alkyleneeamino; C2-C4 alkenyleneamino,
0 un noyau hétérocyclique mono ou bi ou tricyclique comportant 0 à 2 hétéroatome par cycle à la condition qu' au moins un hétéroatome soit présent dans au moins un cycle éventuellement substitué par un ou plusieurs groupes alkyle en C1-C4 ou par des groupes alkylène en C1-C4 ou alkénylène en C2-C40 a heterocyclic ring, mono or bi or tricyclic, comprising 0 to 2 heteroatoms per cycle, provided that at least one heteroatom is present in at least one ring optionally substituted by one or more C1-C4 alkyl groups or by alkylene groups C1-C4 or C2-C4 alkenylene
• R3 et R'3, identiques ou différents, représentent indépendamment l'un de l'autre l'hydrogène ou un radical alkyle en C1-C4 • le répartiteur représente : un groupe triazine éventuellement substitué par un radical XR1(R2) dans lequel X représente un atome d'azote N pour former NR1R2, un radical alkyle linéaire ou ramifié en C1-C6 pour former alkRlR2, un atome d'oxygène O pour former ORl ou un atome de soufre S pour former SRI, avec RI et R2 identiques ou différents sont choisis parmi l'atome d'hydrogène ; alkyle C1-C8 éventuellement substitué par un radical amino, alkylamino, dialkylamino, (phényl) (alkyl) amino, (alkylphényl) (alkyl) amino, alcoxy en Cl- C4, thioalcoxy en C1-C4, trifluorométhyle, pyrrolidinyle, pipéridyle, pipérazinyle, morpholinyle, pyridyle ou phényle ; un cycle aromatique tel que défini ci-dessus; un radical quinuclidine, un radical pyrrolidinyle, pipérazinyle, morpholinyle, pyridyle ou un radical pipéridyle éventuellement substitué par alkyle C1-C4 étant entendu que RI et R2 identiques ne représentent pas tous deux hydrogène ou alkyle C1-C4 non substitué et RI et R2 différents ne représentent pas l'un hydrogène et l'autre alkyle C1-C4 non substitué ou bien lorsque X représente N ou alkyle,• R3 and R'3, identical or different, independently of one another represent hydrogen or a C1-C4 alkyl radical • the distributor represents: a triazine group optionally substituted by an XR1 (R2) radical in which X represents a nitrogen atom N to form NR1R2, a linear or branched C1-C6 alkyl radical to form alkRlR2, an oxygen atom O to form ORl or a sulfur atom S to form SRI, with RI and R2 identical or different are chosen from the hydrogen atom; C1-C8 alkyl optionally substituted by an amino, alkylamino, dialkylamino, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino, C1- alkoxy radical C4, C1-C4 thioalkoxy, trifluoromethyl, pyrrolidinyl, piperidyl, piperazinyl, morpholinyl, pyridyl or phenyl; an aromatic cycle as defined above; a quinuclidine radical, a pyrrolidinyl, piperazinyl, morpholinyl, pyridyl radical or a piperidyl radical optionally substituted with C1-C4 alkyl, it being understood that identical RI and R2 do not both represent hydrogen or unsubstituted C1-C4 alkyl and RI and R2 are different do not represent one hydrogen and the other unsubstituted C1-C4 alkyl or else when X represents N or alkyl,
RI et R2 forment ensemble avec X auquel ils sont liés un radical monocyclique de 3 à 6 chaînons ou bicyclique de 8 à 10 chaînons saturé ou insaturé renfermant éventuellement un ou deux hétéroatomes identiques ou différents choisis parmi N, 0 ou S, un groupe diazine éventuellement substitué par les mêmes groupes que la triazine ou un de ses sels, ces composés étant sous toutes les formes isomères possibles racemiques, enantiomeres et diastéréo-isomères .RI and R2 together with X to which they are linked form a 3 to 6-membered monocyclic or 8 to 10-membered bicyclic radical, saturated or unsaturated, optionally containing one or two identical or different heteroatoms chosen from N, 0 or S, an optionally diazine group substituted by the same groups as triazine or one of its salts, these compounds being in all the possible racemic, enantiomeric and diastereoisomeric isomer forms.
On entend au sens de la formule ci-dessus par cycle aromatique azoté un hétérocycle comportant au moins un atome d'azote ou un groupe aromatique ne comportant pas d' hétéroatome dans le cycle mais contenant au moins un atome d'azote dans une chaîne hydrocarbonée liée au cycle comme par exemple une chaîne guanidino ou guanyl.Within the meaning of the above formula, the term “nitrogen aromatic cycle” means a heterocycle comprising at least one nitrogen atom or an aromatic group not comprising a heteroatom in the cycle but containing at least one nitrogen atom in a hydrocarbon chain linked to the ring such as for example a guanidino or guanyl chain.
Le cycle aromatique représente notamment un radical quinaldine, quinoléine, benzamidine, pyridine et phényle tels que définis ci-dessus et éventuellement substitués comme indiqué ci-dessus.The aromatic ring represents in particular a quinaldine, quinoline, benzamidine, pyridine and phenyl radical as defined above and optionally substituted as indicated above.
Comme cycle en C3-C8 que peuvent former les parties alkyles des radicaux dialkylamino définis ci-dessus, on peut citer par- exemple les . cycles aziriridine, azétidine, pyrrolidine, oxazolidine, thiazolidine, pipéridine, pipérazine, morpholine, thiomorpholine ou encore azépine.As the C3-C8 ring which the alkyl parts of the dialkylamino radicals defined above can form, mention may, for example, be made of them. aziriridine, azetidine, pyrrolidine, oxazolidine, thiazolidine, piperidine, piperazine, morpholine, thiomorpholine or even azepine cycles.
Dans les produits ci-dessus et ci-après, les radicaux chimiques ont leurs sens usuels que l'on trouve dans les documents de travail de l'homme du métier et notamment répondent aux définitions suivantes:In the products above and below, the chemical radicals have their usual meanings which are found in the working documents of those skilled in the art and in particular meet the following definitions:
- le terme radical alkyle désigne des radicaux linéaires ou ramifiés notamment les radicaux méthyle, éthyle, propyle, isopropyle, butyle, isobutyle, sec- butyle, tert-butyle, pentyle, isopentyle, hexyle, isohexyle et également heptyle, octyle, nonyle et décyle ainsi que leurs isomères de position linéaires ou ramifiés, le terme radical - alcoxy désigne des radicaux linéaires ou ramifiés notamment - les radicaux méthoxy, éthoxy, propoxy, isopropoxy, butoxy linéaire, secondaire ou tertiaire, pentoxy ou hexoxy ainsi que leurs isomères de position linéaires ou ramifiés,- the term alkyl radical designates linear or branched radicals in particular methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, hexyl, isohexyl and also heptyl, octyl, nonyl and decyl radicals as well as their linear or branched position isomers, the term radical - alkoxy designates linear or branched radicals in particular - methoxy, ethoxy, propoxy, isopropoxy, linear, secondary or tertiary butoxy, pentoxy or hexoxy radicals as well as their linear position isomers or branched,
- le terme atome d'halogène désigne les atomes de chlore, fluor, brome ou d'iode, et notamment de chlore et de fluor le terme radical cycloalkyle désigne les radicaux cyclohexyle, cyclopropyle, cyclobutyle et également les radicaux cycloheptyle et cyclooctyle -le terme alkylphényle désigne un radical phényle substitué par un ou plusieurs radicaux alkyle tels que définis ci-dessus linéaires ou ramifiés de préférence renfermant au plus 4 atomes de carbone les termes NH(alk) et N(alk) (alk) désignent un radical amino substitué respectivement par un ou deux radicaux alkyle, de tels radicaux alkyle étant linéaires ou ramifiés et renfermant de préférence au plus 4 atomes de carbone le terme acylamino désigne les radicaux -C(0)-NH2, -C(0)-NH(alk) et -C (O) -N (alk) (alk) dans lesquels les radicaux NH(alk) et N(alk) (alk) ont la signification indiquée ci-dessusthe term halogen atom designates the chlorine, fluorine, bromine or iodine atoms, and in particular chlorine and fluorine atoms the term cycloalkyl radical designates the cyclohexyl, cyclopropyl, cyclobutyl radicals and also the cycloheptyl and cyclooctyl radicals the term alkylphenyl denotes a phenyl radical substituted by one or more alkyl radicals as defined above linear or branched preferably containing at most 4 carbon atoms the terms NH (alk) and N (alk) (alk) denote a radical amino substituted respectively by one or two alkyl radicals, such alkyl radicals being linear or branched and preferably containing at most 4 carbon atoms the term acylamino designates the radicals -C (0) -NH2, -C (0) -NH ( alk) and -C (O) -N (alk) (alk) in which the radicals NH (alk) and N (alk) (alk) have the meaning indicated above
-le terme acyle désigne un radical R-C(O)- dans lequel R représente un radical choisi parmi l'atome d'hydrogène, les radicaux alkyle linéaires ou ramifiés renfermant au plus 8 atomes de carbone ou un radical carbocyclique ou hétérocyclique saturé ou pas, choisi par exemple parmi les cycles définis ci-dessus aromatiques ou non aromatiques : le terme acyle désigne ainsi par exemple les radicaux formyle, acétyle, propionyle, butanoyle, pentanoyle, hexanoyle, benzoyle, pyrrolidinyl- carbonyle, pyrazinylcarbonyle, pipérazinylcarbonyle, furylcarbonyle ou furfurylcarbonyle. Le ou les radicaux carboxy des produits de formule (I) peuvent être salifiés ou estérifiés par les groupements divers connus de l'homme du métier parmi lesquels on peut citer, par exemple :the term acyl denotes a radical RC (O) - in which R represents a radical chosen from the hydrogen atom, linear or branched alkyl radicals containing at most 8 carbon atoms or a saturated or unsaturated carbocyclic or heterocyclic radical, chosen for example from the aromatic or non-aromatic rings defined above: the term acyl thus denotes for example the formyl, acetyl, propionyl, butanoyl, pentanoyl, hexanoyl, benzoyl, pyrrolidinylcarbonyl, pyrazinylcarbonyl, piperazinylcarbonyl, furylcarbonyl or furfurylcarbonyl radicals. The carboxy radical (s) of the products of formula (I) can be salified or esterified by various groups known to those skilled in the art, among which there may be mentioned, for example:
- parmi les composés de salification, des bases minérales telles que, par exemple, un équivalent de sodium, de potassium, de lithium, de calcium, de magnésium ou d'ammonium ou des bases organiques telles que, par exemple, la méthylamine, la propylamine, la triméthylamine, la diéthylamine, la triéthyla ine, la N,N-diméthyléthanσlamine, le tris (hydroxyméthyl) amino méthane, 1 ' éthanolamine, la pyridine, la picoline, la dicyclohexylamine, la morpholine, la benzylamine, la procaïne, la lysine, l'arginine, l'histidine, la N-méthylglucamine,- among salification compounds, mineral bases such as, for example, an equivalent of sodium, potassium, lithium, calcium, magnesium or ammonium or organic bases such as, for example, methylamine, propylamine, trimethylamine, diethylamine, triethylamine, N, N-dimethylethanσlamine, tris (hydroxymethyl) amino methane, ethanolamine, pyridine, picoline, dicyclohexylamine, morpholine, benzylamine, procaine, lysine, arginine, histidine, N- methylglucamine
- parmi les composés d' estérification, les radicaux alkyle pour former des groupes alcoxy carbonyle tel que, par exemple, méthoxycarbonyle, éthoxycarbonyle, tert- butoxycarbonyle ou benzyloxycarbonyle, ces radicaux alkyles pouvant être substitués par des radicaux choisis par exemple parmi les atomes d'halogène, les radicaux hydroxyle, alcoxy, acyle, acyloxy, alkylthio, amino ou aryle comme, par exemple, dans les groupements chlorométhyle, hydroxypropyle, méthoxyméthyle, propionyl- oxy éthyle, méthylthiométhyle, diméthylaminoéthyle, benzyle ou phénéthyle.- Among the esterification compounds, the alkyl radicals to form alkoxy carbonyl groups such as, for example, methoxycarbonyl, ethoxycarbonyl, tert-butoxycarbonyl or benzyloxycarbonyl, these alkyl radicals being able to be substituted by radicals chosen for example from atoms of halogen, hydroxyl, alkoxy, acyl, acyloxy, alkylthio, amino or aryl radicals, such as, for example, in chloromethyl, hydroxypropyl, methoxymethyl, propionyloxy ethyl, methylthiomethyl, dimethylaminoethyl, benzyl or phenethyl groups.
Les sels d'addition avec les acides minéraux ou organiques des produits de formule (I) peuvent être, par exemple, les sels formés avec les acides chlorhydrique, bromhydrique, iodhydrique, nitrique, sulfurique, phosphorique, propionique, acétique, trifluoroacétique, formique, benzoïque, maléique, fu arique, succinique, tartrique, citrique, oxalique, glyoxylique, aspartique, ascorbique, les acides alcoylmonosulfoniques tels que par exemple l'acide méthanesulfonique, l'acide éthanesulfonique, l'acide propanesulfonique, les acides alcoyldisulfoniques tels que par exemple l'acide méthanedisulfonique, l'acide alpha, béta-éthane- disulfonique, les acides arylmonosulfoniques tels que l'acide benzènesulfonique et les acides aryldi- sulfoniques .The addition salts with mineral or organic acids of the products of formula (I) can be, for example, the salts formed with hydrochloric, hydrobromic, hydroiodic, nitric, sulfuric, phosphoric, propionic, acetic, trifluoroacetic, formic acids, benzoic, maleic, fu aric, succinic, tartaric, citric, oxalic, glyoxylic, aspartic, ascorbic, alkylmonosulfonic acids such as for example methanesulfonic acid, ethanesulfonic acid, propanesulfonic acid such as for example methanedisulfonic acid, alpha acid, beta-ethane disulfonic acid, arylmonosulfonic acids such as benzenesulfonic acid and aryldisulfonic acids.
Les sels pharmaceutiquement . acceptables des produits de formule (I) sont en particulier des sels utilisables, non toxiques : de tels sels des produits de formule (I) telle que défine ci-dessus peuvent être obtenus par les méthodes ordinaires connues de l'homme du métier, par exemple en combinant un composé de formule (I) avec un acide organique ou inorganique ou une base dans un solvant ou un dispersant ou à partir d'un autre sel par échange de cation ou d'anion.Pharmaceutical salts. acceptable products of formula (I) are in particular usable, non-toxic salts: such salts of products of formula (I) as defined above can be obtained by the ordinary methods known to a person skilled in the art, for example by combining a compound of formula (I) with an organic or inorganic acid or a base in a solvent or a dispersant or from another salt by cation or anion exchange.
On peut rappeler que la stéréoisomérie peut être définie dans son sens large comme l'isomérie de composés ayant les mêmes formules développées, mais dont les différents groupes sont disposés différemment dans l'espace, tels que notamment dans des cyclohexanes monosubstitués dont le substituant peut être en position axiale ou équatoriale, et les différentes .conformations rotationnelles possibles des dérivés de 1 ' éthane . Cependant, il existe un autre type de stéréoisomérie, dû aux arrangements spatiaux différents de substituants fixés, soit sur des doubles liaisons, soit sur des cycles, que l'on appelle souvent isomérie géométrique ou isomérie cis-trans. Le terme stéréoisomères est utilisé dans la présente demande dans son sens le plus large et concerne donc l'ensemble des composés indiqués ci-dessus.It may be recalled that stereoisomerism can be defined in its broad sense as the isomerism of compounds having the same developed formulas, but whose different groups are arranged differently in space, such as in particular in monosubstituted cyclohexanes whose substituent can be in an axial or equatorial position, and the different possible rotational conformations of the ethane derivatives. However, there is another type of stereoisomerism, due to the different spatial arrangements of substituents attached, either on double bonds or on rings, which is often called geometric isomerism or cis-trans isomerism. The term stereoisomers is used in the present application in its broadest sense and therefore relates to all of the compounds indicated above.
La présente invention a notamment pour objet les composés tels que définis ci-dessus caractérisés en ce que le répartiteur représente : - - un groupe triazine éventuellement substitué par un radical XR1(R2) dans lequel X représente un atome d'azote N pour former NR1R2, un atome d'oxygène O pour former ORl ou un atome de soufre S pour former SRI, avec Ri et R2 identiques ou différents sont choisis parmi l'atome d'hydrogène ; alkyle C1-C8 éventuellement substitué par un radical amino, alkylamino, dialkylamino, (phényl) (alkyl) amino, (alkylphényl) (alkyl) amino, alcoxy en Cl- C4, par un radical pyrrolidinyle, pyridyle ou par un radical phényle ; un cycle aromatique tel que défini ci-dessus 7 un radical quinuclidine, un radical pyrrolidinyle ou un radical pipéridyle éventuellement substitué par alkyle C1-C4 étant entendu que Ri et R2 identiques ne représentent pas tous deux hydrogène ou alkyle C1-C4 non substitué et Ri et R2 différents ne représentent pas l'un hydrogène et l'autre alkyle C1-C4 non substitué, ou bien lorsque X représente N, RI et R2 forment ensemble avec X auquel ils sont liés un "radical pipérazinyle, pipéridyle, pyrrolidinyle, morpholinyle ou thiomorpholinyle, un groupe diazine éventuellement substitué par les mêmes groupes que la triazine ou un de ses sels, ces composés étant sous toutes les formes isomères possibles racemiques, enantiomeres et diastéréo-isomères .The subject of the present invention is in particular the compounds as defined above, characterized in that the distributor represents: - a triazine group optionally substituted by a radical XR1 (R2) in which X represents a nitrogen atom N to form NR1R2 , an oxygen atom O to form OR1 or a sulfur atom S to form SRI, with Ri and R2 identical or different are chosen from the hydrogen atom; C1-C8 alkyl optionally substituted by an amino radical, alkylamino, dialkylamino, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino, C1-C4 alkoxy, by a pyrrolidinyl, pyridyl radical or by a phenyl radical; an aromatic ring as defined above 7 a quinuclidine radical, a pyrrolidinyl radical or a piperidyl radical optionally substituted with C1-C4 alkyl, it being understood that identical Ri and R2 do not both represent hydrogen or unsubstituted C1-C4 alkyl and Ri and R2 different do not represent one hydrogen and the other unsubstituted C1-C4 alkyl, or else when X represents N, RI and R2 form together with X to which they are linked a " piperazinyl, piperidyl, pyrrolidinyl, morpholinyl or thiomorpholinyl, a diazine group optionally substituted with the same groups as triazine or one of its salts, these compounds being in all the possible racemic, enantiomeric and diastereomeric isomeric forms.
La présente invention a particulièrement pour objet les composés tels que définis ci-dessus caractérisés en ce que les groupes diazines sont des pyrimidines ou des quinazolines . La présente invention a plus particulièrement pour objet les composés tels que définis ci-dessus caractérisés en ce que XR1(R2) est tel que lorsque X représente N, soit l'un de Ri et R2 représente l'atome d'hydrogène et l'autre de Ri et R2 est choisi parmi les valeurs définis pour RI et R2 soit RI et R2 forment ensemble avec l'atome d'azote auxquels ils sont liés un radical pipérazinyle, pyrrolidinyle, pipéridyle ou morpholino.The present invention particularly relates to the compounds as defined above, characterized in that the diazine groups are pyrimidines or quinazolines. A more particular subject of the present invention is the compounds as defined above, characterized in that XR1 (R2) is such that when X represents N, that is one of Ri and R2 represents the hydrogen atom and the other of Ri and R2 is chosen from the values defined for RI and R2, that is to say RI and R2 form, together with the nitrogen atom to which they are linked, a piperazinyl, pyrrolidinyl, piperidyl or morpholino radical.
La présente invention concerne particulièrement des composés tels que définis ci-dessus caractérisés en ce qu'ils répondent à la formule (I) ci-dessous :The present invention particularly relates to compounds as defined above, characterized in that they correspond to formula (I) below:
dans laquelle :in which :
A représente un radical XR1(R2) dans lequel X représente un atome d'azote, d'oxygène, de soufre ou un radical alkyle en C1-C6 pour former l'un des radicaux suivants :A represents a radical XR1 (R2) in which X represents a nitrogen, oxygen or sulfur atom or a C1-C6 alkyl radical to form one of the following radicals:
NR1R2 avec RI et R2 identiques ou différents sont choisis parmi l'atome d'hydrogène ; un radical alkyle en C1-C8 éventuellement substitué par un ou plusieurs radicaux identiques ou différents ; un cycle aromatique tel que défini ci-dessus ; un radical quinuclidine ; un radical pyrrolidinyle lui-même éventuellement substitué par un radical alkyle ou phénylalkyle avec alkyle en C1-C4 ; un radical pipérazinyle ou homopipérazinyl lui-même éventuellement substitué par un radical alkyle, cycloalkyle ou phénylalkyle ; un radical morpholinyle ; un radical pyridyle, piperidinyle ou un radical pipéridyle éventuellement substitués par un ou plusieurs radicaux alkyle ou phénylalkyle avec alkyle C1-C4 ; un radical indazolyle ; un radical naphtyle ; un radical benzotriazole ; un radical benzimidazolyle ; un radical pyrimidinyle éventuellement substitué par un ou plusieurs alkyle avec alkyle en C1-C4 ; un radical acénaphtène ; un radical amino lui-même éventuellement substitué par un deux radicaux identiques ou différents choisis parmi alkyle, phénylalkyle, alkylaminoalkyle et dialkylaminoalkyle, étant entendu que lorsque XR1R2 représente NR1R2, alors Ri et R2 identiques ne représentent pas tous deux hydrogène ou alkyle C1-C4 non substitué et Ri et R2 différents ne représentent pas l'un hydrogène et l'autre alkyle C1-C4 non substitué ou bien lorsque X représente N ou alkyle, RI et R2 forment ensemble avec X auquel ils sont liés un radical monocyclique de 3 à 6 chaînons ou bicyclique de 8 à 10 chaînons saturé ou insaturé renfermant éventuellement un ou deux hétéroatomes identiques ou différents choisis parmi N, O ou S,NR1R2 with RI and R2 identical or different are chosen from the hydrogen atom; a C1-C8 alkyl radical optionally substituted by one or more identical or different radicals; an aromatic cycle as defined above; a quinuclidine radical; a pyrrolidinyl radical itself optionally substituted by an alkyl or phenylalkyl radical with C1-C4 alkyl; a piperazinyl or homopiperazinyl radical itself optionally substituted by an alkyl, cycloalkyl or phenylalkyl radical; a radical morpholinyl; a pyridyl, piperidinyl or a piperidyl radical optionally substituted by one or more alkyl or phenylalkyl radicals with C1-C4 alkyl; an indazolyl radical; a naphthyl radical; a benzotriazole radical; a benzimidazolyl radical; a pyrimidinyl radical optionally substituted by one or more alkyl with C1-C4 alkyl; an acenaphthene radical; an amino radical itself optionally substituted by two identical or different radicals chosen from alkyl, phenylalkyl, alkylaminoalkyl and dialkylaminoalkyl, it being understood that when XR1R2 represents NR1R2, then Ri and R2 identical do not both represent hydrogen or C1-C4 alkyl not substituted and different Ri and R2 do not represent one hydrogen and the other unsubstituted C1-C4 alkyl or else when X represents N or alkyl, RI and R2 form together with X to which they are linked a monocyclic radical from 3 to 6 8 or 10-membered or bicyclic chain links, saturated or unsaturated, optionally containing one or two identical or different heteroatoms chosen from N, O or S,
• un groupe ORl ou SRI dans lequel Ri a la même signification que précédemment étant entendu que RI ne représente pas hydrogène ou alkyle C1-C4 non substitué, ou • un groupe alkyle contenant 1 à 6 atomes de carbone substitué par Ri R2 tels que définis ci-dessusAn OR1 or SRI group in which Ri has the same meaning as above, it being understood that RI does not represent hydrogen or unsubstituted C1-C4 alkyl, or • an alkyl group containing 1 to 6 carbon atoms substituted by Ri R2 as defined above
- R3 et R'3, identiques ou différents, représentent indépendamment l'un de l'autre l'hydrogène ou un groupe alkyle en C1-C4- R3 and R'3, identical or different, independently of one another represent hydrogen or a C1-C4 alkyl group
- Ari et Ar2 identiques ou différents représentent- Ari and Ar 2 identical or different represent
* quand Ari et Ar2 sont identiques :* when Ari and Ar 2 are identical:
• un motif quinoléine ou isoquinoléine éventuellement substituée par au moins un radical choisi parmi un groupe N(Ra) (Rb) dans lequel Ra et Rb, identiques ou différents représentent l'hydrogène ou un radical alkyle en C1-C4, et un ou plusieurs groupe (s) alkoxy ou alkyle à chaîne courte en C1-C4 lié (s) à un atome de carbone ou d'azote du cycle quinoléine ou isoquinoléine ou• a quinoline or isoquinoline motif optionally substituted by at least one radical chosen from a group N (Ra) (Rb) in which Ra and Rb, which are identical or different, represent hydrogen or a C1-C4 alkyl radical, and one or more C1-C4 alkoxy or short chain alkyl group (s) linked to a carbon or nitrogen atom of the quinoline or isoquinoline ring or
• une quinoléine ou isoquinoléine possédant un atome d'azote sous forme quaternaire ou• a quinoline or isoquinoline having a nitrogen atom in quaternary form or
• une benzamidine ou• a benzamidine or
• une pyridine attachée en position -4 ou fusionnée avec un groupe aryle ou hétéroaryle éventuellement substituée par un groupe alkyle en C1-C4• a pyridine attached in position -4 or fused with an aryl or heteroaryl group optionally substituted by a C1-C4 alkyl group
* quand Ari et Ar2 sont différents* when Ari and Ar 2 are different
• Ari et Ar2 représentent tous les deux l'une des possibilités évoquées ci-dessus pour • Ari représente l'une des possibilités ci- dessus et Ar2 représente * un noyau phényle éventuellement substitué par un groupement halogène, alkoxy en C1-C4, cyano, carbonylamino éventuellement substitué par un ou plusieurs groupes alkyle en C1-C4, guanyl, alkylthio en C1-C4, amino, alkylamino en C1-C4, dialkylamino en Cl- C4 pour chaque groupe alkyle, nitro, alkylèneamino en C1-C4, (ou) alkénylène- amino en C2-C4, ou un radical pipérazinyle éventuellement substitué par un radical alkyle C1-C4,• Ari and Ar 2 both represent one of the possibilities mentioned above for • Ari represents one of the possibilities above and Ar 2 represents * a phenyl ring optionally substituted by a halogen group, C1-C4 alkoxy, cyano, carbonylamino optionally substituted by one or more C1-C4 alkyl groups, guanyl, C1-C4 alkylthio, amino, C1-C4 alkylamino, dialkylamino in C1-C4 for each alkyl, nitro, C1-C4 alkyleneamino, (or) alkenylene-amino in C2-C4, or a piperazinyl radical optionally substituted by a C1-C4 alkyl radical,
* un noyau hétérocyclique mono ou bi ou tricyclique comportant 0 à 2 hétéroatome par cycle à la condition qu' au moins un hétéroatome soit présent dans au moins un cycle éventuellement substitué par un ou plusieurs groupes alkyle en C1-C4 ou par des groupes alkylène en C1-C4 ou alkénylène en C2-C4 ou un de ses sels, ces composés de formule (I) étant sous toutes les formes isomères possibles racemiques, enantiomeres et diastéréo-isomères .* a mono or bi or tricyclic heterocyclic ring comprising 0 to 2 heteroatoms per cycle provided that at least one heteroatom is present in at least one ring optionally substituted by one or more C1-C4 alkyl groups or by alkylene groups C1-C4 or C2-C4 alkenylene or a salt thereof, these compounds of formula (I) being in all the possible racemic isomeric, enantiomeric and diastereoisomeric forms.
On peut citer parmi les composés de formule (I) telle que définie ci-dessus, les composés caractérisés en ce que lorsque l'un ou les deux de RI et R2 représente (nt) un radical alkyle en C1-C8 éventuellement substitué par un ou plusieurs radicaux identiques ou différents, ces radicaux sont choisis parmi le radical amino lui-même éventuellement substitué par un ou deux radicaux identiques ou différents choisis parmi les radicaux alkyle, hydroxyalkyle, alcoxyalkyle, phénylalkyle, carboxyalkyle, hydroxycarboxyalkyle, acyle, naphtyle, phényle et alkylphényle ; le radical trialkylammonio ; les radicaux hydroxy ; alcoxy ; thioalcoxy ; trifluorométhyle ; acyle ; carboxy libre, salifié, estérifié ou a idifié ; ' imidazolyle ; pyrrolidinyle éventuellement substitué par alkyle en C1-C4 ; pipéridyle et pipérazinyle éventuellement substitué (s) par alkyle ou phénylalkyle avec alkyl en C1-C4 ; morpholinyle ; pyridyle ; naphtyle ou phényle lui-même éventuellement substitué par un ou plusieurs radicaux choisis parmi les radicaux alcoxy en C1-C4, halogène ou le radical amino éventuellement substitué comme défini ci-dessus .Mention may be made, among the compounds of formula (I) as defined above, of the compounds characterized in that when one or both of RI and R2 represents (s) a C1-C8 alkyl radical optionally substituted by a or more identical or different radicals, these radicals are chosen from the amino radical itself optionally substituted by one or two identical or different radicals chosen from the alkyl, hydroxyalkyl, alkoxyalkyl, phenylalkyl, carboxyalkyl, hydroxycarboxyalkyl, acyl, naphthyl, phenyl and alkylphenyl; the trialkylammonio radical; hydroxy radicals; alkoxy; thioalkoxy; trifluoromethyl; acyl; free, salified, esterified or identified carboxy; ' imidazolyle; pyrrolidinyl optionally substituted with C1-C4 alkyl; piperidyl and piperazinyl optionally substituted by alkyl or phenylalkyl with C1-C4 alkyl; morpholinyl; pyridyle; naphthyl or phenyl itself optionally substituted by one or more radicals chosen from C1-C4 alkoxy, halogen or optionally substituted amino radical as defined above.
On peut citer notamment parmi les composés- de formule (I) telle que définie ci-dessus, les composés caractérisés en ce que XR1(R2) est tel que lorsque X représente N, soit l'un de RI et R2 représente l'atome d'hydrogène et l'autre de RI et R2 est choisi parmi les valeurs définis ci-dessus pour RI et R2 soit RI et R2 forment ensemble avec l'atome d'azote auxquels ils sont liés un radical pipérazinyle, homopipérazinyle, pyrrolidinyle, pipéridyle, pyridinyle, morpholinyle, thiomorpholinyle, imidazolinyle, diazépine, 1, 2, 3, 4-tétrahydroquinoléine ou 1, 2, 3, 4-tétrahydroisoquinoléine, tous ces radicaux étant éventuellement substitués par un ou plusieurs radicaux tels que définis ci-dessus.Mention may in particular be made, among the compounds of formula (I) as defined above, of the compounds characterized in that XR1 (R2) is such that when X represents N, that is one of RI and R2 represents the atom of hydrogen and the other of RI and R2 is chosen from the values defined above for RI and R2, ie RI and R2 form, together with the nitrogen atom to which they are linked, a piperazinyl, homopiperazinyl, pyrrolidinyl, piperidyl radical , pyridinyl, morpholinyl, thiomorpholinyl, imidazolinyl, diazepine, 1, 2, 3, 4-tetrahydroquinoline or 1, 2, 3, 4-tetrahydroisoquinoline, all these radicals being optionally substituted by one or more radicals as defined above.
On peut citer notamment parmi les composés de formule (I) telle que définie ci-dessus, les composés caractérisés en ce que A représente un cycle aromatique tel que défini ci-dessus ou un radical XR1(R2) dans lequel X représente un atome d'azote N pour former NR1R2, un radical alkyle linéaire ou ramifié en C1-C6 pour former alkRlR2, un atome df oxygène O pour former ORl ou un atome de soufre S pour former SRI, avec RI et R2 identiques ou différents sont choisis parmi l'atome d'hydrogène ; alkyle C1-C8 éventuellement substitué par un ou plusieurs radicaux choisis parmi les radicaux amino, alkylamino, dialkylamino, dialcoxyalkyl- amino, dihydroxyalkylamino, alcoxyalkylamino, hydroxyalkylamino, hydroxycarboxyalkylamino, trialkyl- ammonio, naphtylamino, phénylamino, acylamino, alkyl) (phénylalkyl) amino, (phényl) (alkyl) amino, alkylphényl) (alkyl) amino, hydroxy, alcoxy en C1-C4, thioalcoxy en C1-C4, trifluorométhyle, acyle, carboxy libre, salifié, estérifié ou amidifié, imidazolyle, pyrrolidinyle éventuellement substitué par alkyle en Cl- C4, pipéridyle et pipérazinyle éventuellement substitué (s) par alkyle ou phénylalkyle avec alkyle en C1-C4, morpholinyle, pyridyle, naphtyle ou phényle éventuellement substitué par un ou plusieurs radicaux choisis parmi les radicaux alcoxy en C1-C4, halogène, amino, alkylamino et dialkylamino ; un cycle aromatique tel que défini ci-dessus ; un radical quinuclidine ; un radical pyrrolidinyle lui-même éventuellement substitué par un radical alkyle ou phénylalkyle avec alkyle en Cl- C4 ; un radical pipérazinyle lui-même éventuellement substitué par un radical alkyle, cycloalkyle ou phénylalkyle ; un radical morpholinyle ; un radical pyridyle ou un radical pipéridyle éventuellement substitués par un ou plusieurs radicaux alkyle ou phénylalkyle avec alkyle C1-C4 ; un radical indazolyle ; un radical naphtyle, un radical benzotriazole ; un radical pyrimidinyle éventuellement substitué par un ou plusieurs alkyle avec alkyle en C1-C4 ; un radical acénaphtène, étant entendu que lorsque XR1R2 représente NR1R2, alors RI et R2 identiques ne représentent pas tous deux hydrogène ou alkyle C1-C4 non substitué et RI et R2 différents ne représentent pas l'un hydrogène et l'autre alkyle C1-C4 non substitué ou bien lorsque X représente N ou alkyle, RI et R2 forment ensemble avec X auquel ils sont liés un radical choisi parmi les radicaux suivants : pipérazinyle ou homopipérazinyle éventuellement substitué par un ou plusieurs radicaux identiques ou différents ; pyrrolidinyle éventuellement substitué par alkyle ou alcoxy en C1-C4, hydroxy, acylamino, pyrrolidinylalkyl, pyridinyle et pyridyle ; 1,2,3,4- tétrahydroquinoléinyle et 1,2,3,4- tétrahydroisoquinoléinyle ; diazépine éventuellement substitué par alkyle ou pyrrolidinyl-alkyl ; pipéridyle ou piperidinyle éventuellement substitué par un ou plusieurs radicaux choisis parmi alkyle, alcoxy, alcoxyalkyle, pyrrolylalkyle, piperidinyle, pipéridyle, hydroxy et cycloalkyl-alkyle ; morpholinyle ; thiomorpholinyle ; imidazolinyle éventuellement substitué par alkyleMention may in particular be made, among the compounds of formula (I) as defined above, of the compounds characterized in that A represents an aromatic ring as defined above or a radical XR1 (R2) in which X represents an atom d nitrogen N to form NR1R2, a linear or branched alkyl radical C1-C6 for forming alkRlR2 a dpf oxygen O to form ENT or S sulfur atom to form SRI with RI and the same or different R 2 are selected from the hydrogen atom; C1-C8 alkyl optionally substituted by one or more radicals chosen from amino, alkylamino, dialkylamino, dialkoxyalkylamino, dihydroxyalkylamino, alkoxyalkylamino, hydroxyalkylamino, hydroxycarboxyalkylamino, trialkylammonium, naphthylamino, phenylamino, acylamino) alkyl (phenylalkyl) radicals ) amino, alkylphenyl) (alkyl) amino, hydroxy, C1-C4 alkoxy, C1-C4 thioalkoxy, trifluoromethyl, acyl, free, salified, esterified or amidated carboxy, imidazolyl, pyrrolidinyl optionally substituted with C1-C4 alkyl, piperidyl and piperazinyl optionally substituted by alkyl or phenylalkyl with C1-C4 alkyl, morpholinyl, pyridyl, naphthyl or phenyl optionally substituted by one or more radicals chosen from C1-C4 alkoxy, halogen, amino, alkylamino and dialkylamino radicals; an aromatic cycle as defined above; a quinuclidine radical; a pyrrolidinyl radical itself optionally substituted by an alkyl or phenylalkyl radical with C1-C4 alkyl; a piperazinyl radical itself optionally substituted by an alkyl, cycloalkyl or phenylalkyl radical; a morpholinyl radical; a pyridyl radical or a piperidyl radical optionally substituted by one or more alkyl or phenylalkyl radicals with C1-C4 alkyl; an indazolyl radical; a naphthyl radical, a benzotriazole radical; a pyrimidinyl radical optionally substituted by one or more alkyl with C1-C4 alkyl; an acenaphthene radical, it being understood that when XR1R2 represents NR1R2, then RI and R2 identical do not both represent hydrogen or C1-C4 unsubstituted alkyl and RI and R2 different do not represent one hydrogen and the other C1-C4 alkyl not substituted or when X represents N or alkyl, RI and R2 form, together with X to which they are linked, a radical chosen from the following radicals: piperazinyl or homopiperazinyl optionally substituted by one or more identical or different radicals; pyrrolidinyl optionally substituted with C1-C4 alkyl or alkoxy, hydroxy, acylamino, pyrrolidinylalkyl, pyridinyl and pyridyl; 1,2,3,4-tetrahydroquinolinyl and 1,2,3,4-tetrahydroisoquinolinyl; diazepine optionally substituted by alkyl or pyrrolidinyl-alkyl; piperidyl or piperidinyl optionally substituted by one or more radicals chosen from alkyl, alkoxy, alkoxyalkyl, pyrrolylalkyl, piperidinyl, piperidyl, hydroxy and cycloalkyl-alkyl; morpholinyl; thiomorpholinyl; imidazolinyl optionally substituted with alkyl
On peut citer particulièrement parmi les composés de formule (I) telle que définie ci-dessus, les composés caractérisés en ce que XR1(R2) est tel que lorsque X représente N, soit l'un de RI et R2 représente l'atome d'hydrogène ou un radical alkyle en C1-C4 éventuellement substitué par un radical amino, alkylamino, dialkylamino ou phényle et l'autre de RI et R2 est choisi parmi les valeurs définies pour RI et R2 à l'une quelconque des revendications 1 à 8 soit Ri et R2 forment ensemble avec l'atome d'azote auxquels ils sont liés un radical pipérazinyle ou homopipérazinyle éventuellement substitué par un ou plusieurs radicaux choisis parmi alkyle, aminoalkyle, alkylaminoalkyle, dialkylaminoalkyle, phénylalkyle, alcoxyalkyle, hydroxyalkyl, dihydroxy- alkyle, hydroxyalcoxyalkyle avec alcoxy en C1-C6, imidazolyl-aminoalkyle, imidazolylalkylaminoalkyle, imidazolyl-hydroxyalkylaminoalkyle, pyridylalkyle, pyridinylalkyle, imidazopyridinylalkyle, pyrrolidinyl- alkyle, imidazolyl-alkyle éventuellement substitué par un ou plusieurs radicaux alkyle ou phényle, morpholinylalkyle, benzoimidazolalkyle éventuellement substitué par alkyle ou hydroxyalkyle, cycloalkyle en C3- C8, pyrazinyle, pyrimidinyle, pyridyle, pipéridyle, furylcarbonyle, furfurycarbonyle, quinolyle ou isoquinolyle ; un radical pyrrolidinyle éventuellement substitué par alkyle ou alcoxy en C1-C4, hydroxy, acylamino, pyrrolidinylalkyl, pyridinyle et pyridyle ; un radical 1, 2, 3, 4-tétrahydroquinoléinyle 1,2,3,4- ou tétrahydro-isoquinoléinyle ; un radical diazépine éventuellement substitué par alkyle ou pyrrolidinylalkyl ; un radical pipéridyle éventuellement substitué par un ou plusieurs radicaux choisis parmi les radicaux alkyle, alcoxy, alcoxyalkyle, pyrrolylalkyle, piperidinyle, hydroxy, cycloalkylalkyle et pipéridyle; un radical piperidinyle éventuellement substitué par piperidinyle ; un radical morpholinyle ou thio morpholinyle ; un radical imidazolinyle éventuellement substitué par alkyle.Mention may be made in particular of the compounds of formula (I) as defined above, the compounds characterized in that XR1 (R2) is such that when X represents N, either one of RI and R2 represents the atom d hydrogen or a C1-C4 alkyl radical optionally substituted by an amino, alkylamino, dialkylamino or phenyl radical and the other of RI and R2 is chosen from the values defined for RI and R2 in any one of Claims 1 to 8 either Ri and R2 form, together with the nitrogen atom to which they are linked, a piperazinyl or homopiperazinyl radical optionally substituted by one or more radicals chosen from alkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, phenylalkyl, alkoxyalkyl, hydroxyalkyl, dihydroxyalkyl, hydroxyalkoxyalkyl with C1-C6 alkoxy, imidazolyl-aminoalkyl, imidazolylalkylaminoalkyl, imidazolyl-hydroxyalkylaminoalkyl, pyridylalkyl, pyridinylalkyl-alkylidyridylidyridinylalkidylidyridinylalkylidylpyridinylalkidyl phenyl, morpholinylalkyl, benzoimidazolalkyl optionally substituted by alkyl or hydroxyalkyl, C3-C8 cycloalkyl, pyrazinyl, pyrimidinyl, pyridyl, piperidyl, furylcarbonyl, furfurycarbonyl, quinolyl or isoquinolyl; a pyrrolidinyl radical optionally substituted by C1-C4 alkyl or alkoxy, hydroxy, acylamino, pyrrolidinylalkyl, pyridinyl and pyridyl; a 1,2,3,4,4-tetrahydroquinolinyl 1,2,3,4- or tetrahydroisoquinolinyl radical; a diazepine radical optionally substituted by alkyl or pyrrolidinylalkyl; a piperidyl radical optionally substituted by one or more radicals chosen from the alkyl, alkoxy, alkoxyalkyl, pyrrolylalkyl, piperidinyl, hydroxy, cycloalkylalkyl and piperidyl radicals; a piperidinyl radical optionally substituted by piperidinyl; a morpholinyl or thio morpholinyl radical; an imidazolinyl radical optionally substituted by alkyl.
La présente invention concerne particulièrement des composés de formule (I) tels que définis ci-dessus caractérisés en ce qu'ils répondent à la formule suivante:The present invention particularly relates to compounds of formula (I) as defined above, characterized in that they correspond to the following formula:
dans laquelle : in which :
A représente un radical XR1(R2) dans lequel X représente un atome d'azote, d'oxygène, de soufre ou un radical alkyle en C1-C6 pour former l'un des radicaux suivants :A represents a radical XR1 (R2) in which X represents a nitrogen, oxygen or sulfur atom or a C1-C6 alkyl radical to form one of the following radicals:
NR1R2 avec RI et R2 identiques ou différents sont choisis parmi l'atome d'hydrogène ; un alkyle en C1-C8 éventuellement substitué par un ou plusieurs radicaux identiques ou différents ; un cycle aromatique tel que défini ci-dessus; un radical quinuclidine ; un radical pyrrolidinyle lui-même éventuellement substitué par un radical alkyle ou phénylalkyle avec alkyle en C1-C4 ; un radical pipérazinyle lui-même éventuellement substitué par un radical alkyle, cycloalkyle ou phénylalkyle ; un radical morpholinyle ; un radical pyridyle ou un radical pipéridyle éventuellement substitués par un ou plusieurs radicaux alkyle ou phénylalkyle avec alkyle C1-C4 ; un radical indazolyle ; un radical naphtyle ; un radical benzotriazole; un radical pyrimidinyle éventuellement substitué par un ou plusieurs alkyle avec alkyle en Cl- C4 ; un radical acénaphtène, étant entendu que lorsque XR1R2 représenteNR1R2 with RI and R2 identical or different are chosen from the hydrogen atom; C1-C8 alkyl optionally substituted by one or more identical or different radicals; an aromatic cycle as defined above; a quinuclidine radical; a pyrrolidinyl radical itself optionally substituted by an alkyl or phenylalkyl radical with C1-C4 alkyl; a piperazinyl radical itself optionally substituted by an alkyl, cycloalkyl or phenylalkyl radical; a morpholinyl radical; a pyridyl radical or a piperidyl radical optionally substituted by one or more alkyl or phenylalkyl radicals with C1-C4 alkyl; an indazolyl radical; a naphthyl radical; a benzotriazole radical; a pyrimidinyl radical optionally substituted by one or more alkyl with C1-C4 alkyl; an acenaphthene radical, it being understood that when XR1R2 represents
NR1R2, alors RI et R2 identiques ne représentent pas tous deux hydrogène ou alkyle C1-C4 non substitué et RI et R2 différents ne représentent pas l'un hydrogène et l'autre alkyle C1-C4 non substitué ou bien lorsque X représente N ou alkyle,NR1R2, then identical RI and R2 do not both represent hydrogen or unsubstituted C1-C4 alkyl and different RI and R2 do not represent one hydrogen and the other unsubstituted C1-C4 alkyl or when X represents N or alkyl,
Ri et R2 forment ensemble avec X auquel ils sont liés un radical monocyclique de 3 à 6 chaînons ou bicyclique de 8 à 10 chaînons saturé ou insaturé renfermant éventuellement un ou deux hétéroatomes identiques ou différents choisis parmi N, O ou S,Ri and R2 form, together with X to which they are linked, a 3 to 6-membered monocyclic or 8 to 10-membered bicyclic radical, saturated or unsaturated, optionally containing one or two identical or different heteroatoms chosen from N, O or S,
• un groupe ORl ou SRI dans lequel Ri a la même signification que précédemment étant entendu que RI ne représente pas hydrogène ou alkyle C1-C4 non substitué, ou • un groupe alkyle contenant 1 à 6 atomes de carbone substitué par Ri R2 tels que définis ci-dessus• an ORl or SRI group in which Ri has the same meaning as above, it being understood that RI does not represent hydrogen or unsubstituted C1-C4 alkyl, or • an alkyl group containing 1 to 6 carbon atoms substituted by Ri R2 as defined above
- R3 et R'3, identiques ou différents, représentent indépendamment l'un de l'autre l'hydrogène ou un groupe alkyle en C1-C4- R3 and R'3, identical or different, independently of one another represent hydrogen or a C1-C4 alkyl group
- Ari et Ar2 identiques ou différents représentent- Ari and Ar 2 identical or different represent
* quand Arx et Ar2 sont identiques :* when Ar x and Ar 2 are identical:
• un motif quinoléine éventuellement substitué par au moins un groupe N(Ra) (Rb) dans lequel Ra et Rb identiques ou différents représentent l'hydrogène ou un radical alkyle en C1-C4, (ou) un groupe alkoxy ou alkyle à chaîne courte contenant 1 à 4 atomes de carbone ou • une quinoléine possédant un atome d'azote sous forme quaternaire ou• a quinoline unit optionally substituted by at least one N (Ra) (Rb) group in which Ra and Rb, which are identical or different, represent hydrogen or a C1-C4 alkyl radical, (or) a short-chain alkoxy or alkyl group containing 1 to 4 carbon atoms or • a quinoline having a nitrogen atom in quaternary form or
• une benzamidine ou • une pyridine attachée en position -4 ou fusionnée avec un groupe aryle ou hétéroaryle éventuellement substituée par un groupe alkyle en C1-C4 * quand Ari et Ar2 sont différents• a benzamidine or • a pyridine attached in position -4 or fused with an aryl or heteroaryl group optionally substituted by a C1-C4 * alkyl group when Ari and Ar 2 are different
• Ari et Ar2 représentent tous les deux l'une des possibilités évoquées ci-dessus pour • Ari and Ar 2 both represent one of the possibilities mentioned above for
• Ari représente l'une des possibilités ci-dessus et Ar2 représente• Ari represents one of the possibilities above and Ar 2 represents
* un noyau phényle éventuellement substitué par un groupement halogène, alkoxy en C1-C4, cyano, carbonylamino éventuellement substitué par un ou plusieurs groupes alkyle en C1-C4, guanyl, alkylthio en C1-C4, amino, alkylamino en C1-C4, dialkylamino en Cl- C4 pour chaque groupe alkyle, nitro, alkylèneamino en C1-C4, (ou) alkénylèneamino en C2-C4, ou un radical pipérazinyle éventuellement substitué par un radical alkyle C1-C4,* a phenyl ring optionally substituted by a halogen group, C1-C4 alkoxy, cyano, carbonylamino optionally substituted by one or more C1-C4 alkyl groups, guanyl, C1-C4 alkylthio, amino, C1-C4 alkylamino, dialkylamino in C1-C4 for each alkyl, nitro, C1-C4 alkyleneamino, (or) C2-C4 alkenyleneamino, or a piperazinyl radical optionally substituted by a C1-C4 alkyl radical,
* un noyau hétérocyclique mono ou bi ou tricyclique comportant 0 à 2 hétéroatome par cycle à la condition qu' au moins un hétéroatome soit présent dans au moins un cycle éventuellement substitué par un ou plusieurs groupes alkyle en C1-C4 ou par des groupes alkylène en C1-C4 ou alkénylène en C2-C4 ou un de ses sels, ces composés de formule (I) étant sous toutes les formes isomères possibles racemiques, enantiomeres et diastéréo-isomères . La présente invention concerne notamment les composés tels que définis ci-dessus caractérisés en ce que lorsque l'un ou les deux de RI et R2 représente (nt) un radical alkyle en C1-C8 éventuellement substitué par un ou plusieurs radicaux identiques ou différents, ces radicaux sont choisis parmi le radical amino lui-même éventuellement substitué par un ou deux radicaux identiques ou différents choisis parmi les radicaux alkyle, hydroxyalkyle, alcoxyalkyle, phénylalkyle, carboxyalkyle, hydroxycarboxyalkyle, acyle, naphtyle, phényle et alkylphényle ; le radical trialkyla monio; les radicaux hydroxy ; alcoxy ; thioalcoxy ; trifluoro- méthyle ; carboxy libre, salifié, estérifié ou amidifié ; pyrrolidinyle éventuellement substitué par alkyle en Cl- C4 ; pipéridyle ; pipérazinyle éventuellement substitué par alkyle ou phénylalkyle avec alkyl en C1-C4 ; morpholinyle ; pyridyle ; naphtyle ou phényle lui-même éventuellement substitué par un ou plusieurs radicaux choisis parmi les radicaux alcoxy en C1-C4, halogène ou le radical amino éventuellement substitué comme défini ci-dessus .* a mono or bi or tricyclic heterocyclic ring comprising 0 to 2 heteroatoms per cycle provided that at least one heteroatom is present in at least one ring optionally substituted by one or more C1-C4 alkyl groups or by alkylene groups C1-C4 or C2-C4 alkenylene or a salt thereof, these compounds of formula (I) being in all the possible racemic isomeric, enantiomeric and diastereoisomeric forms. The present invention relates in particular to the compounds as defined above, characterized in that when one or both of R1 and R2 represents (s) a C1-C8 alkyl radical optionally substituted by one or more identical or different radicals, these radicals are chosen from the amino radical itself optionally substituted by one or two identical or different radicals chosen from the alkyl, hydroxyalkyl, alkoxyalkyl, phenylalkyl, carboxyalkyl, hydroxycarboxyalkyl, acyl, naphthyl, phenyl and alkylphenyl radicals; the trialkyla monio radical; hydroxy radicals; alkoxy; thioalkoxy; trifluoromethyl; free, salified, esterified or amidified carboxy; pyrrolidinyl optionally substituted with C1-C4 alkyl; piperidyl; piperazinyl optionally substituted by alkyl or phenylalkyl with C1-C4 alkyl; morpholinyl; pyridyle; naphthyl or phenyl itself optionally substituted by one or more radicals chosen from C1-C4 alkoxy, halogen or optionally substituted amino radical as defined above.
La présente invention concerne ainsi les composés tels que définis ci-dessus caractérisés en ce que XR1(R2) est tel que lorsque X représente N, soit l'un de Ri et R2 représente l'atome d'hydrogène et l'autre de Ri et R2 est choisi parmi les valeurs définis pour RI et R2 soit Ri et R2 forment ensemble avec l'atome d'azote auxquels ils sont liés un radical pipérazinyle, pyrrolidinyle, pipéridyle, morpholinyle, thiomorpholinyle, i idazolinyle, diazépine ou 1,2, 3, 4-tétrahydro- isoquinoléine, tous ces radicaux étant éventuellement substitués par un ou plusieurs radicaux.The present invention thus relates to the compounds as defined above, characterized in that XR1 (R2) is such that when X represents N, either one of Ri and R2 represents the hydrogen atom and the other of Ri and R2 is chosen from the values defined for RI and R2, ie Ri and R2 form, together with the nitrogen atom to which they are linked, a piperazinyl, pyrrolidinyl, piperidyl, morpholinyl, thiomorpholinyl, i idazolinyl, diazepine or 1,2 radical, 3, 4-tetrahydro-isoquinoline, all these radicals being optionally substituted by one or more radicals.
La présente invention concerne notamment les composés tels que définis ci-dessus caractérisés en ce que A représente un cycle aromatique tel que défini ci-dessus ou un radical XR1(R2) dans lequel X représente un atome d'azote N pour former NR1R2, un radical alkyle linéaire ou ramifié en C1-C6 pour former alkRlR2, un atome d'oxygène O pour former ORl ou un atome de soufre S pour former SRI, avec RI et R2 identiques ou différents sont choisis parmi l'atome d'hydrogène ; alkyle C1-C8 éventuellement substitué par un ou plusieurs radicaux choisis parmi les radicaux amino, alkylamino, dialkylamino, dialcoxyalkyl- amino, dihydroxyalkylamino, alcoxyalkylamino, hydroxyalkylamino, hydroxycarboxy-alkylamino, trialkylammonio, naphtylamino, phénylamino, acylamino, (alkyl) (phénylalkyl) amino, (phényl) (alkyl) amino, (alkylphényl) (alkyl) amino, hydroxy, alcoxy en C1-C4, thioalcoxy en C1-C4, trifluorométhyle, carboxy libre, salifié, estérifié ou amidifié, pyrrolidinyle éventuellement substitué par alkyle en C1-C4, pipéridyle, pipérazinyle éventuellement substitué par alkyle ou phénylalkyle avec alkyle en C1-C4, morpholinyle, pyridyle, naphtyle ou phényle éventuellement substitué par un ou plusieurs radicaux choisis parmi les radicaux alcoxy en C1-C4, halogène, amino, alkylamino et dialkylamino ; un cycle aromatique tel que défini ci-dessus ; un radical quinuclidine ; un radical pyrrolidinyle lui-même éventuellement substitué par un radical alkyle ou phénylalkyle avec alkyle en C1-C4 ; un radical pipérazinyle lui-même éventuellement substitué par un radical alkyle, cycloalkyle ou phénylalkyle ; un radical morpholinyle ; un radical pyridyle ou un radical pipéridyle éventuellement substitués par un ou plusieurs radicaux alkyle ou phénylalkyle avec alkyle C1-C4 ; un radical .indazolyle ; un radical naphtyle, un radical benzotriazole ; un radical pyrimidinyle éventuellement substitué par un ou plusieurs alkyle avec alkyle en Cl- C4 ; un radical acénaphtène, étant entendu que lorsque XR1R2 représente NR1R2, alors RI et R2 identiques ne représentent pas tous deux hydrogène ou alkyle C1-C4 non substitué et RI et R2 différents ne représentent pas l'un hydrogène et l'autre alkyle C1-C4 non substitué ou bien lorsque X représente N ou alkyle, RI et R2 forment ensemble avec X auquel ils sont liés un radical choisi parmi les radicaux suivants : pipérazinyle éventuellement substitué par un ou plusieurs radicaux identiques ou différents; pyrrolidinyle éventuellement substitué par alkyle ou alcoxy en C1-C4, hydroxy, acylamino, pyrrolidinylalkyl et pyridyle ; 1,2,3,4- tétrahydroisoquinoléinyle ; diazépine éventuellement substitué par alkyle ou pyrrolidinylalkyl ; pipéridyle éventuellement substitué par alkyle, alcoxy ou alcoxyalkyle, hydroxy et cycloalkylalkyle ; morpholinyle ; imidazolinyle éventuellement substitué par alkyle.The present invention relates in particular to the compounds as defined above, characterized in that A represents an aromatic ring as defined above or a radical XR1 (R2) in which X represents a nitrogen atom N to form NR1R2, a linear or branched C1-C6 alkyl radical to form alkRlR2, an oxygen atom O to form OR1 or a sulfur atom S to form SRI, with RI and R2 identical or different are chosen from the hydrogen atom; C1-C8 alkyl optionally substituted by one or more radicals chosen from amino, alkylamino, dialkylamino, dialkoxyalkylamino, dihydroxyalkylamino, alkoxyalkylamino, hydroxyalkylamino, hydroxycarboxy-alkylamino, trialkylammonio, naphthylamino, phenylamino, alkyl) amino radicals , (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino, hydroxy, C1-C4 alkoxy, C1-C4 thioalkoxy, trifluoromethyl, free, salified, esterified or amidified carboxy, pyrrolidinyl optionally substituted by C1- alkyl C4, piperidyl, piperazinyl optionally substituted by alkyl or phenylalkyl with C1-C4 alkyl, morpholinyl, pyridyl, naphthyl or phenyl optionally substituted by one or more radicals chosen from C1-C4 alkoxy, halogen, amino, alkylamino and dialkylamino radicals; an aromatic cycle as defined above; a quinuclidine radical; a pyrrolidinyl radical itself optionally substituted by an alkyl or phenylalkyl radical with C1-C4 alkyl; a piperazinyl radical itself optionally substituted by an alkyl, cycloalkyl or phenylalkyl radical; a morpholinyl radical; a pyridyl radical or a piperidyl radical optionally substituted by one or more alkyl or phenylalkyl radicals with C1-C4 alkyl; an .indazolyl radical; a naphthyl radical, a benzotriazole radical; a pyrimidinyl radical optionally substituted by one or more alkyl with C1-C4 alkyl; an acenaphthene radical, it being understood that when XR1R2 represents NR1R2, then RI and R2 identical do not both represent hydrogen or C1-C4 unsubstituted alkyl and RI and R2 different do not represent one hydrogen and the other C1-C4 alkyl unsubstituted or else when X represents N or alkyl, RI and R2 form, together with X to which they are linked, a radical chosen from the following radicals: piperazinyl optionally substituted by one or more identical or different radicals; pyrrolidinyl optionally substituted with C1-C4 alkyl or alkoxy, hydroxy, acylamino, pyrrolidinylalkyl and pyridyl; 1,2,3,4-tetrahydroisoquinolineyl; diazepine optionally substituted by alkyl or pyrrolidinylalkyl; piperidyl optionally substituted with alkyl, alkoxy or alkoxyalkyl, hydroxy and cycloalkylalkyl; morpholinyl; imidazolinyl optionally substituted with alkyl.
La présente invention concerne ainsi les composés tels que définis ci-dessus caractérisés en ce que XR1(R2) est tel que lorsque X représente N, soit l'un de RI et R2 représente l'atome d'hydrogène ou un radical alkyle en C1-C4 éventuellement substitué par un radical amino, alkylamino, dialkylamino ou phényle et l'autre de RI et R2 est choisi parmi les valeurs définies pour RI et R2 à l'une quelconque des revendications 1 à 8 soit RI et R2 forment ensemble avec l'atome d'azote auxquels ils sont liés un radical pipérazinyle éventuellement substitué par un ou plusieurs radicaux choisis parmi alkyle, aminoalkyle, alkylaminoalkyle, dialkylaminoalkyle, phénylalkyle, alcoxyalkyle, hydroxyalkyl, hydroxyalcoxy- alkyle avec alcoxy, pyrrolidinylalkyle, cycloalkyle en C3-C8, pyrazinyle, pyrimidinyle, pyridyle, furylcarbonyle, furfurycarbonyle et quinolyle ; pyrrolidinyle éventuellement substitué par alkyle ou alcoxy en C1-C4, hydroxy, acylamino, pyrrolidinylalkyl et pyridyle ; 1, 2, 3, 4-tétrahydroisoquinoléinyle ; diazépine éventuellement substitué par alkyle ou pyrrolidinylalkyl ; pipéridyle éventuellement substitué par alkyle, alcoxy ou alcoxyalkyle, hydroxy et cycloalkylalkyle ; morpholinyle ; imidazolinyle éventuellement substitué par alkyle.The present invention thus relates to the compounds as defined above, characterized in that XR1 (R2) is such that when X represents N, either one of RI and R2 represents the hydrogen atom or an alkyl radical in C1 -C4 optionally substituted with an amino, alkylamino, dialkylamino or phenyl radical and the other of RI and R2 is chosen from the values defined for RI and R2 in any one of claims 1 to 8, either RI and R2 form together with l nitrogen atom to which they are linked a piperazinyl radical optionally substituted by one or more radicals chosen from alkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, phenylalkyl, alkoxyalkyl, hydroxyalkyl, hydroxyalkoxyalkyl with alkoxy, pyrrolidinylalkyl, cycloalkyl C3-C8, pyrazinyl, pyrimidinyl, pyridyl, furylcarbonyl, furfurycarbonyl and quinolyl; pyrrolidinyl optionally substituted with C1-C4 alkyl or alkoxy, hydroxy, acylamino, pyrrolidinylalkyl and pyridyl; 1, 2, 3, 4-tetrahydroisoquinolinyl; diazepine optionally substituted by alkyl or pyrrolidinylalkyl; piperidyl optionally substituted with alkyl, alkoxy or alkoxyalkyl, hydroxy and cycloalkylalkyl; morpholinyl; imidazolinyl optionally substituted with alkyl.
La présente invention concerne ainsi les composés définis ci-dessus fixant la structure G-quadruplex des télomères caractérisés en ce qu'ils répondent à la formule (I) ci-dessous :The present invention thus relates to the compounds defined above fixing the G-quadruplex structure of telomeres characterized in that they correspond to formula (I) below:
dans laquelle : in which :
A représente un radical XR1(R2) dans lequel X représente un atome d'azote, d'oxygène, de soufre ou un radical alkyle en C1-C6 pour former l'un des radicaux suivants :A represents a radical XR1 (R2) in which X represents a nitrogen, oxygen or sulfur atom or a C1-C6 alkyl radical to form one of the following radicals:
NR1R2 avec RI et R2 identiques ou différents sont choisis parmi l'atome d'hydrogène ; alkyle C1-C8 éventuellement substitué par un radical amino, alkylamino, dialkylamino, (phényl) (alkyl) amino, (alkylphényl) (alkyl) amino, alcoxy en C1-C4, thioalcoxy en C1-C4, trifluorométhyle, pyrrolidinyle, pipéridyle, pipérazinyle, morpholinyle, pyridyle ou phényle ; un cycle aromatique tel que défini à la revendication 1 ; un radical quinuclidine, un radical pyrrolidinyle, pipérazinyle, morpholinyle, pyridyle ou un radical pipéridyle éventuellement substitué par alkyle C1-C4 étant entendu que RI et R2 identiques ne représentent pas tous deux hydrogène ou alkyle C1-C4 non substitué et RI et R2 différents ne représentent pas l'un hydrogène et l'autre alkyle C1-C4 non substitué ou bien lorsque X représente N ou alkyle, Ri et R2 forment ensemble avec X auquel ils sont liés un radical monocyclique de 3 à 6 chaînons ou bicyclique de 8 à 10 chaînons saturé ou insaturé renfermant éventuellement un ou deux hétéroatomes identiques ou différents choisis parmi N, 0 ou S,NR1R2 with RI and R2 identical or different are chosen from the hydrogen atom; C1-C8 alkyl optionally substituted by an amino, alkylamino, dialkylamino, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino radical, C1-C4 alkoxy, C1-C4 thioalkoxy, trifluoromethyl, pyrrolidinyl, piperidyl, piperazinyl, morpholinyl, pyridyl or phenyl; an aromatic ring as defined in claim 1; a quinuclidine radical, a pyrrolidinyl, piperazinyl, morpholinyl, pyridyl radical or a piperidyl radical optionally substituted with C1-C4 alkyl, it being understood that identical RI and R2 do not both represent hydrogen or unsubstituted C1-C4 alkyl and RI and R2 are different do not represent one hydrogen and the other unsubstituted C1-C4 alkyl or else when X represents N or alkyl, Ri and R2 form, together with X to which they are linked, a monocyclic radical of 3 to 6 members or bicyclic of 8 to 10 saturated or unsaturated links optionally containing one or two identical or different heteroatoms chosen from N, 0 or S,
• un groupe ORl ou SRI dans lequel RI a la même signification que précédemment étant entendu que Ri ne représente pas hydrogène ou alkyle C1-C4 non substitué, ouAn OR1 or SRI group in which RI has the same meaning as above, it being understood that Ri does not represent hydrogen or unsubstituted C1-C4 alkyl, or
• un groupe alkyle contenant 1 à 6 atomes de carbone substitué par Ri R2 tels que définis ci-dessus• an alkyl group containing 1 to 6 carbon atoms substituted by Ri R2 as defined above
- R3 et R'3, identiques ou différents, représentent indépendamment 1 ' un de 1 ' autre 1 ' ydrogène ou un groupe alkyle en C1-C4- R3 and R'3, identical or different, independently represent one of the other 1 'hydrogen and a C1-C4 alkyl group
- Ari et Ar2 identiques ou différents représentent 1. quand ri et Ar2 sont identiques :- Ari and Ar 2 identical or different represent 1. when ri and Ar 2 are identical:
• un motif quinoléine éventuellement substitué par au moins un groupe N(Ra) (Rb) dans lequel Ra et Rb identiques ou différents représentent l'hydrogène ou un radical alkyle en C1-C4, (ou) un groupe alkoxy ou alkyle à chaîne courte contenant 1 à 4 atomes de carbone ou • une quinoléine possédant un atome d'azote sous forme quaternaire ouA quinoline motif optionally substituted by at least one N (Ra) (Rb) group in which Ra and Rb are identical or different represent hydrogen or a C1-C4 alkyl radical, (or) a short-chain alkoxy or alkyl group containing 1 to 4 carbon atoms or • a quinoline having a nitrogen atom in quaternary form or
• une benzamidine ou• a benzamidine or
• une pyridine attachée en position -4 ou fusionnée avec un groupe aryle ou hétéroaryle éventuellement substituée par un groupe alkyle en C1-C4• a pyridine attached in position -4 or fused with an aryl or heteroaryl group optionally substituted by a C1-C4 alkyl group
2. quand Ar2 et Ar2 sont différents2. when Ar 2 and Ar 2 are different
• Ari et Ar2 représentent tous les deux l'une des possibilités évoquées ci-dessus pour • Ari and Ar 2 both represent one of the possibilities mentioned above for
• Ari représente l'une des possibilités ci-dessus et Ar2 représente• Ari represents one of the possibilities above and Ar 2 represents
* un noyau phényle éventuellement substitué par un groupement halogène, alkoxy en C1-C4, cyano, carbonylamino éventuellement substitué par un ou plusieurs groupes alkyle en C1-C4, guanyl, alkylthio en C1-C4, amino, alkylamino en C1-C4, dialkylamino en Cl- C4 pour chaque groupe alkyle, nitro, alkylèneamino en C1-C4, (ou) alkénylèneamino en C2-C4, ou un radical pipérazinyle éventuellement substitué par un radical alkyle C1-C4, * un noyau hétérocyclique mono ou bi ou tricyclique comportant 0 à 2 hétéroatome par cycle à la condition qu'au moins un hétéroatome soit présent dans au moins un cycle éventuellement substitué par un ou plusieurs groupes alkyle en C1-C4 ou par des groupes alkylène en C1-C4 ou alkénylène en C2-C4 ou un de ses sels, ces composés de formule (I) étant sous toutes les formes isomères possibles racemiques, enantiomeres et diastéréo-isomères.* a phenyl ring optionally substituted by a halogen group, C1-C4 alkoxy, cyano, carbonylamino optionally substituted by one or more C1-C4 alkyl groups, guanyl, C1-C4 alkylthio, amino, C1-C4 alkylamino, dialkylamino in C1-C4 for each alkyl, nitro, C1-C4 alkyleneamino, (or) C2-C4 alkenyleneamino, or a piperazinyl radical optionally substituted by a C1-C4 alkyl radical, * a mono or bi or tricyclic heterocyclic ring comprising 0 to 2 heteroatoms per cycle provided that at least one heteroatom is present in at least a ring optionally substituted by one or more C1-C4 alkyl groups or by C1-C4 alkylene or C2-C4 alkenylene groups or one of its salts, these compounds of formula (I) being in all the isomeric forms possible racemics , enantiomers and diastereoisomers.
La présente invention concerne également les composés nouveaux caractérisés en ce qu'ils répondent à la formule (I) ci-dessous :The present invention also relates to the new compounds characterized in that they correspond to formula (I) below:
dans laquelle :in which :
A représente un radical XR1(R2) dans lequel X représente un atome d'azote, d'oxygène, de soufre ou un radical alkyle en C1-C6 pour former l'un des radicaux suivants :A represents a radical XR1 (R2) in which X represents a nitrogen, oxygen or sulfur atom or a C1-C6 alkyl radical to form one of the following radicals:
• NR1R2 avec RI et R2 identiques ou différents sont choisis parmi l'atome d'hydrogène ; alkyle C1-C8 éventuellement substitué par un radical amino, alkylamino, dialkylamino, (phényl) (alkyl) amino, (alkylphényl) (alkyl) amino, alcoxy en C1-C4, thioalcoxy en Cl- C4, trifluorométhyle, pyrrolidinyle, pipéridyle, pipérazinyle, morpholinyle, pyridyle ou phényle; un cycle aromatique tel que défini à la revendication 1 ; un radical quinuclidine, un radical pyrrolidinyle, pipérazinyle, morpholinyle, pyridyle ou un radical pipéridyle éventuellement substitué par alkyle C1-C4 étant entendu que RI et R2 identiques ne représentent pas tous deux hydrogène ou alkyle Cl- C4 non substitué et RI et R2 différents ne représentent pas l'un hydrogène et l'autre alkyle C1-C4 non substitué ou bien lorsque X représente N ou alkyle, Ri et R2 forment ensemble avec X auquel ils sont liés un radical monocyclique de 3 à 6 chaînons ou bicyclique de 8 à 10 chaînons saturé ou insaturé renfermant éventuellement un ou deux hétéroato es identiques ou différents choisis parmi N, 0 ou S,• NR1R2 with RI and R2 identical or different are chosen from the hydrogen atom; C1-C8 alkyl optionally substituted by amino, alkylamino, dialkylamino, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino, C1-C4 alkoxy, C1-C4 thioalkoxy, trifluoromethyl, pyrrolidinyl, piperidyl, piperazinyl , morpholinyl, pyridyl or phenyl; an aromatic ring as defined in claim 1; a quinuclidine radical, a pyrrolidinyl, piperazinyl, morpholinyl, pyridyl radical or a piperidyl radical optionally substituted by C1-C4 alkyl it being understood that identical RI and R2 do not both represent hydrogen or unsubstituted C1-C4 alkyl and different RI and R2 do not represent one hydrogen and the other unsubstituted C1-C4 alkyl or when X represents N or alkyl , Ri and R2 form, together with X to which they are linked, a 3- to 6-membered monocyclic or 8 to 10-membered bicyclic radical saturated or unsaturated optionally containing one or two identical or different heteroatoes chosen from N, 0 or S,
• un groupe ORl ou SRI dans lequel Ri a la même signification que précédemment étant entendu que Ri ne représente pas hydrogène ou alkyle C1-C4 non substitué, ouAn OR1 or SRI group in which Ri has the same meaning as above, it being understood that Ri does not represent hydrogen or unsubstituted C1-C4 alkyl, or
• un groupe alkyle contenant 1 à 6 atomes de carbone substitué par RI R2 tels que définis ci- dessus• an alkyl group containing 1 to 6 carbon atoms substituted by RI R2 as defined above
- R3 et R'3, identiques ou différents, représentent indépendamment l'un de l'autre l'hydrogène ou un groupe alkyle en C1-C4- R3 and R'3, identical or different, independently of one another represent hydrogen or a C1-C4 alkyl group
- Ari et Ar2 identiques ou différents représentent- Ari and Ar 2 identical or different represent
* quand ri et Ar2 sont identiques :* when ri and Ar 2 are identical:
• un motif quinoléine éventuellement substitué par au moins un groupe N(Ra) (Rb) dans lequel Ra et Rb identiques ou différents représentent l'hydrogène ou un radical alkyle en C1-C4, (ou) un groupe alkoxy ou alkyle à chaîne courte contenant 1 à 4 atome de carbone ou• a quinoline unit optionally substituted by at least one N (Ra) (Rb) group in which Ra and Rb, which are identical or different, represent hydrogen or a C1-C4 alkyl radical, (or) a short-chain alkoxy or alkyl group containing 1 to 4 carbon atoms or
• une quinoléine possédant un atome d'azote sous forme quaternaire ou • une benzamidine ou• a quinoline having a nitrogen atom in quaternary form or • a benzamidine or
• une pyridine attachée en position -4 ou fusionnée avec un groupe aryle ou hétéroaryle éventuellement substituée par• a pyridine attached in position -4 or fused with an aryl or heteroaryl group optionally substituted with
5 un groupe alkyle en C1-C45 a C1-C4 alkyl group
•* quand Ari et Ar2 sont différents • * when Ari and Ar 2 are different
• Arx et Ar2 représentent tous les deux l'une des possibilités évoquées ci-dessus pour • Ar x and Ar 2 both represent one of the possibilities mentioned above for
10 • Ari représente l'une des possibilités ci-dessus et Ar2 représente10 • Ari represents one of the possibilities above and Ar 2 represents
* un noyau phényle éventuellement substitué par un groupement halogène, alkoxy en C1-C4, cyano, carbonylamino* a phenyl ring optionally substituted by a halogen group, C1-C4 alkoxy, cyano, carbonylamino
15 éventuellement substitué par un ou plusieurs groupes alkyle en C1-C4, guanyl, alkylthio en C1-C4, amino, alkylamino en C1-C4, dialkylamino en Cl- C4 pour chaque groupe alkyle, nitro,Optionally substituted with one or more C1-C4 alkyl, guanyl, C1-C4 alkylthio, amino, C1-C4 alkylamino, C1-C4 dialkylamino for each alkyl, nitro,
20 alkylèneamino en C1-C4, (ou) alkénylèneamino en C2-C4, ou un radicla pipérazinyle éventuellement substitué par un radical alkyle C1-C4,C1-C4 alkyleneamino, (or) C2-C4 alkenyleneamino, or a piperazinyl radical optionally substituted by a C1-C4 alkyl radical,
* un noyau hétérocyclique mono ou bi ou 25 tricyclique comportant 0 à 2 hétéroatome par cycle à la condition qu'au moins un hétéroatome soit présent dans au moins un cycle éventuellement substitué par un ou plusieurs groupes alkyle en C1-C4 ou 30 par des groupes alkylène en C1-C4 ou alkénylène en C2-C4 ou un de ses sels, ces composés de formule (I) étant sous toutes les formes isomères - possibles racemiques, enantiomeres et diastéréo-isomères.* a mono or bi or tricyclic heterocyclic ring having 0 to 2 heteroatoms per cycle provided that at least one heteroatom is present in at least one ring optionally substituted by one or more C1-C4 alkyl groups or 30 by groups C1-C4 alkylene or C2-C4 alkenylene or one of its salts, these compounds of formula (I) being in all the isomeric forms - possible racemics, enantiomers and diastereoisomers.
La présente invention concerne notamment les composés de formule (I) telle que définie ci-dessus 'dans laquelle A représente un radical XRl(R2) dans lequel X représente un atome d'azote N pour former NR1R2, un atome d'oxygène O pour former ORl ou un atome de soufre S pour former SRI comme suit : • NR1R2 avec RI et R2 identiques ou différents sont choisis parmi l'atome d'hydrogène ; alkyle C1-C8 éventuellement substitué par un radical amino, alkylamino, dialkylamino, (phényl) (alkyl) amino, (alkylphényl) (alkyl) amino, alcoxy en C1-C4, par un radical pyrrolidinyle, pyridyle ou par un radical phényle; un cycle aromatique tel que défini à la revendication 1 ; un radical quinuclidine, un radical pyrrolidinyle ou un radical pipéridyle éventuellement substitué par alkyle C1-C4 étant entendu que RI et R2 identiques ne représentent pas tous deux hydrogène ou alkyle Cl- C4 non substitué et RI et R2 différents ne représentent pas l'un hydrogène et l'autre alkyle C1-C4 non substitué, ou bien lorsque X représente N, Ri et R2 forment ensemble avec X auquel ils sont liés un radical pipérazinyle, pipéridyle, pyrrolidinyle, morpholinyle ou thiomorpholinyle, • ou un groupe ORl ou SRI dans lequel Ri a la même signification que précédemment étant entendu que RI ne représente pas hydrogène ou alkyle C1-C4 -non substitué. Comme indiqué ci-dessus, Ri ou R2 peut également représenter un radical alkyle substitué par un radical imidazolyle .The present invention relates in particular to the compounds of formula (I) as defined above ' in which A represents a radical XRl (R2) in which X represents a nitrogen atom N to form NR1R2, an oxygen atom O for form OR1 or a sulfur atom S to form SRI as follows: • NR1R2 with RI and R2 identical or different are chosen from the hydrogen atom; C1-C8 alkyl optionally substituted by an amino, alkylamino, dialkylamino, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino, C1-C4 alkoxy radical, by a pyrrolidinyl, pyridyl radical or by a phenyl radical; an aromatic ring as defined in claim 1; a quinuclidine radical, a pyrrolidinyl radical or a piperidyl radical optionally substituted by C1-C4 alkyl, it being understood that identical RI and R2 do not both represent hydrogen or unsubstituted C1-C4 alkyl and RI and R2 different do not represent one hydrogen and the other unsubstituted C1-C4 alkyl, or else when X represents N, Ri and R2 form, together with X to which they are linked, a piperazinyl, piperidyl, pyrrolidinyl, morpholinyl or thiomorpholinyl radical, or an ORl or SRI group in which Ri has the same meaning as above, it being understood that RI does not represent hydrogen or C1-C4 alkyl - not substituted. As indicated above, R 1 or R 2 can also represent an alkyl radical substituted by an imidazolyl radical.
Comme indiqué ci-dessus, RI et R2 peuvent former ensemble avec l'atome d'azote auxquels ils sont liés un radical pipérazinyle, homopipérazinyle, pyrrolidinyle, pipéridyle ou morpholinyle éventuellement substitués, par exemple par alkyle ou pipéridyle.As indicated above, R1 and R2 can form, together with the nitrogen atom to which they are linked, a piperazinyl, homopiperazinyl, pyrrolidinyl, piperidyl or morpholinyl radical which may be substituted, for example by alkyl or piperidyl.
La présente invention concerne plus précisément les composés de formule (I) telle que définie ci-dessus dans laquelle lorsque A représente NR1R2 soit l'un de RI et R2 représente l'atome d'hydrogène et l'autre de RI et R2 est choisi parmi les valeurs définis pour RI et R2 soit RI et R2 forment ensemble avec l'atome d'azote auxquels ils sont liés un radical pipérazinyle, pyrrolidinyle, pipéridyle ou morpholinyle.The present invention relates more precisely to the compounds of formula (I) as defined above in which when A represents NR1R2 either one of RI and R2 represents the hydrogen atom and the other of RI and R2 is chosen among the values defined for RI and R2, that is to say RI and R2 form together with the nitrogen atom to which they are linked a piperazinyl, pyrrolidinyl, piperidyl or morpholinyl radical.
La présente invention a également pour objet les composés définis ci-dessus caractérisés en ce que Ari et Ar2 représentent un groupe choisi parmi les groupes suivants : 4-amino- ou 4-méthylamino- ou 4-diméthylamino- quinolyl, -isoquinolyl, quinolinium ou isoquinolinium dont le noyau quinolyle, isoquinolyl, quinolinium ou isoquinolinium est éventuellement substitué par un ou plusieurs groupe (s) méthyle lié (s) à un atome de carbone ou d'azote du cycle ; ou phényle éventuellement substitué par un ou plusieurs atomes d'halogène.A subject of the present invention is also the compounds defined above, characterized in that Ari and Ar 2 represent a group chosen from the following groups: 4-amino- or 4-methylamino- or 4-dimethylamino-quinolyl, -isoquinolyl, quinolinium or isoquinolinium in which the quinolyl, isoquinolyl, quinolinium or isoquinolinium nucleus is optionally substituted by one or more methyl group (s) linked to a carbon or nitrogen atom in the ring; or phenyl optionally substituted by one or more halogen atoms.
La présente invention a ainsi pour objet les composés définis ci-dessus caractérisés en ce que le groupe A représente : soit un radical amino substitué par un radical choisi parmi les groupes suivants : 4-amino- ou 4-méthylamino- ou 4-diméthylamino- quinolyl, -isoquinolyl, quinolinium ou isoquinolinium dont le noyau quinolyle, isoquinolyl, quinolinium ou isoquinolinium est éventuellement substitué par un ou plusieurs groupe (s) méthyle lié (s) à un atome de carbone ou d' azote du cycle ; pyridyle ; phényle éventuellement substitué par un ou plusieurs atomes d'halogène ou par un radical pipérazinyle ou alkylpipérazinyle ; alkyle en C1-C4 substitué par un radical amino, alkylamino ou dialkylamino, (phényl) (alkyl) amino, (alkylphényl) (alkyl) amino, alcoxy en C2-C4, par un radical alkylpipérazinylcarbonyle, imidazolyle, pyrrolidinyle ou par un radical phényle, radicaux dans lesquels les groupes alkyle possèdent 1 à 4 atomes de carbone ; un radical pyrrolidinyle ; un radical pipéridyle éventuellement substitué par un radical alkyle en C1-C4 ; ou un radical quinuclidineThe present invention thus relates to the compounds defined above, characterized in that the group A represents: either an amino radical substituted by a radical chosen from the following groups: 4-amino- or 4-methylamino- or 4-dimethylamino- quinolyl, -isoquinolyl, quinolinium or isoquinolinium in which the quinolyl, isoquinolyl, quinolinium or isoquinolinium nucleus is optionally substituted by one or more methyl group (s) linked to a carbon or nitrogen atom in the ring; pyridyle; phenyl optionally substituted by one or more halogen atoms or by a piperazinyl or alkylpiperazinyl radical; C1-C4 alkyl substituted by an amino, alkylamino or dialkylamino, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino, C2-alkoxy, alkoxy radical by an alkylpiperazinylcarbonyl, imidazolyl, pyrrolidinyl radical or by a phenyl radical , radicals in which the alkyl groups have 1 to 4 carbon atoms; a pyrrolidinyl radical; a piperidyl radical optionally substituted by a C1-C4 alkyl radical; or a quinuclidine radical
soit un radical pyrrolidinyle, un radical morpholino ou un radical pipérazinyle éventuellement substitué par un radical alkyl C1-C4 ou pipéridyle, soit un radical 0-phényle, O-pyridyle, ou O-alkyle substitué par un radical amino, alkylamino ou dialkylaminoeither a pyrrolidinyl radical, a morpholino radical or a piperazinyl radical optionally substituted by a C1-C4 alkyl or piperidyl radical, or an 0-phenyl, O-pyridyl, or O-alkyl radical substituted by an amino, alkylamino or dialkylamino radical
La présente invention a ainsi pour objet les composés définis ci-dessus caractérisés en ce quand Ari et Ar2 sont identiques, Ari et Ar2 représentent un groupe choisi parmi les groupes 4-amino- ou 4-méthylamino- ou 4-diméthylamino- quinolyl, -isoquinolyl, quinolinium ou isoquinolinium dont le noyau quinolyle, isoquinolyl, quinolinium ou isoquinolinium est éventuellement substitué par un ou plusieurs groupe (s) méthyle lié (s) à un atome de carbone ou d'azote du cycle.A subject of the present invention is thus the compounds defined above, characterized in that when Ari and Ar 2 are identical, Ari and Ar 2 represent a group chosen from the groups 4-amino- or 4-methylamino- or 4-dimethylamino-quinolyl , -isoquinolyl, quinolinium or isoquinolinium in which the quinolyl, isoquinolyl, quinolinium or isoquinolinium nucleus is optionally substituted by one or more methyl group (s) linked to a carbon or nitrogen atom in the ring.
La présente invention concerne encore plus précisément les composés de formule (I) telle que définie ci-dessus dans laquelle le groupe A représente : soit un radical amino substitué par un radical choisi parmi les groupes suivants : 4-amino- ou 4-méthylamino- ou 4-diméthylamino- quinolyl ou quinolinium dont le noyau quinolinium est éventuellement substitué par un groupe méthyle ; pyridyle ; phényle éventuellement substitué par un ou plusieurs atomes d'halogène ou par un radical pipérazinyle ou alkylpipérazinyle ; alkyle en C1-C4 substitué par un radical amino, alkylamino ou dialkylamino, (phényl) (alkyl) amino, (alkylphényl) (alkyl) amino, alcoxy en C2-C4, par un radical pyrrolidinyle ou par un radical phényle, radicaux dans lesquels les groupes alkyle possèdent 1 à 4 atomes de carbone ; un radical pyrrolidinyle ; un radical pipéridyle éventuellement substitué par un radical alkyle en C1-C4 ; ou un radical quinuclidine soit un radical pyrrolidinyle, un radical morpholino ou un radical pipérazinyle éventuellement substitué par un radical alkyl C1-C4The present invention relates even more precisely to the compounds of formula (I) as defined above in which the group A represents: or an amino radical substituted by a radical chosen from the following groups: 4-amino- or 4-methylamino- or 4-dimethylamino-quinolyl or quinolinium in which the quinolinium ring is optionally substituted by a methyl group; pyridyle; phenyl optionally substituted by one or more halogen atoms or by a piperazinyl or alkylpiperazinyl radical; C1-C4 alkyl substituted by an amino, alkylamino or dialkylamino, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino, C2-C4 alkoxy radical, by a pyrrolidinyl radical or by a phenyl radical, radicals in which alkyl groups have 1 to 4 carbon atoms; a pyrrolidinyl radical; a piperidyl radical optionally substituted by a C1-C4 alkyl radical; or a quinuclidine radical or a pyrrolidinyl radical, a morpholino radical or a piperazinyl radical optionally substituted by a C1-C4 alkyl radical
soit un radical O-phényle, O-pyridyle, ou O-alkyle substitué par un radical amino, alkylamino ou dialkylaminoeither an O-phenyl, O-pyridyl, or O-alkyl radical substituted by an amino, alkylamino or dialkylamino radical
Parmi les composés définis ci-dessus, on cite particulièrement les composés caractérisés en ce que ri et Ar2 représentent un groupe choisi parmi les groupes suivants : 4-amino- ou 4-méthylamino- ou 4-diméthylamino- quinolyl ou quinolinium dont le noyau quinolinium est éventuellement substitué par un groupe méthyle ; ou phényle éventuellement substitué par un ou plusieurs atomes d'halogène.Among the compounds defined above, particular mention is made of the compounds characterized in that ri and Ar 2 represent a group chosen from the following groups: 4-amino- or 4-methylamino- or 4-dimethylamino-quinolyl or quinolinium whose nucleus quinolinium is optionally substituted with a methyl group; or phenyl optionally substituted by one or more halogen atoms.
Parmi les composés définis ci-dessus, on cite également particulièrement les composés caractérisés en ce que le groupe A représente : soit un radical amino substitué par un radical choisi parmi les groupes suivants : 4-amino- ou 4-méthylamino- ou 4-diméthylamino- quinolyl ou quinolinium dont le noyau quinolinium est éventuellement substitué par un groupe méthyle ; pyridyle ; phényle éventuellement substitué par un ou plusieurs atomes d'halogène ou par un radical pipérazinyle ou alkylpipérazinyle ; alkyle en C1-C4 substitué par un radical amino, alkylamino ou dialkylamino, (phényl) (alkyl) amino, (alkylphényl) (alkyl) amino, alcoxy en C2-C4, par un radical pyrrolidinyle ou par un radical phényle, radicaux dans lesquels les groupes alkyle possèdent 1 à 4 atomes de carbone ; un radical pyrrolidinyle ; un radical pipéridyle éventuellement substitué par un radical alkyle en C1-C4 ; ou un radical quinuclidineAmong the compounds defined above, particular mention is also made of the compounds characterized in that group A represents: or an amino radical substituted by a radical chosen from the following groups: 4-amino- or 4-methylamino- or 4-dimethylamino-quinolyl or quinolinium in which the quinolinium ring is optionally substituted by a methyl group; pyridyle; phenyl optionally substituted by one or more halogen atoms or by a piperazinyl or alkylpiperazinyl radical; C1-C4 alkyl substituted by an amino, alkylamino or dialkylamino, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino, C2-C4 alkoxy radical, by a pyrrolidinyl radical or by a phenyl radical, radicals in which alkyl groups have 1 to 4 carbon atoms; a pyrrolidinyl radical; a piperidyl radical optionally substituted by a C1-C4 alkyl radical; or a quinuclidine radical
soit un radical pyrrolidinyle, un radical morpholino ou un radical pipérazinyle éventuellement substitué par un radical alkyl C1-C4either a pyrrolidinyl radical, a morpholino radical or a piperazinyl radical optionally substituted by a C1-C4 alkyl radical
soit un radical 0-phényle, O-pyridyle, ou 0-alkyle substitué par un radical amino, alkylamino ou dialkylamino .or an O-phenyl, O-pyridyl, or O-alkyl radical substituted by an amino, alkylamino or dialkylamino radical.
Parmi les composés définis ci-dessus, on cite encore particulièrement les composés caractérisés en ce que quand Ari et Ar2 sont identiques, Ari et Ar2 représentent un groupe choisi parmi les groupes 4-amino- ou 4-méthylamino- ou 4-diméthylamino- quinolyl ou quinolinium dont le noyau quinolinium est éventuellement substitué par un goupe méthyle.Among the compounds defined above, particular mention is again made of the compounds characterized in that when Ari and Ar 2 are identical, Ari and Ar 2 represent a group chosen from the groups 4-amino- or 4-methylamino- or 4-dimethylamino - quinolyl or quinolinium, the quinolinium nucleus of which is optionally substituted by a methyl group.
Parmi les composés définis ci-dessus, on cite particulièrement les composés caractérisés en ce que quand Ari et Ar2 sont différentsAmong the compounds defined above, particular mention is made of the compounds characterized in that when Ari and Ar 2 are different
1. Ari représente : • un motif quinoléine substitué par au moins un groupe N(Ra) (Rb) dans lequel Ra et Rb identiques ou différents représentent l'hydrogène ou un radical alkyle en C1-C4 ou un groupe alkoxy ou alkyle à chaîne courte contenant 1 à 4 atome de carbone ou1. Ari represents: • a quinoline unit substituted by at least one N (Ra) (Rb) group in which Ra and Rb, which are identical or different, represent hydrogen or a C1-C4 alkyl radical or a short-chain alkoxy or alkyl group containing 1 to 4 carbon atom or
• une quinoléine possédant un atome d'azote sous forme quaternaire ou• a quinoline having a nitrogen atom in quaternary form or
• une benzamidine sauf dans le cas où A représente la diéthylamine, l'hydrogène ou un groupe aminé ou• a benzamidine except in the case where A represents diethylamine, hydrogen or an amino group or
• une pyridine attachée en position -4 ou fusionnée avec un groupe aryle ou hétéroaryle 2. Ar2 représente• a pyridine attached in position -4 or fused with an aryl or heteroaryl group 2. Ar 2 represents
* un noyau tel que défini ci-dessus mais différent ou* a nucleus as defined above but different or
* un noyau phényle éventuellement substitué par un groupement halogène, méthoxy, cyano, carbonylamino, guanyl, méthylthio, amino, méthylamino, diméthylamino, morpholine, alkylèneamino en C1-C4 ou alkénylèneamino en C2-C4* a phenyl nucleus optionally substituted by a halogen, methoxy, cyano, carbonylamino, guanyl, methylthio, amino, methylamino, dimethylamino, morpholine, C1-C4 alkyleneamino or C2-C4 alkenyleneamino group
* un noyau quinoline, benzimidazole, indole, benzothiophène, benzofurane, benzothiazole, benzoxazole, carbazole, quinazoline, quinoxaline éventuellement substitué par un ou plusieurs groupes alkyle en C1-C4 ou par des groupes alkylène en C1-C4 ou alkénylène en C2-C4* a quinoline, benzimidazole, indole, benzothiophene, benzofuran, benzothiazole, benzoxazole, carbazole, quinazoline, quinoxaline nucleus optionally substituted by one or more C1-C4 alkyl groups or by C1-C4 alkylene or C2-C4 alkenylene groups
Parmi les composés définis ci-dessus, on cite plus particulièrement les composés caractérisés en ce que A représente un radical amino substitué par un radical choisi parmi les groupes suivants : les radicaux 4-amino- ou 4-méthylamino- ou 4-diméthylamino- quinolyl ou quinolinium dont le noyau quinolinium est éventuellement substitué par un groupe méthyle ; les radicaux alkyle en C1-C4 substitués par un radical amino, alkylamino, dialkylamino, (phényl) (alkyl) amino, (alkylphényl) (alkyl) amino, pyrrolidinyle ou pyridyle ; ou le radical quinuclidine .Among the compounds defined above, there are more particularly cited the compounds characterized in that A represents an amino radical substituted by a radical chosen from the following groups: 4-amino- or 4-methylamino- or 4-dimethylamino-quinolyl or quinolinium radicals in which the quinolinium ring is optionally substituted by a methyl group; C1-C4 alkyl radicals substituted by an amino, alkylamino, dialkylamino, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino, pyrrolidinyl or pyridyl radical; or the quinuclidine radical.
Parmi les composés de la présente invention, on cite notamment les composés caractérisés en ce que A représente soit un radical amino substitué par un ou plusieurs radicaux tels que définis ci-dessus soit un radical pipérazinyle, homopipérazinyle, piperidinyle ou pyrrolidinyle éventuellement substitué (s) par un ou plusieurs radicaux tels que définis ci-dessus.Among the compounds of the present invention, there are in particular the compounds characterized in that A represents either an amino radical substituted by one or more radicals as defined above or a piperazinyl, homopiperazinyl, piperidinyl or pyrrolidinyl radical optionally substituted (s) by one or more radicals as defined above.
Parmi les composés définis ci-dessus, on cite également les composés caractérisés en ce que A représente soit un radical amino substitué par un radical pyridyle ; phényle éventuellement substitué par un radical pipérazinyle ou alkylpipérazinyle ; un radical pipéridyle éventuellement substitué par un radical alkyle en C1-C4 soit un radical pipérazinyle éventuellement substitué par un radical alkyl C1-C4.Among the compounds defined above, there are also cited the compounds characterized in that A represents either an amino radical substituted by a pyridyl radical; phenyl optionally substituted with a piperazinyl or alkylpiperazinyl radical; a piperidyl radical optionally substituted by a C1-C4 alkyl radical or a piperazinyl radical optionally substituted by a C1-C4 alkyl radical.
On cite notamment les composés tels que définis ci-dessus caractérisés en ce que A représente un radical 0(ou S) - cycle aromatique ou un radical O(ou S) -alkyle avec alkyle éventuellement substitué.Mention is made in particular of the compounds as defined above, characterized in that A represents an O (or S) - aromatic ring radical or an O (or S) -alkyl radical with optionally substituted alkyl.
On cite plus particulièrement les composés tels que définis ci-dessus caractérisés en ce que A représente un radical O-phényle, O-pyridyle, O-pyrimidinyle ou 0-alkyle substitué par un radical amino, alkylamino ou dialkylamino ou bien un radical S-phényle, S-pyridyle, S-pyrimidyle ou S-quinoleinyl.Mention is more particularly made of the compounds as defined above, characterized in that A represents an O-phenyl, O-pyridyl, O-pyrimidinyl or O-alkyl radical substituted by an amino, alkylamino or dialkylamino or else an S-phenyl, S-pyridyl, S-pyrimidyl or S-quinoleinyl radical.
Parmi les composés définis ci-dessus, on cite encore les composés caractérisés en ce que A représente un radical O-phényle, O-pyridyle, ou O-alkyle substitué par un radical amino, alkylamino ou dialkylamino.Among the compounds defined above, the compounds further characterized in that A represents an O-phenyl, O-pyridyl or O-alkyl radical substituted by an amino, alkylamino or dialkylamino radical.
Il est évident que les motifs quinoléines peuvent être substitués par tout autre groupe n' intervenant pas dans l'application visée, ainsi des groupes acridines ou isoquinoléines ou quinazolines ou quinoxalines ou phtalazines ou benzothiazines ou benzoxazines ou phénoxazines ou phénothiazines sont inclus dans la définition des groupes quinoléines.It is obvious that the quinoline units can be substituted by any other group which does not intervene in the intended application, thus groups acridines or isoquinolines or quinazolines or quinoxalines or phthalazines or benzothiazines or benzoxazines or phenoxazines or phenothiazines are included in the definition of quinoline groups.
On préfère parmi les composés de formule (I) ci-dessus ceux qui comportent deux heterocycles choisis parmi les groupes 4-aminoquinolyl, 4-aminoquinolinium ou quinolinium dont le noyau quinolinium est éventuellement substitué par un groupe méthyle.Preferred among the compounds of formula (I) above are those which comprise two heterocycles chosen from the 4-aminoquinolyl, 4-aminoquinolinium or quinolinium groups in which the quinolinium nucleus is optionally substituted by a methyl group.
Parmi les produits préférés tels que définis ci-dessus, on peut citer les produits des exemples 1, 2,Among the preferred products as defined above, mention may be made of the products of Examples 1, 2,
11, 17, 19, 20, 27, 29, 31, 32 et 33 du tableau 1 ci-dessous qui correspondent donc respectivement aux composés dont les noms suivent :11, 17, 19, 20, 27, 29, 31, 32 and 33 of Table 1 below, which therefore correspond respectively to the compounds whose names follow:
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (3-diméthylamino-propyl) amino- [1,3,5] triazine (exemple 1)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (3-dimethylamino-propyl) amino- [1,3,5] triazine (example 1)
le 2, 4, 6-tris- (4-amino-2-méthyl-quinolin-6-yl) amino- [1, 3, 5] triazine (exemple 2)2, 4, 6-tris- (4-amino-2-methyl-quinolin-6-yl) amino- [1, 3, 5] triazine (example 2)
- le 2, 4-bis- (4-amino-2-méthyl-quinolin-6-yl) amino-6- (4- diméthylamino-2-méthyl-quinolin-6-yl) amino- [1, 3, 5] triazine (exemple 11) le 2, 4-bis- (4-amino-2-méthyl-quinolin-6-yl) amino-6- (quinuclidin-3-yl) amino- [1, 3, 5] triazine (exemple 17)- 2,4-bis- (4-amino-2-methyl-quinolin-6-yl) amino-6- (4-dimethylamino-2-methyl-quinolin-6-yl) amino- [1, 3, 5 ] triazine (example 11) 2,4-bis- (4-amino-2-methyl-quinolin-6-yl) amino-6- (quinuclidin-3-yl) amino- [1, 3, 5] triazine (example 17)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (l-méthyl-pipéridin-4-yl) -[1,3,5] triazine (exemple 19)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (1-methyl-piperidin-4-yl) - [1,3,5] triazine (example 19)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (l-méthyl-pipérazin-4-yl) -[1,3,5] triazine (exemple 20)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (1-methyl-piperazin-4-yl) - [1,3,5] triazine (example 20)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (pyridin-4-yl)méthylamino- [1, 3, 5] triazine (exemple 27)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (pyridin-4-yl) methylamino- [1, 3, 5] triazine (example 27)
le 2, 4-bis- (4-amino-2-méthyl-quinolin-6-yl) amino-6- phénoxy- [1,3,5] triazine (exemple 29)2,4-bis- (4-amino-2-methyl-quinolin-6-yl) amino-6-phenoxy- [1,3,5] triazine (example 29)
- le 2, 4-bis- (4-amino-2-méthyl-quinolin-6-yl) amino-6- (3- diméthylamino-propyl) oxy- [1, 3, 5] triazine (exemple 31)- 2,4-bis- (4-amino-2-methyl-quinolin-6-yl) amino-6- (3-dimethylamino-propyl) oxy- [1, 3, 5] triazine (example 31)
le 2, 4-bis- (4-amino-2-méthyl-quinolin-6-yl) amino-6- (pyridin-4-yl) oxy- [1, 3, 5] triazine (exemple 32)2,4-bis- (4-amino-2-methyl-quinolin-6-yl) amino-6- (pyridin-4-yl) oxy- [1, 3, 5] triazine (example 32)
le 2, 4-bis- (4-amino-2-méthyl-quinolin-6-yl) amino-6- (phénylméthyl) oxy- [1, 3, 5] triazine (exemple 33).2,4-bis- (4-amino-2-methyl-quinolin-6-yl) amino-6- (phenylmethyl) oxy- [1, 3, 5] triazine (Example 33).
Parmi les produits préférés de la présente invention tels que définis ci-dessus, on peut citer particulièrement les produits du tableau 1 ci-dessous qui correspondent aux composés dont les noms suivent :Among the preferred products of the present invention as defined above, mention may be made in particular of the products of Table 1 below which correspond to the compounds whose names follow:
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (3-diméthylamino-propyl) amino- [1,3,5] triazine (exemple 1)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (3-dimethylamino-propyl) amino- [1,3,5] triazine (example 1)
le 2, 4, 6-tris- (4-amino-2-méthyl-quinolin-6-yl) amino- [1, 3, 5] triazine (exemple 2) - le 2, 4-bis- (4-amino-2-méthyl-quinolin-β-yl) amino-6- (4- diméthylamino-2-méthyl-quinolin-6-yl) amino- [1, 3, 5] triazine (exemple 11)2, 4, 6-tris- (4-amino-2-methyl-quinolin-6-yl) amino- [1, 3, 5] triazine (example 2) - 2,4-bis- (4-amino-2-methyl-quinolin-β-yl) amino-6- (4-dimethylamino-2-methyl-quinolin-6-yl) amino- [1, 3, 5 ] triazine (example 11)
le- 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (l-méthyl-pipérazin-4-yl) -[1,3,5] triazine (exemple 20)le- 2, 4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (1-methyl-piperazin-4-yl) - [1,3,5] triazine (example 20 )
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (pyridin-4-yl) oxy- [1,3, 5] triazine (exemple 115)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (pyridin-4-yl) oxy- [1,3,5] triazine (example 115)
- le 2, 4-bis- (4-amino-2-méthyl-quinolin-6-yl) amino-6- (quinolin-2-yl) thio- [1, 3, 5] triazine (exemple 128)- 2,4-bis- (4-amino-2-methyl-quinolin-6-yl) amino-6- (quinolin-2-yl) thio- [1, 3, 5] triazine (example 128)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6-phényl- [1, 3, 5] triazine (exemple 134)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6-phenyl- [1, 3, 5] triazine (example 134)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- [1- (2-dipropylamino-ethyl) pipérazin-4-yl] - [1, 3, 5] triazine (exemple 137)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [1- (2-dipropylamino-ethyl) piperazin-4-yl] - [1, 3, 5] triazine (example 137)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6-{ [1-2- (2-hydroxy-éthyl) oxy-éthyl]pipérazin-4- yl}- [1, 3, 5] triazine (exemple 141)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- {[1-2- (2-hydroxy-ethyl) oxy-ethyl] piperazin-4-yl} - [1, 3, 5] triazine (example 141)
- le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- [2 (S) - (pyrrolidin-l-yl)méthyl-pyrrolidin-l- yl] - [1, 3, 5] triazine (exemple 149)- 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [2 (S) - (pyrrolidin-1-yl) methyl-pyrrolidin-1-yl] - [ 1, 3, 5] triazine (example 149)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (quinolin-2-yl) thio- [1,3,5] triazine (exemple 133)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (quinolin-2-yl) thio- [1,3,5] triazine (example 133)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (l-méthyl-homopipérazin-4-yl) -[1,3,5] triazine (exemple 135) le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (quinolin-2-yl) thio- [1, 3, 5] triazine (exemple 133)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (1-methyl-homopiperazin-4-yl) - [1,3,5] triazine (example 135) 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6- yl) amino-6- (quinolin-2-yl) thio- [1, 3, 5] triazine (example 133)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (l-méthyl-homopipérazin-4-yl) -[1,3,5] triazine (exemple 135)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (1-methyl-homopiperazin-4-yl) - [1,3,5] triazine (example 135)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- [1- (3-diméthylamino-propyl) -pipérazin-4-yl] - [1, 3, 5] triazine (exemple 136)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [1- (3-dimethylamino-propyl) -piperazin-4-yl] - [1, 3, 5 ] triazine (example 136)
- le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- [N- (l-méthyl-piρéridin-4-yl) -N-méthyl-amino] - [1, 3, 5] triazine (exemple 138)- 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6- yl) amino-6- [N- (l-methyl-piρéridin-4-yl) -N-methyl-amino] - [ 1, 3, 5] triazine (example 138)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6-{ 1- [3- (pyrrolidin-1-yl) propyl-homopipérazin-4- yl) - [1, 3, 5] triazine (exemple 139)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6- yl) amino-6- {1- [3- (pyrrolidin-1-yl) propyl-homopiperazin-4- yl) - [1 , 3, 5] triazine (example 139)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- [1- (pyridin-4-yl) -pipérazin-4-yl] - [1, 3, 5] triazine (exemple 144)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [1- (pyridin-4-yl) -piperazin-4-yl] - [1, 3, 5 ] triazine (example 144)
- le 2, 4-bis- (4-amino-2-méthyl-quinolin-6-yl) amino-6- [1- (2-hydroxy-éthyl) -pipérazin-4-yl] - [1,3, 5] triazine- 2,4-bis- (4-amino-2-methyl-quinolin-6-yl) amino-6- [1- (2-hydroxy-ethyl) -piperazin-4-yl] - [1,3, 5] triazine
(exemple 154)(example 154)
- le 2, 4-bis- (4-amino-2-méthyl-quinolin-6-yl) amino-6- (4- hydroxy-pipéridin-1-yl) - [1, 3, 5] triazine (exemple 155)- 2,4-bis- (4-amino-2-methyl-quinolin-6-yl) amino-6- (4-hydroxy-piperidin-1-yl) - [1, 3, 5] triazine (example 155 )
le 2,4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (3-hydroxy-pyrrolidin-l-yl) -[1,3,5] triazine (exemple 162)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (3-hydroxy-pyrrolidin-1-yl) - [1,3,5] triazine (example 162)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- [1- (2-hydroxy-éthyl) -pipérazin-4-yl] - [1, 3, 5] triazine (exemple 163) le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (4-hydroxy-pipéridin-l-yl) -[1,3, 5] triazine (exemple 164)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [1- (2-hydroxy-ethyl) -piperazin-4-yl] - [1, 3, 5 ] triazine (example 163) 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (4-hydroxy-piperidin-1-yl) - [1,3, 5] triazine (example 164)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (3-hydroxy-pipéridin-l-yl) -[1,3,5] triazine (exemple 169)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (3-hydroxy-piperidin-1-yl) - [1,3,5] triazine (example 169)
le N- [2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino- [1, 3, 5] triazin-6-yl] - (L) -serine (exemple 171)N- [2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino- [1, 3, 5] triazin-6-yl] - (L) -serine (example 171)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl)amino-6-[ (2S) -2, 3-dihydroxy-l-phényl-propyl] amino- [1, 3, 5] triazine (exemple 172)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [(2S) -2, 3-dihydroxy-1-phenyl-propyl] amino- [1, 3, 5] triazine (example 172)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (morpholin-4-yl)méthylamino- [1,3,5] triazine (exemple 179)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (morpholin-4-yl) methylamino- [1,3,5] triazine (example 179)
- le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (pipéridin-1-yl) méthylarαino- [1,3,5] triazine (exemple 180)- 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (piperidin-1-yl) methylarαino- [1,3,5] triazine (example 180)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- [2- (pyridin-3-yl) pyrrolidin-1-yl] - [1, 3, 5] triazine (exemple 181)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [2- (pyridin-3-yl) pyrrolidin-1-yl] - [1, 3, 5] triazine (example 181)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- [4- (2-diméthylamino-éthyl) pipérazin-1-yl] - [1, 3, 5] triazine (exemple 182)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [4- (2-dimethylamino-ethyl) piperazin-1-yl] - [1, 3, 5] triazine (example 182)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (pipéridin-4-yl) thio- [1, 3, 5] triazine (exemple 183)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (piperidin-4-yl) thio- [1, 3, 5] triazine (example 183)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (pyridin-2-yl) amino- [1, 3,5] triazine (exemple 188) le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (4-méthoxy-phényl) amino- [1,3,5] triazine (exemple 191)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (pyridin-2-yl) amino- [1, 3,5] triazine (example 188) 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (4-methoxy-phenyl) amino- [1,3,5] triazine (example 191)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (isopropylamino)méthylamino- [1,3,5] triazine (exemple 192)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (isopropylamino) methylamino- [1,3,5] triazine (example 192)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- [2- (2-méthyl-pyrrolidin-l-yl) éthylamino- [1, 3, 5] triazine (exemple 198)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [2- (2-methyl-pyrrolidin-1-yl) ethylamino- [1, 3, 5] triazine (example 198)
- le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- [4- (pipéridin-4-yl) -pipérazin-1-yl] - [1, 3, 5] triazine (exemple 199)- 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6- yl) amino-6- [4- (piperidin-4-yl) -piperazin-1-yl] - [1, 3, 5] triazine (example 199)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- [4- (pipéridin-1-yl) butyl] amino- [1,3, 5] triazine (exemple 200)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [4- (piperidin-1-yl) butyl] amino- [1,3, 5] triazine (example 200)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- [ (imidazol-l-yl)méthyl] amino- [1,3,5] triazine (exemple 202)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [(imidazol-1-yl) methyl] amino- [1,3,5] triazine (example 202)
Parmi les produits préférés de la présente invention tels que définis ci-dessus, on peut citer tout particulièrement les produits du tableau 1 ci-dessous qui correspondent aux composés dont les noms suivent :Among the preferred products of the present invention as defined above, there may be mentioned very particularly the products of Table 1 below which correspond to the compounds whose names follow:
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (l-méthyl-pipérazin-4-yl) -[1,3, 5] triazine (exemple 20)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (1-methyl-piperazin-4-yl) - [1,3, 5] triazine (example 20)
le 2, -bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (quinolin-2-yl) thio- [1,3,5] triazine (exemple 133) le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (l-méthyl-homopipérazin-4-yl) -[1,3, 5] triazine (exemple 135)2, -bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (quinolin-2-yl) thio- [1,3,5] triazine (example 133) 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (1-methyl-homopiperazin-4-yl) - [1,3, 5] triazine (example 135)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- [1- (3-diméthylamino-propyl) -pipérazin-4-yl] - [1, 3, 5] triazine (exemple 136)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [1- (3-dimethylamino-propyl) -piperazin-4-yl] - [1, 3, 5 ] triazine (example 136)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- [N- (l-méthyl-pipéridin-4-yl) -N-méthyl-amino] - [1, 3, 5] triazine (exemple 138)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [N- (1-methyl-piperidin-4-yl) -N-methyl-amino] - [1 , 3, 5] triazine (example 138)
- le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6-{ 1- [3- (pyrrolidin-1-yl) propyl-homopipérazin-4- yl) - [1,3, 5] riazine (exemple 139)- 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6- yl) amino-6- {1- [3- (pyrrolidin-1-yl) propyl-homopiperazin-4- yl) - [ 1,3,5] riazine (Example 139)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- [1- (pyridin-4-yl) -pipérazin-4-yl] - [1, 3, 5] triazine (exemple 144)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [1- (pyridin-4-yl) -piperazin-4-yl] - [1, 3, 5 ] triazine (example 144)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- [4- (pipéridin-4-yl) -pipérazin-1-yl] - [1, 3, 5] triazine (exemple 199)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [4- (piperidin-4-yl) -piperazin-1-yl] - [1, 3, 5 ] triazine (example 199)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- [4- (pipéridin-1-yl) butyl] amino- [1,3,5] triazine (exemple 200)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [4- (piperidin-1-yl) butyl] amino- [1,3,5] triazine (example 200)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- [ (imidazol-l-yl)méthyl] amino- [1,3,5] triazine (exemple • 202)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [(imidazol-1-yl) methyl] amino- [1,3,5] triazine (example • 202 )
Un autre objet de la présente invention concerne l'utilisation des composés de -la formule (I) comme produit pharmaceutique à usage humain.Another object of the present invention relates to the use of the compounds of formula (I) as a pharmaceutical product for human use.
La présente invention a tout particulièrement pour objet les compositions pharmaceutiques comprenant à titre de principe actif un produit de formule (I) telle que définie ci-dessus.The present invention relates very particularly to pharmaceutical compositions comprising, by way of active ingredient a product of formula (I) as defined above.
La présente invention a tout particulièrement pour objet les compositions pharmaceutiques comprenant à titre de principe actif un produit de formule (I) du tableau 1 ci-dessous .The present invention relates very particularly to pharmaceutical compositions comprising, as active principle, a product of formula (I) in Table 1 below.
La présente invention a tout particulièrement pour objet les compositions pharmaceutiques comprenant à titre de principe actif un produit de formule (I) choisi parmi ceux dont les noms sont cités ci-dessus .The present invention relates very particularly to pharmaceutical compositions comprising, as active ingredient, a product of formula (I) chosen from those whose names are cited above.
L'invention s'étend donc aux compositions pharmaceutiques contenant à titre de principe actif l'un au moins des médicaments tels que définis ci-dessus.The invention therefore extends to pharmaceutical compositions containing as active principle at least one of the medicaments as defined above.
Ces compositions pharmaceutiques peuvent être adminis- trées par voie buccale, par voie parenterale ou par voie locale en application topique sur la peau et les muqueuses ou par injection par voie intraveineuse ou intramusculaire .These pharmaceutical compositions can be administered by the oral route, by the parenteral route or by the local route as a topical application to the skin and the mucous membranes or by injection by the intravenous or intramuscular route.
Ces compositions peuvent être solides ou liquides et se présenter sous toutes les formes pharmaceutiques couramment utilisées en médecine humaine comme, par exemple, les comprimés simples ou dragéifiés, les pilules, les tablettes, les gélules, les gouttes, les granulés, les préparations injectables, les pommades, les crèmes ou les gels ; elles sont préparées selon les méthodes usuelles. Le principe actif peut y être incorporé à des excipients habituellement employés dans ces compositions pharmaceutiques, tels que le talc, la gomme arabique, le lactose, l'amidon, le stéarate de magnésium, le beurre de cacao, les véhicules aqueux ou non, les corps gras d'origine animale ou végétale, les dérivés paraffiniques, les glycols, les divers agents mouillants, dispersants ou émulsifiants, les conservateurs .These compositions can be solid or liquid and can be presented in all the pharmaceutical forms commonly used in human medicine such as, for example, simple or coated tablets, pills, tablets, capsules, drops, granules, injectable preparations, ointments, creams or gels; they are prepared according to the usual methods. The active ingredient can be incorporated therein into excipients usually used in these pharmaceutical compositions, such as talc, gum arabic, lactose, starch, magnesium stearate, cocoa butter, aqueous vehicles or not, fatty substances of animal or vegetable origin, paraffinic derivatives, glycols, various agents wetting, dispersing or emulsifying, preservatives.
Les procédés de préparation des composés de formule (D :The processes for preparing the compounds of formula (D:
sont décrits ci-après.are described below.
Méthode générale 1General method 1
Selon un premier procédé de préparation des composés de formule générale (I) dans lesquels Ari et Ar2 d'une part et R3 et R'3 d'autre part sont identiques et définis tels que précédemment et R représente un atome d'halogène tel que chlore ou fluor, une fonction amino, alkylamino ou dialkylamino dont les parties alkyles droites ou ramifiées contiennent de 1 à 4 atomes de carbone, alkyloxy ou alkylthio dont les parties alkyles droites ou ramifiées contiennent de 1 à 4 atomes de carbone, alkyloxy ou alkylthio dont les parties alkyles droites ou ramifiées contiennent de 1 à 4 atomes de carbone, peuvent être obtenus par amination d'une dihalogénotriazine, très généralement une dichloro-s- triazine, de formule générale (B) dans laquelle A est défini comme ci-dessus par une aminé aromatique ou hétéroaromatique de formule générale (C) dans laquelle Ar est défini comme précédemment en opérant selon le schéma 1 : X According to a first process for the preparation of the compounds of general formula (I) in which Ari and Ar 2 on the one hand and R 3 and R ' 3 on the other hand are identical and defined as above and R represents a halogen atom such as chlorine or fluorine, an amino, alkylamino or dialkylamino function in which the straight or branched alkyl parts contain from 1 to 4 carbon atoms, alkyloxy or alkylthio in which the straight or branched alkyl parts contain from 1 to 4 carbon atoms, alkyloxy or alkylthio, the straight or branched alkyl parts of which contain from 1 to 4 carbon atoms, can be obtained by amination of a dihalogenotriazine, very generally a dichloro-s-triazine, of general formula (B) in which A is defined as below above by an aromatic or heteroaromatic amine of general formula (C) in which Ar is defined as above, operating according to scheme 1: X
(β) (C) (A)( β ) (C) (A)
Schéma 1Diagram 1
Dans le cas où A représente un atome d' halogène, il est utile de faire réagir la 2 , 4 , 6-trihalogéno-s-triazine correspondante de formule générale (B) avec l' aminé aromatique ou hétéroaromatique ArNHR3 de formule généraleIn the case where A represents a halogen atom, it is useful to react the corresponding 2, 4, 6-trihalo-s-triazine of general formula (B) with the aromatic or heteroaromatic amine ArNHR 3 of general formula
(C) .(VS) .
On opère généralement en condensant une mole de dihalogéno-s-triazine, ou trihalogéno-s-triazine, avec 2 moles d'aminé aromatique ou hétéroaromatique. La réaction a lieu en milieu inerte dans les conditions de la réaction. On peut citer parmi les solvants inertes l'acétone éventuellement aqueux ou un alcool éventuellement aqueux comme l'éthanol, ou un solvant halogène tel que le dichloromethane, ou un éther tel que l'oxyde de diéthyle ou le dioxane, ou un solvant aprotique polaire tel que le DMF le DMSO ou la NMP. On opère de préférence à une température comprise entre 20 °C et le reflux, en présence notamment d'une base organique, telle que la triéthylamine, ou minérale, telle que la soude ou le carbonate de sodium ou de potassium. Il est également possible de ne pas utiliser de base lors de la réaction' d' amination, et d'isoler un chlorhydrate du produit de formule générale (A) , dont la base peut ensuite être libérée. Les dihalogéno ou trihalogéno-s-triazines de formule générale (B) sont soit commerciales soit connues, et peuvent être obtenues dans les conditions décrites dans la littérature. Les aminés aromatiques ou hétéroaromatiques de formule générale (C) sont soit connues, soit peuvent être préparées aisément par les méthodes connues de synthèse d'aminés aromatiques ou hétéroaromatiques.One generally operates by condensing one mole of dihalo-s-triazine, or trihalo-s-triazine, with 2 moles of aromatic or heteroaromatic amine. The reaction takes place in an inert medium under the reaction conditions. Mention may be made, among the inert solvents, of optionally aqueous acetone or an optionally aqueous alcohol such as ethanol, or a halogenated solvent such as dichloromethane, or an ether such as diethyl ether or dioxane, or a polar aprotic solvent. such as DMF, DMSO or NMP. The operation is preferably carried out at a temperature of between 20 ° C. and reflux, in the presence in particular of an organic base, such as triethylamine, or inorganic, such as sodium hydroxide or sodium or potassium carbonate. It is also possible not to use a base during the reaction 'amination, and isolate a hydrochloride of the product of general formula (A), the base may then be released. The dihalo or trihalo-s-triazines of general formula (B) are either commercial or known, and can be obtained under the conditions described in the literature. The aromatic or heteroaromatic amines of general formula (C) are either known or can be easily prepared by known methods for the synthesis of aromatic or heteroaromatic amines.
Dans le cas où Ari et Ar2 sont différents, la triazine de formule générale (A) peut être obtenue par déplacement séquentiel des atomes d'halogène, très généralement des atomes de chlore, des produits de formule générale (B) par les aminés ArιNHR3 puis Ar2NHR'3 de formule générale (C) selon le schéma 2 :In the case where Ari and Ar 2 are different, the triazine of general formula (A) can be obtained by sequential displacement of the halogen atoms, very generally chlorine atoms, of the products of general formula (B) by the amines ArιNHR 3 then Ar 2 NHR ' 3 of general formula (C) according to scheme 2:
XX
Schéma 2 (A)Diagram 2 (A)
Généralement on opère avec 1 mole de dihalogéno-s- triazine, ou trihalogéno-s-triazine, et 1 mole d'aminé ArιNHR3. On préfère opérer dans un solvant inerte tel que l'acétone éventuellement aqueux ou un alcool éventuellement aqueux, comme l'éthanol, ou un solvant halogène, tel que le dichloromethane, ou un éther tel que l'oxyde de diéthyle ou le dioxane, ou un solvant aprotique polaire tel que le DMF le DMSO ou la NMP. Selon une meilleure manière de mettre en oeuvre l'invention on opère à une température comprise entre 20 °C et 50 °C. Ensuite on ajoute 1 mole d'aminé Ar2NHR'3 au produit de formule générale (D) , qui peut être éventuellement isolé. On opère notamment à une température comprise entre 50 °C et le reflux.Generally, one operates with 1 mole of dihalo-s-triazine, or trihalo-s-triazine, and 1 mole of amine ArιNHR 3 . It is preferred to operate in an inert solvent such as optionally aqueous acetone or an optionally aqueous alcohol, such as ethanol, or a halogenated solvent, such as dichloromethane, or an ether such as diethyl ether or dioxane, or a polar aprotic solvent such as DMF, DMSO or NMP. According to a better way of implementing the invention, the operation is carried out at a temperature between 20 ° C and 50 ° C. Then 1 mole of amine Ar 2 NHR ' 3 is added to the product of general formula (D), which can be optionally isolated. One operates in particular at a temperature between 50 ° C and reflux.
Avantageusement, on peut opérer dans les conditions décrites dans J. Fluor. Chem., 1988, 39(1), 117-123.Advantageously, one can operate under the conditions described in J. Fluor. Chem., 1988, 39 (1), 117-123.
Méthode générale 2General method 2
Selon une seconde méthode les produits de formule générale (A) dans lesquels ArιNHR3 et Ar2NHR'3 sont définis tels que précédemment et R représente un groupe NR1R2 ou ORl ou SRI ou alkRlR2 peuvent être également préparés par déplacement nucléophile d'un atome d'halogène, généralement un atome de chlore, d'un produit de formule générale (A) dans lequel R représente un atome d'halogène selon le schéma 3 :According to a second method, the products of general formula (A) in which ArιNHR 3 and Ar 2 NHR ' 3 are defined as above and R represents a group NR1R2 or ORl or SRI or alkRlR2 can also be prepared by nucleophilic displacement of an atom of halogen, generally a chlorine atom, of a product of general formula (A) in which R represents a halogen atom according to scheme 3:
(A) (A)(A) (A)
R = Cl (ou F ou Br ou 1) R = NR.,R2 ou OR., ou SRn ou R.,R2alkR = Cl (or F or Br or 1) R = NR., R 2 or OR., Or SR n or R., R 2 alk
Schéma 3Diagram 3
On - opère généralement en condensant 1 mole de produit de formule générale (A) dans lequel R représente un atome d'halogène, préférentiellement un atome de chlore, avec 1 mole d'aminé R1R2NH ou d'alcoolate RIO" ou de thioalcoolate RIS ou d'organometallique RlR2alkM, M pouvant représenter par exemple le magnésium ou le lithium ou le zinc. La réaction a lieu en milieu inerte dans les conditions de la réaction. On peut citer parmi les solvants inertes l'acétone éventuellement aqueux ou un alcool éventuellement aqueux comme l'éthanol, ou un solvant halogène tel que le dichloromethane, ou un éther tel que l'oxyde de diéthyle ou le dioxane ou le tétrahydrofurane, étant entendu que ces éthers sont les solvants utilisables lorsqu'on utilise un organométallique RlR2alkM, ou un solvant aprotique polaire tel que le DMF le DMSO ou la NMP. Lorsque le groupe entrant représente un groupe R1R2NH, on opère de préférence à une température comprise entre 20°C et le reflux, en présence notamment d'une base organique, telle que la triéthylamine, ou minérale, telle que la soude ou le carbonate de sodium ou de potassium. Il est également possible de ne pas utiliser de base lors de la réaction d' amination, et d'isoler un chlorhydrate du produit de formule générale (A) , dont la base peut ensuite être libérée. Lorsque le groupe entrant représente un groupe RIO" ou RIS" on opère préférentiellement avec un alcoolate ou un thioalcoolate alcalin ou alcalinoterreux, tel qu'un sel de sodium ou de potassium ou de lithium ou d'ammonium ou de césium ou de baryum, dans un solvant aprotique polaire tel que le DMF ou le DMSO ou la NMP, à une température comprise entre 50 °C et le reflux. Lorsque le groupe entrant représente un groupe RlR2alk on opère très préférentiellement dans un éther comme l'oxyde de diéthyle ou . le dioxane ou le tétrahydrofurane à une température comprise entre -70 °C et le reflux du milieu réactionnel .We generally operate by condensing 1 mole of product of general formula (A) in which R represents a halogen atom, preferably a chlorine atom, with 1 mole of amine R1R2NH or of alcoholate RIO " or of thioalcoholate RIS or organometallic RlR2alkM, M which may represent, for example, magnesium or lithium or zinc. The reaction takes place in an inert medium under the reaction conditions. Mention may be made, among the inert solvents, of optionally aqueous acetone or an optionally aqueous alcohol. like ethanol, or a halogenated solvent such as dichloromethane, or an ether such as diethyl ether or dioxane or tetrahydrofuran, it being understood that these ethers are the solvents which can be used when an organometallic RlR2alkM is used, or a polar aprotic solvent such as DMF DMSO or NMP. When the incoming group represents an R1R2NH group, the operation is preferably carried out at a temperature between 20 ° C. and reflux, in the presence in particular of an organic base, such as triethylamine, or an inorganic base, such as sodium hydroxide or carbonate. sodium or potassium. It is also possible not to use a base during the amination reaction, and to isolate a hydrochloride from the product of general formula (A), the base of which can then be released. When the incoming group represents an RIO " or RIS " group, it is preferable to operate with an alkali or alkaline earth alcoholate or thioalcoholate, such as a sodium or potassium or lithium or ammonium or cesium or barium salt, in a polar aprotic solvent such as DMF or DMSO or NMP, at a temperature between 50 ° C. and reflux. When the incoming group represents an RlR2alk group, the operation is very preferably in an ether such as diethyl ether or. dioxane or tetrahydrofuran at a temperature between -70 ° C and the reflux of the reaction medium.
Il est entendu que les s-triazines de formule générale peuvent être obtenues sous forme de librairies, en appliquant les méthodes décrites dans les schémas 1, 2, ou 3 en chimie parallèle et/ou combinatoire en phase liquide ou en phase solide, étant entendu que, lorsqu'on travaille en phase solide, l'un quelconque des réactifs est préalablement fixé sur un support solide, choisi en fonction de la réaction chimique mise en jeu, et que ladite réaction chimique est suivie d'une opération de clivage du produit de la réaction du support solide.It is understood that the s-triazines of general formula can be obtained in the form of libraries, by applying the methods described in diagrams 1, 2, or 3 in parallel and / or combinatorial chemistry in the liquid phase or in the solid phase, it being understood that, when working in the solid phase, any of the reactants is previously fixed on a solid support, chosen as a function of the chemical reaction involved, and that said chemical reaction is followed by a cleavage operation of the reaction product of the solid support.
La présente invention concerne aussi les compositions thérapeutiques contenant un composé selon l'invention, en association avec un support pharmaceutiquement acceptable selon le mode d'administration choisi. La composition pharmaceutique peut se présenter sous forme solide, liquide ou de liposomes.The present invention also relates to therapeutic compositions containing a compound according to the invention, in combination with a pharmaceutically acceptable carrier according to the mode of administration chosen. The pharmaceutical composition can be in solid, liquid or liposome form.
Parmi les compositions solides on peut citer les poudres, les gélules, les comprimés. Parmi les formes orales on peut aussi inclure les formes solides protégées vis-à-vis du milieu acide de l'estomac. Les supports utilisés pour les formes solides sont constitués notamment de supports minéraux comme les phosphates, les carbonates ou de supports organiques comme le lactose, les celluloses, l'amidon ou les polymères. Les formes liquides sont constituées de solutions de suspensions ou de dispersions. Elles contiennent comme support dispersif soit l'eau, soit un solvant organique (éthanol, NMP ou autres) ou de mélanges d'agents tensioactifs et de solvants ou d'agents complexants et de solvants.Among the solid compositions, mention may be made of powders, capsules, tablets. Among the oral forms, it is also possible to include the solid forms protected from the acid environment of the stomach. The supports used for the solid forms consist in particular of mineral supports such as phosphates, carbonates or organic supports such as lactose, celluloses, starch or polymers. Liquid forms are made up of solutions of suspensions or dispersions. They contain as dispersive support either water or an organic solvent (ethanol, NMP or others) or mixtures of surfactants and solvents or complexing agents and solvents.
La dose administrée des composés de l'invention sera adaptée par le praticien en fonction de la voie d'administration du patient et de l'état de ce dernier.The administered dose of the compounds of the invention will be adapted by the practitioner according to the route of administration of the patient and the state of the latter.
Les composés de la présente invention peuvent être administrés seuls ou en mélange avec d'autres anticancéreux. Parmi les associations possibles on peut citerThe compounds of the present invention can be administered alone or in admixture with other anticancer agents. Among the possible associations one can cite
• les agents alkylants et notamment le cyclophosphamide, le melphalan, l' ifosfamide, le chlorambucil, le busulfan, le thiotepa, la prednimustine, la carmustine, la lomustine, la semustine, la steptozotocine, la decarbazine, la témozolomide, la procarbazine et l' hexaméthylmélamine• alkylating agents and in particular cyclophosphamide, melphalan, ifosfamide, chlorambucil, busulfan, thiotepa, prednimustine, carmustine, lomustine, semustine, steptozotocin, decarbazine, temozolomide, procarbazine and hexamethylmelamine
• les dérivés du platine comme notamment le cisplatine, le carboplatine ou l' oxaliplatine• platinum derivatives such as cisplatin, carboplatin or oxaliplatin
• les agents antibiotiques comme notamment la bléomycine, la mitomycine, la dactinomycine,• antibiotic agents such as bleomycin, mitomycin, dactinomycin,
• les agents antimicrotubules comme notamment la vinblastine, la vincristine, la vindésine, la vinorelbine, les taxoides (paclitaxel et docétaxel)• antimicrotubule agents such as vinblastine, vincristine, vindesine, vinorelbine, taxoides (paclitaxel and docetaxel)
• les anthracyclines comme notamment la doxorubicine, la daunorubicine, l' idarubicine, l' épirubicine, la mitoxantrone, la losoxantrone • les topoisomérases des groupes I et II telles. que l'étoposide, le teniposide, l'amsacrine, l' irinotecan, le topotecan et le tomudex,• anthracyclines such as doxorubicin, daunorubicin, idarubicin, epirubicin, mitoxantrone, losoxantrone • topoisomerases of groups I and II such. as etoposide, teniposide, amsacrine, irinotecan, topotecan and tomudex,
• les fluoropyrimidines telles que le 5-fluorouracile, l'UFT, la floxuridine,• fluoropyrimidines such as 5-fluorouracil, UFT, floxuridine,
• les analogues de cytidine telles que la 5-azacytidine, la cytarabine, la gemcitabine, la 6-mercaptomurine, la 6-thioguanine• cytidine analogues such as 5-azacytidine, cytarabine, gemcitabine, 6-mercaptomurine, 6-thioguanine
• les analogues d'adénosine telles que la pentostatine, la cytarabine ou le phosphate de fludarabine• adenosine analogs such as pentostatin, cytarabine or fludarabine phosphate
• le méthotrexate et l'acide folinique• methotrexate and folinic acid
• les enzymes et composés divers tels que la L-asparaginase, l'hydroxyurée, l'acide trans- rétinoique, la suramine, la dexrazoxane, 1' amifostine, l'herceptin ainsi que les hormones oetrogéniques, androgéniques • les agents antivasculaires tels que les dérivés de la combretastatine ou de la colchicine et leurs pro-drogues.• enzymes and various compounds such as L-asparaginase, hydroxyurea, trans-retinoic acid, suramin, dexrazoxane, amifostine, herceptin as well as the oestrogenic and androgenic hormones • anti-vascular agents such as combretastatin or colchicine derivatives and their pro-drugs.
Il est également possible d'associer aux composés de la - présente invention un traitement par les radiations. Ces traitements peuvent être administrés simultanément, séparément, séquentiellement. Le traitement sera adapté au malade à traiter par le praticien.It is also possible to combine the compounds of the present invention with radiation treatment. These treatments can be administered simultaneously, separately, sequentially. The treatment will be adapted to the patient to be treated by the practitioner.
L'activité de stabilisation des G-quadruplexes peut être déterminée par une méthode utilisant la formation d'un complexe avec la fluoresceine dont le protocole expérimental est décrit ci-après.The stabilization activity of the G-quadruplexes can be determined by a method using the formation of a complex with fluorescein, the experimental protocol of which is described below.
Oligonucléotides Tous les olignucléotides, modifiés ou non, ont été synthétisés par Eurogentec SA, Seraing, Belgique. L' oligoncléotide FAM + DABCYL porte la référence catalogue, OL-0371-0802. Il possède la séquence: GGGTTAGGGTTAGGGTTAGGG correspondant à 3.5 répétitions du motif télomérique humain (brin riche en G) . La fluoresceine est attaché à l'extrémité 5', le DABCYL à l'extrémité 3', par les bras chimiques décrit par Eurogentec. La concentration des échantillons est vérifiée par spectrophotométrie, en enregistrant le spectre d'absorbance entre 220 et 700 nm et en utilisant le coefficient d'extinction molaire fourni par le fournisseur.Oligonucleotides All olignucleotides, modified or not, have been synthesized by Eurogentec SA, Seraing, Belgium. The oligonucleotide FAM + DABCYL carries the catalog reference, OL-0371-0802. It has the sequence: GGGTTAGGGTTAGGGTTAGGG corresponding to 3.5 repetitions of the human telomeric motif (strand rich in G). Fluorescein is attached to the 5 'end, DABCYL to the 3' end, by the chemical arms described by Eurogentec. The concentration of the samples is verified by spectrophotometry, recording the absorbance spectrum between 220 and 700 nm and using the molar extinction coefficient provided by the supplier.
Tamponstampons
Toutes les expériences ont été réalisées dans un tampon cacodylate de sodium 10 mM pH 7.6 contenant 0.1 M de Chlorure de Lithium (ou de Chlorure de Sodium) .All the experiments were carried out in a 10 mM sodium cacodylate buffer, pH 7.6, containing 0.1 M of Lithium Chloride (or Sodium Chloride).
L'absence de contamination fluorescente dans le tampon a été préalablement vérifiée. L ' oligonucleotide fluorescent est ajouté à la concentration finale de 0.2 μM.The absence of fluorescent contamination in the buffer has been previously checked. The fluorescent oligonucleotide is added to the final concentration of 0.2 μM.
Etude de FluorescenceFluorescence study
Toutes les mesures de fluorescence ont été effectuées sur un appareil Spex Fluorolog DM1B, en utilisant une largeur de raie d'excitation de 1.8 nm et une largeur de raie d'émission de 4.5 nm. Les échantillons sont placés dans une cuvette en quartz micro de 0.2 x 1 cm. La température de l'échantillon est contrôlée par un bain-marie extérieur. L' oligonucleotide seul a été analysé à 20, 30, 40, 50, 60, 70 et 80°C. Les spectres d'émission sont enregistrés en utilisant une longueur d'onde d'excitation de 470 nm. Les spectres d'excitation sont enregistrés en utilisant soit 515 nm soit 588 nm comme longueur d'onde d'émission. Les spectres sont corrigés de la réponse de l'instrument par des courbes de référence. Une extinction importante (80- 90 %) de la fluorescence de la fluoresceine à température ambiante est observée, en accord avec un repli intramoléculaire de 1 ' oligonucleotide à 20 °C sous forme d'un G-quadruplex, ce qui induit une juxtaposition de ses extrémités 5' et 3', respectivement liées à la fluoresceine et au DABCYL. Cette uxtaposition entraîne un phénomène déjà décrit d'extinction de fluorescence, utilisé pour les "Molecular Beacons".All the fluorescence measurements were carried out on a Spex Fluorolog DM1B device, using an excitation line width of 1.8 nm and an emission line width of 4.5 nm. The samples are placed in a 0.2 x 1 cm micro quartz cuvette. The temperature of the sample is controlled by an external water bath. The oligonucleotide alone was analyzed at 20, 30, 40, 50, 60, 70 and 80 ° C. The emission spectra are recorded using an excitation wavelength of 470 nm. The excitation spectra are recorded using either 515 nm or 588 nm as the emission wavelength. The spectra are corrected for the response of the instrument by reference curves. A significant extinction (80-90%) of the fluorescence of fluorescein at room temperature is observed, in agreement with an intramolecular fold of the oligonucleotide at 20 ° C in the form of a G-quadruplex, which induces a juxtaposition its 5 ′ and 3 ′ ends, respectively linked to fluorescein and to DABCYL. This uxtaposition leads to a previously described phenomenon of fluorescence quenching, used for the "Molecular Beacons".
T en fluorescenceT in fluorescence
Une solution stock d'oligonucleotide à la concentration en brin de 0.2 μM dans un tampon 0.1 M LiCl 10 mM cacodylate pH 7.6 est préalablement préparée, chauffée brièvement à 90 °C et refroidie lentement à 20 °C, puis distribuée par aliquots de 600 μl dans les cuves de fluorescence. 3 μl d'eau (pour le contrôle) ou 3 μl du produit à tester (stock à 200 μM, concentration finale 1 μM) sont alors ajoutés et mélangés. Les échantillons sont alors laissés à incuber pendant au moins 1 heure à 20°C avant chaque mesure. L'utilisation de temps d'incubation plus longs (jusqu'à 24 heures) n'a pas d'influence sur le résultat obtenu.An oligonucleotide stock solution with a strand concentration of 0.2 μM in a 0.1 M LiCl 10 mM cacodylate buffer pH 7.6 is previously prepared, briefly heated to 90 ° C and slowly cooled to 20 ° C, then distributed in aliquots of 600 μl in fluorescence cells. 3 μl of water (for control) or 3 μl of the product to be tested (stock at 200 μM, final concentration 1 μM) are then added and mixed. The samples are then left to incubate for at least 1 hour at 20 ° C before each measurement. The use of longer incubation times (up to 24 hours) has no influence on the result obtained.
Chaque expérience ne permet que la mesure d'un seul échantillon. Celui ci est d'abord incubé à une température initiale de 20 °C, porté à 80 °C en 38 minutes, laissé 5 minutes à 80 °C, puis refroidi à 20 °C en 62 minutes. Durant ce temps, la fluorescence est mesurée simultanément à deux longueurs d'onde d'émission (515 nm et 588 nm) en utilisant 470 nm comme longueur d'onde d'excitation. Une mesure est effectuée toutes les 30 secondes. La température du bain-marie est enregistrée en parallèle, et le profil de fluorescence en fonction de la température est reconstitué à partir de ces valeurs. Les profils de fluorescence sont ensuite normalisés entre 20 °C et 80 °C, et la température pour laquelle l'intensité d'émission à 515 nm est la moyenne de celles à haute et basse température est appelée Tm. Dans ces conditions, le Tm de l'échantillon de référence sans addition de produit est de 44 °C dans un tampon Chlorure de Lithium. Cette température est portée à plus de 55 °C dans un tampon Chlorure de Sodium. L'addition d'un composé stabilisant le G-quadruplex induit une augmentation du Tm. Cette augmentation est jugée significative si elle est supérieure à 3°.Each experiment only allows the measurement of a single sample. This is first incubated at an initial temperature of 20 ° C, brought to 80 ° C in 38 minutes, left for 5 minutes at 80 ° C, then cooled to 20 ° C in 62 minutes. During this time, the fluorescence is measured simultaneously at two emission wavelengths (515 nm and 588 nm) using 470 nm as the excitation wavelength. A measurement is made every 30 seconds. The temperature of the water bath is recorded in parallel, and the fluorescence profile as a function of the temperature is reconstituted from these values. The fluorescence profiles are then normalized between 20 ° C and 80 ° C, and the temperature for which the emission intensity at 515 nm is the average of those at high and low temperatures is called Tm. Under these conditions, the Tm of the reference sample without addition of product is 44 ° C. in a Lithium Chloride buffer. This temperature is brought to more than 55 ° C. in a sodium chloride buffer. The addition of a G-quadruplex stabilizing compound induces an increase in Tm. This increase is considered significant if it is greater than 3 °.
L'activité biologique, antitélomérase est déterminée par le protocole expérimental suivant :The biological activity, antitelomerase is determined by the following experimental protocol:
Préparation de l'extrait enrichi en activité télomérase humainePreparation of the extract enriched in human telomerase activity
La lignée de leucémie HL60 est obtenue auprès de l'ATCC (Americam Type Culture Collection, Rockville USA) . Les cellules sont cultivées en suspension dans du milieu RPMI 1640 contenant, L-Glutamine à 2 mM, Pénicilline 200 U/ml, streptomycine 200 μg/ml, gentamycine 50 μg/ml et additionné de 10 % de sérum fœtal de veau inactivé par la chaleur. Une aliquote de 105 cellules est centrifugée à 3000xG et le surnageant écarté. Le culot de cellules est resuspendu par plusieurs pipettages successifs dans 200 μl de tampon de lyse contenant CHAPS 0.5 %, Tris-HCl pH 7,5 10 mM, MgCl2 ImM, EGTA 1 mM, β-mercaptoéthanol 5 mM, PMSF 0.1 mM et glycérol 10 % et est conservé dans la glace pendant 30 minutes. Le lysat est centrifugé à 16 OOOOxG pendant 20 minutes à 4°C et 160 μl du surnageant est récupéré. Le dosage des protéines de l'extrait est effectué par la méthode de Bradford. L'extrait est conservé à -80°C.The HL60 leukemia line is obtained from the ATCC (Americam Type Culture Collection, Rockville USA). Cells are grown in suspension in medium RPMI 1640 containing, 2 mM L-Glutamine, Penicillin 200 U / ml, streptomycin 200 μg / ml, gentamycin 50 μg / ml and supplemented with 10% fetal calf serum inactivated by heat. An aliquot of 10 5 cells is centrifuged at 3000xG and the supernatant discarded. The cell pellet is resuspended by several successive pipetting in 200 μl of lysis buffer containing 0.5% CHAPS, Tris-HCl pH 7.5 10 mM, MgCl 2 ImM, EGTA 1 mM, β-mercaptoethanol 5 mM, PMSF 0.1 mM and glycerol 10% and is kept in ice for 30 minutes. The lysate is centrifuged at 16 OOOOxG for 20 minutes at 4 ° C and 160 μl of the supernatant is recovered. The determination of the proteins of the extract is carried out by the Bradford method. The extract is stored at -80 ° C.
Dosage de l'activité téloméraseDetermination of telomerase activity
L'inhibition de l'activité télomérase est déterminée par un protocole d'extension de l' oligonucleotide TS (5'AATCGTTCGAGCAGAGTT3' ) , en présence d'un extrait cellulaire enrichi en activité télomérase et des composés qui sont ajoutés à différentes concentrations (10, 1, 0.1 et 0,01 μM) . La réaction d'extension est suivie d'une amplification PCR des produits d'extension à l'aide des oligonucleotides TS et CXext (5'GTGCCCTTACCCTTACCCTTACCCTAA3') .The inhibition of telomerase activity is determined by a protocol for extending the oligonucleotide TS ( 5 'AATCGTTCGAGCAGAGTTTT ' ), in the presence of a cellular extract enriched in telomerase activity and of compounds which are added at different concentrations ( 10, 1, 0.1 and 0.01 μM). The extension reaction is followed by PCR amplification of the extension products using the oligonucleotides TS and CXext ( 5 'GTGCCCTTACCCTTACCCTTACCCTAA 3' ).
Le milieu réactionnel est préparé selon la composition suivante :The reaction medium is prepared according to the following composition:
Tris HC1 pH 8,3 20 mMTris HC1 pH 8.3 20 mM
MgCl2 1,5 mM Tween 20 0,005 % (P/V)MgCl2 1.5 mM Tween 20 0.005% (W / V)
EGTA 1 mM dATP 50 μM dGTP 50 μM dCTP 50 μM dTTP 50 μMEGTA 1 mM dATP 50 μM dGTP 50 μM dCTP 50 μM dTTP 50 μM
Oligonucleotide TS 2 μg/mlOligonucleotide TS 2 μg / ml
Oligonucleotide CXext 2 μg/mlCXext oligonucleotide 2 μg / ml
Sérum Albumine bovine 0,1 mg/mlBovine albumin serum 0.1 mg / ml
Taq DNA polymérase 1 U/ml alpha 32P dCTP (3000 Ci/mmole) 0.5 μlTaq DNA polymerase 1 U / ml alpha 32P dCTP (3000 Ci / mmol) 0.5 μl
Extrait télomérase 200 ng sous un volume de 10 μl200 ng telomerase extract in a volume of 10 μl
Produit à tester ou solvant sous un volume de 5 μlTest product or solvent in a volume of 5 μl
. Eau bi-distillée QS 50 μl. Bi-distilled water QS 50 μl
Les oligonucleotides sont obtenus auprès d' Eurogentec (Belgique) et sont conservés à -20 °C à une concentration stock de 1 mg/ml dans de l'eau distillée.The oligonucleotides are obtained from Eurogentec (Belgium) and are stored at -20 ° C at a stock concentration of 1 mg / ml in distilled water.
Les échantillons réactionnels sont assemblés dans des tubes à PCR de 0.2 ml et une goutte d'huile de paraffine est déposée sur chacune des réactions de l'expérience avant la fermeture des tubes. Les échantillons réactionnels sont ensuite incubés dans un appareil à PCR de type Cetus 4800 selon les conditions de températures suivantes :The reaction samples are assembled in 0.2 ml PCR tubes and a drop of paraffin oil is placed on each of the reactions of the experiment before the tubes are closed. The reaction samples are then incubated in a Cetus 4800 type PCR apparatus under the following temperature conditions:
15 minutes à 30°C,15 minutes at 30 ° C,
1 minute à 90 °C, suivis de 30 cycles de,1 minute at 90 ° C, followed by 30 cycles of,
30 secondes à 94CC,30 seconds at 94 C C,
30 secondes à 50°C, et 1 minute 30 secondes à 72 °C, suivis d'un cycle final de 2 minutes à 12 ° C .30 seconds at 50 ° C, and 1 minute 30 seconds at 72 ° C, followed by a final cycle of 2 minutes at 12 ° C.
Pour chacun des échantillons, une aliquote de 10 μl est pipettée sous la couche d'huile et mélangée avec 5 μl d'un tampon de dépôt contenant : TBE 3X glycérol 32 % (P/V)For each of the samples, an aliquot of 10 μl is pipetted under the oil layer and mixed with 5 μl of a deposit buffer containing: TBE 3X glycerol 32% (W / V)
Bleu de bromophénol 0.03 %Bromophenol blue 0.03%
Xylène cyanol 0.03 %Xylene cyanol 0.03%
Les échantillons sont ensuite analysés par électrophorèse en gel d'acrylamide 12 % dans un tampon TBE IX pendant 1 heure sous une tension de 200 volts, à l'aide d'un système d' électrophorèse Novex.The samples are then analyzed by 12% acrylamide gel electrophoresis in TBE IX buffer for 1 hour at a voltage of 200 volts, using a Novex electrophoresis system.
Les gels d' acrylamides sont ensuite séchés sur une feuille de papier Whatmann 3 mm à 80 °C pendant 1 heure. L'analyse et la quantification des produits de la réaction sont effectuées à l'aide d'un appareil Instantlmager (Pacard) .The acrylamide gels are then dried on a sheet of Whatmann 3 mm paper at 80 ° C. for 1 hour. The analysis and quantification of the reaction products are carried out using an Instantlmager device (Pacard).
Pour chaque concentration de composé testée, les résultats sont exprimés en pourcentage d'inhibition de la réaction et calculés à partir du contrôle enzymatique non traité et de l'échantillon sans enzyme (blanc) selon la formule suivante :For each concentration of compound tested, the results are expressed as a percentage inhibition of the reaction and calculated from the untreated enzyme control and the sample without enzyme (white) according to the following formula:
(Valeur Composé - valeur blanc/ Valeur contrôle enzymatique -valeur blanc) x 100. La concentration de composé induisant une inhibition de 50 % de la réaction télomérase (IC50) est déterminée à l'aide d'une représentation graphique semi logarithmique des valeurs d'inhibition obtenues en fonction de 'chacune des concentrations de composé testée. On considère qu'un composé est actif en tant qu'agent - antitélomérase lorsque la quantité inhibant 50 % de la réaction télomérase est notamment inférieure à 5 μM.(Compound value - blank value / Enzyme control value - blank value) x 100. The concentration of compound inducing a 50% inhibition of the telomerase reaction (IC50) is determined using a semi logarithmic graphical representation of the d values 'inhibition obtained as a function of' each of the concentrations of compound tested. A compound is considered to be active as an antelomerase agent when the amount inhibiting 50% telomerase reaction is notably less than 5 μM.
L'activité biologique cytotoxique sur des lignées de tumeur humaines est déterminée selon le protocole expérimental suivant :The cytotoxic biological activity on human tumor lines is determined according to the following experimental protocol:
Les lignées de cellules humaines A549 sont originaires de l'ATCC (Américain Type Culture Collection, Rockville USA) . Les cellules A549 sont cultivées en couche en flacon de culture dans du milieu RPMI 1640, L-Glutamine à 2 mM, Pénicilline 200 U/ml, streptomycine 200 μg/ml et additionné de 10 % de sérum fœtal de veau inactivé par la chaleur. Les cellules KB sont cultivées en couche en flacon de culture dans du milieu de Dulbelco's contenant, L-Glutamine à 2 mM, Pénicilline 200 U/ml, streptomycine 200 μg/ml et additionné de 10 % de sérum fœtal de veau inactivé par la chaleur.The A549 human cell lines originate from the ATCC (American Type Culture Collection, Rockville USA). The A549 cells are cultured in a layer in a culture flask in RPMI 1640 medium, L-Glutamine at 2 mM, Penicillin 200 U / ml, streptomycin 200 μg / ml and supplemented with 10% fetal calf serum inactivated by heat. KB cells are cultured in a culture flask layer in Dulbelco's medium containing, 2 mM L-Glutamine, Penicillin 200 U / ml, streptomycin 200 μg / ml and supplemented with 10% fetal calf serum inactivated by heat .
Les cellules en phase exponentielles de croissances sont trypsinées, lavées dans du PBS IX et sont ensemencées en microplaques 96 puits (Costar) à -raison de 4xl04 cellules/ml pour A549 et de l,5xl04 cellules/mlThe cells in the exponential growth phase are trypsinized, washed in PBS IX and are seeded in 96-well microplates (Costar) at a rate of 4 × 10 4 cells / ml for A549 and 1.5 × 10 4 cells / ml
(0.2 ml/puit) puis incubées pendant 96 heures en présence de concentrations variables de produit à étudier (10, 1,(0.2 ml / well) then incubated for 96 hours in the presence of varying concentrations of product to be studied (10, 1,
0.1 et 0.01 μM, chaque point en quadruplicata) . 16 heures avant la fin de l'incubation, 0.02 % final de rouge neutre est ajouté dans chaque puits. A la fin de l'incubation, les cellules sont lavées par du PBS IX et lysées par 1 % de lauryl sulfate de sodium. L'incorporation cellulaire du colorant, qui reflète la croissance cellulaire, est évaluée par spectrophotométrie ' à une longueur d'onde de 540 nm pour chaque échantillon à l'aide d'un appareil de lecture Dynatech MR5000.0.1 and 0.01 μM, each point in quadruplicate). 16 hours before the end of the incubation, 0.02% final neutral red is added to each well. At the end of the incubation, the cells are washed with PBS IX and lysed with 1% sodium lauryl sulfate. The cellular uptake of the dye, reflecting cellular growth is evaluated by spectrophotometry 'to a 540 nm wavelength for each sample using a Dynatech MR5000 reader appliance.
Pour chaque concentration de composé testée, les résultats sont exprimés en pourcentage d' inhibition de croissance cellulaire et calculés à partir du contrôle non traité et du milieu de culture sans cellules (blanc) selon la - formule suivante :For each concentration of compound tested, the results are expressed as a percentage of inhibition of cell growth and calculated from the untreated control and the cell-free culture medium (white) according to the following formula:
(Valeur Composé - valeur blanc/Valeur contrôle cellules - valeur blanc) x 100(Compound value - blank value / Cell control value - blank value) x 100
La concentration de composé induisant une inhibition de 50 % de la croissance (IC50) est déterminée à l'aide d'une représentation graphique semi logarithmique des valeurs d'inhibition obtenues en fonction de chacune des concentrations de composé testée.The concentration of compound inducing a 50% inhibition of growth (IC50) is determined using a semi logarithmic graphical representation of the inhibition values obtained as a function of each of the concentrations of compound tested.
On considère qu'un composé est actif comme agent cytotoxique si la concentration inhibitrice de 50 % de la croissance des cellules tumorales testées est notamment inférieure à 10 μM. Les exemples suivants et non limitatifs sont donnés pour illustrer l'invention.A compound is considered to be active as a cytotoxic agent if the inhibitory concentration of 50% of the growth of the tumor cells tested is notably less than 10 μM. The following nonlimiting examples are given to illustrate the invention.
Le . tableau 1 ci-après donne les structures chimiques ainsi que les activités G-quartet, antitélomérase et cytotoxique de 202 produits qui constituent, dans l'ordre chronologique où ce tableau les énonce, les exemples 1 à 202 de la présente invention qui illustrent la présente invention sans toutefois la limiter. On indique λaucun' dans le tableau 1 ci-après lorsque le produit ne possède pas de substituant dans la colonne correspondante en accord avec la définition chimique des produits de la présente invention.The . Table 1 below gives the chemical structures as well as the G-quartet, antitelomerase and cytotoxic activities of 202 products which constitute, in chronological order as this table lists them, Examples 1 to 202 of the present invention which illustrate the present invention without however limiting it. We indicate λ none 'in Table 1 below when the product does not have a substituent in the corresponding column in accordance with the chemical definition of the products of the present invention.
Exemple 1 : Préparation du 2, 4-bis- (4-dimethylamino-2- methyl-quinolin-6-yl) amino-'6- (3-dimethylamino- propyl) amino- [1,3,5] triazineExample 1: Preparation of 2,4-bis- (4-dimethylamino-2- methyl-quinolin-6-yl) amino-'6- (3-dimethylamino-propyl) amino- [1,3,5] triazine
Dans un ballon de 250 mL contenant 50 inL de DMF, sous agitation, on charge successivement 0.5g (0.0036 mol) de carbonate de potassium, 1 g (0.00189 mol) de 2, 4-bis- (4- diméthylamino-2-méthyl-quinoléin-6-yl) amino-β-chloro- [1, 3, 5] triazine préparée selon le brevet WO 001561 et 1 mL (0.0078 mol) de N,N-dimethyl-l, 3-propanediamine, puis on porte 15 heures à 100 °C. Le milieu réactionnel est concentré, repris par 100 L d'eau. Le précipité formé est filtré, lavé par 2x50 mL de NaOH 0. IN puis séché. On obtient ainsi 1.2 g de N,N'-bis-(4- dimethylamino-2-methyl-quinolin-6-yl) -N' '- (3- dimethylamino-propyl) - [1, 3, 5] triazine, qui est purifiée par flash chromatographie sur 30 g de silice (35-70 μ ) en éluant par un mélange (85/10/5) de dichloromethane, méthanol et triéthylamine. On obtient alors, après séchage sous vide à 40°C, 0.45 g (41 %) de 2, 4-bis- (4- dimethylamino-2-methyl-quinolin-6-yl) amino-6- (3- dimethylamino-propyl) amino- [1, 3, 5] triazine, sous forme d'une poudre jaune dont les caractéristiques sont les suivantes :0.5 g (0.0036 mol) of potassium carbonate, 1 g (0.00189 mol) of 2,4-bis- (4-dimethylamino-2-methyl) are successively charged into a 250 ml flask containing 50 inL of DMF, with stirring. -quinoline-6-yl) amino-β-chloro- [1, 3, 5] triazine prepared according to patent WO 001561 and 1 mL (0.0078 mol) of N, N-dimethyl-1,3-propanediamine, then the mixture is brought to 100 ° C. for 15 hours. The reaction medium is concentrated, taken up in 100 L of water. The precipitate formed is filtered, washed with 2x50 ml of NaOH 0. IN and then dried. 1.2 g of N, N'-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) -N '' - (3-dimethylamino-propyl) - [1, 3, 5] triazine are thus obtained. which is purified by flash chromatography on 30 g of silica (35-70 μ), eluting with a mixture (85/10/5) of dichloromethane, methanol and triethylamine. 0.45 g (41%) of 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (3-dimethylamino-) is then obtained, after drying under vacuum at 40 ° C. propyl) amino- [1, 3, 5] triazine, in the form of a yellow powder with the following characteristics:
- analyse élémentaire : %C=64.845 (cal=66.3) ; %H=6.855 (cal=7.13) ; %N=25.275 (cal=26.58) ;- elementary analysis:% C = 64.845 (cal = 66.3); % H = 6.855 (cal = 7.13); % N = 25.275 (cal = 26.58);
- Spectre de R.M.N. XH (300 MHz, (CD3)2SO d6, δ en ppm) 1,73 (mt : 2H) ; 2,17 (s : 6H) ; 2,33 (t large, J = 7 Hz- X H NMR spectrum (300 MHz, (CD 3) 2 SO d6, δ in ppm) 1.73 (mt: 2H); 2.17 (s: 6H); 2.33 (t large, J = 7 Hz
2H) ; 2,53 (s large : 6H) ;2,92 (mf : 12H) ; 3,43 (mt 2H) ; 6,51 et 6,53 (2 s larges : 2H en totalité) ; 7,06 (mf : 1H) ; 7,51 * (mt : 2H) ; de 8,10 à 8,30 (mt : 3H) ; 8,38 (mf : 1H) ; 9,24 (s large : 1H) ; 9,37 (s large : 1H) .2H); 2.53 (broad s: 6H); 2.92 (mf: 12H); 3.43 (mt 2H); 6.51 and 6.53 (2 s wide: 2H in total); 7.06 (mf: 1H); 7.51 * (mt: 2H); from 8.10 to 8.30 (mt: 3H); 8.38 (mf: 1H); 9.24 (broad s: 1H); 9.37 (broad s: 1H).
Exemples 1 à 28Examples 1 to 28
Les exemples 1 à 28 décrits dans le tableau 1 peuvent être préparés par synthèse parallèle en milieu liquide : Dans un réacteur magnétique chauffant avec condenseur Zy ark, de type STEM RS2050 contenant 25 puits en parallèle munis d'un tube en verre de 50 ml, on introduit 50 mg d'un produit répondant à la formule suivante : Examples 1 to 28 described in Table 1 can be prepared by parallel synthesis in liquid medium: In a magnetic heating reactor with Zy ark condenser, of the STEM RS2050 type containing 25 wells in parallel provided with a 50 ml glass tube, 50 mg of a product corresponding to the following formula is introduced:
cette formule représentant notamment les produits suivants :this formula representing in particular the following products:
4 mole-équivalents de R1-NH-R2 et 30 mg de carbonate de potassium dans 5 L de DMF. On chauffe à 80°C pendant une nuit. Après refroidissement, on dilue avec 30 mL d'eau et on filtre le précipité obtenu. Le produit brut ainsi isolé est généralement propre (pureté LC/MS > 90 %) , il peut cependant être purifié par LC/MS en utilisant une colonne de silice C18 Waters Xterra 3.5 μM, de diamètre 3 mm et de longueur 50 mm, en éluant par un gradient linéaire d'élution constitué au temps initial (tO = 0 mn) par de l'eau additionnée de 0,05 % de TFA et au temps final (tf = 4 mn) par de l' acétonitrile contenant 0,05 % de TFA.4 mole-equivalents of R1-NH-R2 and 30 mg of potassium carbonate in 5 L of DMF. Heated to 80 ° C overnight. After cooling, it is diluted with 30 ml of water and the precipitate obtained is filtered. The crude product thus isolated is generally clean (LC / MS purity> 90%), it can however be purified by LC / MS using a C18 Waters Xterra 3.5 μM silica column, 3 mm in diameter and 50 mm long, eluting with a linear elution gradient formed at the initial time (tO = 0 min) with water with 0.05% TFA added and at the final time (tf = 4 min) with acetonitrile containing 0.05 % of TFA.
L'exemple 20, 2, 4-bis- (4-diméthylamino-2-méthyl- quinoléin-6-yl) amino-6- (4-méthyl-pipérazin-l-yl) - [1, 3, 5] triazine, peut également être avantageusement préparé de la manière suivante :Example 20, 2, 4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (4-methyl-piperazin-1-yl) - [1, 3, 5] triazine , can also be advantageously prepared as follows:
On agite pendant une nuit à température ambiante, en tricol de 1 L, une solution contenant 3 g de 4-diméthylamino-2-méthyl-quinoléin-β-amine, 2,75 g de 2, 4, 6-trichloro-s-triazine et 4 g de carbonate de potassium dans 300 ml de tétrahydrofurane. Le milieu réactionnel est filtré, puis le filtrat est concentré sous pression réduite, on obtient ainsi 5,1 g (98 %) de 4, 6-dichloro-2- (4-diméthylamino-2-méthyl-quinoléin-6- yl) amino- [1, 3, 5] triazine, sous forme d'un solide brun dont les caractéristiques sont les suivantes :A solution containing 3 g of 4-dimethylamino-2-methyl-quinoline-β-amine, 2.75 g of 2, 4, 6-trichloro-s- is stirred overnight at room temperature in a 1 L three-necked flask. triazine and 4 g of potassium carbonate in 300 ml of tetrahydrofuran. The middle the reaction mixture is filtered, then the filtrate is concentrated under reduced pressure, 5.1 g (98%) of 4,6-dichloro-2- (4-dimethylamino-2-methyl-quinolin-6-yl) amino are thus obtained [1, 3, 5] triazine, in the form of a brown solid, the characteristics of which are the following:
- spectre de masse (EI/DCI) = 349 (M+)- mass spectrum (EI / DCI) = 349 (M +)
- spectre de R.M.N. 1H (300 MHz, (CD3)2SO d6, δ en ppm) : 2,55 (s : 3H) ; 3,01 (s : 6H) ; 6,78 (s : 1H) ; 7,68 (dd large, J ≈ 9 et 2,5 Hz : 1H) ; 7,81 (d, J = 9 Hz : 1H) ; 8,41 (mf : 1H) ; de 11,00 à 11,80 (mf étalé : 1H) .- 1 H NMR spectrum (300 MHz, (CD 3 ) 2 SO d6, δ in ppm): 2.55 (s: 3H); 3.01 (s: 6H); 6.78 (s: 1H); 7.68 (broad dd, J ≈ 9 and 2.5 Hz: 1H); 7.81 (d, J = 9 Hz: 1H); 8.41 (mf: 1H); from 11.00 to 11.80 (mf spread: 1H).
Dans un tricol de 1 L, on dissout, dans 500 mL de dioxane, les 5,1 g de 4, 6-dichloro-2- (4-diméthylamino-2- méthyl-quinoléin-6-yl) amino- [1,3,5] triazine obtenus précédemment, puis on ajoute 2,94 g de 4-diméthylamino-2- méthyl-quinoléin-6-amine et 4 g de carbonate de potassium. Le milieu réactionnel chauffé, sous agitation, au reflux du dioxane pendant 16 heures, puis refroidi et filtré, puis le filtrat est concentré à sec. On obtient ainsi 7,5 g (99 %) de 6-chloro-2, 4-bis- (4-diméthylamino- 2-méthyl-quinoléin-6-yl) amino- [1, 3, 5] triazine, sous forme d'un solide brun dont les caractéristiques sont les suivantes :In a 1 L three-necked flask, 5.1 g of 4, 6-dichloro-2- (4-dimethylamino-2-methyl-quinolin-6-yl) amino- are dissolved in 500 ml of dioxane [1, 3.5] triazine obtained previously, then 2.94 g of 4-dimethylamino-2-methyl-quinolin-6-amine and 4 g of potassium carbonate are added. The reaction medium heated, with stirring, at the reflux of dioxane for 16 hours, then cooled and filtered, then the filtrate is concentrated to dryness. 7.5 g (99%) of 6-chloro-2,4-bis- (4-dimethylamino-2-methyl-quinoline-6-yl) amino- [1, 3, 5] triazine are thus obtained, in the form a brown solid with the following characteristics:
- spectre de masse (EI/DCI) = 514 (M+)- mass spectrum (EI / DCI) = 514 (M +)
- spectre de R.M.N. XH (400 MHz, (CD3)2SO d6 à une température de 383 K, δ en ppm) : 2,57 (s : 6H) ; 2,95- X H NMR spectrum (400 MHz, (CD 3) 2 SO d6 at a temperature of 383 K, δ in ppm): 2.57 (s: 6H); 2.95
(s : 12H) ; 6,72 (s : 2H) ; 7,77 (d, J = 9 Hz : 2H) ; 7,94 (dd, J = 9 et 2 Hz : 2H) ; 8,31 (d, J = 2 Hz : 2H) ; 9, 90 (mf : 2H) .(s: 12H); 6.72 (s: 2H); 7.77 (d, J = 9 Hz: 2H); 7.94 (dd, J = 9 and 2 Hz: 2H); 8.31 (d, J = 2 Hz: 2H); 9.90 (mf: 2H).
Dans un tricol de 500 L, on dissout, dans 200 mL de di éthylformamide, les 7 , 5 g 6-chloro-2 , 4-bis- ( 4- diméthylamino-2-méthyl-quinoléin-6-yl ) amino- [ 1 , 3 , 5 ] triazine, obtenus précédemment . Puis on aj oute 6 mL de - 4-méthyl-pipérazine et 4 g de carbonate de potassium. Le milieu réactionnel est alors chauffé à 100- 105 °C pendant 20 heures. Après concentration sous pression réduite, le résidu est précipité dans 200 mL d'eau. Le produit brut est alors purifié par flash- chromatographie sur 300 g de silice (35-70 Mesh) , en éluant par un mélange de dichloromethane, de méthanol et de triéthylamine (85/10/5 en volumes) . Les fractions contenant très majoritairement le produit attendu sont concentrées sous pression réduite, puis reprises dans 60 mL d'eau, pour éliminer la triéthylamine. On obtient ainsi, après séchage, 3,1 (37 %) de 2, -bis- (4- diméthylamino-2-méthyl-quinoléin-6-yl) amino-6- (4-méthyl- pipérazin-1-yl) - [1, 3, 5] triazine pure, sous forme d'un solide beige dont les caractéristiques sont les suivantes :The 7.5 g 6-chloro-2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino- [3 g] is dissolved in 200 ml of diethylformamide in a 500 L three-necked flask 1, 3, 5] triazine, previously obtained. Then add 6 mL of - 4-methyl-piperazine and 4 g of carbonate potassium. The reaction medium is then heated to 100-105 ° C for 20 hours. After concentration under reduced pressure, the residue is precipitated in 200 ml of water. The crude product is then purified by flash chromatography on 300 g of silica (35-70 mesh), eluting with a mixture of dichloromethane, methanol and triethylamine (85/10/5 by volume). The fractions containing most of the expected product are concentrated under reduced pressure, then taken up in 60 ml of water, to remove the triethylamine. After drying, 3.1 (37%) of 2, -bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (4-methyl-piperazin-1-yl) are thus obtained. - [1, 3, 5] pure triazine, in the form of a beige solid, the characteristics of which are as follows:
- point de fusion (banc Kofler) = 256-60 °C- melting point (Kofler bench) = 256-60 ° C
- spectre de R.M.N. XH (400 MHz, (CD3)2SO d6 à une température de 383 K, δ en ppm) : 2,30 (s : 3H) ; 2,47 (t large, J = 5 Hz : 4H) ; 2, 55 (s : 6H) ; 2,94 (s : 12H) ; 3,89 (t large, J = 5 Hz : 4H) ; 6,75 (s : 2H) ; 7,74 (d,- X H NMR spectrum (400 MHz, (CD 3) 2 SO d6 at a temperature of 383 K, δ in ppm): 2.30 (s: 3H); 2.47 (broad t, J = 5 Hz: 4H); 2.55 (s: 6H); 2.94 (s: 12H); 3.89 (broad t, J = 5 Hz: 4H); 6.75 (s: 2H); 7.74 (d,
J = 9 Hz : 2H) r 7,99 (dd, X 9 et 2 Hz : 2H) ; 8,40 (d,J = 9 Hz: 2H) r 7.99 (dd, X 9 and 2 Hz: 2H); 8.40 (d,
J = 2 Hz : 2H) r de 8,70 à 9,00 (mf : 2H) .J = 2 Hz: 2H) r from 8.70 to 9.00 (mf: 2H).
Exemples 29 à 33 les exemples 29 à 33 décrits dans le tableau 1 peuvent être préparés par synthèse parallèle en milieu liquide :Examples 29 to 33 Examples 29 to 33 described in Table 1 can be prepared by parallel synthesis in liquid medium:
Dans un réacteur magnétique chauffant avec condenseur Zymark, de type STEM RS2050 contenant 25 puits en parallèle munis d'un tube en verre de 50 ml, on introduit 2 mole-équivalents d'hydrure de sodium et 2 mole- équivalents de RIOH dans 5 mL de dioxane. On porte à 40 °C pendant 30 minutes. Puis on ajoute 50 mg d'un produit répondant à la formule suivante : cette formule représentant notamment les produits suivants :In a magnetic heating reactor with Zymark condenser, of type STEM RS2050 containing 25 wells in parallel provided with a glass tube of 50 ml, 2 mole-equivalents of sodium hydride and 2 mole- equivalents of RIOH are introduced into 5 ml dioxane. It is brought to 40 ° C for 30 minutes. Then 50 mg of a product corresponding to the following formula is added: this formula representing in particular the following products:
et on chauffe au reflux pendant une nuit. Après refroidissement, on dilue avec 30 mL d'eau et on filtre le précipité obtenu. Le produit brut ainsi isolé est purifié par LC/MS en utilisant une colonne de silice C18 Waters Xterra 3.5 μM, de diamètre 3 mm et de longueur 50 mm, en éluant par un gradient linéaire d'élution constitué au temps initial (tO = 0 mn) par de l'eau additionnée de 0,05 % de TFA et au temps final (tf = 4 mn) par de l' acétonitrile contenant 0,05 % de TFA. and heated to reflux overnight. After cooling, it is diluted with 30 ml of water and the precipitate obtained is filtered. The crude product thus isolated is purified by LC / MS using a C18 Waters Xterra 3.5 μM silica column, of diameter 3 mm and length 50 mm, eluting with a linear elution gradient formed at the initial time (tO = 0 mn) with water containing 0.05% TFA and at the final time (tf = 4 min) with acetonitrile containing 0.05% TFA.
Les exemples 34 à 108 peuvent être obtenus eh opérant comme décrit précédemment pour les exemples 1 à 28.Examples 34 to 108 can be obtained by operating as described above for Examples 1 to 28.
Les exemples 103 à 115 et l'exemple 196 peuvent être obtenus en opérant comme décrit précédemment pour les exemples.29 à 33.Examples 103 to 115 and Example 196 can be obtained by operating as described above for Examples 29 to 33.
Les exemples 116 à 133, 177 et 183 peuvent être obtenus en opérant comme décrit précédemment pour les exemples 29 à 33, mais en remplaçant RIOH par R1SH.Examples 116 to 133, 177 and 183 can be obtained by operating as described above for Examples 29 to 33, but by replacing RIOH with R1SH.
L'exemple 134_ peut être obtenu en opérant de la manière suivante • : Dans un tricol de 250 mL, on dissout, dans 100 mL de dioxane, 1 g de 2, -dichloro-6-phényl- [1, 3, 5] -triazine qui peut être obtenue en opérant selon Tetrahedron 2000, 56, 9705-9711. Puis on ajoute 0,9 de 4-diméthylamino-2- méthyl-quinoléine-6-amine et 1,2 g de carbonate de potassium, puis on chauffe le milieu réactionnel à 80 °C pendant 18 heures. Après refroidissement, le solvant est évaporé sous pression réduite et le résidu est repris par 100 L d'eau. Le précipité formé est essoré, lavé à l'eau et séché sous pression réduite. On obtient ainsi 1,5 g (89%) de 2-chloro-4- (4-diméthylamino-2-méthyl-quinoléin- 6-yl) amino-6-phényl- [1, 3, 5] -triazine, sous forme d'un solide jaune dont les caractéristiques sont les suivantes : - spectre de masse (EI/DCI) = 390 (M+)134_ The example can be obtained by operating as follows •: 1 g of 2, -dichloro-6-phenyl- [1, 3, 5] -triazine which can be obtained by operating according to Tetrahedron 2000, 56, 9705, is dissolved in 100 ml of dioxane in 100 ml of dioxane -9711. Then 0.9 of 4-dimethylamino-2-methyl-quinoline-6-amine and 1.2 g of potassium carbonate are added, then the reaction medium is heated at 80 ° C. for 18 hours. After cooling, the solvent is evaporated under reduced pressure and the residue is taken up in 100 L of water. The precipitate formed is drained, washed with water and dried under reduced pressure. 1.5 g (89%) of 2-chloro-4- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6-phenyl- [1, 3, 5] -triazine are thus obtained. form of a yellow solid with the following characteristics: - mass spectrum (EI / DCI) = 390 (M +)
- spectre de R.M.N. ^H (400 MHz, (CD3)2SO d6, à une température de 353K, δ en ppm) : 2,60 (s : 3H) ; de 2,95 à 3,10 (s large : 6H) ; 6,83 (s large : 1H) ; 7,62 (t large, J = 8 Hz : 2H) ; 7,69 (t large, J = 8 Hz : 1H) ; 7,86 (d, J = 9 Hz : 1H) ; 7,92 (dd large, J = 9 et 2 Hz : 1H) ; 8,43 (d large, J = 8 Hz : 2H) ; 8,70 (mf : 1H) ; 10,76 (mf : 1H) .- 1 H NMR spectrum (400 MHz, (CD 3 ) 2 SO d6, at a temperature of 353K, δ in ppm): 2.60 (s: 3H); from 2.95 to 3.10 (broad s: 6H); 6.83 (broad s: 1H); 7.62 (wide t, J = 8 Hz: 2H); 7.69 (wide t, J = 8 Hz: 1H); 7.86 (d, J = 9 Hz: 1H); 7.92 (broad dd, J = 9 and 2 Hz: 1H); 8.43 (broad d, J = 8 Hz: 2H); 8.70 (mf: 1H); 10.76 (mf: 1H).
A une solution de 0,75 g de 2-chloro-4- (4-diméthylamino- 2-méthyl-quinoléin-6-yl) amino-6-phényl- [1,3,5] -triazine dans 30 L de DMF, on ajoute 0,39 g de 4-diméthylamino-2- méthyl-quinoléine-6-amine et 0,7 g de carbonate de potassium. Puis on chauffe le milieu réactionnel pendant 18 heures à 140°C. Après refroidissement et dilution avec 100 L d'eau, le précipité formé est essoré, puis purifié par flash-chromatographie sur 50 g de gel de silice (35- 70 Mesh) , en éluant par un mélange de dichloromethane, de méthanol et de triéthylamine (96/2/2 en volumes). On obtient ainsi 0,12 g (11 %) de 2, 4-bis- (4-diméthylamino- 2-méthyl-quinoléin-6-yl) amino-6-phényl- [1, 3, 5] triazine pure, sous forme d'un solide jaune dont les caractéristiques sont les suivantes :To a solution of 0.75 g of 2-chloro-4- (4-dimethylamino-2-methyl-quinoline-6-yl) amino-6-phenyl- [1,3,5] -triazine in 30 L of DMF , 0.39 g of 4-dimethylamino-2-methyl-quinoline-6-amine and 0.7 g of potassium carbonate are added. Then the reaction medium is heated for 18 hours at 140 ° C. After cooling and diluting with 100 L of water, the precipitate formed is drained, then purified by flash chromatography on 50 g of silica gel (35-70 mesh), eluting with a mixture of dichloromethane, methanol and triethylamine (96/2/2 by volume). 0.12 g (11%) of 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6-phenyl- [1, 3, 5] triazine is thus obtained pure, in the form of a yellow solid with the following characteristics:
- point de fusion (banc Kofler) = 172 °C- melting point (Kofler bench) = 172 ° C
- spectre de R.M.N. ^H (400 MHz, (CD3)2S0 d6, avec ajout de quelques gouttes de CD3COOD d4, à une température de 353K, D en ppm) : 2,51 (s large : 6H) ; 3,20 (s : 12H) ; 6,76 (s : 2H) ; 7,55 (t large, J = 8 Hz : 2H) ; 7,60 (t large, J ≈ 8 Hz : 1H) ; 7,87 (d, J = 8,5 Hz : 2H) ; 8,30 (dd large, J = 8,5 et 2 Hz : 2H) ; 8,40 (d large, J = 8 Hz : 2H) ; 8,69 (d, J = 2 Hz : 2H) .- 1 H NMR spectrum (400 MHz, (CD 3 ) 2 S0 d6, with the addition of a few drops of CD 3 COOD d4, at a temperature of 353K, D in ppm): 2.51 (broad s: 6H); 3.20 (s: 12H); 6.76 (s: 2H); 7.55 (wide t, J = 8 Hz: 2H); 7.60 (broad t, J ≈ 8 Hz: 1H); 7.87 (d, J = 8.5 Hz: 2H); 8.30 (broad dd, J = 8.5 and 2 Hz: 2H); 8.40 (broad d, J = 8 Hz: 2H); 8.69 (d, J = 2 Hz: 2H).
L'exemple 178 peut être obtenu en opérant comme à l'exemple 134 mais à partir de 2, 4-dichloro-6- phénylméthyl- [1, 3, 5] -triazine qui peut être obtenue en opérant selon Tetrahedron 2000, 56, 9705-9711.Example 178 can be obtained by operating as in Example 134 but starting with 2,4-dichloro-6-phenylmethyl- [1, 3, 5] -triazine which can be obtained by operating according to Tetrahedron 2000, 56, 9705-9711.
Les exemples 135 à 176, 178 à 182, 184, 187 à 195 et 197 à 202 peuvent être obtenus en opérant comme décrit précédemment pour les exemples 1 à 28, si ce n'est que le volume de DMF est réduit de 5 à 2 mL et que la température de chauffage est augmentée de 80 à 108-110 °C.Examples 135 to 176, 178 to 182, 184, 187 to 195 and 197 to 202 can be obtained by operating as described above for Examples 1 to 28, except that the volume of DMF is reduced from 5 to 2 mL and the heating temperature is increased from 80 to 108-110 ° C.
L'exemple 185, 2- ( (4-diméthylamino-2-méthyl-quinoléin-6- yl) amino) -4- ( (4-diméthylamino-l, 2-diméthyl-quinoléinyl-6- yl) amino) 6- (4-ethoxyethyl-pipérazin-l-yl) - [1, 3, 5] triazine, peut être avantageusement préparé de la manière suivante :Example 185, 2- ((4-dimethylamino-2-methyl-quinoline-6-yl) amino) -4- ((4-dimethylamino-1,2-dimethyl-quinoline-6-yl) amino) 6- (4-ethoxyethyl-pipérazin-l-yl) - [1, 3, 5] triazine, can advantageously be prepared in the following way:
Dans un tricol de 50 ml, on ajoute 20 ml de 1,4-dioxane et 200 mg (0,57 mmoles)de 4, 6-dichloro-2- (4- diméthylamino-2-méthyl-quinoléin-6-yl) amino- [1,3,5] triazine, qui peut être préparée comme à l'exemple 20. On agite la réaction, puis on ajoute successivement 122 mg (0,70 mmoles) de 1- [2- (2-hydroxyéthoxy) éthyl]pipérazine et 100 μl(0,57 mmoles) de N,N-diisopropyléthyl-amine. On chauffe pendant 48 heures à 110 °C sous argon. Après concentration du milieu réactionnel, on reprend avec du dichloromethane, on lave avec une solution saturée de chlorure d'ammonium et on concentre sous pression réduite. On obtient 0.23 g de 2- ( (4-diméthylamino-2- méthyl-quinoléin-6-yl) amino) -4-chloro-6- (4-éthoxyéthyl- pipérazin-1-yl) - [1, 3, 5] triazine, utilisée telle quelle à l'étape suivante dont les caractéristiques sont les suivantes : - spectre de masse (El) = 488 (Mf) .20 ml of 1,4-dioxane and 200 mg (0.57 mmol) of 4, 6-dichloro-2- (4-dimethylamino-2-methyl-quinolin-6-yl) are added to a 50 ml three-necked flask amino- [1,3,5] triazine, which can be prepared as in Example 20. The reaction is stirred, then 122 mg (0.70 mmol) of 1- [2- (2-hydroxyethoxy) are successively added ethyl] piperazine and 100 μl (0.57 mmol) of N, N-diisopropylethylamine. We heats for 48 hours at 110 ° C under argon. After concentrating the reaction medium, the residue is taken up in dichloromethane, washed with a saturated solution of ammonium chloride and concentrated under reduced pressure. 0.23 g of 2- ((4-dimethylamino-2-methyl-quinoline-6-yl) amino) -4-chloro-6- (4-ethoxyethyl-piperazin-1-yl) - [1, 3, 5 are obtained. ] triazine, used as it is in the next step, the characteristics of which are as follows: - mass spectrum (El) = 488 (Mf).
Dans un réacteur magnétique chauffant avec condenseur Zymark, de type STEM RS2050 contenant 25 puits en parallèle munis chacun d'un tube en verre de 50 ml, on introduit 24 mg (0,05 mmole) de 2- ( (4-diméthylamino-2- méthyl-quinoléin-6-yl) amino) -4-chloro-6- (4-éthoxyéthyl- pipérazin-1-yl) - [1, 3, 5] triazine. Dans le tube 1, on ajoute successivement 5 ml de DMF, 1 ml de 1,4-dioxane, 9 μl (0,05 mmole) de N,N-di-isopropyléthylamine et 19 mgIn a magnetic heating reactor with Zymark condenser, of type STEM RS2050 containing 25 wells in parallel each provided with a glass tube of 50 ml, 24 mg (0.05 mmol) of 2- ((4-dimethylamino-2) are introduced - methyl-quinoline-6-yl) amino) -4-chloro-6- (4-ethoxyethyl-piperazin-1-yl) - [1, 3, 5] triazine. In tube 1, 5 ml of DMF, 1 ml of 1,4-dioxane, 9 μl (0.05 mmol) of N, N-di-isopropylethylamine and 19 mg are successively added
(0,10 mmole) de chlorure de 4-diméthylamino-l, 2-diméthyl- quinoléinium-6-yl) aminé, préparée s lon le brevet W0001561. Le milieu réactionnel est chauffé à 120 °C sous argon pendant 48 heures. Après refroidissement, le contenu du tube est évaporé sous pression réduite, repris par 5 ml d'eau, filtré et lavé avec de l'oxyde de diéthyle. Le produit brut obtenu est alors purifié par LC/MS en utilisant une colonne de silice C18 Waters Xterra 3.5 μM, de diamètre 3 mm et de longueur 50 mm, en éluant par un gradient linéaire d'élution constitué au temps initial (t0 = 0 mn) par de l'eau contenant 0,05 % d'acide trifluoroacétique et au temps final (tf = 4 mn) par de l' acétonitrile contenant 0,05 % d'acide trifluoroacétique. On obtient ainsi, après purification, 18.8 mg de chlorure de 2- ( (4-diméthylamino-2-méthyl- quinoléin-6-yl) amino) -4- ( (4-diméthylamino-l, 2-diméthyl- quinoléinium-6-yl) amino) -6- (4-éthoxyéthyl-pipérazin-l- yl) - [1, 3, 5] triazine, dont les caractéristi-ques sont les suivantes :(0.10 mmol) of 4-dimethylamino-1,2-dimethyl-quinolinium-6-yl) amino chloride, prepared according to patent W0001561. The reaction medium is heated to 120 ° C under argon for 48 hours. After cooling, the contents of the tube are evaporated under reduced pressure, taken up in 5 ml of water, filtered and washed with diethyl ether. The crude product obtained is then purified by LC / MS using a C18 Waters Xterra 3.5 μM silica column, 3 mm in diameter and 50 mm long, eluting with a linear elution gradient formed at the initial time (t 0 = 0 min) with water containing 0.05% trifluoroacetic acid and at the final time (tf = 4 min) with acetonitrile containing 0.05% trifluoroacetic acid. 18.8 mg of 2- ((4-dimethylamino-2-methyl-quinolin-6-yl) amino) -4- (4-dimethylamino-1,2-dimethyl-quinoline-6-chloride) chloride are thus obtained, after purification. -yl) amino) -6- (4-ethoxyethyl-piperazin-1- yl) - [1, 3, 5] triazine, the characteristics of which are as follows:
- spectre de masse (DAD-TIC) = 639 (MH+)- mass spectrum (DAD-TIC) = 639 (MH + )
L'exemple 186, 2, 4-bis- ( (4-diméthylamino-2-méthyl- quinoléin-6-yl) amino) -6- (4-cyclopentyl-pipérazin-l-yl) - [1, 3, 5] triazine, peut être avantageusement préparé de la manière suivante :Example 186, 2, 4-bis- ((4-dimethylamino-2-methyl-quinolin-6-yl) amino) -6- (4-cyclopentyl-piperazin-1-yl) - [1, 3, 5 ] triazine, can advantageously be prepared as follows:
On ajoute 1.10 g de 2, 4, β-trichloro-s-triazine et 25 ml de 1,4-dioxane dans un tricol de 100 ml. On agite la réaction jusqu'à dissolution du 2, 4, 6-trichloro-s- triazine. On met le tricol dans un bain de glace. Après 10 minutes, on ajoute 930 mg du 1-cyclopentyl-pipérazine et 640 mg de carbonate de sodium. Après 4 heures, le bain de la glace est enlevé. Après retour à la température ambiante, le solide qui est précipité est filtré. On obtient ainsi 1,496 g de 2, 4-dichloro-6- (4-cyclopentyl- pipérazin-1-yl) - [1, 3, 5] triazine, utilisée telle quelle à l'étape suivante, dont les caractéristiques sont les suivantes : - spectre de masse (El) = 303 (Mf)1.10 g of 2, 4, β-trichloro-s-triazine and 25 ml of 1,4-dioxane are added to a 100 ml three-necked flask. The reaction is stirred until the 2,4,6-trichloro-s-triazine is dissolved. We put the tricolor in an ice bath. After 10 minutes, 930 mg of 1-cyclopentyl-piperazine and 640 mg of sodium carbonate are added. After 4 hours, the ice bath is removed. After returning to room temperature, the solid which is precipitated is filtered. 1.496 g of 2,4-dichloro-6- (4-cyclopentyl-piperazin-1-yl) - [1, 3, 5] triazine are thus obtained, used as it is in the following step, the characteristics of which are as follows : - mass spectrum (El) = 303 (Mf)
Dans un tricol de 50 ml, on ajoute 906 mg de 2, 4-dichloro-6- (4-cyclopentyl-pipérazin-l-yl) - [1, 3, 5] tria-zine, obtenue ci-dessus, et 25 ml de 1,4-dioxane. On agite la réaction. On ajoute alors, successivement, 603 mg de 4-diméthylamino-2-méthyl- quinoléin-6-ylamine, qui peut être préparée selon J. Med. Chem. 1992, 35, 252, et 414 mg de carbonate de sodium. On chauffe à 110 °C sous argon pendant 18 heures. Après filtration puis lavage du précipité au méthanol, on obtient après concentration 1,06 g de 2-chloro-4- (4- diméthylamino-2-méthyl-quinoléin-6-ylamine) -6- (4- cyclopentyl-pipérazin-1-yl) -[1,3,5] triazine, utilisée telle quelle à l'étape suivante, dont les caractéristiques sont les suivantes :906 mg of 2,4-dichloro-6- (4-cyclopentyl-piperazin-1-yl) - [1, 3, 5] tria-zine, obtained above, and 25 are added to a 50 ml three-necked flask ml 1,4-dioxane. The reaction is stirred. 603 mg of 4-dimethylamino-2-methyl-quinolin-6-ylamine, which can be prepared according to J. Med. Chem. 1992, 35, 252, and 414 mg of sodium carbonate. The mixture is heated at 110 ° C. under argon for 18 hours. After filtration and then washing the precipitate with methanol, 1.06 g of 2-chloro-4- (4-dimethylamino-2-methyl-quinolin-6-ylamine) -6- (4-cyclopentyl-piperazin-1) is obtained after concentration -yl) - [1,3,5] triazine, used as is in the next step, the characteristics of which are as follows:
- spectre de masse (El) = 465 (Mf ) .- mass spectrum (El) = 465 (Mf).
Dans un réacteur magnétique chauffant avec condenseur Zymark, de type STEM RS2050 contenant 25 puits en parallèle munis chacun d'un tube en verre de 50 ml, on introduit 25 mg (0,05 mmole) de 2-chloro-4- (4- diméthylamino-2-méthyl-quinoléin-6-ylamine) -6- (4- cyclopentyl-pipérazin-1-yl) -[1,3,5] triazine, obtenue ci-dessus. Dans le premier tube, on ajoute successivementIn a magnetic heating reactor with Zymark condenser, of the STEM RS2050 type containing 25 wells in parallel each provided with a 50 ml glass tube, 25 mg (0.05 mmol) of 2-chloro-4- (4- dimethylamino-2-methyl-quinoline-6-ylamine) -6- (4-cyclopentyl-piperazin-1-yl) - [1,3,5] triazine, obtained above. In the first tube, we add successively
5 ml de DMF, 1 ml de 1,4-dioxane, 9 μl (0,05 mmole) de5 ml of DMF, 1 ml of 1,4-dioxane, 9 μl (0.05 mmol) of
N,N-di-isopropyléthylamine et 19 mg (0,10 mmole) deN, N-di-isopropylethylamine and 19 mg (0.10 mmol) of
(4-diméthylamino-l, 2-diméthyl-quinoléinyl-6-yl) aminé. Le milieu réactionnel est chauffé à 120 °C sous argon pendant 48 heures. Après refroidissement, le contenu du tube est évaporé sous pression réduite, repris par 5 ml d'eau, filtré et lavé avec de l'oxyde de diéthyle. Le produit brut obtenu est alors purifié par LC/MS en utilisant une colonne de silice C18 Waters Xterra 3.5 μM, de diamètre 3 mm et de longueur 50 mm, en éluant par un gradient linéaire . d' élution constitué au temps initial (to = 0 mn) par de l'eau contenant 0,05 % d'acide trifluoroacétique et au temps final (tf = 4 mn) par de l' acétonitrile contenant 0,05 % d'acide trifluoroacétique. On obtient ainsi, après purification, 18.8 mg de 2,4-bis- ( (4-diméthylamino-2-méthyl-quinoléin-6-yl) amino) -6- (4- cyclopentyl-pipérazin-1-yl) - [1, 3, 5] triazine, dont les caractéristiques sont les suivantes :(4-dimethylamino-1,2-dimethyl-quinolinyl-6-yl) amine. The reaction medium is heated to 120 ° C under argon for 48 hours. After cooling, the contents of the tube are evaporated under reduced pressure, taken up in 5 ml of water, filtered and washed with diethyl ether. The crude product obtained is then purified by LC / MS using a 3.5 μM C18 Waters Xterra silica column, 3 mm in diameter and 50 mm long, eluting with a linear gradient. elution constituted at the initial time (t o = 0 min) with water containing 0.05% trifluoroacetic acid and at the final time (t f = 4 min) with acetonitrile containing 0.05% d trifluoroacetic acid. 18.8 mg of 2,4-bis- ((4-dimethylamino-2-methyl-quinolin-6-yl) amino) -6- (4-cyclopentyl-piperazin-1-yl) are thus obtained, after purification. 1, 3, 5] triazine, the characteristics of which are as follows:
- spectre de masse (DAD-TIC) = 619 (MH+)- mass spectrum (DAD-TIC) = 619 (MH + )
Exemples 203 : En opérant comme à l'exemple 185, par synthèse parallèle, mais étant entendu qu'il est possible d'introduire successivement l'une quelconque des trois chaines latérales, identiques ou différentes, sont avantageusement préparées les triazines de formule générale (Ib) ci-dessous :EXAMPLES 203: By operating as in Example 185, by parallel synthesis, but it being understood that it is possible to successively introduce any one of the three side chains, identical or different, are advantageously prepared the triazines of general formula (Ib) below:
dans lesquelles :in which :
- B représente un radical ArιNR3 un radical choisi parmi les radicaux :- B represents an ArιNR 3 radical, a radical chosen from the radicals:
1. (4-amino-2-méthyl-quinoléin-6-yl) amino1. (4-amino-2-methyl-quinoline-6-yl) amino
2. (2-méthyl-4-méthylamino-quinoléin-6-yl) amino2. (2-methyl-4-methylamino-quinoline-6-yl) amino
3. (4-diméthylamino-2-méthyl-quinoléin-6-yl) amino3. (4-dimethylamino-2-methyl-quinoline-6-yl) amino
4. ( [2, 4-bis (diméthylamino) -quinoléih-6-yl] amino4. ([2,4-bis (dimethylamino) -quinoleih-6-yl] amino
5. (4-diméthylamino-2-méthylamino-quinoléin-6- yl) amino5. (4-dimethylamino-2-methylamino-quinoline-6-yl) amino
6. (4-diméthylamino-2-méthyl-quinoléin-7-yl) amino6. (4-dimethylamino-2-methyl-quinoline-7-yl) amino
C ' représente - un radical Ar2NR3 choisi parmi les radicaux :C ' represents - an Ar 2 NR 3 radical chosen from the radicals:
1. (4-amino-2-méthyl-quinoléin-6-yl) amino1. (4-amino-2-methyl-quinoline-6-yl) amino
2. (2-méthyl-4-méthylamino-quinoléin-6-yl) amino2. (2-methyl-4-methylamino-quinoline-6-yl) amino
3. (4-diméthylamino-2-méthyl-quinoléin-6-yl) amino3. (4-dimethylamino-2-methyl-quinoline-6-yl) amino
4. ( [2, 4-bis (diméthylamino) -quinoléin-6-yl] amino4. ([2,4-bis (dimethylamino) -quinoline-6-yl] amino
5. (4-diméthylamino-2-méthylamino-quinoléin-6- yl) amino 6. (4-diméthylamino-2-méthyl-quinoléin-7-yl) amino5. (4-dimethylamino-2-methylamino-quinoline-6-yl) amino 6. (4-dimethylamino-2-methyl-quinoline-7-yl) amino
!.. (4-phénylméthylamino-2-méthyl-quinoléin-6- yl) amino! .. (4-phenylmethylamino-2-methyl-quinoline-6-yl) amino
8. (4-diéthylamino-2-méthyl-quinoléin-6-yl) amino8. (4-diethylamino-2-methyl-quinoline-6-yl) amino
9. (4-isopropylamino-2-méthyl-quinoléin-6-yl) amino9. (4-isopropylamino-2-methyl-quinoline-6-yl) amino
1.0. [4- (2-méthoxy-éthyl) amino-2-méthyl- quinoléin-6-yl] amino1.0. [4- (2-methoxy-ethyl) amino-2-methyl-quinoline-6-yl] amino
11. [4- (4-acétylamino-phényl) amino-2-méthyl- quinoléin-6-yl] amino11. [4- (4-acetylamino-phenyl) amino-2-methyl-quinolin-6-yl] amino
12. [4- (azétidin-1-yl) -2-méthyl-quinoléin-6- yl) amino12. [4- (azetidin-1-yl) -2-methyl-quinoline-6- yl) amino
13. - [2-méthyl-4- (pyrrolidin-1-yl) -quinoléin-6- yl) amino13. - [2-methyl-4- (pyrrolidin-1-yl) -quinoline-6- yl) amino
14. ( 6-diméthylamino-phénanthridin-2-yl) amino14. (6-dimethylamino-phenanthridin-2-yl) amino
15. (l-diméthylamino-isoquinoléin-7-yl) amino15. (l-dimethylamino-isoquinoline-7-yl) amino
16. [N- (4-diméthylamino-2-méthyl-quinoléin-6- yl) -N-méthyl] amino16. [N- (4-dimethylamino-2-methyl-quinoline-6-yl) -N-methyl] amino
17. (4-diméthylamino-2-phényl-quinoléin-6- yl) amino17. (4-dimethylamino-2-phenyl-quinoline-6-yl) amino
18. (4-amino-2-isopropyl-quinoléin-6-yl) amino18. (4-amino-2-isopropyl-quinoline-6-yl) amino
19. (2 , 7-diméthyl-4-diméthylamino-quinoléin-6- yl) amino19. (2,7-dimethyl-4-dimethylamino-quinoline-6-yl) amino
20. (2-méthyl-lH-benzoimidazol-5-yl ) amino20. (2-methyl-1H-benzoimidazol-5-yl) amino
21. (2-diméthylamino-lH-benzoimidazol-5- yl) amino 22. (2-diméthylamino-3-méthyl-3H- benzoimidazol-5-yl) amino21. (2-dimethylamino-1H-benzoimidazol-5-yl) amino 22. (2-dimethylamino-3-methyl-3H-benzoimidazol-5-yl) amino
23. (2-diméthylamino-l-méthyl-lH- benzoimidazol-5-yl) amino23. (2-dimethylamino-1-methyl-1H-benzoimidazol-5-yl) amino
24. (l-diméthylamino-3-méthyl-isoquinoléin-7- yl) amino24. (1-dimethylamino-3-methyl-isoquinoline-7-yl) amino
25. [1- (2-Diméthylamino-ethyl) -lH-indol-5- yl] amino25. [1- (2-Dimethylamino-ethyl) -1H-indol-5-yl] amino
26. (9-diméthylamino-acridin-2-yl) amino26. (9-dimethylamino-acridin-2-yl) amino
27. (4-diméthylamino-quinazolin-6-yl) amino27. (4-dimethylamino-quinazolin-6-yl) amino
28. (4-amino-l, 2-diméthyl-quinoléinio-6- yl) amino28. (4-amino-1,2-dimethyl-quinoline-6-yl) amino
29. (napthtalèn-2-yl) amino29. (Naphthalen-2-yl) amino
30. (napthtalèn-2-yl)méthylamino30. (naphththalen-2-yl) methylamino
31. 2- (napthtalèn-2-yl) éthylamino31. 2- (Naphthalen-2-yl) ethylamino
32. (anthracèn-2-yl) amino32. (anthracen-2-yl) amino
33. diphénylméthylamino33. diphenylmethylamino
34 . ( 3, 4 , 5-triméthoxy-phényl) amino34. (3, 4, 5-trimethoxy-phenyl) amino
35. ( 3 , 4 , 5-triméthoxy-phényl) méthylamino35. (3, 4, 5-trimethoxy-phenyl) methylamino
3'6. ( 4-trifluorométhyl-phényl ) amino3 ' 6. (4-trifluoromethyl-phenyl) amino
37. (4-trifluorométhyl-phényl)méthylamino37. (4-trifluoromethyl-phenyl) methylamino
38. (4-cyanophényl) amino38. (4-cyanophenyl) amino
39. (4-cyanophényl)méthylamino 40. ( 4-triméthylammonio-phényl ) amino39. (4-cyanophenyl) methylamino 40. (4-trimethylammonio-phenyl) amino
41. (2-triméthylammonio-éthyl) amino41. (2-trimethylammonioethyl) amino
42. (l-méthyl-pyridinio-4-yl) amino42. (1-methyl-pyridinio-4-yl) amino
43. (4-amidinophényl) amino43. (4-amidinophenyl) amino
- A représente un radical choisi parmi les radicaux :- A represents a radical chosen from the radicals:
1. (4-amino-2-méthyl-quinoléin-6-yl) amino1. (4-amino-2-methyl-quinoline-6-yl) amino
2. (2-méthyl-4-méthylamino-quinoléin-6-yl) amino2. (2-methyl-4-methylamino-quinoline-6-yl) amino
3. (4-diméthylamino-2-méthyl-quinoléin-6-yl) amino3. (4-dimethylamino-2-methyl-quinoline-6-yl) amino
4. ( [2, 4-bis (diméthylamino) -quinoléin-6-yl] amino4. ([2,4-bis (dimethylamino) -quinoline-6-yl] amino
5. (4-diméthylamino-2-méthylamino-quinoléin-6- yl) amino5. (4-dimethylamino-2-methylamino-quinoline-6-yl) amino
6. (4-diméthylamino-2-méthyl-quinoléin-7-yl) amino6. (4-dimethylamino-2-methyl-quinoline-7-yl) amino
7. (4-amino-l, 2-diméthyl-quinoléinio-6-yl) amino7. (4-amino-1,2-dimethyl-quinoline-6-yl) amino
8. [N- (l-méthyl-pipéridin-4-yl) ] -N-méthyl] amino8. [N- (1-methyl-piperidin-4-yl)] -N-methyl] amino
9. 4- (pyridin-4-yl) pipérazin-1-yl9. 4- (pyridin-4-yl) piperazin-1-yl
10 . 4- (2-hydroxyéthyl) pipérazin-l-yl10. 4- (2-hydroxyethyl) piperazin-1-yl
11 . 4- (3-diméthylamino-propyl ) homopipérazin-1- yi11. 4- (3-dimethylamino-propyl) homopiperazin-1- yi
12. 4- [3- (pyrrolidin-1-yl) propyl]pipérazin-l- yl12. 4- [3- (pyrrolidin-1-yl) propyl] piperazin-1-yl
13. (2, 3-dihydroxy-l-phényl-prop-l-yl) amino13. (2,3-dihydroxy-1-phenyl-prop-1-yl) amino
14. 4- [2- (pyrrolidin-1-yl) éthyl]pipérazin-l-yl 15. 4- [2- (pyrrolidin-1-yl) éthyl]homopipérazin- 1-yl14. 4- [2- (pyrrolidin-1-yl) ethyl] piperazin-l-yl 15. 4- [2- (pyrrolidin-1-yl) ethyl] homopiperazin- 1-yl
16. 4-[2-(lH-imidazol-l- yl) éthyl] homopipérazin-1-yl16. 4- [2- (1H-imidazol-1-yl) ethyl] homopiperazin-1-yl
17. 4- [2- (1-H-imidazol-l-yl) éthyl] pipérazin-1- yl17. 4- [2- (1-H-imidazol-1-yl) ethyl] piperazin-1- yl
18. 4-[3-(l-H-imidazol-l- yl) propyl] homopipérazin-1-yl18. 4- [3- (1-H-imidazol-1-yl) propyl] homopiperazin-1-yl
19. 4- [3- (1-H-imidazol-l-yl) propyl] pipérazin- 1-yl19. 4- [3- (1-H-imidazol-1-yl) propyl] piperazin-1-yl
20. 4-[2-(2-phényl-l-H-imidazol-l- yl) éthyl] homopipérazin-1-yl20. 4- [2- (2-phenyl-1-H-imidazol-1-yl) ethyl] homopiperazin-1-yl
21. 4- [2- (2-phényl-l-H-imidazol-l- yl) éthyl] pipérazin-1-yl21. 4- [2- (2-phenyl-1-H-imidazol-1-yl) ethyl] piperazin-1-yl
22. 4-[3-(2-phényl-l-H-imidazol-l- yl) propyl] homopipérazin-1-yl22. 4- [3- (2-phenyl-1-H-imidazol-1-yl) propyl] homopiperazin-1-yl
23. 4- [3- (2-phényl-l-H-imidazol-l- yl) propyl] pipérazin-1-yl23. 4- [3- (2-phenyl-1-H-imidazol-1-yl) propyl] piperazin-1-yl
24. 4- [2- (morpholin-1-yl) éthyl] homopipérazin- 1-yl24. 4- [2- (morpholin-1-yl) ethyl] homopiperazin-1-yl
25. 4- [2- (morpholin-1-yl) éthyl] pipérazin-1-yl25. 4- [2- (morpholin-1-yl) ethyl] piperazin-1-yl
26. 4- [3- (morpholin-1-yl) propyl] homopipérazin- 1-yl26. 4- [3- (morpholin-1-yl) propyl] homopiperazin- 1-yl
27. 4- [3- (morpholin-1-yl) propyl] pipérazin-1-yl27. 4- [3- (morpholin-1-yl) propyl] piperazin-1-yl
28. 4- [2- (lH-imidazo[4,5b]pyridin-l- yl) éthyl] homopipérazin-1-yl 29. 4- [2- (1-H-imidazo [4, 5b] pyridin-1- yl) éthyl] pipérazin-1-yl28. 4- [2- (1H-imidazo [4,5b] pyridin-1-yl) ethyl] homopiperazin-1-yl 29. 4- [2- (1-H-imidazo [4, 5b] pyridin-1- yl) ethyl] piperazin-1-yl
30. 4-[3-(l-H-imidazo[4,5b]pyridin-l- yl) propyl] homopipérazin-1-yl30. 4- [3- (1-H-imidazo [4,5b] pyridin-1-yl) propyl] homopiperazin-1-yl
31. 4- [3- (1-H-imidazo [4, 5b]pyridin-l- yl) propyl] pipérazin-1-yl31. 4- [3- (1-H-imidazo [4, 5b] pyridin-1-yl) propyl] piperazin-1-yl
32. 4-[2-(lH-benzoimidazol-l- yl) éthyl] homopipérazin-1-yl32. 4- [2- (1H-benzoimidazol-1-yl) ethyl] homopiperazin-1-yl
33. 4- [2- (1-H-benzoimidazol-l- yl) éthyl] pipérazin-1-yl33. 4- [2- (1-H-benzoimidazol-1-yl) ethyl] piperazin-1-yl
34. 4- [3- (1-H-benzoimidazol-l- yl) propyl] homopipérazin-1-yl34. 4- [3- (1-H-benzoimidazol-1-yl) propyl] homopiperazin-1-yl
35. 4- [3- (1-H-benzoimidazol-l- yl ) propyl] pipérazin-1-yl35. 4- [3- (1-H-benzoimidazol-1-yl) propyl] piperazin-1-yl
36. 4- [2- (2-hydroxyméthyl-lH-benzoimidazol-l- yl) éthyl] homopipérazin-1-yl36. 4- [2- (2-hydroxymethyl-1H-benzoimidazol-1-yl) ethyl] homopiperazin-1-yl
37. 4- [2- (2-hydroxyméthyl-l-H-benzoimidazol-l- yl) éthyl] pipérazin-1-yl37. 4- [2- (2-hydroxymethyl-1-H-benzoimidazol-1-yl) ethyl] piperazin-1-yl
38. 4- [3- (2-hydroxyméthyl-l-H-benzoimidazol-l- yl) propyl] homopipérazin-1-yl38. 4- [3- (2-hydroxymethyl-1-H-benzoimidazol-1-yl) propyl] homopiperazin-1-yl
39. 4- [3- (2-hydroxyméthyl-l-H-benzoimidazol-l- yl) propyl] pipérazin-1-yl39. 4- [3- (2-hydroxymethyl-1-H-benzoimidazol-1-yl) propyl] piperazin-1-yl
40. 4- [2- (lH-imidazol-2-yl) amino- . éthyl] homopipérazin-1-yl40. 4- [2- (1H-imidazol-2-yl) amino-. ethyl] homopiperazin-1-yl
41. 4-[2-(l-H-imidazol-2-yl)amino- éthyl] pipérazin-1-yl 42. 4- [3- (l-H-imidazol-2-yl) amino- propyl] homopipérazin-1-yl41. 4- [2- (1H-imidazol-2-yl) aminoethyl] piperazin-1-yl 42. 4- [3- (1H-imidazol-2-yl) aminopropyl] homopiperazin-1-yl
43. 4- [3- (l-H-imidazol-2-yl) amino- propyl] ipérazin-1-yl43. 4- [3- (1-H-imidazol-2-yl) aminopropyl] iperazin-1-yl
44. 4-{2-[2- (lH-imidazol-2-yl)-l- hydroxyméthyl -éthyl] amino-éthyl}homopipérazin- 1-yl44. 4- {2- [2- (1H-imidazol-2-yl) -l- hydroxymethyl -ethyl] amino-ethyl} homopiperazin- 1-yl
45. 4-{2-[2- (lH-imidazol-2-yl)-l- hydroxyméthyl-éthyl] amino-éthyl }pipérazin-l-yl45. 4- {2- [2- (1H-imidazol-2-yl) -l- hydroxymethyl-ethyl] amino-ethyl} piperazin-1-yl
46. 4-{3-[2-(lH-imidazol-2-yl)-l- hydroxyméthyl-éthyl] amino-propyl }homopipérazin- 1-yl46. 4- {3- [2- (1H-imidazol-2-yl) -l- hydroxymethyl-ethyl] amino-propyl} homopiperazin- 1-yl
47. 4-{3-[2- (lH-imidazol-2-yl) -1- hydroxyméthyl-éthyl] amino-propyl }pipérazin-l-yl47. 4- {3- [2- (1H-imidazol-2-yl) -1-hydroxymethyl-ethyl] amino-propyl} piperazin-1-yl
48. 4- (pipéridin-4-yl)pipéridin-l-yl48. 4- (piperidin-4-yl) piperidin-l-yl
49. (l-H-benzoimidazol-l-yl)méthylamino49. (1-H-benzoimidazol-1-yl) methylamino
50. (pipéridin-l-yl)méthylamino50. (piperidin-l-yl) methylamino
51. 2- (pyridin-2-yl)pyrrolidin-l-yl51. 2- (pyridin-2-yl) pyrrolidin-l-yl
52. 4- (2-diméthylamino-éthyl) pipérazin-1-yl52. 4- (2-dimethylamino-ethyl) piperazin-1-yl
53. (l-méthyl-pipéridin-4-yl) amino53. (1-methyl-piperidin-4-yl) amino
54. (quinuclidin-3-yl) amino54. (quinuclidin-3-yl) amino
55. (4-méthyl-homopipérazin-l-yl) amino55. (4-methyl-homopiperazin-1-yl) amino
56. [N- (2-diméthylamino-éthyl) -N- (phénylméthyl) amino]méthylamino56. [N- (2-dimethylamino-ethyl) -N- (phenylmethyl) amino] methylamino
57. (diisopropylamino)méthylamino 58. (diéthylamino)méthylamino57. (diisopropylamino) methylamino 58. (diethylamino) methylamino
59. (pyridin-2-yl) amino59. (pyridin-2-yl) amino
60. (pyrimidin-2-yl) amino60. (pyrimidin-2-yl) amino
61. (pipéridin-l-yl) éthylamino61. (piperidin-l-yl) ethylamino
62. (l-phénylméthyl-pyrrolidin-3-yl) amino62. (1-phenylmethyl-pyrrolidin-3-yl) amino
63. (2-diméthylamino-éthyl) oxy63. (2-dimethylamino-ethyl) oxy
64. phényloxy64. phenyloxy
65. (pyridin-2-yl) oxy65. (pyridin-2-yl) oxy
66. (pyrimidin-2-yl) oxy66. (pyrimidin-2-yl) oxy
67. phénylsulfanyl67. phenylsulfanyl
68. (pyridin-2-yl) suifanyl68. (pyridin-2-yl) suifanyl
69. (pyrimidin-2-yl) suifanyl69. (pyrimidin-2-yl) suifanyl
70. (quinoléin-2-yl) suifanyl70. (quinoline-2-yl) suifanyl
Les aminés, les alcools ou phénols et les thiols ou thiophenols, nécessaires pour l'introduction des radicaux de type B, C ou A des produits de formule générale (Ib) , sont :Amines, alcohols or phenols and thiols or thiophenols, necessary for the introduction of radicals of type B, C or A of the products of general formula (Ib), are:
• soit commerciaux,• either commercial,
• soit préparés comme décrit dans la littérature :• be prepared as described in the literature:
o 2-méthyl-quinoléin-4, 6-diylamineo 2-methyl-quinoline-4, 6-diylamine
(A1/B1/C1) selon J. Med. Chem. 1992, 35, 252-258 o 2-méthyl-4-méthylamino-quinoléin-6-amine (A2/B2/C2) selon J. Med. Chem. 2000, 43, 4667(A1 / B1 / C1) according to J. Med. Chem. 1992, 35, 252-258 o 2-methyl-4-methylamino-quinoline-6-amine (A2 / B2 / C2) according to J. Med. Chem. 2000, 43, 4667
o 4-diméthylamino-quinoléin-6-amine (A3/B3/C3) selon WO 0140218o 4-dimethylamino-quinoline-6-amine (A3 / B3 / C3) according to WO 0140218
o 4-phénylméthylamino-quinoléin-6-amine (B7) selon J. Med. Chem. 1992, 35, 252-258o 4-phenylmethylamino-quinoline-6-amine (B7) according to J. Med. Chem. 1992, 35, 252-258
o 2-diméthylamino-l-méthyl-lH-benzoimidazol- 5-amine (B23) selon Khim Geterosikl. Soedin. 1969, 543-546o 2-dimethylamino-1-methyl-1H-benzoimidazol-5-amine (B23) according to Khim Geterosikl. Soedin. 1969, 543-546
o 4-diméthylamino-quinazolin-6-amine (B27) selon WO 9738983o 4-dimethylamino-quinazolin-6-amine (B27) according to WO 9738983
o chlorure de 1, 2-diméthyl-quinolinium-4, 6- diamirie (B28/C7) selon WO 0140218o 1,2-dimethyl-quinolinium-4,6-diamirie chloride (B28 / C7) according to WO 0140218
o 4- [2- (lH-imidazol-1-yl) éthyl] pipérazineo 4- [2- (1H-imidazol-1-yl) ethyl] piperazine
(C17) selon WO 0196323(C17) according to WO 0196323
o 4- [3- (lH-imidazol-1-yl) propyl] pipérazine (C19) selon EP 350145o 4- [3- (1H-imidazol-1-yl) propyl] piperazine (C19) according to EP 350 145
préparés comme cidessous :prepared as below:
o La 4-diéthylamino-2-méthyl-quinoléin-6-amineo 4-diethylamino-2-methyl-quinoline-6-amine
(B8), la 4-isopropylamino-2-méthyl-quinoléin- 6-amine (B9) , la 4- (2-méthoxy-éthyl) amino-2- méthyl-quinoléin-6-amine (B10), la 4- (4- acétylamino-phényl) amino-2-méthyl-quinoléin- 6-amine (Bll) , la 4- (azétidin-1-yl) -2-méthyl- quinoléin-6-amine (B12) et la 2-méthyl-4- (pyrrolidin-1-yl) -quinoléin-6-amine (B13) peuvent être préparées par synthèse parallèle en opérant de la manière- suivante : Etape 1 : Substitution en parallèle de la 4-chloro-2- méthyl-6-quinoléine(B8), 4-isopropylamino-2-methyl-quinoline-6-amine (B9), 4- (2-methoxy-ethyl) amino-2-methyl-quinoline-6-amine (B10), 4- (4-acetylamino-phenyl) amino-2-methyl-quinoline-6-amine (B11), 4- (azetidin-1-yl) -2-methyl-quinoline-6-amine (B12) and 2-methyl -4- (pyrrolidin-1-yl) -quinoline-6-amine (B13) can be prepared by parallel synthesis by operating as follows: Step 1: Parallel substitution of 4-chloro-2-methyl-6-quinoline
Dans un réacteur de 24 puits en acier inoxydable, chauffant, agitable et pressurisable, on introduit par puits les aminés suivantes : 0.094 g d'isopropylamine 0.173 g de chlorhydrate de diéthylamine 0.120 g de 2-méthoxyéthylamine 0.091 g d'azétidine 0.114 g de pyrrolidineThe following amines are introduced into a 24-well, stirred, pressurizable, stainless steel reactor: 0.094 g of isopropylamine 0.173 g of diethylamine hydrochloride 0.120 g of 2-methoxyethylamine 0.091 g of azetidine 0.114 g of pyrrolidine
0.296 g de chlorhydrate de 4-aminoacétanilide0.296 g of 4-aminoacetanilide hydrochloride
Puis on ajoute dans chaque puits 1.35 ml d'une solution mère préparée à partir de 2,67 g de 4-chloro-2-méthyl-6- nitro-quinoléine dans 30 ml de N-méthylpyrrolidinone et de 10,1 ml de triéthylamine. Cette opération est reproduite dans 4 puits, pour chaque aminé substituante. L'appareil est fermé puis pressuré sous 10BAR d'argon et agité pendant 5 heures à 100 °C. Après refroidissement, on rassemble les solutions des puits de même composition, puis on dilue ces solutions à l'aide de 30 ml d'eau. On essore l'insoluble formé sur plaque poreuse, on le rince par 15 ml d'eau et le sèche à l'air. Les produits sont purifiés par LCMS dans les conditions suivantes :Then 1.35 ml of a mother solution prepared from 2.67 g of 4-chloro-2-methyl-6-nitro-quinoline in 30 ml of N-methylpyrrolidinone and 10.1 ml of triethylamine are added to each well. . This operation is reproduced in 4 wells, for each substituent amine. The device is closed then pressurized under 10BAR of argon and stirred for 5 hours at 100 ° C. After cooling, the solutions of the wells of the same composition are combined, then these solutions are diluted using 30 ml of water. The insoluble material formed is drained on a porous plate, rinsed with 15 ml of water and air dried. The products are purified by LCMS under the following conditions:
Spectromètre de masse Pla tform MICROMASS Chaîne HPLC 1100 Agilent (Hewlett Packard)MICROMASS Pla tform mass spectrometer Agilent HPLC 1100 chain (Hewlett Packard)
Colonne THERMO Hypersil 50X4. 6 mm 5 μ hyPURITY Cl 8 Gradient d' élution (eau/acétonitrile en volumes) : t = 0 mn (95-5) ; t = 3,5 mn (10/90) ; t = 4 mn (10/90) ; t = 4,5 n (95/15) ; t = 6 n 595/5). On obtient ainsi les produits purs suivants :THERMO Hypersil 50X4 column. 6 mm 5 μ hyPURITY Cl 8 Elution gradient (water / acetonitrile by volume): t = 0 min (95-5); t = 3.5 min (10/90); t = 4 min (10/90); t = 4.5 n (95/15); t = 6 n 595/5). The following pure products are thus obtained:
0,323 g de 4-isopropylamino-2-méthyl-6-nitro-quinoléine (temps de rétention LCMS : 3,04 mn)0.323 g of 4-isopropylamino-2-methyl-6-nitro-quinoline (LCMS retention time: 3.04 min)
0,386 g • de 4-diéthylamino-2-méthyl-6-nitro-quinoléine (temps de rétention LCMS : 2,98 mn) 0.365 g de 4- (2-méthoxy-éthyl) amino-2-méthyl-6-nitro- quinoldéne (temps de rétention LCMS : 2,69 mn) 0,258 g d' 4- (azétidin-1-yl) -2-méthyl-6-nitro-quinoléine (temps de rétention LCMS : 2,87 mn) 0,275 g de 4- (pyrrolidin-1-yl) -2-méthyl-6-nitro- quinoléine (temps de rétention LCMS": 3,04 mn) 0,461 g de 4- (4-acétylamino-phényl) -2-méthyl-6-nitro- quinoléine (temps de rétention LCMS : 2,96 mn)0.386 g • of 4-diethylamino-2-methyl-6-nitro-quinoline (LCMS retention time: 2.98 min) 0.365 g of 4- (2-methoxy-ethyl) amino-2-methyl-6-nitro-quinoldene (LCMS retention time: 2.69 min) 0.258 g of 4- (azetidin-1-yl) -2-methyl -6-nitro-quinoline (LCMS retention time: 2.87 min) 0.275 g of 4- (pyrrolidin-1-yl) -2-methyl-6-nitro-quinoline (LCMS retention time ": 3.04 min ) 0.461 g of 4- (4-acetylamino-phenyl) -2-methyl-6-nitroquinoline (LCMS retention time: 2.96 min)
Etape 2 : Réduction en parallèle des 6-nitro- quinoléines Les produits décrits précédemment sont répartis chacun dans 4 puits. Leur réduction est effectuée dans l'appareil décrit précédemment, en introduisant dans chaque puits 0,050 g de palladium à 10 % sur carbone et 1,5 ml d'une solution méthanol/dichlorométhane (80/20 en volumes) . Après obturation et inertage, on agite pendant 6 heures à 20 °C sous 6 bars d'hydrogène. Les solutions des puits de même composition sont regroupées, le catalyseur est filtré puis rincé par 5 ml de méthanol. Le filtrat est alors concentré sous pression réduite. Les produits sont purifiés par LCMS dans les conditions décrites à l'étape 1. On obtient ainsi :Step 2: Reduction in parallel of 6-nitroquinolines The products described above are each distributed in 4 wells. Their reduction is carried out in the apparatus described above, by introducing into each well 0.050 g of 10% palladium on carbon and 1.5 ml of a methanol / dichloromethane solution (80/20 by volume). After obturation and inerting, the mixture is stirred for 6 hours at 20 ° C. under 6 bars of hydrogen. The solutions of the wells of the same composition are combined, the catalyst is filtered and then rinsed with 5 ml of methanol. The filtrate is then concentrated under reduced pressure. The products are purified by LCMS under the conditions described in step 1. This gives the following:
0,289 g de 4-isopropylamino-2-méthyl-quinoléin-6- amine (temps de rétention LCMS : 3,07 mn)0.289 g of 4-isopropylamino-2-methyl-quinoline-6-amine (LCMS retention time: 3.07 min)
0,487 g de 4-diéthylamino-2-méthyl-quinoléin-6-amine (temps de rétention LCMS : 2,62 mn)0.487 g of 4-diethylamino-2-methyl-quinoline-6-amine (LCMS retention time: 2.62 min)
0,323 g de 4- (2-méthoxy-éthyl) amino-2-méthyl- quinoléin-6-amine (temps de rétention LCMS : 2,78 mn) 0,035 g de 4- (azétidin-1-yl) -2-méthyl-quinoléin-6- aminé (temps de rétention LCMS : 1,74 mn)0.323 g of 4- (2-methoxy-ethyl) amino-2-methyl-quinolin-6-amine (LCMS retention time: 2.78 min) 0.035 g of 4- (azetidin-1-yl) -2-methyl -quinoline-6- amino (LCMS retention time: 1.74 min)
0,201 g de 4- (pyrrolidin-1-yl) -2-méthyl-quinoléin-β- amine (temps de rétention LCMS : 2,53 mn) 0,170 g de 4- (4-acétylamino-phényl) -2-méthyl- quinoléin-6-amine (temps de rétention LCMS : 2,76 mn .0.20 g of 4- (pyrrolidin-1-yl) -2-methyl-quinoline-β- amine (LCMS retention time: 2.53 min) 0.170 g of 4- (4-acetylamino-phenyl) -2-methyl-quinoline-6-amine (LCMS retention time: 2.76 min.
o La 2, 4-bis (diméthylamino) -quinoléin-6-amine (A4/B4/C4) peut être préparée en opérant de la manière suivante :o 2,4-bis (dimethylamino) -quinoline-6-amine (A4 / B4 / C4) can be prepared by operating as follows:
180 mg de 2, 4-bis (diméthylamino) -6-nitro-quinoléine en solution dans 12 mL d'un mélange méthanol- dichlorométhane (3/1 en volumes) est placée sous atmosphère d'hydrogène (5 bars) en présence de 15 mg de palladium sur charbon à 10 % pendant 12 heures. Après filtration sur célite, le filtrat est concentré sous pression réduite. On obtient ainsi 186 mg de 2,4- bis (diméthylamino) -quinoléin-6-amine sous forme de chlorhydrate dont les caractéristiques sont les suivantes :180 mg of 2,4-bis (dimethylamino) -6-nitro-quinoline in solution in 12 ml of a methanol-dichloromethane mixture (3/1 by volume) is placed under a hydrogen atmosphere (5 bars) in the presence of 15 mg of 10% palladium on carbon for 12 hours. After filtration on celite, the filtrate is concentrated under reduced pressure. 186 mg of 2,4-bis (dimethylamino) -quinoline-6-amine are thus obtained in the form of the hydrochloride, the characteristics of which are as follows:
Spectre de R.M.N. 1H (300 MHz, (CD3)2SO d6, δ en ppm) : 3,12 (s : 6H) ; 3,28 (s : 6H) ; 5,48 (mf : 2H) ; 6,04 (s : 1H) ; 7,06 (dd, J = 9 et 2,5 Hz : 1H) ; 7,11 (d, J = 2,5 Hz : 1H) ; 7,81 (d, J = 9 Hz : 1H) .1H NMR spectrum (300 MHz, (CD 3 ) 2 SO d6, δ in ppm): 3.12 (s: 6H); 3.28 (s: 6H); 5.48 (mf: 2H); 6.04 (s: 1H); 7.06 (dd, J = 9 and 2.5 Hz: 1H); 7.11 (d, J = 2.5 Hz: 1H); 7.81 (d, J = 9 Hz: 1H).
Spectre de massse :Mass spectrum:
EI(70eV) m/z=230 M+" pic de base m/z=215 [M - CH3] + m/z=201 [215 - CH2] + m/z=187 [M - NC2H5]+-EI (70eV) m / z = 230 M + "base peak m / z = 215 [M - CH 3 ] + m / z = 201 [215 - CH 2 ] + m / z = 187 [M - NC 2 H 5 ] + -
La 2, 4-bis (diméthylamino) -6-nitro-quinoléine peut être préparée de la façon suivante : 300 mg de 2,4- dichloro-6-nitro-quinoléine est mise en solution dans 12 mL de DMF en présence de 853 mg de carbonate de potassium et de 1 g de chlorhydrate de diméthylammonium. Le mélange réactionnel est agité à 100 °C pendant 3 heures. Après retour à température ambiante, l'insoluble est éliminé par filtration et le filtrat est concentré sous pression réduite. Le résidu est hydrolyse par ajout d'eau et le précipité obtenu est récupéré par filtration puis séché sous pression réduite. On obtient ainsi 180 mg de 2, 4-bis (diméthylamino) -6-nitro-quinoléine sous forme d'une poudre jaune dont le spectre de masse est le suivant :2,4-bis (dimethylamino) -6-nitro-quinoline can be prepared as follows: 300 mg of 2,4-dichloro-6-nitro-quinoline is dissolved in 12 ml of DMF in the presence of 853 mg of potassium carbonate and 1 g of dimethylammonium hydrochloride. The reaction mixture is stirred at 100 ° C for 3 hours. After returning to room temperature, the insoluble material is removed by filtration and the filtrate is concentrated under reduced pressure. The residue is hydrolyzed by adding water and the precipitate obtained is recovered by filtration and then dried under reduced pressure. 180 mg of 2,4-bis (dimethylamino) -6-nitro-quinoline are thus obtained in the form of a yellow powder, the mass spectrum of which is as follows:
EI(70eV) m/z=260 M+" pic de base m/z=245 [M - CH3] + m/z=231 [245 - CH2] + m/z=217 [M - NC2H5]+- m/z=199 [245 - N02]+"EI (70eV) m / z = 260 M + "base peak m / z = 245 [M - CH 3 ] + m / z = 231 [245 - CH 2 ] + m / z = 217 [M - NC 2 H 5 ] + - m / z = 199 [245 - N0 2 ] + "
La 2, 4-dichloro-6-nitro-quinoléine peut être préparée de la façon suivante : Une solution de 500 mg de 6-nitro-quinoléine-2, 4-diol dans 10 mL de P0C13 est portée au reflux pendant 3 heures. Après retour à température ambiante, le mélange réactionnel est concentré sous pression réduite puis repris avec de l'eau. Le pH de la phase aqueuse est amené à 8 par ajout d'une solution aqueuse d'ammoniaque à 28 % et la phase aqueuse est extraite avec du dichloromethane. La phase organique est alors séchée sur sulfate de magnésium puis concentrée sous pression réduite. On obtient ainsi 300 mg de 2, 4-dichloro-6-nitro-quinoléine sous forme d'une poudre jaune dont le spectre de masse est le suivant : EI(70eV) m/z=242 M+- pic de base, massif isotopique du pic dichloré m/z=212 [M - NO]+ massif isotopique du pic dichloré m/z=196 [M - N02]+ massif isotopique du pic dichloré m/z=184 [M - CN02]+massif isotopique du pic dichloré m/z=161 [196 - Cl]+"massif isotopique du pic monochloré Le 6-nitro-quinoléine-2, 4-diol peut être préparé de la façon suivante : 500 mg de 2, 4-quinoléinediol sont placés en solution dans 6 mL d'acide sulfurique concentré à 0°C. 314 mg de nitrate de potassium est alors additionné et le mélange réactionnel est agité à 0°C pendant 1 heure puis une nuit à température ambiante. Il est ensuite jeté dans un mélange eau-glace et le pH de la solution aqueuse ainsi obtenue est amenée à pH 7 par ajout d'une solution aqueuse d'ammoniaque à 28 %. La phase aqueuse est alors extraite avec du dichloromethane et la phase organique résultante est lavée avec de l'eau : un précipité se forme dans la phase organique qui est récupéré par filtration et séché sous pression réduite. On obtient alors 357 mg de 6-nitro-quinoléine- 2,4-diol sous forme d'une poudre jaune dont le spectre de masse est le suivant :2,4-dichloro-6-nitro-quinoline can be prepared as follows: A solution of 500 mg of 6-nitro-quinoline-2,4-diol in 10 ml of P0C1 3 is brought to reflux for 3 hours . After returning to ambient temperature, the reaction mixture is concentrated under reduced pressure and then taken up with water. The pH of the aqueous phase is brought to 8 by adding a 28% aqueous ammonia solution and the aqueous phase is extracted with dichloromethane. The organic phase is then dried over magnesium sulfate and then concentrated under reduced pressure. 300 mg of 2,4-dichloro-6-nitro-quinoline are thus obtained in the form of a yellow powder, the mass spectrum of which is as follows: EI (70eV) m / z = 242 M + - base peak, massive isotopic of the dichlorinated peak m / z = 212 [M - NO] + isotopic mass of the dichlorinated peak m / z = 196 [M - N0 2 ] + isotopic mass of the dichlorinated peak m / z = 184 [M - CN0 2 ] + solid isotopic of the dichlorinated peak m / z = 161 [196 - Cl] + "isotopic mass of the monochlorinated peak The 6-nitro-quinoline-2,4-diol can be prepared in the following way: 500 mg of 2,4-quinolinediol are placed in solution in 6 ml of concentrated sulfuric acid at 0 ° C. 314 mg of potassium nitrate is then added and the reaction mixture is stirred at 0 ° C for 1 hour and then overnight at room temperature. It is then thrown into a water-ice mixture and the pH of the aqueous solution thus obtained is brought to pH 7 by addition of a 28% aqueous ammonia solution. The aqueous phase is then extracted with dichloromethane and the resulting organic phase is washed with water: a precipitate forms in the organic phase which is recovered by filtration and dried under reduced pressure. 357 mg of 6-nitro-quinoline-2,4-diol is then obtained in the form of a yellow powder, the mass spectrum of which is as follows:
EI(70eV) m/z=206 M+' m/z=176 [M - NO]+ m/z=160 [M - N02] + m/z=36 [HC1]+- pic de base, présence de HC1 dans le milieu o La 4-diméthylamino-2-méthylamino-quinoléin-6- amine (A5/B5/C5) peut être préparée en opérant de la manière suivante : 150 mg de 4-diméthylamino-2-méthylamino-6-nitro- quinoléine en solution dans 4 mL d'un mélange méthanol- dichlorométhane (3/1 en volumes) est placée sous atmosphère d'hydrogène (5 bars) en présence de 20 mg de palladium sur charbon à 10 % pendant 12 heures. Après filtration sur célite, le filtrat est concentré sous pression réduite. On obtient ainsi 122 mg de 4-diméthylamino-2-méthylamino-quinoléin-6-amine sous forme de chlorhydrate dont les caractéristiques sont les suivantes : Spectre de R.M.N. XH (300 MHz, (CD3) SO d6, δ en ppm) : 3,02 (s : 3H) ; 3,05 (s : 6H) ; 5,44 (mf : 2H) ;EI (70eV) m / z = 206 M + 'm / z = 176 [M - NO] + m / z = 160 [M - N0 2 ] + m / z = 36 [HC1] + - base peak, presence of HC1 in the medium o 4-dimethylamino-2-methylamino-quinoline-6-amine (A5 / B5 / C5) can be prepared by operating as follows: 150 mg of 4-dimethylamino-2-methylamino-6- Nitroquinoline in solution in 4 mL of a methanol-dichloromethane mixture (3/1 by volume) is placed under a hydrogen atmosphere (5 bars) in the presence of 20 mg of palladium on carbon at 10% for 12 hours. After filtration on celite, the filtrate is concentrated under reduced pressure. 122 mg of 4-dimethylamino-2-methylamino-quinoline-6-amine are thus obtained in the form of the hydrochloride, the characteristics of which are as follows: NMR spectrum X H (300 MHz, (CD 3) SO d6, δ in ppm): 3.02 (s: 3H); 3.05 (s: 6H); 5.44 (mf: 2H);
6,10 (s : 1H) ; 7,03 (dd, J = 9 et 2,5 Hz : 1H) ; 7,106.10 (s: 1H); 7.03 (dd, J = 9 and 2.5 Hz: 1H); 7.10
(d, J = 2,5 Hz : 1H) ; 7,64 (d, J = 9 Hz : 1H) ; 8,27 (mf : 1H) ;11,97 (mf étalé : 1H) .(d, J = 2.5 Hz: 1H); 7.64 (d, J = 9 Hz: 1H); 8.27 (mf: 1H); 11.97 (spread mf: 1H).
Spectre de masseMass spectrum
EI ( 70eV) m/z=216 M+" pic de base m/z=187 [M - NCH3] +- m/z=172 [ 187 - CH3 ] + EI (70eV) m / z = 216 M + "base peak m / z = 187 [M - NCH 3 ] + - m / z = 172 [187 - CH 3 ] +
La 4-diméthylamino-2-méthylamino-6-nitro-quinoléine peut être préparée de la façon suivante : 188 mg de 4-chloro-2-méthylamino-6-nitro-quinoléine est mise en solution dans 8 L de DMF en présence de 546 mg de carbonate de potassium et de 645 mg de chlorhydrate de diméthylammonium. Le mélange réactionnel est agité à 100 °C pendant 10 heures. Après retour à température ambiante, il est hydrolyse par ajout d'eau et la phase aqueuse ainsi obtenue est extraite avec du dichloromethane. La phase organique est séchée sur sulfate de magnésium puis concentrée sous pression réduite. On obtient ainsi 150 mg de 4-diméthylamino-2- méthylamino-6-nitro-quinoléine sous forme d'une poudre jaune dont le spectre de masse est le suivant :4-Dimethylamino-2-methylamino-6-nitro-quinoline can be prepared as follows: 188 mg of 4-chloro-2-methylamino-6-nitro-quinoline is dissolved in 8 L of DMF in the presence of 546 mg of potassium carbonate and 645 mg of dimethylammonium hydrochloride. The reaction mixture is stirred at 100 ° C for 10 hours. After returning to ambient temperature, it is hydrolyzed by adding water and the aqueous phase thus obtained is extracted with dichloromethane. The organic phase is dried over magnesium sulfate and then concentrated under reduced pressure. 150 mg of 4-dimethylamino-2-methylamino-6-nitro-quinoline are thus obtained in the form of a yellow powder, the mass spectrum of which is as follows:
EI(70eV) m/z=246 M+" pic de base m/z=217 [M - NCH3]+"EI (70eV) m / z = 246 M + "base peak m / z = 217 [M - NCH 3 ] + "
La 4-chloro-2-méthylamino-6-nitro-quinoléine peut être préparée de la façon suivante : 600 mg de 2,4- dichloro-6-nitro-quinoléine est mis en solution dans 10 mL de THF en présence de 2.15 mL d'une solution 2M de diméthylamine dans le THF. Le mélange réactionnel est agité à 90 °C pendant 3 heures. Après retour à température ambiante, le milieu réactionnel est concentré sous pression réduite. Une fraction du résidu obtenu est purifié par HPLC sur une colonne Chromasil (C18, 5 μM, 100x20mm) avec un mélange eau-acétonitrile contenant 0.07 % de TFA (gradient 95/5 à 60/40 en volumes en 20 minutes à un débit de 20 L/min) comme éluant. On obtient 188 mg de (4-chloro-2-méthylamino-6-nitro- quinoléine sous forme d'une poudre jaune dont le spectre de masse est le suivant :4-chloro-2-methylamino-6-nitro-quinoline can be prepared as follows: 600 mg of 2,4-dichloro-6-nitro-quinoline is dissolved in 10 mL of THF in the presence of 2.15 mL of a 2M solution of dimethylamine in THF. The reaction mixture is stirred at 90 ° C for 3 hours. After returning to ambient temperature, the reaction medium is concentrated under reduced pressure. A fraction of the residue obtained is purified by HPLC on a Chromasil column (C18, 5 μM, 100x20mm) with a water-acetonitrile mixture containing 0.07% TFA (gradient 95/5 to 60/40 by volume in 20 minutes at a flow rate of 20 L / min) as eluent. 188 mg of (4-chloro-2-methylamino-6-nitroquinoline) are obtained in the form of a yellow powder, the mass spectrum of which is as follows:
EI(70eV) m/z=237 M+" pic de base, massif isotopique du pic monochloré m/z=208 [M - NCH3]+*massif isotopique du pic monochloréEI (70eV) m / z = 237 M + "base peak, isotopic mass of the monochlorine peak m / z = 208 [M - NCH 3 ] + * isotopic mass of the monochlorine peak
La 2, 4-dichloro-6-nitro-quinoléine peut être préparée comme décrit à l'exemple précédent. o La 4-diméthylamino-2-méthyl-quinoléin-7-amine (A6/B6/C6) peut être préparée en opérant de la manière suivante :2,4-dichloro-6-nitro-quinoline can be prepared as described in the previous example. o 4-dimethylamino-2-methyl-quinoline-7-amine (A6 / B6 / C6) can be prepared by operating as follows:
A 52 mg de la N7-benzhydrylidène-4-diméthylamino-2- méthyl-quinoléin-7-amine en solution dans 500 μL de THF, est additionné 25 μL d'une solution aqueuse d'acide chlorhydrique 2M. Après 2 heures d'agitation à température ambiante, le mélange réactionnel est additionné d'une solution aqueuse d'acide chlorhydrique 0.5M et lavé par un mélange acétate d' éthyle-cyclohexane (1/2 en volumes) . La phase aqueuse est ensuite amenée à pH 8 par ajout d'une solution aqueuse de soude IM puis extraite avec du dichloromethane. La phase organique ainsi obtenue est séchée sur sulfate de magnésium puis concentrée sous pression réduite. On obtient ainsi 29 mg de 4-diméthylamino-2-méthyl-quinoléin-7-amine sous forme d'une huile beige dont les caractéristiques sont les suivantes :A 52 mg of N7-benzhydrylidene-4-dimethylamino-2-methyl-quinolin-7-amine dissolved in 500 μL of THF is added 25 μL of an aqueous solution of 2M hydrochloric acid. After 2 hours of stirring at room temperature, the reaction mixture is added with an aqueous 0.5M hydrochloric acid solution and washed with an ethyl acetate-cyclohexane mixture (1/2 by volume). The aqueous phase is then brought to pH 8 by adding an aqueous solution of IM sodium hydroxide and then extracted with dichloromethane. The organic phase thus obtained is dried over magnesium sulfate and then concentrated under reduced pressure. 29 mg of 4-dimethylamino-2-methyl-quinoline-7-amine are thus obtained in the form of a beige oil, the characteristics of which are as follows:
Spectre de R.M.N. ^H . (300 MHz, (CD3)2SO d6, δ en ppm) : 2,45 (s : 3H) ; 2,91 (s : 6H) ; 5,53 (s : 2H) ; 6, 45 ( s : 1H) ; de 6, 75 à 6, 90 (mt : 2H) ; 7 , 70 ( d, J = 9 Hz : 1H) .1 H NMR spectrum. (300 MHz, (CD 3 ) 2 SO d6, δ in ppm): 2.45 (s: 3H); 2.91 (s: 6H); 5.53 (s: 2H); 6.45 (s: 1H); from 6.75 to 6.70 (mt: 2H); 7.70 (d, J = 9 Hz: 1H).
Spectre de masse : EI(70eV) m/z=201 M+- pic de base m/z=186 [M - CH3] + m/z=158 [M - NC2H5]+-Mass spectrum: EI (70eV) m / z = 201 M + - base peak m / z = 186 [M - CH 3 ] + m / z = 158 [M - NC 2 H 5 ] + -
La N7-benzhydrylidène-4-diméthylamino-2-méthyl- quinoléin-7-aminé peut être préparée de la façon suivante : 100 mg de 7-chloro-4-diméthylamino-2-méthyl- quinoléine en mélange avec la 5-chloro-4-diméthylamino-2- méthyl-quinoléine dans des proportions 70/30 (en mole), en solution dans 2 mL de 1, 2-diméthoxyéthane est additionné à un mélange de 41.2 mg de tris (dibenzylidèneacetone) dipalladium, 35.4 mg de 2-cyclohexylphosphino-2' (N,N-diméthylamino) -biphényl et 221.2 mg de carbonate de césium sous argon. 90.6 μL de benzophénone imine est alors additionné et le mélange réactionnel est chauffé à 100 °C pendant 72 heures. Après retour à température ambiante, le milieu réactionnel est hydrolyse par ajout d'eau et la phase aqueuse ainsi obtenue est extraite avec du dichloromethane. La phase organique est alors séchée sur sulfate de magnésium, puis concentrée sous pression réduite. Après chromatographie sur colonne de silice avec un mélange dichlorométhane- méthanol (gradient 100/0 à 94/6 en volumes) comme éluant, on obtient 52 mg de N7-benzhydrylidène-4-diméthylamino-2- méthyl-quinoléin-7-amine sous forme d'un solide beige dont le spectre de masse est le suivant :N7-benzhydrylidene-4-dimethylamino-2-methyl-quinoline-7-amino can be prepared in the following way: 100 mg of 7-chloro-4-dimethylamino-2-methyl-quinoline in mixture with 5-chloro- 4-dimethylamino-2-methyl-quinoline in proportions 70/30 (in mole), in solution in 2 ml of 1, 2-dimethoxyethane is added to a mixture of 41.2 mg of tris (dibenzylideneacetone) dipalladium, 35.4 mg of 2 -cyclohexylphosphino-2 '(N, N-dimethylamino) -biphenyl and 221.2 mg of cesium carbonate under argon. 90.6 μL of benzophenone imine is then added and the reaction mixture is heated at 100 ° C for 72 hours. After returning to ambient temperature, the reaction medium is hydrolyzed by adding water and the aqueous phase thus obtained is extracted with dichloromethane. The organic phase is then dried over magnesium sulphate, then concentrated under reduced pressure. After chromatography on a silica column with a dichloromethane-methanol mixture (gradient 100/0 to 94/6 by volume) as eluent, 52 mg of N7-benzhydrylidene-4-dimethylamino-2-methyl-quinoline-7-amine are obtained under form of a beige solid whose mass spectrum is as follows:
EI(70eV) m/z=365 M+- m/z=364 [M - H]+ pic de base m/z=288 [M - C6H5] + EI (70eV) m / z = 365 M + - m / z = 364 [M - H] + base peak m / z = 288 [M - C 6 H 5 ] +
La 7-chloro-4-diméthylamino-2-méthyl-quinoléine peut être préparée de la façon suivante : 500 mg de 4, 7-dichloro-2-méthyl-quinoléine en mélange avec la 4, 5-dichloro-2-méthyl-quinoléine dans les proportions 70/30 (en mole) , est mis en solution dans 12 mL de DMF en présence de 1.63 g de carbonate de potassium et de 1.96 g de chlorhydrate de diméthylammonium. Le mélange réactionnel est agité à 100 °C pendant 3 heures. Après retour à température ambiante, l'insoluble est éliminé par filtration et le filtrat est concentré sous pression réduite. Le résidu est hydrolyse par ajout d'eau et la phase aqueuse ainsi obtenue est extraite avec du dicholorométhane. La phase organique est ensuite séchée sur sulfate de magnésium puis concentrée sous pression réduite. On obtient ainsi 623 mg de 7-chloro-4- diméthylamino-2-méthyl-quinoléine en mélange avec la 5-chloro-4-diméthylamino-2-méthyl-quinoléine dans des proportions 70/30 sous forme d'une huile orange dont le spectre de masse est le suivant :7-chloro-4-dimethylamino-2-methyl-quinoline can be prepared as follows: 500 mg of 4, 7-dichloro-2-methyl-quinoline mixed with 4, 5-dichloro-2-methyl-quinoline in the proportions 70/30 (in mole), is dissolved in 12 ml of DMF in the presence of 1.63 g of potassium carbonate and 1.96 g of dimethylammonium hydrochloride. The reaction mixture is stirred at 100 ° C for 3 hours. After returning to ambient temperature, the insoluble material is removed by filtration and the filtrate is concentrated under reduced pressure. The residue is hydrolyzed by adding water and the aqueous phase thus obtained is extracted with dicholoromethane. The organic phase is then dried over magnesium sulfate and then concentrated under reduced pressure. 623 mg of 7-chloro-4-dimethylamino-2-methyl-quinoline are thus obtained in mixture with 5-chloro-4-dimethylamino-2-methyl-quinoline in proportions 70/30 in the form of an orange oil of which the mass spectrum is as follows:
EI(70eV) m/z=220 M+' pic de base, massif isotopique du pic monochloré m/z=184 .[M - HC1]+- m/z=169 [184 - CH3] + EI (70eV) m / z = 220 M + 'base peak, isotopic mass of the monochlorine peak m / z = 184 . [M - HC1] + - m / z = 169 [184 - CH 3 ] +
La 4, 7-dichloro-2-méthyl-quinoléine peut être préparée de la façon suivante : Une solution de 500 mg de 7-chloro-2-méthyl-quinolin-4-ol, en mélange avec le 5-chloro-2-méthyl-quinolin-4-ol dans des proportions 70/30 (en mole), dans 7.6 mL de P0C13 est portée au reflux pendant 3 heures . Après retour à température ambiante, le mélange réactionnel est concentré sous pression réduite puis repris avec de l'eau. Le pH de la phase aqueuse est amené à 8 par ajout d'une solution aqueuse saturée en hydrogénocarbonate de sodium et le précipité ainsi obtenu est récupéré par filtration, lavé avec de l'eau puis séché sous pression réduite. On obtient ainsi 539 mg de 4, 7-dichloro-2-méthyl-quinoléine en mélange avec la 4, 5-dichloro-2-méthyl-quinoléine dans les proportions 70/30 (en mole) sous forme d'un solide violet dont le spectre de masse est le suivant :4, 7-dichloro-2-methyl-quinoline can be prepared as follows: A 500 mg solution of 7-chloro-2-methyl-quinolin-4-ol, mixed with 5-chloro-2- methyl-quinolin-4-ol in proportions 70/30 (in mole), in 7.6 mL of P0C1 3 is brought to reflux for 3 hours. After returning to ambient temperature, the reaction mixture is concentrated under reduced pressure and then taken up with water. The pH of the aqueous phase is brought to 8 by adding a saturated aqueous solution of sodium hydrogencarbonate and the precipitate thus obtained is recovered by filtration, washed with water and then dried under reduced pressure. 539 mg of 4,7-dichloro-2-methyl-quinoline are thus obtained as a mixture with 4, 5-dichloro-2-methyl-quinoline in the proportions 70/30 (in mole) in the form of a purple solid whose mass spectrum is as follows:
EI(70eV) m/z=211 M+' pic de base, massif isotopique du pic dichloré m/z=176 [M - Cl]+ massif isotopique du pic monochloré m/z=140 [176 - Cl]+ EI (70eV) m / z = 211 M + 'base peak, isotopic massif of the dichlorinated peak m / z = 176 [M - Cl] + isotopic massif of the monochlorinated peak m / z = 140 [176 - Cl] +
Le 7-chloro-2-méthyl-quinolin-4-ol peut être préparé comme décrit dans les brevets EP 97585 et EP 56765.7-chloro-2-methyl-quinolin-4-ol can be prepared as described in patents EP 97585 and EP 56765.
o La 6-diméthylamino-phénanthridin-2-aminé (Cl4) peut être préparée en opérant de la manière suivante :o 6-dimethylamino-phenanthridin-2-amine (Cl4) can be prepared by operating as follows:
210 mg de 6-diméthylamino-2-nitro-phénanthridine en solution dans 5 mL d'un mélange méthanol-dichlorométhane210 mg of 6-dimethylamino-2-nitro-phenanthridine in solution in 5 mL of a methanol-dichloromethane mixture
(3/1 en volumes) est placée sous atmosphère d'hydrogène(3/1 by volume) is placed under a hydrogen atmosphere
(5 bars) en présence de 20 mg de palladium sur charbon à(5 bars) in the presence of 20 mg of palladium on carbon at
10% pendant 12 heures. Après filtration sur célite, le filtrat est concentré sous pression réduite. On obtient ainsi 186 mg de 6-diméthylamino-phénanthridin-2-amine sous forme d'une mousse jaune dont les caractéristiques sont les suivantes :10% for 12 hours. After filtration on celite, the filtrate is concentrated under reduced pressure. 186 mg of 6-dimethylamino-phenanthridin-2-amine are thus obtained in the form of a yellow foam, the characteristics of which are as follows:
Spectre de R.M.N. 3-H (300 MHz, (CD3)2SO d6, δ en ppm) : 3,07 (s : 6H) ; de 5,50 à 6,50 (mf très étalé : 2H) ; 7,05 (dd, J = 9 et 2,5 Hz : 1H) ; 7,64 (d, J ≈ 9 Hz : 1H) ; 7,65 (d, J = 2,5 Hz : 1H) ; 7,71 (t large, J = 8 Hz : 1H) ; 7,87 (t large, J = 8 Hz : 1H) ; 8,25 (d large, J ≈ 8 Hz : 1H) ; 8,47 (d large, J = 8 Hz : 1H) .3-H NMR spectrum (300 MHz, (CD 3 ) 2 SO d6, δ in ppm): 3.07 (s: 6H); from 5.50 to 6.50 (very spread mf: 2H); 7.05 (dd, J = 9 and 2.5 Hz: 1H); 7.64 (d, J ≈ 9 Hz: 1H); 7.65 (d, J = 2.5 Hz: 1H); 7.71 (broad t, J = 8 Hz: 1H); 7.87 (wide t, J = 8 Hz: 1H); 8.25 (broad d, J ≈ 8 Hz: 1H); 8.47 (large d, J = 8 Hz: 1H).
Spectre de masse : EI(70eV) m/z=237 M+" pic de base m/z=222 [M - CH3] + m/z=208 [222 - CH2] + m/z=194 [M - NC2H5] + La 6-diméthylamino-2-nitro-phénanthridine peut être préparée de la façon suivante : 211 mg de 6-chloro-2- nitro-phénanthridine est mise en solution dans 4 mL de DMF en présence de 600 mg de carbonate de potassium et de 711 mg de chlorhydrate de diméthylammonium. Le mélange réactionnel est agité à 100 °C pendant 3 heures. Après retour à température ambiante, il est hydrolyse par ajout d'eau et la phase aqueuse ainsi obtenue est extraite avec du dichloromethane. La phase organique est séchée sur sulfate de magnésium puis concentrée sous pression réduite. On obtient ainsi 211 mg de 6-diméthylamino-2- nitro-phénanthridine sous forme d'une poudre jaune dont le spectre de masse est le suivant :Mass spectrum: EI (70eV) m / z = 237 M + "base peak m / z = 222 [M - CH 3 ] + m / z = 208 [222 - CH 2 ] + m / z = 194 [M - NC 2 H 5 ] + 6-Dimethylamino-2-nitro-phenanthridine can be prepared as follows: 211 mg of 6-chloro-2-nitro-phenanthridine is dissolved in 4 ml of DMF in the presence of 600 mg of potassium carbonate and 711 mg of dimethylammonium hydrochloride. The reaction mixture is stirred at 100 ° C for 3 hours. After returning to ambient temperature, it is hydrolyzed by adding water and the aqueous phase thus obtained is extracted with dichloromethane. The organic phase is dried over magnesium sulfate and then concentrated under reduced pressure. 211 mg of 6-dimethylamino-2-nitro-phenanthridine are thus obtained in the form of a yellow powder, the mass spectrum of which is as follows:
EI(70eV) m/z=267 M+- m/z=266 [M - H]+ pic de base m/z=252 [M - CH3] + m/z=220 [266 - N02] + m/z=177 [220 - NC2H5] + EI (70eV) m / z = 267 M + - m / z = 266 [M - H] + base peak m / z = 252 [M - CH 3 ] + m / z = 220 [266 - N0 2 ] + m / z = 177 [220 - NC 2 H 5 ] +
La 6-chloro-2-nitro-phénanthridine peut être préparée de la façon suivante : Une solution de 200 mg de6-chloro-2-nitro-phenanthridine can be prepared as follows: A solution of 200 mg of
2-nitro-6 (5H) -phénantridinone dans 2 mL de P0C13 est portée au reflux pendant 3 heures. Après retour à température ambiante, le mélange réactionnel est additionné de cyclohexane jusqu'à l'obtention d'un précipité qui est récupéré par filtration puis repris avec de l'eau. Le pH de la phase aqueuse ainsi obtenue est amenée à 8 par ajout d'une solution aqueuse d'ammoniaque à 28 % et le précipité résultant est récupéré par filtration, lavé avec de l'eau puis séché sous pression réduite. On obtient ainsi 215 mg de2-nitro-6 (5H) -phenanthridinone in 2 mL of P0C1 3 is brought to reflux for 3 hours. After returning to room temperature, the reaction mixture is added with cyclohexane until a precipitate is obtained which is recovered by filtration and then taken up with water. The pH of the aqueous phase thus obtained is brought to 8 by adding a 28% aqueous ammonia solution and the resulting precipitate is recovered by filtration, washed with water and then dried under reduced pressure. 215 mg of
6-chloro-2-nitro-phénanthridine sous forme d'une poudre blanche dont le spectre de masse est le suivant :6-chloro-2-nitro-phenanthridine in the form of a white powder with a mass spectrum as follows:
EI(70eV) m/z=258 M+" pic de base, massif isotopique du pic monochloré m/z=228 [M - NO]+ massif isotopique du pic monochloré m/z=212 [M - N02]+ massif isotopique du pic monochloré m/z=200 [M - CN02]+massif isotopique du pic monochloré m/z=177 [212 - Cl]+-EI (70eV) m / z = 258 M + "base peak, isotopic mass of the monochlorine peak m / z = 228 [M - NO] + isotopic mass of the monochlorine peak m / z = 212 [M - N0 2 ] + isotopic mass of the monochlorine peak m / z = 200 [M - CN0 2 ] + isotopic mass of the monochlorine peak m / z = 177 [212 - Cl] + -
o La • l-diméthylamino-isoquinoléin-7-amine (C15) peut être préparée en opérant de la manière suivante :o • l-Dimethylamino-isoquinoline-7-amine (C15) can be prepared by operating as follows:
390 mg de l-diméthylamino-7-nitro-isoquinoléine en mélange avec la l-diméthylamino-5-nitro-isoquinoléine dans des proportions 40/60 (en mole) en solution dans 8 mL d'un mélange méthanol-dichlorométhane (3/1 en volumes) est placée sous atmosphère d'hydrogène (5 bars) en présence de 40 mg de palladium sur charbon à 10 % pendant 12 heures. Après filtration sur célite, le filtrat est concentré sous pression réduite. Après chromatographie sur colonne de silice avec un mélange cyclohexane-isopropanol (gradient 100/0 à 90/10 en volumes) comme éluant, on obtient 50 mg de l-diméthylamino-isoquinoléin-7-amine sous forme d'une poudre marron dont les caractéristiques sont les suivantes : Spectre de R.M.N. ^R (300 MHz, (CD3)2SO d6, δ en ppm) : 2,91 (s : 6H) ; 5,57 (s large : 2H) ; de 7,05 à 7,20 (mt : 3H) ; 7,56 (d, J = 9 Hz : 1H) ; 7,74 (d, J = 6 Hz : 1H) .390 mg of l-dimethylamino-7-nitro-isoquinoline in mixture with l-dimethylamino-5-nitro-isoquinoline in proportions 40/60 (in mole) dissolved in 8 ml of a methanol-dichloromethane mixture (3 / 1 by volume) is placed under a hydrogen atmosphere (5 bars) in the presence of 40 mg of palladium on carbon at 10% for 12 hours. After filtration on celite, the filtrate is concentrated under reduced pressure. After chromatography on a silica column with a cyclohexane-isopropanol mixture (gradient 100/0 to 90/10 by volume) as eluent, 50 mg of l-dimethylamino-isoquinoline-7-amine is obtained in the form of a brown powder, the characteristics are as follows: NMR spectrum R (300 MHz, (CD 3 ) 2 SO d6, δ in ppm): 2.91 (s: 6H); 5.57 (br s: 2H); from 7.05 to 7.20 (mt: 3H); 7.56 (d, J = 9 Hz: 1H); 7.74 (d, J = 6 Hz: 1H).
Spectre de masse : EI(70eV) m/z=187 M+> m/z=186 [M - H]+ m/z=172 [M - CH3 ] + m/z=158 [ 172 - CH2] + pic de base m/z=144 [M - C2H5N] + m/ z=116 [ 144 - CH2N ] +Mass spectrum: EI (70eV) m / z = 187 M +> m / z = 186 [M - H] + m / z = 172 [M - CH 3 ] + m / z = 158 [172 - CH 2 ] + base peak m / z = 144 [M - C 2 H 5 N] + m / z = 116 [144 - CH 2 N] +
La l-diméthylamino-7-nitro-isoquinoléine peut être préparée de la façon suivante : 375 mg de l-chloro-7- nitro-isoquinoléine en mélange avec la l-chloro-5-nitro- isoquinoléine dans des proportions 40/60 (en mole) est mis en solution dans 6 mL de DMF en présence de 1.24 g de carbonate de potassium et de 1.46 g de chlorhydrate de diméthylammonium. Le mélange réactionnel est agité à 100 °C pendant 3 heures. Après retour à température ambiante, il est hydrolyse par ajout d'eau et la phase aqueuse ainsi obtenue est extraite avec du dichloromethane. La phase organique est séchée sur sulfate de magnésium puis concentrée sous pression réduite. On obtient ainsi 390 mg de 1-diméthylamino-7- nitro-isoquinoléine en mélange avec la l-diméthylamino-5- nitro-isoquinoléine dans des proportions 40/60 (en mole) sous forme d'une poudre rouge dont le spectre de masse est le suivant :L-dimethylamino-7-nitro-isoquinoline can be prepared as follows: 375 mg of l-chloro-7-nitro-isoquinoline in mixture with l-chloro-5-nitro-isoquinoline in proportions 40/60 ( in moles) is dissolved in 6 ml of DMF in the presence of 1.24 g of potassium carbonate and 1.46 g of dimethylammonium hydrochloride. The reaction mixture is stirred at 100 ° C for 3 hours. After returning to ambient temperature, it is hydrolyzed by adding water and the aqueous phase thus obtained is extracted with dichloromethane. The organic phase is dried over magnesium sulfate and then concentrated under reduced pressure. 390 mg of 1-dimethylamino-7-nitro-isoquinoline is thus obtained mixed with l-dimethylamino-5-nitro-isoquinoline in proportions 40/60 (in mole) in the form of a red powder whose mass spectrum is the next :
E EII((7700eeVV)) mm//zz==2217 M+- mm//zz==221166 [ [MM -- H H]]++ pic de base m/z=202 [M - CH3] + m/z=188 [ 202 - CH2] + m/z=170 [ 216 - N02] + m/ z=156 [ 170 - CH2 ] + E EII ((7700eeVV)) mm // zz == 2217 M + - mm // zz == 221166 [[MM - HH]] ++ base peak m / z = 202 [M - CH 3 ] + m / z = 188 [202 - CH 2 ] + m / z = 170 [216 - N0 2 ] + m / z = 156 [170 - CH 2 ] +
La l-chloro-7-nitro-isoquinoléine peut être préparée de la façon suivante : Une solution de 580 mg de 7-nitro- isoquinolin-1-ol, en mélange avec le 5-nitro-isoquinolin- l-ol dans des proportions 40/60 (en mole) , dans 6 mL de POCI3 est portée au reflux pendant 3 heures. Après retour à température ambiante, le mélange réactionnel est additionné de cyclohexane jusqu'à l'obtention d'un précipité qui est récupéré par filtration puis repris avec de l'eau. Le pH de la phase aqueuse ainsi obtenue est amenée à 8 - par ajout d'une solution aqueuse d'ammoniaque à 28 % et le précipité résultant est récupéré par filtration, lavé avec de l'eau puis séché sous pression réduite. On obtient ainsi 412 mg de l-chloro-7-nitro-isoquinoléine en mélange avec la l-chloro-5-nitro-isoquinoléine dans des proportions 40/60 (en mole) sous forme d'une poudre blanche dont le spectre de masse est le suivant :L-chloro-7-nitro-isoquinoline can be prepared as follows: A solution of 580 mg of 7-nitro-isoquinolin-1-ol, mixed with 5-nitro-isoquinolin-1-ol in proportions 40/60 (in moles), in 6 mL of POCI 3 is brought to reflux for 3 hours. After returning to room temperature, the reaction mixture is added with cyclohexane until a precipitate is obtained which is recovered by filtration and then taken up with water. The pH of the aqueous phase thus obtained is brought to 8 - by adding an aqueous solution of 28% ammonia and the resulting precipitate is recovered by filtration, washed with water and then dried under reduced pressure. 412 mg of l-chloro-7-nitro-isoquinoline are thus obtained in mixture with l-chloro-5-nitro-isoquinoline in proportions 40/60 (in mole) in the form of a white powder whose mass spectrum is the next :
EI ( 70eV) m/ z=208 M+- pic de base m/ z=178 [M - NO] +- m/z=173 [M - Cl ] + m/z=162 [M - N02 ] +" m/ z=150 [ 178 -co] +- m/z=126 [ 173 - HN02] ' m/z=99 [ 126 - HCN] + EI (70eV) m / z = 208 M + - base peak m / z = 178 [M - NO] + - m / z = 173 [M - Cl] + m / z = 162 [M - N0 2 ] + "m / z = 150 [178 -co] + - m / z = 126 [173 - HN0 2 ] ' m / z = 99 [126 - HCN] +
Le 7-nitro-isoquinolin-l-ol peut être préparé de la façon suivante : 500 mg de 1-isoquinolinol sont placés en solution dans 5 mL d'acide sulfurique concentré à 0°C. 348 mg de nitrate de potassium est alors additionné et le mélange réactionnel est agité à 0°C pendant 1 heure puis une nuit à température ambiante. Il est ensuite jeté dans un mélange eau-glace et le pH de la solution aqueuse ainsi obtenue est amenée à pH 8 par ajout d'une solution aqueuse d'ammoniaque à 28 %. Le précipité obtenu est récupéré par filtration, lavé avec de l'eau puis séché sous pression réduite. On obtient alors 580 mg de 7-nitro-isoquinolin-l-ol en mélange avec le 5-nitro- isoquinolin-1-ol dans des proportion 40/60 (en mole) sous forme d'une poudre jaune dont le spectre de masse est le suivant : DCI(NH3) m/z=208 MNH4 + m/z=l91 MH+ m/z=161 [M - NO]+ m/z=146 M'H+ correspond au départ o La 4-diméthylamino-2-méthyl-quinoléin-6-N- méthylamine (C16) peut être préparée en opérant de la manière suivante :7-nitro-isoquinolin-1-ol can be prepared as follows: 500 mg of 1-isoquinolinol are placed in solution in 5 ml of concentrated sulfuric acid at 0 ° C. 348 mg of potassium nitrate is then added and the reaction mixture is stirred at 0 ° C for 1 hour and then overnight at room temperature. It is then thrown into a water-ice mixture and the pH of the aqueous solution thus obtained is brought to pH 8 by addition of a 28% aqueous ammonia solution. The precipitate obtained is recovered by filtration, washed with water and then dried under reduced pressure. 580 mg of 7-nitro-isoquinolin-1-ol is then obtained in mixture with 5-nitro-isoquinolin-1-ol in proportions 40/60 (in mole) in the form of a yellow powder whose mass spectrum is as follows: DCI (NH 3 ) m / z = 208 MNH 4 + m / z = l91 MH + m / z = 161 [M - NO] + m / z = 146 M'H + corresponds to the start o 4-dimethylamino-2-methyl-quinoline-6-N-methylamine (C16) can be prepared by operating as follows:
170 mg de 4-diméthylamino-2-méthyl-quinoléin-6-N- méthyl-acétamide est porté au reflux dans 3 mL d'un mélange d'une solution d'acide chlorhydrique concentrée à 37 % / -eau (2/1 en volumes) pendant 2 heures. Après retour à' température ambiante, le pH est amené à 8 par ajout d'une solution aqueuse d'ammoniaque à 28 % et la phase aqueuse est extraite avec du dichloromethane. La phase organique est séchée sur sulfate de magnésium puis concentrée sous pression réduite. On obtient ainsi 120 mg de 4-diméthylamino-2-méthyl-quinoléin-6-N-méthylamine sous forme d'une huile jaune dont les caractéristiques sont les suivantes :170 mg of 4-dimethylamino-2-methyl-quinoline-6-N-methyl-acetamide is brought to reflux in 3 ml of a mixture of a concentrated hydrochloric acid solution at 37% / -water (2/1 by volume) for 2 hours. After returning to ambient temperature, the pH is brought to 8 by adding an aqueous solution of 28% aqueous ammonia and the aqueous phase is extracted with dichloromethane. The organic phase is dried over magnesium sulfate and then concentrated under reduced pressure. 120 mg of 4-dimethylamino-2-methyl-quinoline-6-N-methylamine are thus obtained in the form of a yellow oil, the characteristics of which are as follows:
Spectre de R.M.N. !H ( 300 MHz , (CD3 ) 2SO d6 , δ en ppm) : 2,48 (s : 3H) ; 2 , 79 (d, J = 5 Hz : 3H) / 2 , 89 (s : 6H) ; 6,00 (q, J = 5 Hz : IH) ; 6, 71 (mt : 2H ) r 7,06 (dd, J = 9 et 2,5 H Hzz : IH) ; 7 ( 57 (d, J = 9 Hz " IH) .1 H NMR spectrum (300 MHz, (CD 3 ) 2 SO d6, δ in ppm): 2.48 (s: 3H); 2.79 (d, J = 5 Hz: 3H) / 2.89 (s: 6H); 6.00 (q, J = 5 Hz: 1 H); 6.71 (mt: 2H) r 7.06 (dd, J = 9 and 2.5H Hzz: 1H); 7 ( 57 (d, J = 9 Hz "1H).
Spectre de masse : EI(70eV) m/z=215 M+" pic de base m/z=200 [M - CH3] + m/z=185 [M - NHCH3]+I DCI(NH3) m/z=216 MH+ Mass spectrum: EI (70eV) m / z = 215 M + "base peak m / z = 200 [M - CH 3 ] + m / z = 185 [M - NHCH 3 ] + I DCI (NH 3 ) m / z = 216 MH +
Le 4-diméthylamino-2-méthyl-quinoléin-6-N-méthyl- acétamide peut être préparé de la façon suivante : à 250 mg de 4-diméthylamino-2-méthyl-quinoléin-6-acétamide en solution dans 2 mL de DMF à 0°C, sont additionnés 45 mg d'hydrure de sodium à 60 % dans l'huile. Après 20 minutes d'agitation à température ambiante, le milieu réactionnel est à nouveau refroidit à 0°C et 77 μL d'iodure de méthyle sont additionnés. Après 2 heures d'agitation à température ambiante, de l'eau est additionnée et la phase aqueuse est extraite avec du dichloromethane. La phase organique est séchée sur sulfate de.magnésium et concentrée sous pression réduite. Après chromatographie sur colonne de silice avec un mélange dichloromethane-méthanol (gradient 100/0 à 90/10 en volumes) comme éluant, on obtient 170 mg de 4-diméthylamino-2-méthyl-quinoléin-6-N-méthyl-acétamide sous forme d'une huile jaune dont le spectre de masse est le suivant :4-dimethylamino-2-methyl-quinoline-6-N-methyl-acetamide can be prepared as follows: 250 mg of 4-dimethylamino-2-methyl-quinoline-6-acetamide in solution in 2 mL of DMF at 0 ° C., 45 mg of 60% sodium hydride in oil are added. After 20 minutes of stirring at room temperature, the reaction medium is again cooled to 0 ° C. and 77 μL of methyl iodide are added. After 2 hours of stirring at room temperature, water is added and the aqueous phase is extracted with dichloromethane. The organic phase is dried over magnesium sulfate and concentrated under reduced pressure. After chromatography on a silica column with a dichloromethane-methanol mixture (gradient 100/0 to 90/10 by volume) as eluent, 170 mg of 4-dimethylamino-2-methyl-quinoline-6-N-methyl-acetamide is obtained under form of a yellow oil with the following mass spectrum:
I ( 70eV) m/z=257 M+- pic de base m/z=215 [M - COCH3 ] + m/z=185 [M - CH3CONCH3] +-I (70eV) m / z = 257 M + - base peak m / z = 215 [M - COCH 3 ] + m / z = 185 [M - CH 3 CONCH 3 ] + -
CI (NH3 ) m/ z=216 MH+ CI (NH 3 ) m / z = 216 MH +
Le 4-diméthylamino-2-méthyl-quinoléin-6-acétamide peut être préparé de la façon suivante : à 300 mg de4-Dimethylamino-2-methyl-quinoline-6-acetamide can be prepared as follows: at 300 mg of
4-diméthylamino-2-méthyl-quinoléin-6-amine en solution dans 3 mL de dichloromethane sont additionnés 415 μL de triéthylamine, 211 μL d' anhydride acétique et 9 mg de4-dimethylamino-2-methyl-quinoline-6-amine dissolved in 3 mL of dichloromethane are added 415 μL of triethylamine, 211 μL of acetic anhydride and 9 mg of
DMAP . Le mélange réactionnel est porté à reflux pendant 2 heures . Après retour à température ambiante , de l ' eau est additionné et la phase aqueuse est extraite avec du dichloromethane . La phase organique est séchée sur sulfate de magnésium puis concentrée sous pression réduite . On obtient ainsi 263 mg de 4-diméthylamino-2- méthyl-quinoléin-6-acétamide sous forme d' une mousse beige dont le spectre de masse est le suivant :DMAP. The reaction mixture is brought to reflux for 2 hours. After returning to ambient temperature, water is added and the aqueous phase is extracted with dichloromethane. The organic phase is dried over magnesium sulfate and then concentrated under reduced pressure. 263 mg of 4-dimethylamino-2-methyl-quinoline-6-acetamide are thus obtained in the form of a beige foam, the mass spectrum of which is as follows:
EI ( 70eV) m/z=243 M+' pic de base m/z=201 [M - COCH2] +- m/z=43 [COCH3] + EI (70eV) m / z = 243 M + 'base peak m / z = 201 [M - COCH 2 ] + - m / z = 43 [COCH 3 ] +
La 4-diméthylamino-2-méthyl-quinoléin-6-amine peut être préparée comme décrit dans le brevet WO 0140218 . o La 4-diméthylamino-2-phényl-quinoléin-6-amine (C17) peut être préparée en opérant de la manière suivante :4-Dimethylamino-2-methyl-quinoline-6-amine can be prepared as described in patent WO 0140218. o 4-dimethylamino-2-phenyl-quinoline-6-amine (C17) can be prepared by operating as follows:
360 mg de 4-diméthylamino-2-phényl-quinoléin-6- acetamide est porté au reflux dans 6 mL d'un mélange acide chlorhydrique concentré-eau (2/1 en volumes) pendant 2 heures. Après retour à température ambiante, le pH est amené à 8 par ajout d'une solution aqueuse d'ammoniaque à 28 % et la phase aqueuse est extraite avec du dichloromethane. La phase organique est séchée sur sulfate de magnésium puis concentrée sous pression réduite. On obtient ainsi 310 mg de 4-diméthylamino-2- phényl-quinoléin-6-amine sous forme d'une huile marron dont les caractéristiques sont les suivantes : Spectre de R.M.N. lfi[ (300 MHz, (CD3)2SO d6, δ en ppm) : 2,96 (s : 6H) ; 5,57 (s large : 2H) ; 7,05 (d, J = 2,5 Hz : IH) ; 7,10 (dd, J = 9 et 2,5 Hz : IH) ; 7,28 (s : IH) ; 7,42 (tt, J = 7,5 et 1,5 Hz : IH) ; 7,50 (t, J = 7,5 Hz : 2H) ; 7,72 (d, J = 9 Hz : IH) ; 8,05 (d large, J = 7,5 Hz : 2H) .360 mg of 4-dimethylamino-2-phenyl-quinoline-6-acetamide is brought to reflux in 6 ml of a concentrated hydrochloric acid-water mixture (2/1 by volume) for 2 hours. After returning to ambient temperature, the pH is brought to 8 by adding a 28% aqueous ammonia solution and the aqueous phase is extracted with dichloromethane. The organic phase is dried over magnesium sulfate and then concentrated under reduced pressure. 310 mg of 4-dimethylamino-2-phenyl-quinoline-6-amine are thus obtained in the form of a brown oil, the characteristics of which are as follows: NMR spectrum lfi [(300 MHz, (CD 3 ) 2 SO d6, δ in ppm): 2.96 (s: 6H); 5.57 (br s: 2H); 7.05 (d, J = 2.5 Hz: 1H); 7.10 (dd, J = 9 and 2.5 Hz: 1 H); 7.28 (s: 1H); 7.42 (tt, J = 7.5 and 1.5 Hz: 1 H); 7.50 (t, J = 7.5 Hz: 2H); 7.72 (d, J = 9 Hz: 1 H); 8.05 (broad d, J = 7.5 Hz: 2H).
Spect re de masse :Mass spectrum:
EI ( 70eV) m/ z=263 M+- pic de base m/z=248 [M - CH3 ] + m/ z=219 [M - N ( CH3 ) 2] +-EI (70eV) m / z = 263 M + - base peak m / z = 248 [M - CH 3 ] + m / z = 219 [M - N (CH 3 ) 2 ] + -
DCI (NH3 ) m/z=264 MH+ DCI (NH 3 ) m / z = 264 MH +
Le ' 4-diméthylamino-2-phényl-quinoléin-6-acétamide peut être préparé de la façon suivante : 400 mg de 4-chloro-2-phényl-quinoléin-6-acétamide est mis en solution dans 15 mL de DMF en présence de 1.86 g de carbonate de potassium et 'de 1.10 g de chlorhydrate de diméthylammonium. Le mélange réactionnel est agité à 150 °C pendant 6 heures. Après retour à température ambiante, il est hydrolyse par ajout d'eau et la phase aqueuse ainsi obtenue est extraite avec du dichloromethane. La phase organique est séchée sur sulfate de magnésium puis concentrée sous pression réduite. On obtient ainsi 360 mg de 4-diméthylamino-2- phényl-quinoléin-6-acétamide sous forme d'une huile marron dont le spectre de masse est le suivant :The ' 4-dimethylamino-2-phenyl-quinoline-6-acetamide can be prepared as follows: 400 mg of 4-chloro-2-phenyl-quinoline-6-acetamide is dissolved in 15 ml of DMF in the presence 1.86 g of potassium carbonate and '1.10 g of dimethylammonium hydrochloride. The reaction mixture is stirred at 150 ° C for 6 hours. After returning to ambient temperature, it is hydrolyzed by adding water and the aqueous phase thus obtained is extracted with dichloromethane. The organic phase is dried over magnesium sulfate and then concentrated under reduced pressure. 360 mg of 4-dimethylamino-2-phenyl-quinoline-6-acetamide are thus obtained in the form of a brown oil, the mass spectrum of which is as follows:
EI(70eV) m/z=305 M+- pic de base m/z=262 [M - COCH3]+- m/z=246 [262 - CH2] + m/z=43 [COCH3] + EI (70eV) m / z = 305 M + - base peak m / z = 262 [M - COCH 3 ] + - m / z = 246 [262 - CH 2 ] + m / z = 43 [COCH 3 ] +
Le 4-chloro-2-phényl-quinoléin-6-acétamide peut être préparé de la façon suivante : Une solution de 380 mg de 4-hydroxy-2-phényl-quinoléin-6-acétamide dans 2 mL de P0C13 est portée au reflux pendant 3 heures. Après retour à température ambiante, le mélange réactionnel est additionné de cyclohexane jusqu'à l'obtention d'un précipité qui est récupéré par filtration puis repris avec de l'eau. Le pH de la phase aqueuse ainsi obtenue est amenée à 8 par ajout d'une solution aqueuse d'ammoniaque à 28 % et le précipité résultant est récupéré par filtration, lavé avec de l'eau puis séché sous pression réduite. On obtient ainsi 400 mg de 4-chloro-2-phényl-quinoléin-6-acétamide sous forme d'une poudre jaune dont le spectre de masse est le suivant :The 4-chloro-2-phenyl-quinoline-6-acetamide can be prepared as follows: A solution of 380 mg of 4-hydroxy-2-phenyl-quinoline-6-acetamide in 2 ml of P0C1 3 is brought to the reflux for 3 hours. After returning to room temperature, the reaction mixture is added with cyclohexane until a precipitate is obtained which is recovered by filtration and then taken up with water. The pH of the aqueous phase thus obtained is brought to 8 by adding a 28% aqueous ammonia solution and the resulting precipitate is recovered by filtration, washed with water and then dried under reduced pressure. 400 mg of 4-chloro-2-phenyl-quinoline-6-acetamide are thus obtained in the form of a yellow powder, the mass spectrum of which is as follows:
EI(70eV) m/z=296 M+' m/z=254 [M - COCH2]+- pic de base m/z=219 [254 - Cl]+ m/z=43 [COCH3] + EI (70eV) m / z = 296 M + 'm / z = 254 [M - COCH 2 ] + - base peak m / z = 219 [254 - Cl] + m / z = 43 [COCH 3 ] +
Le 4-hydroxy-2-phényl-quinoléin-6-acétamide peut être préparé de la façon suivante : 1 g de 3- (4- acetylamino-phénylamino) -3-phényl-acrylate d'éthyle est jeté dans 20 mL de dowtherm A au reflux. Après 45 minutes, on revient à température ambiante et le milieu réactionnel est additionné de cyclohexane jusqu'à formation d'un précipité qui est récupéré par filtration, lavé avec du cyclohexane puis séché sous pression réduite. On obtient ainsi 688 mg de 4-hydroxy-2-phényl- quinoléin-6-acétamide sous forme d'une poudre ocre dont le spectre de masse est le suivant :The 4-hydroxy-2-phenyl-quinoline-6-acetamide can be prepared as follows: 1 g of ethyl 3- (4-acetylamino-phenylamino) -3-phenyl-acrylate is poured into 20 ml of dowtherm Has reflux. After 45 minutes, it returns to ambient temperature and the reaction medium is supplemented with cyclohexane until formation of a precipitate which is recovered by filtration, washed with cyclohexane and then dried under reduced pressure. 688 mg of 4-hydroxy-2-phenyl-quinoline-6-acetamide are thus obtained in the form of an ocher powder, the mass spectrum of which is as follows:
EI(70eV) m/z=278 M+" m/z=236 [M - C0CH3]+" m/z=43 [COCH3]+ pic de baseEI (70eV) m / z = 278 M + "m / z = 236 [M - C0CH 3 ] + " m / z = 43 [COCH 3 ] + base peak
Le 3- (4-acetylamino-phénylamino) -3-phényl-acrylate d'éthyle peut être préparé de la façon suivante : àEthyl 3- (4-acetylamino-phenylamino) -3-phenyl-acrylate can be prepared as follows:
500 mg de 4-aminoacétanilide dans 2 mL d'éthanol absolu sont additionnés 634 mL de benzoylacétate d'éthyle,500 mg of 4-aminoacetanilide in 2 ml of absolute ethanol are added 634 ml of ethyl benzoylacetate,
6 gouttes d'acide acétique et 1.13 g de driérite. Le mélange réactionnel est porté au reflux pendant 48 heures. Après retour à température ambiante, l'insoluble est éliminé par filtration et le filtrat est concentré sous pression réduite. On obtient ainsi 1.03 g de 3- (4-acétylamino-phénylamino) -3-phényl-acrylate d'éthyle sous forme d'une poudre jaune dont le spectre de masse est le suivant :6 drops of acetic acid and 1.13 g of drierite. The reaction mixture is brought to reflux for 48 hours. After returning to ambient temperature, the insoluble material is removed by filtration and the filtrate is concentrated under reduced pressure. 1.03 g of ethyl 3- (4-acetylamino-phenylamino) -3-phenyl-acrylate is thus obtained in the form of a yellow powder, the mass spectrum of which is as follows:
EI(70eV) m/z=263 M+" pic de base m/z=248 [M - CH3] + m/z=219 [M - N(CH3)2]+' EI (70eV) m / z = 263 M + "base peak m / z = 248 [M - CH 3 ] + m / z = 219 [M - N (CH 3 ) 2 ] + '
DCI(NH3) m/z=264 MH+ DCI (NH 3 ) m / z = 264 MH +
o La 4-diméthylamino-2-isopropyl-quinoléin-6- a ine (C18) peut être préparée en opérant de la manière suivante :o 4-Dimethylamino-2-isopropyl-quinoline-6- a ine (C18) can be prepared by operating as follows:
315 mg 4-diméthylamino-2-isopropyl-6-nitro-quinoléine en mélange avec la 4-diméthylamino-2-isopropyl-8-nitro- quinoléine dans des proportions 8.5/1.5 en solution dans 4 mL d'un mélange méthanol-dichlorométhane (2/1 en volumes) est placée sous atmosphère d'hydrogène (5 bars) en présence de 20 mg de palladium sur charbon à 10 % pendant 12 heures. Après filtration sur célite, le filtrat est concentré sous pression réduite. Après chromatographie sur colonne de silice avec un mélange dichloromethane-méthanol (gradient 95/5 à 85/15 en volumes) comme éluant, on obtient 142 mg de 4-diméthylamino-2-isopropyl-quinoléin-6-amine sous forme d'une cire marron dont les caractéristiques sont les suivantes :315 mg 4-dimethylamino-2-isopropyl-6-nitro-quinoline in mixture with 4-dimethylamino-2-isopropyl-8-nitro-quinoline in proportions 8.5 / 1.5 dissolved in 4 ml of a methanol-dichloromethane mixture (2/1 by volume) is placed under a hydrogen atmosphere (5 bars) in the presence of 20 mg of palladium on carbon at 10% for 12 hours. After filtration on celite, the filtrate is concentrated under reduced pressure. After chromatography on a silica column with a dichloromethane-methanol mixture (gradient 95/5 to 85/15 by volume) as eluent, 142 mg of 4-dimethylamino-2-isopropyl-quinoline-6-amine is obtained in the form of a brown wax with the following characteristics:
Spectre de R.M.N. ^-H (300 MHz, (CD3)2SO d6, δ en ppm) : 1,29 (d, J = 7 Hz : 6H) ; 2,88 (s : 6H) ; 3,02 (mt : IH) ; 5,38 (s large : 2H) ; 6,68 (s : IH) ; de 6,95 à 7,10 (mt : 2H) ; 7,58 (d, J = 9 Hz : IH) .1 H-NMR spectrum (300 MHz, (CD 3 ) 2 SO d6, δ in ppm): 1.29 (d, J = 7 Hz: 6H); 2.88 (s: 6H); 3.02 (mt: 1H); 5.38 (br s: 2H); 6.68 (s: 1H); from 6.95 to 7.10 (mt: 2H); 7.58 (d, J = 9 Hz: 1 H).
Spectre de masse : EI(70eV) m/z=229 M+" pic de base m/z=214 [M - CH3] + m/z=201 [214 - CH]+" DCI(NH3) ' m/z=230 MH+ Mass spectrum: EI (70eV) m / z = 229 M + "base peak m / z = 214 [M - CH 3 ] + m / z = 201 [214 - CH] + " DCI (NH 3 ) 'm / z = 230 MH +
La 4-diméthylamino-2-isopropyl-6-nitro-quinoléine peut être préparée de la façon suivante : 450 mg de 4-chloro-2-isopropyl-6-nitro-quinoléine en mélange avec la 4-chloro-2-isopropyl-8-nitro-quinoléine dans des proportions 8.5/1.5 est mise en solution dans 12 mL de DMF en présence de 1.2 g de carbonate de potassium et de 1.47 g de chlorhydrate de diméthylammonium. Le mélange réactionnel est agité à 100 °C pendant 3 heures. Après retour à température ambiante, il est hydrolyse par ajout d'eau et la phase aqueuse ainsi obtenue est extraite avec du dichloromethane. La phase organique est séchée sur sulfate de magnésium puis concentrée sous pression réduite. On obtient ainsi 317 mg de 4-diméthylamino-2- isopropyl-6-nitro-quinoléine en mélange avec la 4-diméthylamino-2-isopropyl-8-nitro-quinoléine dans des proportions 8.5/1.5 (en mole) sous forme d'une cire marron dont le spectre de masse est le suivant : EI(70eV) m/z=259 M+I m/z=244 [M - CH3]+ pic de base m/z=231 [244 - CH]+' m/z=212 [M - HN02] + m/z=198 [244 -N02] + 4-dimethylamino-2-isopropyl-6-nitro-quinoline can be prepared as follows: 450 mg of 4-chloro-2-isopropyl-6-nitro-quinoline mixed with 4-chloro-2-isopropyl- 8-nitro-quinoline in proportions 8.5 / 1.5 is dissolved in 12 mL of DMF in the presence of 1.2 g of potassium carbonate and 1.47 g of dimethylammonium hydrochloride. The reaction mixture is stirred at 100 ° C for 3 hours. After returning to ambient temperature, it is hydrolyzed by adding water and the aqueous phase thus obtained is extracted with dichloromethane. The organic phase is dried over magnesium sulfate and then concentrated under reduced pressure. 317 mg of 4-dimethylamino-2-isopropyl-6-nitro-quinoline are thus obtained in mixture with 4-dimethylamino-2-isopropyl-8-nitro-quinoline in proportions 8.5 / 1.5 (in mole) in the form of a brown wax with the following mass spectrum: EI (70eV) m / z = 259 M + I m / z = 244 [M - CH 3 ] + base peak m / z = 231 [244 - CH] + 'm / z = 212 [M - HN0 2 ] + m / z = 198 [244 -N0 2 ] +
La 4-chloro-2-isopropyl-6-nitro-quinoléine peut être préparée de la façon suivante : Une solution de 475 mg de 2-isopropyl-6-nitro-quinolin-4-ol, en mélange avec le 2-isopropyl-8-nitro-quinolin-4-ol dans des proportions 8.5/1.5 (en mole), dans 4 mL de P0C13 est portée au reflux pendant 3 heures. Après retour à température ambiante, le mélange réactionnel est additionné d'eau et de cyclohexane et le pH de la phase aqueuse est amené à 8 par . addition d'une solution aqueuse d' a monique à 28 %. Un précipité est formé qui est récupéré par filtration et la phase aqueuse est extraite au dichloromethane. Les phases organiques rassemblées sont séchées sur sulfate de magnésium puis concentrées sous pression réduite Les solides ainsi obtenus sont réunis et séchés sous pression réduite. On obtient alors 450 mg de 4-chloro-2-isopropyl- 6-nitro-quinoléine en mélange avec la 4-chloro-2- isopropyl-8-nitro-quinoléine dans des proportions 8.5/1.5 (en mole) sous forme d'un solide bordeaux dont le spectre de masse est le suivant :4-chloro-2-isopropyl-6-nitro-quinoline can be prepared as follows: A solution of 475 mg of 2-isopropyl-6-nitro-quinolin-4-ol, mixed with 2-isopropyl- 8-nitro-quinolin-4-ol in proportions 8.5 / 1.5 (in moles), in 4 mL of P0C1 3 is brought to reflux for 3 hours. After returning to ambient temperature, the reaction mixture is added with water and cyclohexane and the pH of the aqueous phase is brought to 8. addition of an aqueous solution of 28% monique. A precipitate is formed which is recovered by filtration and the aqueous phase is extracted with dichloromethane. The combined organic phases are dried over magnesium sulfate and then concentrated under reduced pressure The solids thus obtained are combined and dried under reduced pressure. 450 mg of 4-chloro-2-isopropyl-6-nitro-quinoline are then obtained in mixture with 4-chloro-2-isopropyl-8-nitro-quinoline in proportions 8.5 / 1.5 (in mole) in the form of a solid burgundy with a mass spectrum as follows:
El ( 70eV) m/z=250 M+- m/z=235 [M - 0] + pic de base m/z=222 [235 - CH] +" m/z=203 [M - HN02 ] + m/z=189 [203 - CH3] + El (70eV) m / z = 250 M + - m / z = 235 [M - 0] + base peak m / z = 222 [235 - CH] + "m / z = 203 [M - HN0 2 ] + m / z = 189 [203 - CH 3 ] +
DCI (NH3) m/z=251 MH+ DCI (NH 3 ) m / z = 251 MH +
Le 2-isopropyl-6-nitro-quinolin-4-ol peut être préparé de la façon suivante : 450 mg de 2-isopropyl-lH- quinolin-4-one sont placés en solution dans 5 mL d'acide sulfurique concentré à 0°C. 243 mg de nitrate de potassium est alors additionné et le mélange réactionnel est agité à 0°C pendant 1 heure puis une nuit à température ambiante. Il est ensuite jeté dans un mélange eau-glace et le pH de la solution aqueuse ainsi obtenue est amenée à pH 8 par ajout d'une solution aqueuse d'ammoniaque à 28 %. Un précipité se forme qui est récupéré par filtration et séché sous pression réduite. On obtient alors 510 mg de 2-isopropyl-6-nitro-quinolin- 4-ol en mélange avec la 2-isopropyl-8-nitro-quinolin-4-ol dans des proportions 8.5/1.5 (en mole) sous forme d'une poudre jaune dont le spectre de masse est le suivant :2-isopropyl-6-nitro-quinolin-4-ol can be prepared as follows: 450 mg of 2-isopropyl-1H-quinolin-4-one are placed in solution in 5 ml of acid concentrated sulfuric at 0 ° C. 243 mg of potassium nitrate is then added and the reaction mixture is stirred at 0 ° C for 1 hour and then overnight at room temperature. It is then thrown into a water-ice mixture and the pH of the aqueous solution thus obtained is brought to pH 8 by addition of a 28% aqueous ammonia solution. A precipitate forms which is collected by filtration and dried under reduced pressure. 510 mg of 2-isopropyl-6-nitro-quinolin-4-ol are then obtained in mixture with 2-isopropyl-8-nitro-quinolin-4-ol in proportions 8.5 / 1.5 (in mole) in the form of a yellow powder with the following mass spectrum:
El ( 70eV) m/z=232 M+- pic de base m/z=217 [M - CH3] + m/z=204 [M - co] +- m/ z=18 6 [M - N02] +- m/z=171 [ 186 - CH3] + El (70eV) m / z = 232 M + - base peak m / z = 217 [M - CH 3 ] + m / z = 204 [M - co] + - m / z = 18 6 [M - N0 2 ] + - m / z = 171 [186 - CH 3 ] +
La 2-isopropyl-lH-quinolin-4-one peut être préparée de la façon suivante : 4.09g de 2-isopropyl-4- triisoprόρylsilanyloxy-2H-quinoline-l-carboxylate de benzyle en solution dans 115 mL de méthanol est placée sous atmosphère d'hydrogène (5 bars) en présence de 400 mg de palladium sur charbon à 10 % pendant 12 heures. Après filtration sur célite, le filtrat est concentré sous pression réduite. Après chromatographie sur colonne de silice avec un mélange dichloromethane-méthanol (gradient 100/0 à 95/5 en volumes) comme éluant, on obtient 750 mg de 2-isopropyl-lH-quinolin-4-one sous forme d'une poudre blanche dont le spectre de masse est le suivant :2-isopropyl-1H-quinolin-4-one can be prepared as follows: 4.09g of benzyl 2-isopropyl-4-triisoprόρylsilanyloxy-2H-quinoline-1-carboxylate in solution in 115 ml of methanol is placed under hydrogen atmosphere (5 bar) in the presence of 400 mg of 10% palladium on carbon for 12 hours. After filtration on celite, the filtrate is concentrated under reduced pressure. After chromatography on a silica column with a dichloromethane-methanol mixture (gradient 100/0 to 95/5 by volume) as eluent, 750 mg of 2-isopropyl-1H-quinolin-4-one is obtained in the form of a white powder whose mass spectrum is as follows:
EI(70eV) m/z=187 M+I m/z=172 [M - CH3]+ pic de base m/z=159 [M - C0]+- m/z=144 [M - C3H7]+- Le 2-isopropyl-4-triisopropylsilanyloxy-2H- quinoline-1-carboxylate de benzyle peut être préparé de la façon suivante : un mélange de 750 mg de 4-oxo-4H- quinoline-1-carboxylate de benzyle et de 1.5 mL de triisopropylsilyltrifluoromethanesulfonate est agité lentement pendant 1 heure sous argon. 15.5 mL de dichloromethane sont alors additionnées ainsi que 0.65 mL de 2, 6-lutidine. Le mélange réactionnel est alors refroidi à 0°C et 2.8 mL d'une solution 2M de chlorure d' isopropylmagnesium dans le THF sont additionnés goutte à goutte. Le mélange réactionnel est agité pendant 1 heure à température ambiante puis hydrolyse par ajout d'un mélange eau-glace. La phase aqueuse ainsi obtenue est extraite avec du dichloromethane et la phase organique est séchée sur sulfate de magnésium puis concentrée sous pression réduite. Après chromatographie sur colonne de silice <avec du dichloromethane comme éluant, on obtient 596 mg de 2-isopropyl-4- triisopropylsilanyloxy-2H-quinoline-l-carboxylate de benzyle sous forme d'une huile incolore dont le spectre de masse est le suivant :EI (70eV) m / z = 187 M + I m / z = 172 [M - CH 3 ] + base peak m / z = 159 [M - C0] + - m / z = 144 [M - C 3 H 7 ] + - Benzyl 2-isopropyl-4-triisopropylsilanyloxy-2H-quinoline-1-carboxylate can be prepared as follows: a mixture of 750 mg of benzyl 4-oxo-4H-quinoline-1-carboxylate and 1.5 ml of benzyl triisopropylsilyltrifluoromethanesulfonate is stirred slowly for 1 hour under argon. 15.5 mL of dichloromethane are then added together with 0.65 mL of 2,6-lutidine. The reaction mixture is then cooled to 0 ° C. and 2.8 ml of a 2M solution of isopropylmagnesium chloride in THF are added dropwise. The reaction mixture is stirred for 1 hour at room temperature and then hydrolyzed by adding a water-ice mixture. The aqueous phase thus obtained is extracted with dichloromethane and the organic phase is dried over magnesium sulfate and then concentrated under reduced pressure. After chromatography on a silica column <with dichloromethane as eluent, 596 mg of benzyl 2-isopropyl-4-triisopropylsilanyloxy-2H-quinoline-1-carboxylate are obtained in the form of a colorless oil whose mass spectrum is as follows :
EI(70eV) m/z=479 M+' pic de base m/z=436 [M - C3H7] + m/z=392 [436 - C3H8] + EI (70eV) m / z = 479 M + 'base peak m / z = 436 [M - C 3 H 7 ] + m / z = 392 [436 - C 3 H 8 ] +
Le 4-oxo-4H-quinoline-l-carboxylate de benzyle peut être préparé de la façon suivante : à 500 mg de 4-hydroxyquinoline dans 3 mL de tert-butanol à 30 °C sont additionnés 179 mg d'hydrure de sodium à 60 % dans l'huile puis le mélange réactionnel est chauffé à 50 °C jusqu'à la fin du dégagement gazeux. On revient alors à température ambiante et on additionne 673 μL de chloroformate de benzyle goutte à goutte puis on agite pendant 3 heures. Le milieu réactionnel est ensuite hydrolyse avec 10 mL d'eau et le pH est amené à 4 par ajout d'une solution aqueuse 0.5 M d'acide chlorhydrique. La phase aqueuse ainsi obtenue est extraite avec du dichloromethane, séchée' sur sulfate de magnésium puis concentrée sous pression réduite. Après chromatographie sur colonne de silice avec un mélange dichloromethane- méthanol (gradient 100/0 à 97/3 en volumes) comme éluant, on obtient 890 mg de 4-oxo-4H-quinoline-l-carboxylate de benzyle sous forme d'une huile visqueuse blanche dont le spectre de masse est le suivant : EI(70eV) m/z=279 M+" m/z=91 [C7H7]+ ' pic de base DCI(NH3) m/z=280 MH+ Benzyl 4-oxo-4H-quinoline-1-carboxylate can be prepared as follows: to 179 mg of 4-hydroxyquinoline in 3 ml of tert-butanol at 30 ° C. are added 179 mg of sodium hydride to 60% in oil then the reaction mixture is heated to 50 ° C until the end of gas evolution. It then returns to room temperature and 673 μL of benzyl chloroformate is added dropwise then the mixture is stirred for 3 hours. The reaction medium is then hydrolyzed with 10 ml of water and the pH is brought to 4 by addition of a 0.5 M aqueous solution of hydrochloric acid. The aqueous phase thus obtained is extracted with dichloromethane, dried 'over magnesium sulfate and then concentrated under reduced pressure. After chromatography on a silica column with a dichloromethane-methanol mixture (gradient 100/0 to 97/3 by volume) as eluent, 890 mg of benzyl 4-oxo-4H-quinoline-1-carboxylate is obtained in the form of a white viscous oil whose mass spectrum is as follows: EI (70eV) m / z = 279 M + "m / z = 91 [C 7 H 7 ] + ' base peak DCI (NH 3 ) m / z = 280 MH +
o- La 2, 7-diméthyl-4-diméthylamino-quinoléin-6- amine (C19) peut être préparée en opérant de la manière suivante :o- The 2,7-dimethyl-4-dimethylamino-quinoline-6-amine (C19) can be prepared by operating as follows:
472 mg de 2, 7-diméthyl-4-diméthylamino-6-nιtro- quinoléin-6-amine en mélange avec la 2, 7-diméthyl-4- diméthylamino-8-nitro-quinoléin-6-amine dans des proportions 35/65 (en mole) en solution dans 8 mL d'un mélange dichloromethane-méthanol (1/3 en volumes) est placée sous atmosphère d'hydrogène (5 -bars) en présence de 45 mg de palladium sur charbon à 10 % pendant 12 heures. Après filtration sur célite, le filtrat est concentré sous pression réduite. Après chromatographie sur colonne de silice avec un mélange dichloromethane- méthanol (gradient 100/0 à 75/25 en volumes) comme éluant, on obtient 168 mg de 2, 7-diméthyl-4- diméthylamino-quinoléin-6-amine sous forme d'une poudre caramel dont les caractéristiques sont les suivantes : Spectre de R.M.N. ^-H (300 MHz, (CD3)2SO d6, δ en ppm) : 2,29 (s : 3H) ; 2,57 (s : 3H) ; 3,24 (s : 6H) ;472 mg of 2, 7-dimethyl-4-dimethylamino-6-nitroquinoline-6-amine in mixture with the 2, 7-dimethyl-4-dimethylamino-8-nitro-quinoline-6-amine in proportions 35 / 65 (in mole) dissolved in 8 mL of a dichloromethane-methanol mixture (1/3 by volume) is placed under a hydrogen atmosphere (5-bars) in the presence of 45 mg of 10% palladium on carbon for 12 hours. After filtration on celite, the filtrate is concentrated under reduced pressure. After chromatography on a silica column with a dichloromethane-methanol mixture (gradient 100/0 to 75/25 by volume) as eluent, 168 mg of 2,7-dimethyl-4-dimethylamino-quinolin-6-amine are obtained in the form of 'a caramel powder, the characteristics of which are as follows: 1 H-NMR spectrum (300 MHz, (CD 3 ) 2 SO d6, δ in ppm): 2.29 (s: 3H); 2.57 (s: 3H); 3.24 (s: 6H);
5,59 (mf : 2H) ; 6,70 (s : IH) ; 7,33 (s large : IH) ;5.59 (mf: 2H); 6.70 (s: 1H); 7.33 (br s: 1H);
7,50 (s large : IH) . Spectre de masse7.50 (broad s: IH). Mass spectrum
EI ( 70eV) m/z=215 M+- pic de base m/z=200 [M - CH3] + m/z=184 [ 200 - NH2] + m/z=172 [M - C2H5N] + EI (70eV) m / z = 215 M + - base peak m / z = 200 [M - CH 3 ] + m / z = 184 [200 - NH 2 ] + m / z = 172 [M - C 2 H 5 N] +
La 2, 7-diméthyl-4-diméthylamino-6-nitro-quinoléin-6- amine peut être préparée de la façon suivante : 500 mg de 4-chloro-2, 7-diméthyl-6-nitro-quinoléine en mélange avec la 4-chloro-2, 7-diméthyl-8-nitro-quinoléine dans des proportions 35/65 (en mole) est mis en solution dans 8 mL de DMF en présence de 1.46 g de carbonate de potassium et de 1.72 g de chlorhydrate de diméthylammonium. Le mélange réactionnel est agité à 100 °C pendant 3 heures. Après retour à température ambiante, il est hydrolyse par ajout d'eau et la phase aqueuse ainsi obtenue est extraite avec du dichloromethane. La phase organique est séchée sur sulfate de magnésium puis concentrée sous pression réduite. On obtient ainsi 476 mg de (2, 7-diméthyl-4- diméthylamino-6-nitro-quinoléin-6-amine en mélange avec le 2, 7-diméthyl-4-diméthylamino-8-nitro-quinoléin-6-amine dans des proportions 35/65 (en mole) sous forme d'un solide caramel dont le spectre de masse est le suivant :The 2,7-dimethyl-4-dimethylamino-6-nitro-quinoline-6-amine can be prepared as follows: 500 mg of 4-chloro-2, 7-dimethyl-6-nitro-quinoline in mixture with the 4-chloro-2, 7-dimethyl-8-nitro-quinoline in proportions 35/65 (in moles) is dissolved in 8 ml of DMF in the presence of 1.46 g of potassium carbonate and 1.72 g of hydrochloride dimethyl. The reaction mixture is stirred at 100 ° C for 3 hours. After returning to ambient temperature, it is hydrolyzed by adding water and the aqueous phase thus obtained is extracted with dichloromethane. The organic phase is dried over magnesium sulfate and then concentrated under reduced pressure. 476 mg of (2, 7-dimethyl-4-dimethylamino-6-nitro-quinoline-6-amine) are thus obtained in admixture with 2, 7-dimethyl-4-dimethylamino-8-nitro-quinoline-6-amine in proportions 35/65 (in moles) in the form of a solid caramel with a mass spectrum as follows:
( 70eV) m/z=245 M+" pic de base m/z=228 [M - OH] + m/z=215 [M - NO] +- m/z=199 [M - N02] +" m/z=183 [M - HN02-CH3] +-(70eV) m / z = 245 M + "base peak m / z = 228 [M - OH] + m / z = 215 [M - NO] + - m / z = 199 [M - N0 2 ] + " m / z = 183 [M - HN0 2 -CH 3 ] + -
La 4-chloro-2, 7-diméthyl-6-nitro-quinoléine peut être préparée de la façon suivante : Une solution de 660 mg de 2, 7-diméthyl-6-nitro-quinolin-4-ol, en mélange avec le 2, 7-diméthyl-8-nitro-quinolin-4-ol dans des proportions 35/65 (en mole) , dans 5 mL de P0C13 est portée au reflux pendant 3 heures. Après retour à température ambiante, le mélange réactionnel est additionné de cyclohexane jusqu'à l'obtention d'un précipité qui est récupéré par filtration puis repris avec de l'eau. Le pH de la phase aqueuse ainsi obtenue est amenée à 8 par ajout d'une solution aqueuse d'ammoniaque à 28 % et le précipité résultant est récupéré par filtration, lavé avec de l'eau puis séché sous pression réduite. On obtient ainsi 516 mg de 4-chloro-2, 7-diméthyl-6-nitro-quinoléine en mélange avec la 4-chloro-2, 7-diméthyl-8-nitro-quinoléine dans des proportions 35/65 (en mole) sous la forme d'une poudre marron dont le spectre de masse est le suivant :4-chloro-2, 7-dimethyl-6-nitro-quinoline can be prepared as follows: A solution of 660 mg of 2, 7-dimethyl-6-nitro-quinolin-4-ol, mixed with 2, 7-dimethyl-8-nitro-quinolin-4-ol in proportions 35/65 (in moles), in 5 ml of P0C1 3 is brought to reflux for 3 hours. After returning to ambient temperature, the reaction mixture is added with cyclohexane until a precipitate is obtained which is recovered by filtration and then taken up with water. The pH of the aqueous phase thus obtained is brought to 8 by adding a 28% aqueous ammonia solution and the resulting precipitate is recovered by filtration, washed with water and then dried under reduced pressure. 516 mg of 4-chloro-2, 7-dimethyl-6-nitro-quinoline is thus obtained in mixture with 4-chloro-2, 7-dimethyl-8-nitro-quinoline in proportions 35/65 (in moles) in the form of a brown powder, the mass spectrum of which is as follows:
EI(70eV) m/z=236 M+> pic de base m/z=219 [M - OH]+ m/z=206 [M - NO]+- m/z=190 [M - N02]+" m/z=155 [M - N02-C1] +EI (70eV) m / z = 236 M +> base peak m / z = 219 [M - OH] + m / z = 206 [M - NO] + - m / z = 190 [M - N0 2 ] + "m / z = 155 [M - N0 2 -C1] +
Le 2, 7-diméthyl-6-nitro-quinolin-4-ol peut être préparé de la façon suivante : 625 mg de 2, 7-diméthyl- quinolin-4-ol sont placés en solution dans 6 mL d'acide sulfurique concentré à 0°C. 365 mg de nitrate de potassium est alors additionné et le mélange réactionnel est agité à 0°C pendant 1 heure puis une nuit à température ambiante. Il est ensuite jeté dans un mélange eau-glace et le pH de la solution aqueuse ainsi obtenue est amenée à pH 7 par ajout d'une solution aqueuse d'ammoniaque à 28 %. Le précipité obtenu est récupéré par filtration, lavé avec de l'eau puis séché sous pression réduite. On obtient alors 787 mg de 2, 7-diméthyl-6-nitro- quinolin-4-ol en mélange avec le 2, 7-diméthyl-8-nitro- quinolin-4-ol dans des proportions 35/65 (en mole) sous la forme d'une poudre jaune dont le spectre de masse est le suivant :2, 7-dimethyl-6-nitro-quinolin-4-ol can be prepared as follows: 625 mg of 2, 7-dimethyl-quinolin-4-ol are placed in solution in 6 mL of concentrated sulfuric acid at 0 ° C. 365 mg of potassium nitrate is then added and the reaction mixture is stirred at 0 ° C for 1 hour and then overnight at room temperature. It is then thrown into a water-ice mixture and the pH of the aqueous solution thus obtained is brought to pH 7 by adding a 28% aqueous ammonia solution. The precipitate obtained is recovered by filtration, washed with water and then dried under reduced pressure. We then obtain 787 mg of 2, 7-dimethyl-6-nitro-quinolin-4-ol in mixture with the 2, 7-dimethyl-8-nitro-quinolin-4-ol in proportions 35/65 (in moles) in the form of a yellow powder with a mass spectrum as follows:
EI(70eV) m/z=218 M+- pic de base m/z=201 [M - OH]+ m/z=172 [M - N02]+" m/z=144 [M - HN02-C0]+< EI (70eV) m / z = 218 M + - base peak m / z = 201 [M - OH] + m / z = 172 [M - N0 2 ] + "m / z = 144 [M - HN0 2 -C0] + <
Le 2, 7-diméthyl-quinolin-4-ol peut être préparé de la façon suivante : 3.54 g de 3-m-tolylamino-but-2-énoate d'éthyle est jeté dans 30 mL de dowtherm A au reflux. Après 45 minutes, on revient à température ambiante et le milieu réactionnel est additionné de cyclohexane jusqu'à formation d'un précipité qui est récupéré par filtration, lavé avec du cyclohexane puis séché sous pression réduite. Après chromatographie sur colonne de silice avec un mélange cycohexane-isopropanol (gradient 95/5 à 60/40 en volumes) comme éluant, on obtient 416 mg de 2,7- diméthyl-quinolin-4-ol sous forme d'une poudre blanche dont le spectre de masse est le suivant : EI(70eV) m/z=173 M+- • pic de base m/z=144 [M - CHO]+ The 2, 7-dimethyl-quinolin-4-ol can be prepared in the following way: 3.54 g of ethyl 3-m-tolylamino-but-2-enoate is thrown into 30 ml of dowtherm A at reflux. After 45 minutes, it returns to ambient temperature and the reaction medium is supplemented with cyclohexane until a precipitate is formed which is recovered by filtration, washed with cyclohexane and then dried under reduced pressure. After chromatography on a silica column with a cycohexane-isopropanol mixture (gradient 95/5 to 60/40 by volume) as eluent, 416 mg of 2,7-dimethyl-quinolin-4-ol is obtained in the form of a white powder whose mass spectrum is as follows: EI (70eV) m / z = 173 M + - • base peak m / z = 144 [M - CHO] +
Le 3-m-tolylamino-but-2-énoate d'éthyle peut être préparé de la façon suivante : à 2 mL de m-toluidine dans 8 mL d'éthanol absolu sont additionnés 2.59 mL d' acetoacetate d'éthyle,' 24 gouttes d'acide acétique et 6.29 g de driérite. Le mélange réactionnel est porté au reflux pendant 48 heures. Après retour à température ambiante, l'insoluble est éliminé par filtration et le filtrat est concentré sous pression réduite. On obtient ainsi 3.54 g de 3-m-tolylamino-but-2-énoate d'éthyle sous forme d'huile incolore dont le spectre de masse est le suivant :3-m-tolylamino-but-2-enoic acid ethyl ester can be prepared as follows: 2 mL of m-toluidine in 8 mL of absolute ethanol are added 2.59 ml of ethyl acetoacetate, '24 drops of acetic acid and 6.29 g of drierite. The reaction mixture is brought to reflux for 48 hours. After returning to ambient temperature, the insoluble material is removed by filtration and the filtrate is concentrated under reduced pressure. 3.54 g of ethyl 3-m-tolylamino-but-2-enoate are thus obtained in the form of a colorless oil, the mass spectrum of which is as follows:
( 70eV) m/z=219 M+- m/z=174 [M - OEt] + pic de base m/z=146 [M - COOEt] + m/z=107 [C7H9N] +- m/ z=91 [ C7H7] + o La 2-diméthylamino-lH-benzoimidazol-5-amine (C21) peut être préparée en opérant de la manière suivante :(70eV) m / z = 219 M + - m / z = 174 [M - OEt] + base peak m / z = 146 [M - COOEt] + m / z = 107 [C 7 H 9 N] + - m / z = 91 [C 7 H 7 ] + o 2-dimethylamino-1H-benzoimidazol-5-amine (C21) can be prepared by operating as follows:
250 mg de 2-diméthylamino-5-nitro-lH-benzoimidazole en solution dans 3.2 mL d'un mélange dichloromethane- méthanol (1/3 en volumes) est placée sous atmosphère d'hydrogène (1 bar) en présence de 25 mg de palladium sur charbon à 10 % pendant 12 heures. Après filtration sur célite, le filtrat est concentré sous pression réduite. Après chromatographie sur colonne de silice avec un mélange dichlorométhane-méthanol/ammoniac 2M (gradient 100/0 à 90/10 en volumes) comme éluant, on obtient 66 mg de 2-diméthylamino-lH-benzoimidazol-5-amine sous forme d'une huile marron dont les caractéristiques sont les suivantes :250 mg of 2-dimethylamino-5-nitro-1H-benzoimidazole in solution in 3.2 mL of a dichloromethane-methanol mixture (1/3 by volume) is placed under a hydrogen atmosphere (1 bar) in the presence of 25 mg of 10% palladium on charcoal for 12 hours. After filtration on celite, the filtrate is concentrated under reduced pressure. After chromatography on a silica column with a 2M dichloromethane-methanol / ammonia mixture (gradient 100/0 to 90/10 by volume) as eluent, 66 mg of 2-dimethylamino-1H-benzoimidazol-5-amine is obtained in the form of a brown oil with the following characteristics:
Spectre de R.M.N.^H (300 MHz, (CD3)2SO d6, δ en ppm). Nous observons le mélange 50/50 des isomères de position NH en 1 et NH en 3.1 H NMR spectrum (300 MHz, (CD 3 ) 2 SO d6, δ in ppm). We observe the 50/50 mixture of isomers of position NH in 1 and NH in 3.
2,97 et 2,98 (2 s : 6H en totalité) ; 4,40 et 4,50 (2 mfs : 2H en totalité) ; 6,70 et 6,77 (2 d larges, J = 9 Hz : IH en totalité) ; 6,65 et 6,66 (2 s : IH en totalité) ; 6,81 et 6,88 (2 d larges, J = 9 Hz : IH en totalité) ; 10,68 et 10,80 (2 mfs : IH en totalité).2.97 and 2.98 (2 s: 6H in total); 4.40 and 4.50 (2 mfs: 2 hours in total); 6.70 and 6.77 (2 d wide, J = 9 Hz: 1H in total); 6.65 and 6.66 (2 sec: 1H in total); 6.81 and 6.88 (2 d wide, J = 9 Hz: 1H in total); 10.68 and 10.80 (2 mfs: 1H in total).
Spectre de masse : EI(70eV) m/z=176 M+I pic de base m/z=161 [M - CH3]+- - m/z=147 [161 - CH2]+" m/z=133 [M - C2H5N]+-Mass spectrum: EI (70eV) m / z = 176 M + I base peak m / z = 161 [M - CH 3 ] + - - m / z = 147 [161 - CH 2 ] + "m / z = 133 [M - C 2 H 5 N] + -
La 2-diméthylamino-5-nitro-lH-benzoimidazole peut être préparée de la façon suivante : 500 mg de 2-chloro- 5-nitro-lH-benzoimidazole en solution dans 4 mL de DMF en présence de 825 mg de chlorhydrate de diméthylmmonium et de 395 mg d'acide p-toluène-sulfonique est chauffé à 100°C pendant 20 heures. Après retour à température ambiante, de l'eau est additionnée et la phase aqueuse est extraite avec du dichloromethane. La phase organique est lavée avec une solution aqueuse de soude IN, séchée sur sulfate de magnésium et concentrée sous pression réduite. On obtient ainsi 239 mg de 2-diméthylamino-5- nitro-lH-benzoimidazole sous forme d'un solide marron dont le spectre de masse est le suivant :2-dimethylamino-5-nitro-1H-benzoimidazole can be prepared as follows: 500 mg of 2-chloro-5-nitro-1H-benzoimidazole in solution in 4 ml of DMF in the presence of 825 mg of dimethylmmonium hydrochloride and 395 mg of p-toluene sulfonic acid is heated at 100 ° C for 20 hours. After return to temperature ambient, water is added and the aqueous phase is extracted with dichloromethane. The organic phase is washed with an aqueous IN sodium hydroxide solution, dried over magnesium sulphate and concentrated under reduced pressure. 239 mg of 2-dimethylamino-5-nitro-1H-benzoimidazole is thus obtained in the form of a brown solid, the mass spectrum of which is as follows:
EI(70eV) m/z=206 M+- pic de base m/z=191 [M - CH3]+- m/z=177 [191 - CH2]+-EI (70eV) m / z = 206 M + - base peak m / z = 191 [M - CH 3 ] + - m / z = 177 [191 - CH 2 ] + -
DCI(NH3) m/z=207 MH+ m/z=177 [MH - NO]+ pic de baseDCI (NH 3 ) m / z = 207 MH + m / z = 177 [MH - NO] + base peak
Le 2-chloro-5-nitro-lH-benzoimidazole peut être préparé comme décrit dans la littérature (Jung, F. ; Delvare, C. ; Boucherot, D. ; Ha on, A.' J. Med. Chem . 1991, 34 (3), 1110-11162-chloro-5-nitro-1H-benzoimidazole can be prepared as described in the literature (Jung, F.; Delvare, C.; Boucherot, D.; Ha on, A. ' J. Med. Chem. 1991, 34 (3), 1110-1116
o La 2-diméthylamino-3-méthyl-3H-benzoimidazol-5- amine (C22) peut être préparée en opérant de la manière suivante : 314 mg de 2-diméthylamino-5-nitro-lH-benzoimidazole est additionné à une solution de 122 mg d'hydrure de sodium à 60 % dans l'huile dans 6 mL de DMF. Après addition de 110 μL d' iodométhane, le mélange réactionnel est agité à température ambiante pendant 3 heures puis additionné d'une solution aqueuse saturée en chlorure d'ammonium. La phase aqueuse est extraite avec du dichloromethane. La phase organique est séchée sur sulfate de magnésium et concentrée sous pression réduite. Le résidu en solution dans 12 mL d'un mélange dichloromethane-méthanol (1/3 en volumes) est placé sous atmosphère d'hydrogène (1 bars) en présence de 32 mg de palladium sur charbon à 10 % pendant 12 heures. Après filtration sur célite, le filtrat est concentré sous pression réduite. Après chromatographie sur colonne de silice avec un mélange dichlorométhane-méthanol/ammoniac 2M (gradient 100/0 à 90/10 en volumes) comme éluant, on obtient 46 mg de 2-diméthylamino-3-méthyl-3H- benzoimidazol-5-amine sous forme d'une huile marron dont les caractéristiques sont les suivantes :o 2-dimethylamino-3-methyl-3H-benzoimidazol-5-amine (C22) can be prepared by operating as follows: 314 mg of 2-dimethylamino-5-nitro-1H-benzoimidazole is added to a solution of 122 mg of 60% sodium hydride in oil in 6 mL of DMF. After the addition of 110 μL of iodomethane, the reaction mixture is stirred at ambient temperature for 3 hours then added with a saturated aqueous solution of ammonium chloride. The aqueous phase is extracted with dichloromethane. The organic phase is dried over magnesium sulfate and concentrated under reduced pressure. The residue in solution in 12 ml of a dichloromethane-methanol mixture (1/3 by volume) is placed under a hydrogen atmosphere (1 bar) in the presence of 32 mg of palladium on carbon at 10% for 12 hours. After filtration on celite, the filtrate is concentrated under reduced pressure. After chromatography on a silica column with a 2M dichloromethane / methanol / ammonia mixture (gradient 100/0 to 90/10 by volume) as eluent, 46 mg of 2-dimethylamino-3-methyl-3H-benzoimidazol-5-amine is obtained in the form of a brown oil, the characteristics of which are as follows:
Spectre de R.M.N. (300 MHz, (CD3)2SO d6, δ en ppm) : 2,81 (s : 6H) ; 3,48 (s : 3H) ; 4,75 (mf : 2H) ; 6,40 (dd, J = 9 et 2,5 Hz : IH ) ; 6,46 (d, J = 2,5 Hz : IH) ; 7,05 (d, J = 9 Hz : IH) .NMR spectrum (300 MHz, (CD 3 ) 2 SO d6, δ in ppm): 2.81 (s: 6H); 3.48 (s: 3H); 4.75 (mf: 2H); 6.40 (dd, J = 9 and 2.5 Hz: 1 H); 6.46 (d, J = 2.5 Hz: 1 H); 7.05 (d, J = 9 Hz: 1 H).
Spectre de masse : EI(70eV) m/z=190 M+- pic de base m/z=175 [M - CH3]+- m/z=161 [175 - CH2]+' m/z=147 [M - C2H5N]+-Mass spectrum: EI (70eV) m / z = 190 M + - base peak m / z = 175 [M - CH 3 ] + - m / z = 161 [175 - CH 2 ] + 'm / z = 147 [M - C 2 H 5 N] + -
Le 2-diméthylamino-5-nitro-lH-benzoimidazole peut être préparé comme décrit à l'exemple précédent.2-Dimethylamino-5-nitro-1H-benzoimidazole can be prepared as described in the previous example.
o La l-diméthylamino-3-méthyl-isoquinoléin-7- amine (C24) peut être préparée en opérant de la manière suivante :o L-dimethylamino-3-methyl-isoquinoline-7-amine (C24) can be prepared by operating as follows:
190 mg de l-diméthylamino-3-méthyl-7-nitro- isoquinoléine en solution dans 12 L d'un mélange dichloromethane-méthanol (1/3 en volumes) sont placés sous atmosphère d'hydrogène (5 bars) en présence de 18 mg de palladium sur charbon à 10 % pendant 12 heures. Après filtration sur célite, le filtrat est concentré sous pression réduite. Après chromatographie sur colonne de silice avec un mélange dichlorométhane-méthanol/ammoniac 2M (gradient 100/0 à 90/10 en volumes) comme éluant, on obtient 42 mg de l-diméthylamino-3-méthyl-isoquinoléin-7- amine sous la forme d'une pâte orange dont les caractéristiques sont les suivantes : Spectre de R.M.N. ^E (300 MHz, (CD3)2SO d6, δ en ppm) : 2,37 (s : 3H) ; 2,90 (s : 6H) ; 5,42 (s large : 2H) ; 6,92 (s : IH) ; 7,03 (dd, J = 9 et 2,5 Hz : IH ) ; 7,09 (d, J = 2,5 Hz : IH) ; 7,45 (d, J = 9 Hz : IH) .190 mg of 1-dimethylamino-3-methyl-7-nitro-isoquinoline in solution in 12 L of a dichloromethane-methanol mixture (1/3 by volume) are placed under a hydrogen atmosphere (5 bars) in the presence of 18 mg of 10% palladium on carbon for 12 hours. After filtration on celite, the filtrate is concentrated under reduced pressure. After chromatography on a silica column with a 2M dichloromethane / methanol / ammonia mixture (gradient 100/0 to 90/10 by volume) as eluent, 42 mg of l-dimethylamino-3-methyl-isoquinoline-7-amine is obtained under the form of an orange paste with the following characteristics: ^ E NMR spectrum (300 MHz, (CD 3 ) 2 SO d6, δ in ppm): 2.37 (s: 3H); 2.90 (s: 6H); 5.42 (br s: 2H); 6.92 (s: 1H); 7.03 (dd, J = 9 and 2.5 Hz: 1 H); 7.09 (d, J = 2.5 Hz: 1 H); 7.45 (d, J = 9 Hz: 1 H).
Spectre de masseMass spectrum
EI ( 70eV) m/z=201 M+" pic de base m/ z=186 [M - CH3] +- m/z=172 [ 186 - CH2] +- m/ z=158 [M - C2H5N] +-EI (70eV) m / z = 201 M + "base peak m / z = 186 [M - CH 3 ] + - m / z = 172 [186 - CH 2 ] + - m / z = 158 [M - C 2 H 5 N] + -
DCI (NH3 ) m/ z=202 MH+ DCI (NH 3 ) m / z = 202 MH +
La l-diméthylamino-3-méthyl-7-nitro-isoquinoléine peut être préparée de la façon suivante : 810 mg de 2-(l- acétyl-2-oxo-propyl) -5-nitro-benzonitrile est chauffée à 40 °C pendant 16 heures dans 10 mL d'une solution aqueuse de diméthylamine à 40 %. Après retour à température ambiante, 30 mL d'une solution aqueuse d'acide chlorhydrique 2.5N sont additionnés puis la phase aqueuse est lavée avec de l'acétate d'éthyle. La phase aqueuse est ramenée à pH 9 par ajout d'une solution aqueuse de soude 5N et le précipité résultant est récupéré par filtration et séché sous pression réduite. On obtient ainsi 190 mg de l-diméthylamino-3-méthyl-7-nitro- isoquinoléine sous forme d'une poudre orange dont le spectre de masse est le suivant : EI(70eV) m/z=231 M+- pic de base m/z=216 [M - CH3]+- m/z=202 [216 - CH2]+- L-dimethylamino-3-methyl-7-nitro-isoquinoline can be prepared as follows: 810 mg of 2- (l-acetyl-2-oxo-propyl) -5-nitro-benzonitrile is heated to 40 ° C for 16 hours in 10 mL of a 40% aqueous dimethylamine solution. After returning to ambient temperature, 30 ml of a 2.5N aqueous hydrochloric acid solution are added and then the aqueous phase is washed with ethyl acetate. The aqueous phase is brought back to pH 9 by addition of a 5N aqueous sodium hydroxide solution and the resulting precipitate is recovered by filtration and dried under reduced pressure. 190 mg of l-dimethylamino-3-methyl-7-nitro-isoquinoline are thus obtained in the form of an orange powder, the mass spectrum of which is as follows: EI (70eV) m / z = 231 M + - base peak m / z = 216 [M - CH 3 ] + - m / z = 202 [216 - CH 2 ] + -
DCI(NH3) m/z=232 MH+ pic de base m/z=202 [M - NO]H+ DCI (NH 3 ) m / z = 232 MH + base peak m / z = 202 [M - NO] H +
Le 2- (l-acétyl-2-oxo-propyl) -5-nitro-benzonitrile peut être préparé comme décrit dans la littérature (Shinkai, H ; Ito,T. ; Iida, T. ; Kitao, Y. ; Yamada, H. ; Uchida, I. J. Med. Chem . 2000, 43 (24) , 4667-4677). o La 9-diméthylamino-acridin-2-amine (C26) peut être préparée en opérant de la manière suivante :2- (1-acetyl-2-oxo-propyl) -5-nitro-benzonitrile can be prepared as described in the literature (Shinkai, H; Ito, T .; Iida, T.; Kitao, Y.; Yamada, H.; Uchida, IJ Med. Chem. 2000, 43 (24), 4667-4677). o 9-dimethylamino-acridin-2-amine (C26) can be prepared by operating as follows:
385 mg de 9-phénoxy-acridin-2-amine sont chauffés à 120 °C pendant 15 heures dans 12 mL d'une solution 2M de diméthylamine dans le THF. Après retour à température ambiante et concentration sous pression réduite, du dichloromethane est additionné et la phase organique est lavée avec une solution aqueuse de soude IN puis séchée sur sulfate de magnésium et concentrée sous pression réduite. Après chromatographie sur colonne de silice avec un mélange dichloromethane-méthanol (gradient 100/0 à 95/5 en volumes) comme éluant, on obtient 47 mg de 9-diméthylamino-acridin-2-amine sous forme d'une laque jaune dont les caractéristiques sont les suivantes :385 mg of 9-phenoxy-acridin-2-amine are heated at 120 ° C for 15 hours in 12 mL of a 2M solution of dimethylamine in THF. After returning to ambient temperature and concentration under reduced pressure, dichloromethane is added and the organic phase is washed with an aqueous solution of IN sodium hydroxide then dried over magnesium sulfate and concentrated under reduced pressure. After chromatography on a silica column with a dichloromethane-methanol mixture (gradient 100/0 to 95/5 by volume) as eluent, 47 mg of 9-dimethylamino-acridin-2-amine is obtained in the form of a yellow lacquer, the features are:
Spectre de R.M.N. R (300 MHz, (CD3)2SO d6, δ en ppm) : 3,22 (s : 6H) ; 5,77 (s large : 2H) ; 7,15 (d, J = 2,5 Hz : IH) ; 7,31 (dd, J = 9 et 2, 5 Hz : IH ) ; 7,45 (t large, J = 8 Hz : IH) ; 7,59 (t large, J = 8 Hz : IH) ; 7,86 (d, J = 9 Hz : IH) ; 7,98 (d large, J = 8 Hz : IH) ; 8,17 (d large, J = 8 Hz : IH) .NMR spectrum R (300 MHz, (CD 3 ) 2 SO d6, δ in ppm): 3.22 (s: 6H); 5.77 (br s: 2H); 7.15 (d, J = 2.5 Hz: 1 H); 7.31 (dd, J = 9 and 2.5 Hz: 1 H); 7.45 (broad t, J = 8 Hz: 1 H); 7.59 (broad t, J = 8 Hz: 1 H); 7.86 (d, J = 9 Hz: 1 H); 7.98 (broad d, J = 8 Hz: 1 H); 8.17 (broad d, J = 8 Hz: 1 H).
Spect re de masse :Mass spectrum:
El ( 70eV) m/z=237 M+- pic de base m/z=222 [M - CH3] +- m/z=207 [222 - CH3 ] +- m/z=195 [ 222 - HCN] + El (70eV) m / z = 237 M + - base peak m / z = 222 [M - CH 3 ] + - m / z = 207 [222 - CH 3 ] + - m / z = 195 [222 - HCN ] +
DCI (NH3) m/z=238 MH+ DCI (NH 3 ) m / z = 238 MH +
La 9-phénoxy-acridin-2-amine peut être préparée de la façon suivante : 494 mg de 9-phénoxy-acridin-2- trifluoroacétamide en solution dans 50 mL de méthanol est additionnée de 3 mL d'eau et de 940 mg de carbonate de potassium. Le milieu réactionnel est porté au reflux pendant 5 heures. Après retour à température ambiante et concentration sous pression réduite, de l'eau est additionnée et la phase aqueuse est extraite avec du dichloromethane. La phase organique est séchée sur sulfate de magnésium et concentrée sous pression réduite. On obtient ainsi 385 mg de 9-phénoxy-acridin-2-amine sous forme d'une mouse orange dont le spectre de masse est le suivant :The 9-phenoxy-acridin-2-amine can be prepared as follows: 494 mg of 9-phenoxy-acridin-2-trifluoroacetamide in solution in 50 ml of methanol is added with 3 ml of water and 940 mg of potassium carbonate. The reaction medium is brought to reflux for 5 hours. After returning to ambient temperature and concentration under reduced pressure, water is added and the aqueous phase is extracted with dichloromethane. The organic phase is dried over magnesium sulfate and concentrated under reduced pressure. 385 mg of 9-phenoxy-acridin-2-amine are thus obtained in the form of an orange mouse, the mass spectrum of which is as follows:
EI ( 70eV) m/z=286 M+- pic de base m/z=209 [M - C6H5] + EI (70eV) m / z = 286 M + - base peak m / z = 209 [M - C 6 H 5 ] +
DCI (NH3 ) m/z=287 MH+ DCI (NH 3 ) m / z = 287 MH +
La 9-phénoxy-acridin-2-trifluoroacétamide peut être préparée de la façon suivante : 770 mg de 9-chloro- acridin-2-trifluoroacétamide est chauffé à 100 °C pendant 15 heures dans 2.23 g de phénol.- Après retour à température ambiante, du dichloromethane est additionné et la phase organique est lavée successivement avec une solution -aqueuse de soude IN et de l'eau, puis est séchée sur sulfate de magnésium- et concentrée sous pression réduite. On obtient ainsi 594 mg de 9-phénoxy-acridin-2- trifluoroacétamide sous forme d'une poudre rouge dont le spectre de masse est le suivant :The 9-phenoxy-acridin-2-trifluoroacetamide can be prepared as follows: 770 mg of 9-chloro-acridin-2-trifluoroacetamide is heated at 100 ° C. for 15 hours in 2.23 g of phenol. ambient, dichloromethane is added and the organic phase is washed successively with an aqueous solution of IN sodium hydroxide and water, then is dried over magnesium sulphate and concentrated under reduced pressure. 594 mg of 9-phenoxy-acridin-2-trifluoroacetamide are thus obtained in the form of a red powder, the mass spectrum of which is as follows:
DCI(NH3) m/z=383 MH+ m/z=287 M'H+ autre produit ( M - COCF3 + H )DCI (NH 3 ) m / z = 383 MH + m / z = 287 M'H + other product (M - COCF 3 + H)
Le 9-chloro-acridin-2-trifluoroacétamide peut être préparé de la façon suivante : Une solution de 725 mg de 2-trifluoroacétamido-acridone dans 7 mL de P0C13 est portée au reflux pendant 30 minutes. Après retour à température ambiante et concentration sous pression réduite, une solution aqueuse saturée en hydrogénocarbonate de sodium est additionnée et le précipité résultant est récupéré par filtration, lavé avec de l'eau puis séché sous pression réduite. On obtient ainsi 770 mg 9-chloro-acridin-2- trifluoroacétamide sous forme d'une poudre jaune dont le spectre de masse est le suivant :9-chloro-acridin-2-trifluoroacetamide can be prepared as follows: A solution of 725 mg of 2-trifluoroacetamido-acridone in 7 ml of P0C1 3 is brought to reflux for 30 minutes. After returning to ambient temperature and concentration under reduced pressure, a saturated aqueous solution of sodium hydrogencarbonate is added and the resulting precipitate is recovered by filtration, washed with water and then dried under reduced pressure. 770 mg 9-chloro-acridin-2- is thus obtained trifluoroacetamide in the form of a yellow powder with a mass spectrum as follows:
EI(70eV) m/z=324 M+" pic de base m/z=254 [M - HCF3]+- m/z=227 [M - COCF3]+- m/z=200 [227 - HCN]+- m/z=164 [200 - HC1]+"EI (70eV) m / z = 324 M + "base peak m / z = 254 [M - HCF 3 ] + - m / z = 227 [M - COCF 3 ] + - m / z = 200 [227 - HCN ] + - m / z = 164 [200 - HC1] + "
La 2-trifluoroacétamido-acridone peut être préparée de la façon suivante : à 400 mg de 2-aminoacridone en solution dans 6.5 mL de dichloromethane à 0°C, sont additionnés 535 μL de triéthylamine, 405 μL d'anhydride trifluoroacétique et 13 mg de DMAP. Le mélange réactionnel est agité à température ambiante pendant 15 heures. Après concentration sous pression réduite, de l'eau est additionnée et le précipité résultant est récupéré par filtration puis séché sous- pression réduite. On obtient ainsi 580 mg de 2-trifluoroacétamido-acridone sous forme d'une poudre jaune dont le spectre de masse est le suivant : EI(70eV) m/z=306 M+" pic de base m/z=237 [M - CF3]+- m/z=209 [237 - CO ]+1 2-trifluoroacetamido-acridone can be prepared as follows: to 400 mg of 2-aminoacridone in solution in 6.5 mL of dichloromethane at 0 ° C, are added 535 μL of triethylamine, 405 μL of trifluoroacetic anhydride and 13 mg of DMAP. The reaction mixture is stirred at room temperature for 15 hours. After concentration under reduced pressure, water is added and the resulting precipitate is recovered by filtration and then dried under reduced pressure. 580 mg of 2-trifluoroacetamido-acridone is thus obtained in the form of a yellow powder, the mass spectrum of which is as follows: EI (70eV) m / z = 306 M + "base peak m / z = 237 [M - CF 3 ] + - m / z = 209 [237 - CO] +1
o La l-diméthyiamino-3-méthyl-isoquinoléin-7- amine (C24) peut être préparée en opérant de la manière suivante :o L-dimethyiamino-3-methyl-isoquinoline-7-amine (C24) can be prepared by operating as follows:
190 mg de l-diméthylamino-3-méthyl-7-nitro- isoquinoléine en solution dans 12 mL d'un mélange dichloromethane-méthanol (1/3 en volumes) est placée sous atmosphère' d'hydrogène (5 bars) en présence de 18 mg de palladium sur charbon à 10 % pendant 12 heures. Après filtration sur célite, le filtrat est concentré sous pression réduite. Après chromatographie sur colonne de silice avec un mélange dichlorométhane-méthanol/ammoniac 2M (gradient 100/0 à 90/10 en volumes) comme éluant, on obtient 42 mg de l-diméthylamino-3-méthyl-isoquinoléin-7- amine sous la forme d'une pâte orange dont les caractéristiques sont les suivantes : Spectre de R.M.N. IJH (300 MHz, (CD3)2SO d6, δ en ppm) : 2,37 (s : 3H) ; 2,90 (s : 6H) ; 5,42 (s large :190 mg of l-dimethylamino-3-methyl-7-nitro-isoquinoline, in solution in 12 mL of a mixture dichloromethane-methanol (1/3 by volume) is placed under atmosphere 'of hydrogen (5 bar) in the presence of 18 mg of 10% palladium on carbon for 12 hours. After filtration on celite, the filtrate is concentrated under reduced pressure. After chromatography on a silica column with a dichloromethane-methanol / ammonia mixture 2M (gradient 100/0 to 90/10 by volume) as eluent, 42 mg of l-dimethylamino-3-methyl-isoquinoline-7-amine are obtained in the form of an orange paste, the characteristics of which are the following: Spectrum 1 H NMR (300 MHz, (CD 3 ) 2 SO d6, δ in ppm): 2.37 (s: 3H); 2.90 (s: 6H); 5.42 (s wide:
2H) ; 6,92 (s : IH) ; 7,03 (dd, J = 9 et 2,5 Hz : IH ) ;2H); 6.92 (s: 1H); 7.03 (dd, J = 9 and 2.5 Hz: 1 H);
7,09 (d, J = 2,5 Hz : IH) ; 7,45 (d, J = 9 Hz : IH) .7.09 (d, J = 2.5 Hz: 1 H); 7.45 (d, J = 9 Hz: 1 H).
Spectre de masse : EI(70eV) m/z=201 M+- pic de base m/z=186 [M - CH3]+- m/z=172 [186 - CH2]+- m/z=158 [M - CH5N]+- DCI (NH3) m/z=202 MH+ Mass spectrum: EI (70eV) m / z = 201 M + - base peak m / z = 186 [M - CH 3 ] + - m / z = 172 [186 - CH 2 ] + - m / z = 158 [M - CH 5 N] + - DCI (NH 3 ) m / z = 202 MH +
La l-diméthylamino-3-méthyl-7-nitro-isoquinoléine peut être préparée de la façon suivante : 810 mg de 2-(l- acétyl-2-oxo-propyl) -5-nitro-benzonitrile est chauffée à 40°C pendant 16 heures dans 10 mL d'une solution aqueuse de diméthylamine à 40 %. Après retour à température ambiante, 30 mL d'une solution aqueuse d'acide chlorhydrique 2.5N sont additionnés puis la phase aqueuse est lavée avec de l'acétate d'éthyle. La phase aqueuse est ramenée à pH 9 par ajout d'une solution aqueuse de soude 5N et le précipité résultant est récupéré par filtration et séché sous pression réduite. On obtient ainsi 190 mg de l-diméthylamino-3-méthyl-7-nitro- isoquinoléine sous forme d' une poudre orange dont le spectre de masse est le suivant :L-dimethylamino-3-methyl-7-nitro-isoquinoline can be prepared as follows: 810 mg of 2- (l-acetyl-2-oxo-propyl) -5-nitro-benzonitrile is heated to 40 ° C for 16 hours in 10 mL of a 40% aqueous dimethylamine solution. After returning to ambient temperature, 30 ml of a 2.5N aqueous hydrochloric acid solution are added and then the aqueous phase is washed with ethyl acetate. The aqueous phase is brought back to pH 9 by addition of a 5N aqueous sodium hydroxide solution and the resulting precipitate is recovered by filtration and dried under reduced pressure. 190 mg of l-dimethylamino-3-methyl-7-nitro-isoquinoline are thus obtained in the form of an orange powder, the mass spectrum of which is as follows:
EI(70eV) m/z=231 M+> pic de base m/z=216 [M - CH3]+I m/z=202 [216 - CH2]+-EI (70eV) m / z = 231 M +> basic peak m / z = 216 [M - CH 3 ] + I m / z = 202 [216 - CH 2 ] + -
DCI(NH3) m/z=232 MH+ pic de base m/z=202 [M - NO]H+ Le 2- (l-acétyl-2-oxo-propyl) -5-nitro-benzonitrile peut être préparé comme décrit dans la littérature (Shinkai, H ; Ito,T. ; Iida, T. ; Kitao, Y. ; Yamada, H. ; Uchida, I. J. Med. Chem. 2000, 43 ( 24 ) , 4667-4677)DCI (NH 3 ) m / z = 232 MH + base peak m / z = 202 [M - NO] H + 2- (1-acetyl-2-oxo-propyl) -5-nitro-benzonitrile can be prepared as described in the literature (Shinkai, H; Ito, T .; Iida, T.; Kitao, Y.; Yamada, H.; Uchida, IJ Med. Chem. 2000, 43 (24), 4667-4677)
• Les produits dans lesquels C représente un radical [1- (2-diméthylamino-éthyl) -1H- indol-5-yl] àmino peuvent être préparés par alkylation des produits correspondants dans lesquels C représente un radical (1H- indol-5-yl) amino, lesquels sont eux mêmes préparés en opérant comme à l'exemple 185, en opérant dans les conditions ci- dessous :• The products in which C represents a radical [1- (2-dimethylamino-ethyl) -1H- indol-5-yl] àmino can be prepared by alkylation of the corresponding products in which C represents a radical (1H- indol-5- yl) amino, which are themselves prepared by operating as in Example 185, operating under the conditions below:
A une suspension de 0.22 mmol d'hydrure de sodium dans 1.5 L de DMF sous argon est additionné 0.2 mmol du produit dans lequels C représente un radical (lH-indol-5- yl) amino. Le mélange réactionnel est agité à température ambiante jusqu'à fin du dégagement gazeux. Une solution de 0.22 mmol de chlorure de diméthylaminoéthyle dans 0.5 mL de DMF est alors additionnée, solution elle-même obtenue par addition de 0.22 mmol de chlorhydrate de chlorure de diméthylaminoéthyle dans une suspension de 0.24 mmol d'hydrure de sodium dans le DMF. A complétion de la réaction, le mélange réactionnel est hydrolyse par une solution aqueuse saturée en chlorure d'ammonium. La phase aqueuse ainsi obtenue est extraite avec du dichloromethane et la phase organique est séchée sur sulfate de magnésium puis concentrée sous pression réduite. Le produit correspondant dans lesquels C représente un radical [1- (2-diméthylamino-éthyl) -1H- indol-5-yl] amino est ainsi obtenu après purification sur silice. • Les produits dans lesquels C représente un radical [1- (2-diméthylamino-éthyl) -1H- indol-5-yl] amino peuvent également être préparés à partir des produits correspondants dans lesquels C représente un radical ( [1- (2-hydroxy-éthyl) -lH-indol- 5-yl] amino en opérant dans les conditions ci-dessous :To a suspension of 0.22 mmol of sodium hydride in 1.5 L of DMF under argon is added 0.2 mmol of the product in which C represents an amino radical (1H-indol-5-yl). The reaction mixture is stirred at room temperature until the evolution of gas has ended. A solution of 0.22 mmol of dimethylaminoethyl chloride in 0.5 ml of DMF is then added, the solution itself obtained by adding 0.22 mmol of dimethylaminoethyl chloride hydrochloride in a suspension of 0.24 mmol of sodium hydride in DMF. On completion of the reaction, the reaction mixture is hydrolyzed with a saturated aqueous solution of ammonium chloride. The aqueous phase thus obtained is extracted with dichloromethane and the organic phase is dried over magnesium sulfate and then concentrated under reduced pressure. The corresponding product in which C represents a [1- (2-dimethylamino-ethyl) -1H-indol-5-yl] amino radical is thus obtained after purification on silica. • The products in which C represents a [1- (2-dimethylamino-ethyl) -1H-indol-5-yl] amino radical can also be prepared from the corresponding products in which C represents a ([1- (2 -hydroxy-ethyl) -lH-indol- 5-yl] amino by operating under the conditions below:
A une solution de 0.2 mmol du produit dans lequels C représente un radical ( [1- (2-hydroxy-éthyl) -lH-indol-5- yl] amino dans 3 mL d'un mélange dichlorométhane-THF (2/1 en volumes), est additionné 0.24 mmol de triéthylamine ainsi que 0.22 mmol de chlorure de méthanesulfonyle. Après completion de la réaction et concentration sous pression réduite, le résidu . obtenu est hydrolyse par addition d'eau et le pH de la phase aqueuse est amené à 8 par addition d'une solution aqueuse d'ammoniaque à 28 %. Le précipité résultant est récupéré par filtration, séché, puis remis en solution dans 3 mL de méthanol et additionné de 1 mL d'une solution 2M de diméthylamine dans le méthanol. Après chauffage à 80 °C pendant 15 heures dans un autoclave, le mélange réactionnel est concentré sous pression réduite puis purifié pour conduire au produit dans lesquels C représente un radical [1- (2-diméthylamino-éthyl) -lH-indol-5-yl] amino.To a solution of 0.2 mmol of the product in which C represents a radical ([1- (2-hydroxy-ethyl) -lH-indol-5-yl] amino in 3 ml of a dichloromethane-THF mixture (2/1 in 0.24 mmol of triethylamine and 0.22 mmol of methanesulfonyl chloride are added) After completion of the reaction and concentration under reduced pressure, the residue obtained is hydrolyzed by addition of water and the pH of the aqueous phase is brought to 8 by addition of a 28% aqueous ammonia solution The resulting precipitate is recovered by filtration, dried, then redissolved in 3 ml of methanol and added with 1 ml of a 2M solution of dimethylamine in methanol. After heating at 80 ° C for 15 hours in an autoclave, the reaction mixture is concentrated under reduced pressure and then purified to yield the product in which C represents a radical [1- (2-dimethylamino-ethyl) -lH-indol-5- yl] amino.
• Les produits dans lesquels C représente un radical ( [1- (2-hydroxy-éthyl) -lH-indol-5- yl] amino sont eux-mêmes préparés en opérant comme à l'exemple 185 à partir du 5-amino-l- (2-hydroxy-éthyl) -indole, lui- même pouvant être préparé en opérant dans les conditions suivantes : Le 5-nitro-l- (2-hydroxy-éthyl) -indole peut être préparé de la façon suivante : Une solution de 1 mmol de 5-nitro-l- (2-tert-butyldiméthylsilyloxy-éthyl) -indole dans 2 L de méthanol contenant 120 μL d'une solution aqueuse concentrée en acide chlorhydrique (37 % w/w) est agitée à température ambiante pendant 15 heures. Le mélange réactionnel est alors additionné de 1 L d'une solution aqueuse d' amonniaque à 28 % puis concentré sous pression réduite. Le 5-nitro-l- (2-hydroxy-éthyl) -indole est ainsi obtenu après purification sur silice.• The products in which C represents a radical ([1- (2-hydroxy-ethyl) -lH-indol-5-yl] amino are themselves prepared by operating as in Example 185 from 5-amino- l- (2-hydroxy-ethyl) -indole, itself can be prepared by operating under the following conditions: 5-nitro-1- (2-hydroxy-ethyl) -indole can be prepared as follows: A solution of 1 mmol of 5-nitro-1- (2-tert-butyldimethylsilyloxy-ethyl) -indole in 2 L of methanol containing 120 μL of an aqueous solution concentrated in hydrochloric acid (37% w / w) is stirred at room temperature for 15 hours. The reaction mixture is then added with 1 L of a 28% aqueous ammonia solution and then concentrated under reduced pressure. 5-nitro-1- (2-hydroxy-ethyl) -indole is thus obtained after purification on silica.
Le 5-nitro-l- (2-tert-butyldiméthylsilyloxy-éthyl) - indole peut être préparé de la façon suivante : A une suspension de 1.1 mmol d'hydrure de sodium dans 2 mL de DMF sous argon est additionné 1 mmol de 5-nitroindole . Le mélange réactionnel est agité à température ambiante jusqu'à fin du dégagement gazeux puis 1.2 mmol deThe 5-nitro-1- (2-tert-butyldimethylsilyloxy-ethyl) - indole can be prepared as follows: To a suspension of 1.1 mmol of sodium hydride in 2 ml of DMF under argon is added 1 mmol of 5 -nitroindole. The reaction mixture is stirred at ambient temperature until the evolution of gas has ended and then 1.2 mmol of
(2-bromoéthoxy) -tert-butyldiméthylsilane est additionné.(2-bromoethoxy) -tert-butyldimethylsilane is added.
A completion de la réaction, le mélange réactionnel est hydrolyse par une solution aqueuse saturée en chlorure d'ammonium. La phase aqueuse ainsi obtenue est extraite avec du dichloromethane et la phase organique est séchée sur sulfate de magnésium puis concentrée sous pression réduite. Le 5-nitro-l- (2-tert-butyldiméthylsilyloxy- éthyl) -indole est ainsi obtenu après purification sur silice.Upon completion of the reaction, the reaction mixture is hydrolyzed with a saturated aqueous solution of ammonium chloride. The aqueous phase thus obtained is extracted with dichloromethane and the organic phase is dried over magnesium sulfate and then concentrated under reduced pressure. 5-nitro-1- (2-tert-butyldimethylsilyloxyethyl) -indole is thus obtained after purification on silica.
• Les produits dans lesquels C représente un radical 4- [2- (pyrrolidin-1-yl) éthyl]pipérazin-1-yl (A14) ou 4- [2- (pyrrolidin-1-yl) éthyl] homopipérazin-1-yl (A15) ou 4- [2- (lH-imidazol-1-yl) éthyl] homopipérazin-1-yl (A16) ou ' 4- [2- (IH-imidazol-l-yl) éthyl]pipérazin-1-yl (A17), ou 4- [3- (IH-imidazol-l-yl) propyl] homopipé-razin-1-yl (A18) ou 4- [3- (lH-imidazol-l-yl)propyl]pipérazin-l-yl (A19) ou 4- [2- (2-phényl-l-H-imidazol-l-yl) éthyl] homopipérazin-1-yl (A20), ou 4-[2-(2-ρhényl-l-H-imidazol-l-yl)éthyl] pipérazin-1-yl (A21) , ou 4- [3- (2-phényl-l-H-imidazol-l- yl) propyl] homopipérazin-1-yl (A22), ou 4- [3- (2-phényl-l- H-imidazol-1-yl) propyl] pipérazin-1-yl (A23) , ou 4-[2- (morpholin-1-yl) éthyl] homopipérazin-1-yl (A24) ou 4- [2- (morpholin-1-yl) éthyl] pipérazin-1-yl (A25) ou 4- [3- (morpholin-1-yl) propyl] homopipérazin-1-yl (A26) ou 4- [3- (morpholin-1-yl) propyl] pipérazin-1-yl (A27) ou 4-[2-(lH- imidazo [4, 5b] pyridin-1-yl) éthyl] homopipérazin-1-yl (A28) ou 4- [2- (1-H-imidazo [4, 5b]pyridin-l-yl) éthyl] pipérazin-1- yl (A29) ou 4- [3- (1-H-imidazo [4, 5b] pyridin-1-yl) propyl] homopipérazin-1-yl (A30) ou 4- [3- (1-H-imidazo [4, 5b] pyridin-1-yl) propyl] pipérazin-1-yl (A31) ou 4-[2-(lH- benzoimidazol-1-yl) éthyl] homopipérazin-1-yl (A32) ou 4- [2- (1-H-benzoimidazol-l-yl) éthyl] pipérazin-1-yl (A33) ou 4- [3- (1-H-benzoimidazol-l-yl) propyl] homopipérazin-1-yl• Products in which C represents a 4- [2- (pyrrolidin-1-yl) ethyl] piperazin-1-yl (A14) or 4- [2- (pyrrolidin-1-yl) ethyl] homopiperazin-1- radical yl (A15) or 4- [2- (1H-imidazol-1-yl) ethyl] homopiperazin-1-yl (A16) or ' 4- [2- (IH-imidazol-1-yl) ethyl] piperazin-1 -yl (A17), or 4- [3- (IH-imidazol-1-yl) propyl] homopipé-razin-1-yl (A18) or 4- [3- (1H-imidazol-1-yl) propyl] piperazin-1-yl (A19) or 4- [2- (2-phenyl-1H-imidazol-1-yl) ethyl] homopiperazin-1-yl (A20), or 4- [2- (2-ρhenyl-1H -imidazol-l-yl) ethyl] piperazin-1-yl (A21), or 4- [3- (2-phenyl-1H-imidazol-1-yl) propyl] homopiperazin-1-yl (A22), or 4- [3- (2-phenyl- l- H-imidazol-1-yl) propyl] piperazin-1-yl (A23), or 4- [2- (morpholin-1-yl) ethyl] homopiperazin-1-yl (A24) or 4- [2- (morpholin-1-yl) ethyl] piperazin-1-yl (A25) or 4- [3- (morpholin-1-yl) propyl] homopiperazin-1-yl (A26) or 4- [3- (morpholin-1 -yl) propyl] piperazin-1-yl (A27) or 4- [2- (1H- imidazo [4, 5b] pyridin-1-yl) ethyl] homopiperazin-1-yl (A28) or 4- [2- (1-H-imidazo [4, 5b] pyridin-1-yl) ethyl] piperazin-1- yl (A29) or 4- [3- (1-H-imidazo [4, 5b] pyridin-1-yl) propyl] homopiperazin-1-yl (A30) or 4- [3- (1-H-imidazo [4, 5b] pyridin-1-yl) propyl] piperazin-1-yl (A31) or 4- [2- ( 1H-benzoimidazol-1-yl) ethyl] homopiperazin-1-yl (A32) or 4- [2- (1-H-benzoimidazol-1-yl) ethyl] piperazin-1-yl (A33) or 4- [3 - (1-H-benzoimidazol-l-yl) propyl] homopiperazin-1-yl
(A34) ou 4- [3- (l-H-benzoimidazol-l-yl)propyl]pipé-razin- 1-yl (A35) ou 4- [2- (2-hydroxyméthyl-lH-benzoimidazol-l- yl) éthyl] homopipérazin-1-yl (A36) ou 4- [2- (2-hydroxy- méthyl-1-H-benzoimidazol-l-yl) éthyl] pipé-razin-1-yl (A37) ou 4- [3- (2-hydroxyméthyl-l-H-benzoimidazol-l-yl) propyl] homopipérazin-1-yl (A38) ou 4- [3- (2-hydroxyméthyl-l-H- benzoimidazol-1-yl) propyl] pi-pérazin-1-yl (A39) ou 4- [2- (lH-imidazol-2-yl) amino-éthyl] homopipérazin-1-yl (A40) ou 4- [2- (l-H-imidazol-2-yl) amino-éthyl] pipérazin-1-yl (A41) ou 4- [3- (l-H-imidazol-2-yl) amino-propyl] homopiρérazin-1- yl (A42) ou 4- [3- (l-H-imidazol-2-yl) amino-propyl] pipérazin-1-yl (A43) ou 4-{2- [2- (lH-imidazol-2-yl) -1- hydroxyméthyl-éthyl] amino-éthyl}homopipérazin-l-yl (A44) ou 4-{2- [2- (lH-imidazol-2-yl) -1-hydroxyméthyl-éthyl] amino-éthyl }pipérazin-l-yl (A45) ou 4-{ 3- [2- (lH-imidazol- 2-yl) -1-hydroxyméthyl-éthyl] amino-propyl}homopipérazin-l- yl (A46) ou 4-{3- [2- (lH-imidazol-2-yl) -1-hydroxyméthyl- éthyl] amino-propyl }pipérazin-l-yl (A47) .(A34) or 4- [3- (1H-benzoimidazol-1-yl) propyl] pipé-razin- 1-yl (A35) or 4- [2- (2-hydroxymethyl-1H-benzoimidazol-1-yl) ethyl ] homopiperazin-1-yl (A36) or 4- [2- (2-hydroxy-methyl-1-H-benzoimidazol-1-yl) ethyl] pipé-razin-1-yl (A37) or 4- [3- (2-hydroxymethyl-1H-benzoimidazol-1-yl) propyl] homopiperazin-1-yl (A38) or 4- [3- (2-hydroxymethyl-1H-benzoimidazol-1-yl) propyl] pi-perazin-1- yl (A39) or 4- [2- (1H-imidazol-2-yl) amino-ethyl] homopiperazin-1-yl (A40) or 4- [2- (1H-imidazol-2-yl) amino-ethyl] piperazin-1-yl (A41) or 4- [3- (1H-imidazol-2-yl) amino-propyl] homopiperazin-1- yl (A42) or 4- [3- (1H-imidazol-2-yl) amino-propyl] piperazin-1-yl (A43) or 4- {2- [2- (1H-imidazol-2-yl) -1-hydroxymethyl-ethyl] amino-ethyl} homopiperazin-1-yl (A44) or 4- {2- [2- (1H-imidazol-2-yl) -1-hydroxymethyl-ethyl] amino-ethyl} piperazin-1-yl (A45) or 4- {3- [2- (1H-imidazol- 2-yl) -1-hydroxymethyl-ethyl] amino-propyl} homopiperazin-1-yl (A46) or 4- {3- [2- (1H-imidaz ol-2-yl) -1-hydroxymethyl-ethyl] amino-propyl} piperazin-1-yl (A47).
Les aminés nécessaires pour l'introduction des radicaux de type A de formule générale (lb) , sont • soit commerciaux : o 1- (2-pyrrolidinoéthyl) pipérazine (A14) o 1- (2-morpholinoéthyl) pipérazine (A25) o 1- (3-morpholinopropy) pipérazine (A27)The amines necessary for the introduction of type A radicals of general formula (lb) are • either commercial: o 1- (2-pyrrolidinoethyl) piperazine (A14) o 1- (2-morpholinoethyl) piperazine (A25) o 1- (3-morpholinopropy) piperazine (A27)
• soit préparés comme écrit dans la littérature : o 1- (2-lH-imidazolo-l-éthy) pipérazine (A17) selon• either prepared as written in the literature: o 1- (2-1H-imidazolo-1-ethy) piperazine (A17) according to
WO 0196323 o 1- (3-lH-imidazolo-l-propyl) pipérazine (A19) selon l'Eur. Pat. Appl. EP 350145WO 0196323 o 1- (3-1H-imidazolo-1-propyl) piperazine (A19) according to Eur. Pat. Appl. EP 350145
• soit préparés comme ci-dessous :• be prepared as below:
Il est attendu que les produits peuvent être avantageusement préparés par synthèse parallèle en phase solide. Dans ce cas il est particulièrement avantageux de produire en premier le groupe A, en opérant de la manière suivante :It is expected that the products can be advantageously prepared by parallel synthesis in solid phase. In this case, it is particularly advantageous to produce group A first, by operating as follows:
o. Dans un tricol de 100 mL on ajoute successivement 5 g de résine de Wang substituée par un groupe imidazole carbonyle (préparé selon Wang et Hauske Tetrahedron Letters, 1997, , 37, 6529-32), 50 mL de tétrahydrofurane et 1,44 g du 2- (1, 4-diazepan-l-yl) ethan-1-ol. On agite la réaction avec un agitateur magnétique. Après 14 heures, on filtre et lave successivement avec du THF six fois. On ajoute le produit obtenu ci-dessus dans un tricol de 50 ml. On ajoute successivement 50 ml de pyridine, et 1,91 g de chlorure de para-toluènesulfonyle. On agite la réaction avec un agitateur magnétique. Après 14 heures, on filtre et lave successivement avec de la pyridine 1 fois et puis avec du THF six fois. On ajoute le produit obtenu ci-dessus dans un tricol de 50 ml. On ajoute successivement 50 ml de DMF et 1,2 g d' imidazole. On agite la réaction avec un agitateur magnétique en chauffant vers 80 °C. Après 14 heures, on filtre et lave successivement avec du DMF 2 fois et puis avec du THF six fois. On ajoute le produit obtenu ci-dessus dans un ballon de 25 ml. On ajoute 25 mL du TFA. On agite. Après 1,5 heure on filtre la réaction. On garde le filtrat et lave le solide avec 20 Ml du CH2C12. On mélange les filtrats et on sèche. On obtient le sel TFA du 4- [2- (IH-imidazol-l-yl) éthyl] homopipérazin-1-yl (Al6) .o . 5 g of Wang resin substituted by a carbonyl imidazole group (prepared according to Wang and Hauske Tetrahedron Letters, 1997,, 37, 6529-32), 50 ml of tetrahydrofuran and 1.44 g of 2- (1, 4-diazepan-1-yl) ethan-1-ol. The reaction is stirred with a magnetic stirrer. After 14 hours, filter and wash successively with THF six times. The product obtained above is added to a 50 ml three-necked flask. 50 ml of pyridine and 1.91 g of para-toluenesulfonyl chloride are successively added. The reaction is stirred with a magnetic stirrer. After 14 hours, filter and wash successively with pyridine 1 time and then with THF six times. The product obtained above is added to a 50 ml three-necked flask. We successively add 50 ml of DMF and 1.2 g of imidazole. The reaction is stirred with a magnetic stirrer while heating to 80 ° C. After 14 hours, filter and wash successively with DMF 2 times and then with THF six times. The product obtained above is added to a 25 ml flask. 25 mL of TFA are added. We stir. After 1.5 hours the reaction is filtered. The filtrate is kept and the solid is washed with 20 ml of CH 2 C1 2 . The filtrates are mixed and dried. The TFA salt of 4- [2- (1H-imidazol-1-yl) ethyl] homopiperazin-1-yl (A1 6) is obtained.
Exemple 204Example 204
Les activités G-quartet , antitélomérase et cytotoxique des différents composés exemplifies 1 à 176, données dans le tableau 1 sont déterminées selon les protocoles opératoires décrits ci-avant . The G-quartet, antitelomerase and cytotoxic activities of the various compounds exemplified 1 to 176, given in Table 1 are determined according to the operating protocols described above.

Claims

REVENDICATIONS
1 - Composés fixant la structure G-quadruplex d'ADN ou d'ARN caractérisés en ce qu'ils répondent à la formule générale suivante : cycle aromatique azoté - NR3 - répartiteur - NR'3 - cycle aromatique dans laquelle1 - Compounds fixing the G-quadruplex structure of DNA or RNA characterized in that they correspond to the following general formula: nitrogen aromatic cycle - NR 3 - distributor - NR ' 3 - aromatic cycle in which
• le cycle aromatique azoté, représente :• the nitrogen aromatic cycle, represents:
0 une quinoléine ou isoquinoléine éventuellement substituée par au moins un radical choisi parmi un groupe N(Ra) (Rb) dans lequel Ra et Rb, identiques ou différents représentent l'hydrogène ou un radical alkyle en C1-C4, et un ou plusieurs groupe (s) alkoxy ou alkyle à chaîne courte en C1-C4 lié (s) à un atome de carbone ou d'azote du cycle quinoléine ou isoquinoléine ou0 a quinoline or isoquinoline optionally substituted by at least one radical chosen from a group N (Ra) (Rb) in which Ra and Rb, identical or different, represent hydrogen or a C1-C4 alkyl radical, and one or more group (s) alkoxy or C1-C4 short chain alkyl linked (s) to a carbon or nitrogen atom of the quinoline or isoquinoline ring or
0 une quinoléine ou isoquinoléine possédant un atome d'azote sous forme quaternaire ou0 a quinoline or isoquinoline having a nitrogen atom in quaternary form or
0 une benzamidine ou 0 une pyridine0 a benzamidine or 0 a pyridine
• le cycle aromatique représente• the aromatic cycle represents
0 une quinoléine. ou isoquinoléine éventuellement substituée par au moins un radical choisi parmi un groupe N(Ra) (Rb) dans lequel Ra et Rb, identiques ou différents représentent l'hydrogène ou un radical alkyle en χi-C4, et un ou plusieurs groupe (s) alkoxy ou alkyle à chaîne courte en C1-C4 lié (s) à un atome de carbone ou d' azote du cycle quinoléine ou isoquinoléine ou Φ une quinoléine ou isoquinoléine possédant un atome d'azote sous forme quaternaire ou 0 une benzamidine ou0 a quinoline. or isoquinoline optionally substituted by at least one radical chosen from a group N (Ra) (Rb) in which Ra and Rb, which are identical or different, represent hydrogen or an χi-C4 alkyl radical, and one or more group (s) C1-C4 alkoxy or short chain alkyl linked to a carbon or nitrogen atom of the quinoline or isoquinoline ring or quin a quinoline or isoquinoline having a nitrogen atom in quaternary form or 0 a benzamidine or
0 une pyridine ou0 a pyridine or
0 un noyau phényle éventuellement substitué par un groupement halogène ; alkoxy en Cl- C4 ; cyano ; carbonylamino éventuellement substitué par un ou plusieurs groupes alkyle en C1-C4 ; guanyl ; alkylthio en C1-C4 ; amino, alkylamino en C1-C4, dialkylamino en C1-C4 pour chaque groupe alkyle et dont les parties alkyles peuvent ensemble former un cycle en C3-C8, nitro ; alkylèneamino en C1-C4 ; alkénylèneamino en C2-C4 ;0 a phenyl ring optionally substituted by a halogen group; C1-C4 alkoxy; cyano; carbonylamino optionally substituted with one or more C1-C4 alkyl groups; guanyl; C1-C4 alkylthio; amino, C1-C4 alkylamino, C1-C4 dialkylamino for each alkyl group and the alkyl parts of which can together form a C3-C8, nitro ring; C1-C4 alkyleneeamino; C2-C4 alkenyleneamino;
0 un noyau hétérocyclique mono ou bi ou tricyclique comportant 0 à 2 hétéroatome par cycle à la condition qu'au moins un hétéroatome soit présent dans au moins un cycle éventuellement substitué par un ou plusieurs groupes alkyle en C1-C4 ou par des groupes alkylène en C1-C4 ou alkénylène en C2-C40 a heterocyclic mono or bi or tricyclic ring comprising 0 to 2 heteroatoms per cycle provided that at least one heteroatom is present in at least one ring optionally substituted by one or more C1-C4 alkyl groups or by alkylene groups C1-C4 or C2-C4 alkenylene
• R3 et R'3, identiques ou différents, représentent indépendamment l'un de l'autre l'hydrogène ou un radical alkyle en C1-C4 • le répartiteur représente : un groupe triazine éventuellement substitué par un cycle aromatique tel que défini ci-dessus ou par un radical XR1(R2) dans lequel X représente un atome d'azote N pour former NR1R2, un radical alkyle linéaire ou ramifié en C1-C6 pour former alkRlR2, un atome d'oxygène O pour former ORl ou un atome de soufre S pour former SRI, avec RI et R2 identiques ou différents sont choisis parmi l'atome d'hydrogène ;• R3 and R'3, identical or different, represent independently of one another hydrogen or a C1-C4 alkyl radical • the distributor represents: a triazine group optionally substituted by an aromatic ring as defined above above or by a radical XR1 (R2) in which X represents a nitrogen atom N to form NR1R2, a linear or branched C1-C6 alkyl radical to form alkRlR2, an oxygen atom O to form ORl or a sulfur atom S to form SRI, with RI and R2 identical or different are chosen from the hydrogen atom;
5 un radical alkyle en C1-C8 éventuellement substitué par un ou plusieurs radicaux identiques ou différents; un cycle aromatique tel que défini ci-dessus éventuellement substitué ; un radical5 a C1-C8 alkyl radical optionally substituted by one or more identical or different radicals; an aromatic ring as defined above optionally substituted; a radical
10 quinuclidine ; un radical pyrrolidinyle lui-même éventuellement substitué par un radical alkyle ou phénylalkyle avec alkyle en C1-C4 ; un radical pipérazinyle ou homopipérazinyle lui-même éventuellementQuinuclidine; a pyrrolidinyl radical itself optionally substituted by an alkyl or phenylalkyl radical with C1-C4 alkyl; a piperazinyl or homopiperazinyl radical itself, optionally
15 substitué par un radical alkyle, cycloalkyle ou phénylalkyle ; un radical morpholinyle ; un radical pyridyle, piperidinyle ou un radical pipéridyle éventuellement substitués par un ouSubstituted by an alkyl, cycloalkyl or phenylalkyl radical; a morpholinyl radical; a pyridyl, piperidinyl radical or a piperidyl radical optionally substituted by one or
20 plusieurs radicaux alkyle ou phénylalkyle avec alkyle C1-C4 ; un radical indazolyle ; un radical naphtyle ; un radical benzotriazole ; un radical benzoimidazolyle ; un radical pyrimidinyleSeveral alkyl or phenylalkyl radicals with C1-C4 alkyl; an indazolyl radical; a naphthyl radical; a benzotriazole radical; a benzoimidazolyl radical; a pyrimidinyl radical
25 éventuellement substitué par un ou plusieurs alkyle avec alkyle en C1-C4 ; un radical acénaphtène ; un radical amino lui-même éventuellement substitué par un deux radicaux identiques ou différentsOptionally substituted by one or more alkyl with C1-C4 alkyl; an acenaphthene radical; an amino radical itself optionally substituted by one two identical or different radicals
30 choisis parmi alkyle, phénylalkyle, alkylaminoalkyle et dialkylaminoalkyle, étant entendu que lorsque XR1R2 représente3 0 selected from alkyl, phenylalkyl, alkylaminoalkyl and dialkylaminoalkyl, being understood that when represents XR1R2
NR1R2, alors RI et R2 identiques ne représentent pas tous deux hydrogène ouNR1R2, then RI and R2 identical do not both represent hydrogen or
35 alkyle C1-C4 non substitué et RI et R2 différents ne représentent pas l'un hydrogène et l'autre alkyle C1-C4 non substitué ou bien lorsque X représente N ou alkyle, RI et R2 forment ensemble avec X auquel ils sont liés un radical monocyclique de 3 à 6 chaînons ou bicyclique de 8 à 10 chaînons saturé ou insaturé renfermant éventuellement un ou deux hétéroatomes identiques ou différents choisis parmi N,35 unsubstituted C1-C4 alkyl and RI and R2 different do not represent one hydrogen and the other unsubstituted C1-C4 alkyl or else when X represents N or alkyl, RI and R2 form together with X to which they are linked a monocyclic radical of 3 to 6 members or bicyclic of 8 with 10 saturated or unsaturated links optionally containing one or two identical or different heteroatoms chosen from N,
O ou S, ce radical étant éventuellement substitué, un groupe diazine éventuellement substitué par les mêmes groupes que la triazine ou un de ses sels, ces composés étant sous toutes les formes isomères possibles racemiques, enantiomeres et diastéréo-isomères .O or S, this radical being optionally substituted, a diazine group optionally substituted by the same groups as triazine or one of its salts, these compounds being in all the possible racemic, enantiomeric and diastereoisomeric isomer forms.
2 - Composés fixant la structure G-quadruplex des télomères caractérisés en ce qu'ils répondent à la formule générale telle que définie à la revendication 1.2 - Compounds fixing the G-quadruplex structure of telomeres characterized in that they correspond to the general formula as defined in claim 1.
3 - Composés selon la revendication 1 ou 2 caractérisés en ce que lorsque l'un .ou les deux de RI et R2 représente (nt) un radical alkyle en C1-C8 éventuellement substitué par un ou plusieurs radicaux identiques ou différents, ces radicaux sont choisis parmi les radicaux suivants : le radical amino lui-même éventuellement substitué par un ou deux radicaux identiques ou différents choisis parmi les radicaux alkyle, hydroxyalkyle, alcoxyalkyle, alkylphénylalkyle, phénylalkyle, carboxyalkyle, hydroxycarboxyalkyle, acyle r naphtyle, phényle et alkylphényle ; le radical trialkylammonio ; les radicaux hydroxy ; alcoxy en C1-C4; thioalcoxy ; trifluorométhyle ; acyle ; carboxy libre, salifié, estérifié ou' amidifié ; imidazolyle ; pyrrolidinyle éventuellement substitué par alkyle en Cl- C4 ; pipéridyle et pipérazinyle éventuellement substitué (s) par alkyle ou phenylalkyl avec alkyl en Cl- C4 ; morpholinyle ; pyridyle ; naphtyle ou phényle lui-même éventuellement substitué par un ou plusieurs radicaux choisis parmi les radicaux alcoxy en C1-C4, halogène ou le radical amino éventuellement substitué comme défini ci-dessus.3 - Compounds according to claim 1 or 2 characterized in that when one or both of RI and R2 represents (s) a C1-C8 alkyl radical optionally substituted by one or more identical or different radicals, these radicals are selected from the following radicals: amino itself radical optionally substituted by one or two identical or different radicals chosen from alkyl, hydroxyalkyl, alkoxyalkyl, alkylphenylalkyl, phenylalkyl, carboxyalkyl, hydroxycarboxyalkyle, acyl r naphthyl, phenyl and alkylphenyl; the trialkylammonio radical; hydroxy radicals; C1-C4 alkoxy; thioalkoxy; trifluoromethyl; acyl; free, salified, esterified or amidified carboxy; imidazolyl; pyrrolidinyl optionally substituted with C1-C4 alkyl; piperidyl and piperazinyl optionally substituted by alkyl or phenylalkyl with C1-C4 alkyl; morpholinyl; pyridyle; naphthyl or phenyl itself optionally substituted by one or more radicals chosen from C1-C4 alkoxy, halogen or optionally substituted amino radical as defined above.
4 - Composés selon la revendication 1 ou 2 caractérisés en ce que le répartiteur représente : un groupe triazine éventuellement substitué par un cycle aromatique tel que défini ci-dessus ou par un radical XR1(R2) dans lequel X représente un atome d'azote N pour former NR1R2, un radical alkyle linéaire ou ramifié en C1-C6 pour former alkRlR2, un atome d'oxygène O pour former ORl ou un atome de soufre S pour former4 - Compounds according to claim 1 or 2 characterized in that the distributor represents: a triazine group optionally substituted by an aromatic ring as defined above or by a radical XR1 (R2) in which X represents a nitrogen atom N to form NR1R2, a linear or branched C1-C6 alkyl radical to form alkRlR2, an oxygen atom O to form ORl or a sulfur atom S to form
SRI, avec RI et R2 identiques ou différents sont choisis parmi l'atome d'hydrogène ; alkyle C1-C8 éventuellement substitué par un ou plusieurs radicaux choisis parmi les radicaux amino, alkylamino, dialkylamino, alcoxyalkylamino, dialcoxyalkylamino, hydroxyalkylamino, dihydroxyalkylamino, hydroxycarboxyalkylamino, trialkylammonium, - naphtylamino, phénylamino, acylamino,SRI, with RI and R2 identical or different are chosen from the hydrogen atom; C1-C8 alkyl optionally substituted by one or more radicals chosen from amino, alkylamino, dialkylamino, alkoxyalkylamino, dialcoxyalkylamino, hydroxyalkylamino, dihydroxyalkylamino, hydroxycarboxyalkylamino, trialkylammonium, - naphthylamino, phenylamino, acylamino radicals
(alkyl) (phenylalkyl) amino,(alkyl) (phenylalkyl) amino,
(phényl) (alkyl) amino,(phenyl) (alkyl) amino,
(alkylphényl) (alkyl) amino, hydroxy, alcoxy en C1-C4, thioalcoxy en C1-C4, trifluorométhyle, acyle, carboxy libre, salifié, estérifié ou amidifié, imidazolyle, pyrrolidinyle éventuellement 5 substitué par alkyle en C1-C4, pipéridyle, pipérazinyle et homopipérazinyle éventuellement substitué (s) par alkyle ou phénylalkyle avec alkyle en C1-C4, morpholinyle, pyridyle, naphtyle ou(alkylphenyl) (alkyl) amino, hydroxy, alkoxy C1-C4, C1-C4 thioalkoxy, trifluoromethyl, acyl, free, salified carboxy, esterified or amidified, imidazolyl, pyrrolidinyl optionally substituted by C1-C4 alkyl, piperidyl, piperazinyl and homopiperazinyl optionally substituted by alkyl or phenylalkyl with C1-C4 alkyl, morpholinyl, pyridyl, naphthyl or
10 phényle éventuellement substitué (s) par un ou plusieurs radicaux choisis parmi les radicaux alcoxy en C1-C4, halogène, amino, alkylamino et dialkylamino ; un cycle aromatique tel que défini ci-dessus ; unPhenyl optionally substituted with one or more radicals chosen from C1-C4 alkoxy, halogen, amino, alkylamino and dialkylamino radicals; an aromatic cycle as defined above; a
15 radical quinuclidine ; un radical pyrrolidinyle lui-même éventuellement substitué par un radical alkyle ou phénylalkyle avec alkyle en C1-C4 ; un radical pipérazinyle lui-mêmeQuinuclidine radical; a pyrrolidinyl radical itself optionally substituted by an alkyl or phenylalkyl radical with C1-C4 alkyl; a piperazinyl radical itself
20 éventuellement substitué par un radical alkyle, cycloalkyle ou phénylalkyle ; un radical morpholinyle ; un radical pyridyle ou un radical pipéridyle éventuellement substitués par un ou plusieurs radicauxOptionally substituted with an alkyl, cycloalkyl or phenylalkyl radical; a morpholinyl radical; a pyridyl radical or a piperidyl radical optionally substituted by one or more radicals
25 alkyle ou phénylalkyle avec alkyle C1-C4 ; un radical indazolyle ; un radical naphtyle, un radical benzotriazole; un radical pyrimidinyle éventuellement substitué par un ou plusieurs alkyle avecAlkyl or phenylalkyl with C1-C4 alkyl; an indazolyl radical; a naphthyl radical, a benzotriazole radical; a pyrimidinyl radical optionally substituted by one or more alkyl with
30 alkyle en C1-C4 ; un radical acénaphtène, étant entendu que lorsque XR1R2 représente NR1R2, alors RI et R2 identiques ne représentent pas tous deux hydrogène ou alkyle C1-C4 non substitué et RI et R2 35 différents ne représentent pas l'un hydrogène et l'autre alkyle C1-C4 non substitué ou bien lorsque X représente N ou alkyle,C1-C4 alkyl; an acenaphthene radical, it being understood that when XR1R2 represents NR1R2, then RI and R2 identical do not both represent hydrogen or C1-C4 unsubstituted alkyl and RI and R2 3 5 do not represent one hydrogen and the other unsubstituted C1-C4 alkyl or when X represents N or alkyl,
RI et R2 forment ensemble avec X auquel ils sont liés un radical choisi parmi les radicaux suivants : pipérazinyle ou homopipérazinyle éventuellement substitué par un ou plusieurs radicaux identiques ou différents/ pyrrolidinyle éventuellement substitué par alkyle ou alcoxy en C1-C4, hydroxy, acylamino, pyrrolidinylalkyl, pyridinyle et pyridyle ; 1, 2, 3, 4-tétra- hydroquinoléinyle et 1, 2, 3, 4-tétra- hydroisoquinbléinyle ; diazépine éventuellement substitué par alkyle ou pyrrolidinyl-alkyl ; pipéridyle ou piperidinyle éventuellement substitué par un ou plusieurs radicaux choisis parmi alkyle, alcoxy, alcoxyalkyle, pyrrolylalkyle, piperidinyle, pipéridyle, hydroxy et cycloalkyl-alkyle ; morpholinyle ; thiomorpholinyle ; imidazolinyle éventuellement substitué par alkyle, - ou un groupe diazine éventuellement substitué par les mêmes groupes que la triazine ou un de ses sels, ces composés étant sous toutes les formes isomères possibles racemiques, enantiomeres et diastéréo-isomères .RI and R2 form, together with X to which they are linked, a radical chosen from the following radicals: piperazinyl or homopiperazinyl optionally substituted by one or more identical or different radicals / pyrrolidinyl optionally substituted by C1-C4 alkyl or alkoxy, hydroxy, acylamino, pyrrolidinylalkyl , pyridinyl and pyridyl; 1,2,3,4-tetra-hydroquinoline and 1,2,3,4-tetra-hydroquinoquinyl; diazepine optionally substituted by alkyl or pyrrolidinyl-alkyl; piperidyl or piperidinyl optionally substituted by one or more radicals chosen from alkyl, alkoxy, alkoxyalkyl, pyrrolylalkyl, piperidinyl, piperidyl, hydroxy and cycloalkyl-alkyl; morpholinyl; thiomorpholinyl; imidazolinyl optionally substituted by alkyl, - or a diazine group optionally substituted by the same groups as triazine or one of its salts, these compounds being in all the possible racemic, enantiomeric and diastereoisomeric isomer forms.
5 - Composés selon l'une quelconque des revendications 1 à 4 caractérisés en ce que les groupes diazines sont des pyrimidines et des quinazolines.. 6 - Composés selon l'une quelconque des revendications 1 à 5 caractérisés en ce que XR1(R2) est tel que lorsque X représente N, soit l'un de RI et R2 représente l'atome d'hydrogène ou un radical alkyle en C1-C4 éventuellement substitué par amino, alkylamino, dialkylamino ou phényle, et l'autre de RI et R2 est choisi parmi les valeurs définies pour Ri et R2 à l'une quelconque des revendications 1 à 5 soit RI et R2 forment ensemble avec l'atome d'azote auxquels ils sont liés un radical cyclique choisi parmi les radicaux suivants :un radical pipérazinyle ou homopipérazinyle éventuellement substitué par un ou plusieurs radicaux choisis parmi alkyle, aminoalkyle, alkylaminoalkyle, dialkylaminoalkyle, phénylalkyle, alcoxyalkyle, hydroxyalkyl, dihydroxyalkyle, hydroxyalcoxyalkyle avec alcoxy, imidazolylaminoalkyle, imidazolylalkylaminoalkyle, imidazolylhydroxyalkylaminoalkyle, pyridylalkyle, pyridinylalkyle, imidazopyridinylalkyle, pyrrolidinylalkyle, imidazolylalkyle éventuellement substitué par un ou plusieurs radicaux alkyle ou phényle, morpholinylalkyle, benzoimidazolalkyle éventuellement substitué par alkyle ou hydroxyalkyle, cycloalkyle en C3-C8, pyrazinyle, pyrimidinyle, pyridyle, pipéridyle, furylcarbonyle, furfurycarbonyle, quinolyle ou isoquinolyle ; un radical pyrrolidinyle éventuellement substitué par alkyle ou alcoxy en C1-C4, hydroxy, acylamino, pyrrolidinylalkyl, pyridinyle et pyridyle ; un radical 1, 2, 3, 4-tétrahydroquinoléinyle 1,2,3,4- ou tétrahydroisoquinoléinyle ; un radical diazépine éventuellement substitué par alkyle ou pyrrolidinylalkyl ; un radical pipéridyle éventuellement substitué par un ou plusieurs radicaux choisis parmi les radicaux alkyle, alcoxy, alcoxyalkyle, pyrrolylalkyle, piperidinyle, hydroxy, cycloalkylalkyle et pipéridyle; un radical piperidinyle éventuellement substitué par piperidinyle ; un radical morpholinyle ou thio morpholinyle; un radical imidazolinyle éventuellement substitué par alkyle.5 - Compounds according to any one of claims 1 to 4 characterized in that the diazine groups are pyrimidines and quinazolines. 6 - Compounds according to any one of claims 1 to 5 characterized in that XR1 (R2) is such that when X represents N, either one of RI and R2 represents the hydrogen atom or a C1 alkyl radical -C4 optionally substituted by amino, alkylamino, dialkylamino or phenyl, and the other of RI and R2 is chosen from the values defined for Ri and R2 in any one of claims 1 to 5, either RI and R2 form together with nitrogen atom to which they are linked a cyclic radical chosen from the following radicals: a piperazinyl or homopiperazinyl radical optionally substituted by one or more radicals chosen from alkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, phenylalkyl, alkoxyalkyl, hydroxyalkyl, dihydroxyalkyl, hydroxyalkoxyalkyl with alkoxy , imidazolylaminoalkyle, imidazolylalkylaminoalkyle, imidazolylhydroxyalkylaminoalkyle, pyridylalkyle, pyridinylalkyle, imidazopyridinylalkyle, pyrrolidinylalkyle, imidazolylalkyle even optionally substituted by one or more alkyl or phenyl, morpholinylalkyl, benzoimidazolalkyl radicals optionally substituted by alkyl or hydroxyalkyl, C3-C8 cycloalkyl, pyrazinyl, pyrimidinyl, pyridyl, piperidyl, furylcarbonyl, furfurycarbonyl, quinolyl or isoquinolyl; a pyrrolidinyl radical optionally substituted by C1-C4 alkyl or alkoxy, hydroxy, acylamino, pyrrolidinylalkyl, pyridinyl and pyridyl; a 1,2,3,4,4-tetrahydroquinolinyl 1,2,3,4- or tetrahydroisoquinolinyl radical; a diazepine radical optionally substituted by alkyl or pyrrolidinylalkyl; a piperidyl radical optionally substituted by one or more radicals chosen from the alkyl, alkoxy, alkoxyalkyl, pyrrolylalkyl, piperidinyl, hydroxy, cycloalkylalkyl and piperidyl radicals; a piperidinyl radical optionally substituted by piperidinyl; a morpholinyl or thio morpholinyl radical; an imidazolinyl radical optionally substituted by alkyl.
7 - Composés selon la revendication 1 ou 2 caractérisés en ce qu'ils répondent à la formule générale suivante : cycle aromatique azoté - NR3 - répartiteur - NR'3 - cycle aromatique dans laquelle le cycle aromatique azoté, le cycle aromatique et R3 et R'3 ont les significations indiquées à l'une quelconque des revendications précédentes, et le répartiteur représente : un groupe triazine éventuellement substitué, par un radical XR1(R2) dans lequel X représente un atome d'azote N pour former NR1R2, un radical alkyle linéaire ou ramifié en C1-C6 pour former alkRlR2, un atome d'oxygène O pour former ORl ou un atome de soufre S pour former SRI, avec RI et R2 identiques ou différents ont les significations indiquées à l'une quelconque des revendications précédentes, un groupe diazine éventuellement substitué par les mêmes groupes que la triazine ou un de ses sels, ces composés étant sous toutes les formes isomères possibles racemiques, enantiomeres et diastéréo-isomères .7 - Compounds according to claim 1 or 2, characterized in that they correspond to the following general formula: aromatic nitrogen cycle - NR 3 - distributor - NR ' 3 - aromatic cycle in which the aromatic nitrogen cycle, the aromatic cycle and R3 and R'3 have the meanings indicated in any one of the preceding claims, and the distributor represents: a triazine group optionally substituted, by a radical XR1 (R2) in which X represents a nitrogen atom N to form NR1R2, a radical linear or branched C1-C6 alkyl to form alkRlR2, an oxygen atom O to form ORl or a sulfur atom S to form SRI, with RI and R2 identical or different have the meanings indicated in any one of the preceding claims , a diazine group optionally substituted by the same groups as triazine or a salt thereof, these compounds being in all the possible racemic, enantiomeric and diast isomeric forms Reo-isomers.
8 - Composés selon la revendication 1 ou 2 caractérisés en ce que le répartiteur représente : un groupe triazine éventuellement substitué par un radical XR1(R2) dans lequel X représente un atome d'azote N pour former NR1R2, un atome d'oxygène O8 - Compounds according to claim 1 or 2 characterized in that the distributor represents: a triazine group optionally substituted by a radical XR1 (R2) in which X represents a nitrogen atom N to form NR1R2, an oxygen atom O
5 pour former ORl ou un atome de soufre S pour former SRI, avec Ri et R2 identiques ou différents sont choisis parmi l'atome d'hydrogène ; alkyle C1-C8 éventuellement substitué par5 to form OR1 or a sulfur atom S to form SRI, with Ri and R2 identical or different are chosen from the hydrogen atom; C1-C8 alkyl optionally substituted by
10 un radical amino, alkylamino, dialkylamino, (phényl) (alkyl) amino, (alkylphényl) (alkyl) amino, alcoxy en Cl- C4, un radical acyle, un radical imidazolyle, par un radical pyrrolidinyle,An amino, alkylamino, dialkylamino, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino, C1-C4 alkoxy radical, an acyl radical, an imidazolyl radical, by a pyrrolidinyl radical,
15 pyridyle ou par un radical phényle ; un cycle aromatique tel que défini à la revendication 1 ; un radical quinuclidine, un radical pyrrolidinyle ou un radical pipéridyle éventuellement substitué parPyridyl or by a phenyl radical; an aromatic ring as defined in claim 1; a quinuclidine radical, a pyrrolidinyl radical or a piperidyl radical optionally substituted by
20 alkyle C1-C4 étant entendu que RI et R2 identiques ne représentent pas tous deux hydrogène ou alkyle C1-C4 non substitué et RI et' R2 différents ne représentent pas l'un 25 hydrogène et l'autre alkyle C1-C4 non substitué, ou bien lorsque X représente N, RI et R2 forment ensemble avec X auquel ils sont liés un radical pipérazinyle,20 C1-C4 alkyl being understood that identical RI and R2 do not both represent hydrogen or unsubstituted C1-C4 alkyl and RI and ' R2 different do not represent one hydrogen and the other C1-C4 unsubstituted alkyl, or when X represents N, RI and R2 form, together with X to which they are linked, a piperazinyl radical,
30 homopipérazinyle,- pipéridyle, pyrrolidinyle, morpholinyle ou thiomorpholinyle, éventuellement substitués par un ou plusieurs radicaux, ou un groupe diazine éventuellement substitué par les mêmes groupes que la triazine ou un de ses sels, ces composés étant sous toutes les formes isomères possibles racemiques, enantiomeres et diastéréo-isomèresHomopiperazinyl, piperidyl, pyrrolidinyl, morpholinyl or thiomorpholinyl, optionally substituted by one or more radicals, or a diazine group optionally substituted by the same groups as triazine or one of its salts, these compounds being in all the possible racemic isomeric, enantiomeric and diastereoisomeric forms
9 - Composés selon la revendication 1 ou 2 caractérisés en ce qu'ils répondent à la formule (I) ci-dessous :9 - Compounds according to claim 1 or 2 characterized in that they correspond to formula (I) below:
dans laquelle : in which :
A représente un radical XR1(R2) dans lequel X représente un atome d'azote, d'oxygène, de soufre ou un radical alkyle en C1-C6 pour former l'un des radicaux suivants :A represents a radical XR1 (R2) in which X represents a nitrogen, oxygen or sulfur atom or a C1-C6 alkyl radical to form one of the following radicals:
NR1R2 avec RI et R2 identiques ou différents sont choisis parmi l'atome d'hydrogène ; un radical alkyle en C1-C8 éventuellement substitué par un ou plusieurs radicaux identiques ou différents ; un cycle aromatique tel que défini ci-dessus ; un radical quinuclidine ; un radical pyrrolidinyle lui-même . éventuellement substitué par un radical alkyle ou phénylalkyle avec alkyle en C1-C4 ; un radical pipérazinyle ou homopipérazinyl lui-même éventuellement substitué par un radical alkyle, cycloalkyle - ou phénylalkyle ; un radical morpholinyle ; un radical pyridyle, piperidinyle ou un radical pipéridyle éventuellement substitués par un ou plusieurs radicaux alkyle ou phénylalkyle avec alkyle C1-C4 ; un radical indazolyle ; un radical naphtyle ; un radical benzotriazole ; un radical benzimidazolyle ; un radical pyrimidinyle éventuellement substitué par un ou plusieurs alkyle avec alkyle en C1-C4 ; un radical acénaphtène ; un radical amino lui-même éventuellement substitué par un deux radicaux identiques ou différents choisis parmi alkyle, phénylalkyle, al ylaminoalkyle et dialkylaminoalkyle, étant entendu que lorsque XR1R2 représenteNR1R2 with RI and R2 identical or different are chosen from the hydrogen atom; a C1-C8 alkyl radical optionally substituted by one or more identical or different radicals; an aromatic cycle as defined above; a quinuclidine radical; a pyrrolidinyl radical itself. optionally substituted by an alkyl or phenylalkyl radical with C1-C4 alkyl; a piperazinyl or homopiperazinyl radical itself optionally substituted by an alkyl radical, cycloalkyl - or phenylalkyl; a morpholinyl radical; a pyridyl, piperidinyl or a piperidyl radical optionally substituted by one or more alkyl or phenylalkyl radicals with C1-C4 alkyl; an indazolyl radical; a naphthyl radical; a benzotriazole radical; a benzimidazolyl radical; a pyrimidinyl radical optionally substituted by one or more alkyl with C1-C4 alkyl; an acenaphthene radical; an amino radical itself optionally substituted by two identical or different radicals chosen from alkyl, phenylalkyl, al ylaminoalkyl and dialkylaminoalkyl, it being understood that when XR1R2 represents
NR1R2, alors RI et R2 identiques ne représentent pas tous deux hydrogène ou alkyle C1-C4 non substitué et RI et R2 différents ne représentent pas l'un hydrogène et l'autre alkyle C1-C4 non substitué ou bien lorsque X représente N ou alkyle, RI et R2 forment ensemble avec X auquel ils sont liés un radical monocyclique de 3 à 6 chaînons ou bicyclique de 8 à 10 chaînons saturé ou insaturé renfermant éventuellement un ou deux hétéroatomes identiques ou différents choisis parmi N,NR1R2, then RI and R2 identical do not both represent hydrogen or C1-C4 unsubstituted alkyl and RI and R2 different do not represent one hydrogen and the other C1-C4 alkyl unsubstituted or when X represents N or alkyl , RI and R2 form, together with X to which they are linked, a 3 to 6-membered monocyclic or 8 to 10-membered bicyclic radical, saturated or unsaturated, optionally containing one or two identical or different heteroatoms chosen from N,
O ou S,O or S,
• un groupe ORl ou SRI dans lequel Ri a la même signification que précédemment étant entendu que RI ne représente pas hydrogène ou alkyle C1-C4 non substitué, ou• an ORl or SRI group in which Ri has the same meaning as above, being understood that RI does not represent hydrogen or unsubstituted C1-C4 alkyl, or
• un groupe alkyle contenant 1 à 6 atomes de carbone substitué par RI R2 tels que définis ci-dessus• an alkyl group containing 1 to 6 carbon atoms substituted by RI R2 as defined above
- R3 et R'3, identiques ou différents, représentent indépendamment l'un de l'autre l'hydrogène ou un groupe alkyle en C1-C4- R3 and R'3, identical or different, independently of one another represent hydrogen or a C1-C4 alkyl group
- Ari et Ar2 identiques ou différents représentent * quand Ari et Ar2 sont identiques :- Ari and Ar 2 identical or different represent * when Ari and Ar 2 are identical:
• un motif quinoléine ou isoquinoléine éventuellement substituée par au moins un radical choisi parmi un groupe N(Ra) (Rb) dans lequel Ra et Rb, identiques ou différents représentent l'hydrogène ou un radical alkyle en C1-C4, et un ou plusieurs groupe (s) alkoxy ou alkyle à chaîne courte en C1-C4 lié (s) à un atome de carbone ou d' azote du cycle quinoléine ou isoquinoléine ou" • a quinoline or isoquinoline motif optionally substituted by at least one radical chosen from a group N (Ra) (Rb) in which Ra and Rb, which are identical or different, represent hydrogen or a C1-C4 alkyl radical, and one or more C1-C4 alkoxy or short chain alkyl group (s) linked to a carbon or nitrogen atom of the quinoline or isoquinoline ring or "
• une quinoléine ou isoquinoléine possédant un atome d'azote sous forme quaternaire ou• a quinoline or isoquinoline having a nitrogen atom in quaternary form or
• une benzamidine ou• a benzamidine or
• une pyridine attachée en position -4 ou fusionnée avec un groupe aryle ou hétéroaryle éventuellement substituée par un groupe alkyle en C1-C4• a pyridine attached in position -4 or fused with an aryl or heteroaryl group optionally substituted by a C1-C4 alkyl group
* quand Ari et Ar2 sont différents* when Ari and Ar 2 are different
• ri et Ar2 représentent tous les deux l'une des possibilités évoquées ci-dessus pour • Ari représente l'une des possibilités ci- dessus et Ar2 représente• ri and Ar 2 both represent one of the possibilities mentioned above for • Ari represents one of the possibilities above and Ar 2 represents
* un noyau phényle éventuellement substitué par un groupement halogène, alkoxy en C1-C4, cyano, carbonylamino éventuellement substitué par un ou plusieurs groupes alkyle en C1-C4, guanyl, alkylthio en C1-C4, amino, alkylamino en C1-C4, dialkylamino en Cl- C4 pour chaque groupe alkyle, nitro, alkylèneamino en C1-C4, (ou) alkénylèneamino en C2-C4, ou un radical pipérazinyle éventuellement substitué par un radical alkyle C1-C4, * un noyau hétérocyclique mono ou bi ou tricyclique comportant 0 à 2 hétéroatome par cycle à la condition qu'au moins un hétéroatome soit présent dans au moins un cycle éventuellement substitué par un ou plusieurs groupes alkyle en C1-C4 ou par des groupes alkylène en C1-C4 ou alkénylène en C2-C4 ou un de ses sels, ces composés de formule (I) étant sous toutes les formes isomères possibles racemiques, enantiomeres et diastéréo-isomères .* a phenyl ring optionally substituted by a halogen group, C1-C4 alkoxy, cyano, carbonylamino optionally substituted by one or more C1-C4 alkyl groups, guanyl, C1-C4 alkylthio, amino, C1-C4 alkylamino, dialkylamino in C1-C4 for each alkyl, nitro, C1-C4 alkyleneamino, (or) C2-C4 alkenyleneamino, or a piperazinyl radical optionally substituted by a C1-C4 alkyl radical, * a mono or bi or tricyclic heterocyclic ring comprising 0 to 2 heteroatoms per ring provided that at least one heteroatom is present in at least one ring optionally substituted by one or more C1-C4 alkyl groups or by C1-C4 alkylene or C2-C4 alkenylene groups or one of its salts, these compounds of formula (I) being in all the possible isomeric, racemic, enantiomeric and diastereoisomeric forms.
10 - Composés selon la revendication 9 caractérisés en ce que lorsque l'un ou les deux de RI et R2 représente (nt) un radical alkyle en C1-C8 éventuellement substitué par un ou plusieurs radicaux identiques ou différents, ces radicaux sont choisis parmi le radical amino lui-même éventuellement substitué par un ou deux radicaux identiques ou différents choisis parmi les radicaux alkyle, hydroxyalkyle, alcoxyalkyle, phénylalkyle, carboxyalkyle, hydroxycarboxyalkyle, acyle, naphtyle, phényle et alkylphényle ; le radical trialkylammonio ; les radicaux hydroxy ; alcoxy ; thioalcoxy ; trifluorométhyle ; acyle ; carboxy libre, salifié, estérifié ou amidifié ; imidazolyle ; pyrrolidinyle éventuellement substitué par alkyle en C1-C4 ; pipéridyle et pipérazinyle éventuellement substitué (s) par alkyle ou phénylalkyle avec alkyl en C1-C4 ; morpholinyle ; pyridyle ; naphtyle ou phényle lui-même éventuellement substitué par un ou plusieurs radicaux choisis parmi les radicaux alcoxy en C1-C4, halogène ou le radical amino éventuellement substitué comme défini ci-dessus .10 - Compounds according to Claim 9, characterized in that when one or both of RI and R2 represents (s) a C1-C8 alkyl radical optionally substituted by one or more identical or different radicals, these radicals are chosen from amino radical itself optionally substituted by one or two identical or different radicals chosen from alkyl, hydroxyalkyl, alkoxyalkyl, phenylalkyl, carboxyalkyl, hydroxycarboxyalkyl, acyl, naphthyl radicals, phenyl and alkylphenyl; the trialkylammonio radical; hydroxy radicals; alkoxy; thioalkoxy; trifluoromethyl; acyl; free, salified, esterified or amidified carboxy; imidazolyl; pyrrolidinyl optionally substituted with C1-C4 alkyl; piperidyl and piperazinyl optionally substituted by alkyl or phenylalkyl with C1-C4 alkyl; morpholinyl; pyridyle; naphthyl or phenyl itself optionally substituted by one or more radicals chosen from C1-C4 alkoxy, halogen or optionally substituted amino radical as defined above.
11 - Composés selon l'une quelconque des revendications 1 à 10 caractérisés en ce que XR1(R2) est tel que lorsque X représente N, soit l'un de Ri et R2 représente l'atome d'hydrogène et l'autre de RI et R2 est choisi parmi les valeurs définis pour Ri et R2 à l'une quelconque des revendications 1 à 10 soit RI et R2 forment ensemble avec l'atome d'azote auxquels ils sont liés un radical pipérazinyle, homopipérazinyle, pyrrolidinyle, .pipéridyle, pyridinyle, morpholinyle, thiomorpholinyle, imidazolinyle, diazépine, 1,2, 3, 4-tétrahydroquinoléine ou 1, 2, 3, 4-tétrahydroisoquinoléine, tous ces radicaux étant éventuellement substitués par un ou plusieurs radicaux tels que définis à l'une quelconque des revendications 1 à 10.11 - Compounds according to any one of claims 1 to 10 characterized in that XR1 (R2) is such that when X represents N, either one of Ri and R2 represents the hydrogen atom and the other of RI and R2 is chosen from the values defined for Ri and R2 in any one of claims 1 to 10, ie RI and R2 form, together with the nitrogen atom to which they are linked, a piperazinyl, homopiperazinyl, pyrrolidinyl, .piperidyl radical, pyridinyl, morpholinyl, thiomorpholinyl, imidazolinyl, diazepine, 1,2, 3, 4-tetrahydroquinoline or 1, 2, 3, 4-tetrahydroisoquinoline, all these radicals being optionally substituted by one or more radicals as defined in any one of claims 1 to 10.
12 - Composés selon la revendication 9 caractérisés en ce que A représente un cycle aromatique tel que défini ci-dessus ou un radical XR1(R2) dans lequel X représente un atome d'azote N pour former NR1R2, un radical alkyle linéaire' ou ramifié en C1-C6 pour former alkRlR2, un atome d' oxygène O pour former ORl ou un atome de soufre S pour former SRI, avec Ri et R2 identiques ou différents sont choisis parmi l'atome d'hydrogène ; alkyle C1-C8 éventuellement substitué par un ou plusieurs radicaux choisis parmi les radicaux amino, alkylamino, dialkylamino, dialcoxyalkyl- amino, dihydroxyalkylamino, alcoxyalkylamino, hydroxyalkylamino, hydroxycarboxyalkylamino, trialkylammonio, naphtylamino, phénylamino, acylamino, (alkyl) (phenylalkyl) amino, (phényl) (alkyl) amino,12 - Compounds according to claim 9 characterized in that A represents an aromatic ring as defined above or a radical XR1 (R2) wherein X represents a nitrogen atom N to form NR1R2, linear alkyl 'or branched in C1-C6 to form alkRlR2, an oxygen atom O to form ORl or a sulfur atom S to form SRI, with Ri and R2 identical or different are chosen from the hydrogen atom; C1-C8 alkyl optionally substituted by one or more radicals chosen from amino, alkylamino, dialkylamino, dialkoxyalkylamino, dihydroxyalkylamino, alkoxyalkylamino, hydroxyalkylamino, hydroxycarboxyalkylamino, trialkylammonio, naphthylamino, phenylamino () alkyl radical) phenyl) (alkyl) amino,
(alkylphényl) (alkyl) amino, hydroxy, alcoxy en C1-C4, thioalcoxy en C1-C4, trifluorométhyle, acyle, carboxy libre, salifié, estérifié ou amidifié, imidazolyle, pyrrolidinyle éventuellement substitué par alkyle en Cl- C4, pipéridyle et pipérazinyle éventuellement substitué (s) par alkyle ou phénylalkyle avec alkyle en C1-C4, morpholinyle, pyridyle, naphtyle ou phényle éventuellement substitué par un ou plusieurs radicaux choisis parmi les radicaux alcoxy en C1-C4, halogène, amino, alkylamino et dialkylamino ; un cycle aromatique tel que défini ci-dessus ; un radical quinuclidine ; un radical pyrrolidinyle lui-même éventuellement substitué par un radical alkyle ou phénylalkyle avec alkyle en Cl- C4 ; un radical pipérazinyle lui-même éventuellement substitué par un radical alkyle, cycloalkyle ou phénylalkyle ; un radical morpholinyle ; un radical pyridyle ou un radical pipéridyle éventuellement substitués par un ou plusieurs radicaux alkyle ou phénylalkyle avec alkyle C1-C4 ; un radical indazolyle ; un radical naphtyle, un radical benzotriazole ; un radical pyrimidinyle éventuellement substitué par un ou plusieurs alkyle avec alkyle en C1-C4 ; un radical acénaphtène, étant entendu que lorsque XR1R2 représente NR1R2, alors Ri et R2 identiques ne représentent pas tous deux hydrogène ou alkyle C1-C4 non substitué et Ri et R2 différents ne représentent pas l'un hydrogène et l'autre alkyle C1-C4 non substitué ou bien lorsque X représente N ou alkyle,(alkylphenyl) (alkyl) amino, hydroxy, C1-C4 alkoxy, C1-C4 thioalkoxy, trifluoromethyl, acyl, free, salified, esterified or amidated carboxy, imidazolyl, pyrrolidinyl optionally substituted with C1-C4 alkyl, piperidyl and piperazinyl optionally substituted by alkyl or phenylalkyl with C1-C4 alkyl, morpholinyl, pyridyl, naphthyl or phenyl optionally substituted by one or more radicals chosen from C1-C4 alkoxy, halogen, amino, alkylamino and dialkylamino radicals; an aromatic cycle as defined above; a quinuclidine radical; a pyrrolidinyl radical itself optionally substituted by an alkyl or phenylalkyl radical with C1-C4 alkyl; a piperazinyl radical itself optionally substituted by an alkyl, cycloalkyl or phenylalkyl radical; a morpholinyl radical; a pyridyl radical or a piperidyl radical optionally substituted by one or more alkyl or phenylalkyl radicals with C1-C4 alkyl; an indazolyl radical; a naphthyl radical, a benzotriazole radical; a pyrimidinyl radical optionally substituted by one or more alkyl with C1-C4 alkyl; an acenaphthene radical, it being understood that when XR1R2 represents NR1R2, then Ri and R2 identical do not both represent hydrogen or C1-C4 unsubstituted alkyl and Ri and R2 different do not represent one hydrogen and the other unsubstituted C1-C4 alkyl or else when X represents N or alkyl,
RI et R2 forment ensemble avec X auquel ils sont liés un radical choisi parmi les radicaux suivants : pipérazinyle ou homopipérazinyle éventuellement substitué par un ou plusieurs radicaux identiques ou différents; pyrrolidinyle éventuellement substitué par alkyle ou alcoxy en C1-C4, hydroxy, acyla ino, pyrrolidinylalkyl, pyridinyle et pyridyle ; 1, 2, 3, 4-tétra- hydroquinoléinyle et 1,2, 3, -tétra- hydroisoquinoléinyle ; diazépine éventuellement substitué par alkyle ou pyrrolidinyl-alkyl ; pipéridyle ou piperidinyle éventuellement substitué par un ou plusieurs radicaux choisis parmi alkyle, alcoxy, alcoxyalkyle, pyrrolylalkyle, piperidinyle, pipéridyle, hydroxy et cycloalkyl-alkyle ; morpholinyle ; thiomorpholinyle ; imidazolinyle éventuellement substitué par alkyle,RI and R2 form, together with X to which they are linked, a radical chosen from the following radicals: piperazinyl or homopiperazinyl optionally substituted by one or more identical or different radicals; pyrrolidinyl optionally substituted with C1-C4 alkyl or alkoxy, hydroxy, acyla ino, pyrrolidinylalkyl, pyridinyl and pyridyl; 1, 2, 3, 4-tetra-hydroquinoline and 1,2, 3, -tetra-hydroisoquinoline; diazepine optionally substituted by alkyl or pyrrolidinyl-alkyl; piperidyl or piperidinyl optionally substituted by one or more radicals chosen from alkyl, alkoxy, alkoxyalkyl, pyrrolylalkyl, piperidinyl, piperidyl, hydroxy and cycloalkyl-alkyl; morpholinyl; thiomorpholinyl; imidazolinyl optionally substituted with alkyl,
13 - Composés selon la revendication 9 caractérisés en ce que XR1(R2) est tel que lorsque X représente N, soit l'un de RI et R2 représente l'atome d'hydrogène ou un radical alkyle en C1-C4 éventuellement substitué par un radical amino, alkylamino, dialkylamino ou phényle et l'autre de Ri et R2 est choisi parmi les valeurs définies pour Ri et R2 à l'une quelconque des revendications 1 à 8 soit RI et R2 forment ensemble avec l'atome d'azote auxquels ils sont liés un radical pipérazinyle ou homopipérazinyle éventuellement substitué par un ou plusieurs radicaux choisis parmi alkyle, aminoalkyle, alkylaminoalkyle, dialkylaminoalkyle, phénylalkyle, alcoxyalkyle, hydroxyalkyl, dihydroxyalkyle, hydroxyalcoxyalkyle avec alcoxy en C1-C6, imidazolylaminoalkyle, imidazolyl- alkylaminoalkyle, imidazolylhydroxyalkylaminoalkyle, pyridylalkyle, pyridinylalkyle, imidazopyridinylalkyle, pyrrolidinylalkyle, imidazolylalkyle éventuellement substitué par un ou plusieurs radicaux alkyle ou phényle, morpholinylalkyle, benzoimidazolalkyle éventuellement substitué par alkyle ou hydroxyalkyle, cycloalkyle en C3- C8, pyrazinyle, pyrimidinyle, pyridyle, pipéridyle, furylcarbonyle, furfurycarbonyle, quinolyle ou isoquinolyle ; un radical pyrrolidinyle éventuellement substitué par alkyle ou alcoxy en C1-C4, hydroxy, acylamino, pyrrolidinylalkyl, pyridinyle et pyridyle ; un radical 1, 2, 3, 4-tétrahydroquinoléinyle 1,2,3,4- ou tétrahydroisoquinoléinyle ; un . radical diazépine éventuellement substitué par alkyle ou pyrrolidinylalkyl ; un radical pipéridyle éventuellement substitué par un ou plusieurs radicaux choisis parmi les radicaux alkyle, alcoxy, alcoxyalkyle, pyrrolylalkyle, piperidinyle, hydroxy, cycloalkylalkyle et pipéridyle; un radical piperidinyle éventuellement substitué par piperidinyle ; un radical morpholinyle ou thio morpholinyle; un radical imidazolinyle éventuellement substitué par alkyle.13 - Compounds according to Claim 9, characterized in that XR1 (R2) is such that when X represents N, either one of RI and R2 represents the hydrogen atom or a C1-C4 alkyl radical optionally substituted by a amino, alkylamino, dialkylamino or phenyl radical and the other of Ri and R2 is chosen from the values defined for Ri and R2 in any one of claims 1 to 8, either RI and R2 form together with the nitrogen atom to which they are linked a piperazinyl or homopiperazinyl radical optionally substituted by one or more radicals selected from alkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, phenylalkyl, alkoxyalkyl, hydroxyalkyl, dihydroxyalkyl, hydroxyalkoxyalkyl with C1-C6 imidazolylaminoalkyle, imidazolyl alkylaminoalkyl, imidazolylhydroxyalkylaminoalkyle, pyridyl, pyridinylalkyl, imidazopyridinylalkyle, pyrrolidinylalkyl, imidazolyl optionally substituted by one or more radicals alkyl or phenyl, morpholinylalkyl, benzoimidazolalkyl optionally substituted by alkyl or hydroxyalkyl, C3-C8 cycloalkyl, pyrazinyl, pyrimidinyl, pyridyl, piperidyl, furylcarbonyl, furfurycarbonyl, quinolyl or isoquinolyl; a pyrrolidinyl radical optionally substituted by C1-C4 alkyl or alkoxy, hydroxy, acylamino, pyrrolidinylalkyl, pyridinyl and pyridyl; a 1,2,3,4,4-tetrahydroquinolinyl 1,2,3,4- or tetrahydroisoquinolinyl radical; a . diazepine radical optionally substituted by alkyl or pyrrolidinylalkyl; a piperidyl radical optionally substituted by one or more radicals chosen from the alkyl, alkoxy, alkoxyalkyl, pyrrolylalkyl, piperidinyl, hydroxy, cycloalkylalkyl and piperidyl radicals; a piperidinyl radical optionally substituted by piperidinyl; a morpholinyl or thio morpholinyl radical; an imidazolinyl radical optionally substituted by alkyl.
14 - Composés selon la revendication 9 caractérisés en ce qu'ils répondent à la formule (I) ci-dessous :14 - Compounds according to Claim 9, characterized in that they correspond to formula (I) below:
dans laquelle : A représente un radical XR1(R2) dans lequel X représente un atome d'azote, d'oxygène, de soufre ou un radical alkyle en C1-C6 pour former l'un des radicaux suivants : in which : A represents a radical XR1 (R2) in which X represents a nitrogen, oxygen or sulfur atom or a C1-C6 alkyl radical to form one of the following radicals:
• NR1R2 avec Ri et R2 identiques ou différents sont choisis parmi l'atome d'hydrogène ; alkyle C1-C8 éventuellement substitué par un radical amino, alkylamino, dialkylamino,- (phényl) (alkyl) amino, (alkylphényl)• NR1R2 with Ri and R2 identical or different are chosen from the hydrogen atom; C1-C8 alkyl optionally substituted by an amino, alkylamino, dialkylamino, - (phenyl) (alkyl) amino, (alkylphenyl) radical
(alkyl) amino, alcoxy en C1-C4, thioalcoxy en Cl-(alkyl) amino, C1-C4 alkoxy, C1- thioalkoxy
C4, trifluorométhyle, pyrrolidinyle, pipéridyle, pipérazinyle, morpholinyle, pyridyle ou phényle; un cycle aromatique tel que défini à la revendication 1 ; un radical quinuclidine, un radical pyrrolidinyle, pipérazinyle, morpholinyle, pyridyle ou un radical pipéridyle éventuellement substitué par alkyle C1-C4 étant entendu que Ri et R2 identiques ne représentent pas tous deux hydrogène ou alkyle Cl- C4 non substitué et RI et R2 différents ne représentent pas l'un hydrogène et l'autre alkyle C1-C4 non substitué ou bien lorsque X représente N ou alkyle, Ri et R2 forment ensemble avec X auquel ils sont liés un radical monocyclique de 3 à 6 chaînons ou bicyclique de 8 à 10 chaînons saturé ou insaturé renfermant éventuellement un ou deux hétéroatomes identiques ou différents choisis parmi N, O ou S, • un groupe ORl ou SRI dans lequel Ri a la même signification que précédemment étant entendu que Ri ne représente pas hydrogène ou alkyle C1-C4 non substitué, ou • un groupe alkyle contenant 1 à 6 atomes de carbone substitué par Ri R2 tels que définis ci-dessusC4, trifluoromethyl, pyrrolidinyl, piperidyl, piperazinyl, morpholinyl, pyridyl or phenyl; an aromatic ring as defined in claim 1; a quinuclidine radical, a pyrrolidinyl, piperazinyl, morpholinyl, pyridyl radical or a piperidyl radical optionally substituted by C1-C4 alkyl, it being understood that identical Ri and R2 do not both represent hydrogen or unsubstituted C1-C4 alkyl and RI and R2 are different do not represent one hydrogen and the other unsubstituted C1-C4 alkyl or else when X represents N or alkyl, Ri and R2 form, together with X to which they are linked, a monocyclic radical of 3 to 6 members or bicyclic of 8 to 10 saturated or unsaturated links optionally containing one or two identical or different heteroatoms chosen from N, O or S, • an ORl or SRI group in which Ri has the same meaning as above, it being understood that Ri does not represent hydrogen or C1-C4 alkyl not substituted, or • an alkyl group containing 1 to 6 carbon atoms substituted by Ri R2 as defined above
- R3 et R'3, identiques ou différents, représentent indépendamment l'un de l'autre l'hydrogène ou un groupe alkyle en C1-C4- R3 and R'3, identical or different, independently of one another represent hydrogen or a C1-C4 alkyl group
- ri et Ar2 identiques ou différents représentent- ri and Ar 2 identical or different represent
* quand ri et Ar2 sont identiques :* when ri and Ar 2 are identical:
• un motif quinoléine éventuellement substitué par au moins un groupe N(Ra) (Rb) dans lequel Ra et Rb identiques ou différents représentent l'hydrogène ou un radical alkyle en C1-C4, (ou) un groupe alkoxy ou alkyle à chaîne courte contenant 1 à 4 atome de carbone ou• a quinoline unit optionally substituted by at least one N (Ra) (Rb) group in which Ra and Rb, which are identical or different, represent hydrogen or a C1-C4 alkyl radical, (or) a short-chain alkoxy or alkyl group containing 1 to 4 carbon atoms or
• une quinoléine possédant un atome d'azote sous forme quaternaire ou• a quinoline having a nitrogen atom in quaternary form or
• une benzamidine ou• a benzamidine or
• une pyridine attachée en position. -4 ou fusionnée avec un groupe aryle ou hétéroaryle éventuellement substituée par un groupe alkyle en C1-C4• a pyridine attached in position . -4 or fused with an aryl or heteroaryl group optionally substituted by a C1-C4 alkyl group
* quand Arx et Ar2 sont différents* when Ar x and Ar 2 are different
• Arx et Ar2 représentent tous les deux l'une des possibilités évoquées ci-dessus pour• Ar x and Ar 2 both represent one of the possibilities mentioned above for
Arx et Ar2 ouAr x and Ar 2 or
• Ari représente l'une des possibilités ci- dessus et Ar2 représente• Ari represents one of the possibilities above and Ar 2 represents
* un noyau phényle éventuellement substitué par un groupement halogène, alkoxy en C1-C4, cyano, carbonylamino éventuellement substitué par un ou plusieurs groupes alkyle en C1-C4, guanyl, alkylthio en C1-C4, amino, alkylamino en C1-C4, dialkylamino en Cl- C4 pour chaque groupe alkyle, nitro, alkylèneamino en C1-C4, (ou) alkénylèneamino en C2-C4, ou un radicla pipérazinyle éventuellement substitué par un radical alkyle C1-C4,* a phenyl ring optionally substituted by a halogen group, C1-C4 alkoxy, cyano, carbonylamino optionally substituted by one or several C1-C4 alkyl groups, guanyl, C1-C4 alkylthio, amino, C1-C4 alkylamino, C1-C4 dialkylamino for each alkyl, nitro, C1-C4 alkyleneamino, (or) C2-C4 alkenyleneamino group , or a piperazinyl radical optionally substituted by a C1-C4 alkyl radical,
* un noyau hétérocyclique mono ou bi ou tricyclique comportant 0 à 2 hétéroatome par cycle à la condition qu'au moins un hétéroatome soit présent dans au moins un cycle éventuellement substitué par un ou plusieurs groupes alkyle en C1-C4 ou par des groupes alkylène en C1-C4 ou alkénylène en C2-C4 ou un de ses sels, ces composés de formule (I) étant sous toutes les formes isomères possibles racemiques, enantiomeres et diastéréo-isomères.* a mono or bi or tricyclic heterocyclic ring comprising 0 to 2 heteroatoms per cycle provided that at least one heteroatom is present in at least one ring optionally substituted by one or more C1-C4 alkyl groups or by alkylene groups C1-C4 or C2-C4 alkenylene or a salt thereof, these compounds of formula (I) being in all the possible racemic isomeric, enantiomeric and diastereoisomeric forms.
15 - Composés selon la revendication 9 caractérisés en ce qu'ils répondent à la formule (I) ci-dessous :15 - Compounds according to Claim 9, characterized in that they correspond to formula (I) below:
dans laquelle : in which :
A représente un radical XR1(R2) dans lequel X représente un atome d'azote, d'oxygène, de soufre ou un radical alkyle en C1-C6 pour former l'un des radicaux suivants : NR1R2 avec RI et R2 identiques ou différents sont choisis parmi l'atome d'hydrogène ; alkyle C1-C8 éventuellement substitué par un radical amino, alkylamino, dialkylamino, (phényl)A represents a radical XR1 (R2) in which X represents a nitrogen, oxygen or sulfur atom or a C1-C6 alkyl radical to form one of the following radicals: NR1R2 with RI and R2 identical or different are chosen from the hydrogen atom; C1-C8 alkyl optionally substituted by an amino, alkylamino, dialkylamino, (phenyl) radical
(alkyl) amino, (alkylphényl) (alkyl) amino, alcoxy en C1-C4, thioalcoxy en C1-C4, trifluorométhyle, pyrrolidinyle, pipéridyle, pipérazinyle, morpholinyle, pyridyle ou phényle ; un cycle aromatique tel que défini à la revendication 1 ; un radical quinuclidine, un radical pyrrolidinyle, pipérazinyle, morpholinyle, pyridyle ou un radical pipéridyle éventuellement substitué par alkyle C1-C4 étant entendu que RI et R2 identiques ne représentent pas tous deux hydrogène ou alkyle C1-C4 non substitué et RI et R2 différents ne représentent pas l'un hydrogène et l'autre alkyle C1-C4 non substitué ou bien lorsque X représente N ou alkyle, RI et R2 forment ensemble avec X auquel ils sont liés un radical monocyclique de 3 à 6 chaînons ou bicyclique de 8 à 10 chaînons saturé ou insaturé renfermant éventuellement un ou deux hétéroatomes identiques ou différents choisis parmi N, O ou S,(alkyl) amino, (alkylphenyl) (alkyl) amino, C1-C4 alkoxy, C1-C4 thioalkoxy, trifluoromethyl, pyrrolidinyl, piperidyl, piperazinyl, morpholinyl, pyridyl or phenyl; an aromatic ring as defined in claim 1; a quinuclidine radical, a pyrrolidinyl, piperazinyl, morpholinyl, pyridyl radical or a piperidyl radical optionally substituted by C1-C4 alkyl, it being understood that identical RI and R2 do not both represent hydrogen or unsubstituted C1-C4 alkyl and RI and R2 are different do not represent one hydrogen and the other unsubstituted C1-C4 alkyl or else when X represents N or alkyl, RI and R2 form, together with X to which they are linked, a monocyclic radical of 3 to 6 members or bicyclic of 8 to 10 saturated or unsaturated links optionally containing one or two identical or different heteroatoms chosen from N, O or S,
• un groupe ORl ou SRI dans lequel RI a la même signification que précédemment étant entendu que Ri ne représente pas hydrogène ou alkyle C1-C4 non substitué, ou • un groupe alkyle contenant 1 à 6 atomes de carbone substitué par RI R2 tels que définis ci-dessus - R3 et R'3, identiques ou différents, représentent indépendamment 1 ' un de 1 ' autre 1 ' hydrogène ou un groupe alkyle en C1-C4• an OR1 or SRI group in which RI has the same meaning as above, it being understood that Ri does not represent hydrogen or unsubstituted C1-C4 alkyl, or • an alkyl group containing 1 to 6 carbon atoms substituted by RI R2 as defined above - R3 and R'3, identical or different, independently represent one of the other hydrogen or a C1-C4 alkyl group
- Arx et Ar2 identiques ou différents représentent * quand ri et Ar2 'sont identiques :- Ar x and Ar 2 identical or different represent * when ri and Ar 2 ' are identical:
• un motif quinoléine éventuellement substitué par au moins un groupe N(Ra) (Rb) dans lequel Ra et Rb identiques ou différents représentent l'hydrogène ou un radical alkyle en C1-C4, (ou) un groupe alkoxy ou 'alkyle à chaîne courte contenant 1 à 4 atome de carbone ou• a quinoline unit optionally substituted by at least one N (Ra) (Rb) group in which Ra and Rb, which are identical or different, represent hydrogen or a C1-C4 alkyl radical, (or) an alkoxy or ' chain alkyl group short containing 1 to 4 carbon atoms or
• une quinoléine possédant un atome d'azote sous forme quaternaire ou • une benzamidine ou• a quinoline having a nitrogen atom in quaternary form or • a benzamidine or
• une pyridine attachée en position -4 ou fusionnée avec un groupe aryle ou hétéroaryle éventuellement substituée par un groupe alkyle en C1-C4 * quand Ari et Ar2sont différents• a pyridine attached in position -4 or fused with an aryl or heteroaryl group optionally substituted by a C1-C4 * alkyl group when Ari and Ar 2 are different
• Ari et Ar2 représentent tous les deux l'une des possibilités évoquées ci-dessus pour Ari et Ar2 ou• Ari and Ar 2 both represent one of the possibilities mentioned above for Ari and Ar 2 or
• Ari représente l'une des possibilités ci- dessus et Ar2 représente• Ari represents one of the possibilities above and Ar 2 represents
* un noyau phényle éventuellement substitué par un groupement halogène, alkoxy en C1-C4, cyano, carbonylamino éventuellement substitué par un ou plusieurs groupes alkyle en C1-C4, guanyl, alkylthio en C1-C4, amino, alkylamino -en C1-C4, dialkylamino en Cl- C4 pour chaque groupe alkyle, nitro, alkylènea ino en C1-C4, (ou) alkénylèneamino en C2-C4, ou un radicla pipérazinyle éventuellement substitué par un radical alkyle C1-C4,a phenyl ring optionally substituted by a halogen group, C1-C4 alkoxy, cyano, carbonylamino optionally substituted by one or more C1-C4 alkyl groups, guanyl, C1-C4 alkylthio, amino, C1-C4 alkylamino, dialkylamino in Cl- C4 for each alkyl, nitro, C1-C4 alkylene ino, (or) C2-C4 alkenyleneamino, or a piperazinyl radical optionally substituted by a C1-C4 alkyl radical,
* un noyau hétérocyclique mono ou bi ou tricyclique comportant 0 à 2 hétéroatome par cycle à la condition qu'au moins un hétéroatome soit présent dans au moins un cycle éventuellement substitué par un ou plusieurs groupes alkyle en C1-C4 ou par des groupes alkylène en C1-C4 ou alkénylène en C2-C4 ou un de ses sels, ces composés de formule (I) étant sous toutes les formes isomères possibles racemiques, enantiomeres et diastéréo-isomères.* a mono or bi or tricyclic heterocyclic ring comprising 0 to 2 heteroatoms per cycle provided that at least one heteroatom is present in at least one ring optionally substituted by one or more C1-C4 alkyl groups or by alkylene groups C1-C4 or C2-C4 alkenylene or a salt thereof, these compounds of formula (I) being in all the possible racemic isomeric, enantiomeric and diastereoisomeric forms.
16 - Composés selon l'une quelconque des revendications 9 à 15 caractérisés en ce que16 - Compounds according to any one of Claims 9 to 15, characterized in that
A représente un radical XR1(R2) dans lequel X représente un atome d'azote N pour former NR1R2, un atome d'oxygène 0 pour former ORl ou un atome de soufre S pour former SRI comme suit :A represents a radical XR1 (R2) in which X represents a nitrogen atom N to form NR1R2, an oxygen atom 0 to form OR1 or a sulfur atom S to form SRI as follows:
• NR1R2 avec RI et R2 identiques ou différents sont choisis parmi l'atome d'hydrogène ; alkyle C1-C8 éventuellement substitué par un radical amino, alkylamino, dialkylamino, (phényl) (alkyl) amino, (alkylphényl) (alkyl) amino, alcoxy en C1-C4, par un radical imidazolyle, pyrrolidinyle, pyridyle ou par un radical phényle; un cycle aromatique tel que défini à la revendication 1 ; un radical quinuclidine, un radical pyrrolidinyle ou un radical pipéridyle éventuellement substitué par alkyle C1-C4 étant entendu que RI et R2 identiques ne représentent pas tous deux hydrogène ou alkyle Cl- C4 non substitué et RI et R2 différents ne représentent pas l'un hydrogène et l'autre alkyle C1-C4 non substitué, ou bien lorsque X représente N, RI et R2 forment ensemble avec X auquel ils sont liés un radical pipérazinyle, pipéridyle, pyrrolidinyle, morpholinyle ou thiomorpholinyle,• NR1R2 with RI and R2 identical or different are chosen from the hydrogen atom; C1-C8 alkyl optionally substituted by an amino, alkylamino, dialkylamino, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino, C1-C4 alkoxy radical, by an imidazolyl, pyrrolidinyl, pyridyl radical or by a phenyl radical ; an aromatic ring as defined in claim 1; a quinuclidine radical, a pyrrolidinyl radical or a piperidyl radical optionally substituted by C1-C4 alkyl, it being understood that identical RI and R2 do not both represent hydrogen or unsubstituted C1-C4 alkyl and RI and R2 different do not represent one hydrogen and the other C1-C4 alkyl not substituted, or else when X represents N, RI and R2 form, together with X to which they are linked, a piperazinyl, piperidyl, pyrrolidinyl, morpholinyl or thiomorpholinyl radical,
• ou un groupe ORl ou SRI dans lequel RI a la même signification que précédemment étant entendu que RI ne représente pas hydrogène ou alkyle C1-C4 non substitué, ou un de ses sels, ces composés étant sous toutes les formes isomères possibles racemiques, enantiomeres et diastéréo-isomères .• or a group ORl or SRI in which RI has the same meaning as previously, it being understood that RI does not represent hydrogen or unsubstituted C1-C4 alkyl, or one of its salts, these compounds being in all the possible racemic, enantiomeric isomeric forms and diastereoisomers.
17 - Composés selon l'une quelconque des revendications 9 à 15 caractérisés en ce que lorsque A représente NR1R2 soit l'un de Ri et R2 représente l'atome d'hydrogène et l'autre de Ri et R2 est choisi parmi les valeurs définis pour Ri et R2 soit RI et R2 forment ensemble avec l'atome d'azote auxquels ils sont liés un radical pipérazinyle, pyrrolidinyle, pipéridyle ou morpholinyle éventuellement substitués par alkyle ou pipéridyle.17 - Compounds according to any one of claims 9 to 15 characterized in that when A represents NR1R2 is one of Ri and R2 represents the hydrogen atom and the other of Ri and R2 is chosen from the defined values for R 1 and R 2 either R 1 and R 2 form, together with the nitrogen atom to which they are linked, a piperazinyl, pyrrolidinyl, piperidyl or morpholinyl radical optionally substituted by alkyl or piperidyl.
18 - Composés selon l'une quelconque des revendications 1 à 17 caractérisés en ce que Ari et Ar2 représentent un groupe choisi parmi les groupes suivants : 4-amino- ou 4- méthylamino- ou 4-diméthylamino- quinolyl, -isoquinolyl, quinolinium ou isoquinolinium dont le noyau quinolyle, isoquinolyl, quinolinium ou isoquinolinium est éventuellement substitué par un ou plusieurs groupe (s) méthyle lié (s) à un atome de carbone ou d'azote du cycle; ou phényle éventuellement substitué par un ou plusieurs atomes d'halogène.18 - Compounds according to any one of claims 1 to 17 characterized in that Ari and Ar 2 represent a group chosen from the following groups: 4-amino- or 4-methylamino- or 4-dimethylamino-quinolyl, -isoquinolyl, quinolinium or isoquinolinium in which the quinolyl, isoquinolyl, quinolinium or isoquinolinium nucleus is optionally substituted by one or more group (s) methyl linked to a carbon or nitrogen atom in the ring; or phenyl optionally substituted by one or more halogen atoms.
19 - Composés selon l'une quelconque des revendications 9 à 18 caractérisés en ce que le groupe A représente : soit un radical amino substitué par un radical choisi parmi les groupes suivants : 4-amino- ou 4-méthylamino- ou 4-diméthylamino- quinolyl, -isoquinolyl, quinolinium ou isoquinolinium dont le noyau quinolyle, isoquinolyl, quinolinium ou isoquinolinium est éventuellement substitué par un ou plusieurs groupe (s) méthyle lié (s) à un atome de carbone ou d'azote du cycle ; pyridyle ; phényle éventuellement substitué par un ou plusieurs atomes d'halogène ou par un radical pipérazinyle ou alkylpipérazinyle ; alkyle en C1-C4 substitué par un radical amino, alkylamino ou dialkylamino, (phényl) (alkyl) amino, (alk'ylphényl) (alkyl) amino, alcoxy en C2-C4, par un radical alkylpipérazinylcarbonyle, imidazolyle, pyrrolidinyle ou par un radical phényle, radicaux dans lesquels les groupes alkyle possèdent 1 à 4 atomes de carbone ; un radical pyrrolidinyle ; un radical pipéridyle éventuellement substitué par un radical alkyle en C1-C4 ; ou un radical quinuclidine19 - Compounds according to any one of Claims 9 to 18, characterized in that the group A represents: either an amino radical substituted by a radical chosen from the following groups: 4-amino- or 4-methylamino- or 4-dimethylamino- quinolyl, -isoquinolyl, quinolinium or isoquinolinium whose quinolyl, isoquinolyl, quinolinium or isoquinolinium ring is optionally substituted by one or more methyl group (s) linked to a carbon or nitrogen atom in the ring; pyridyle; phenyl optionally substituted by one or more halogen atoms or by a piperazinyl or alkylpiperazinyl radical; C1-C4 alkyl substituted by an amino, alkylamino or dialkylamino, (phenyl) (alkyl) amino, (alk ' ylphenyl) (alkyl) amino, C2-C4 alkoxy, by an alkylpiperazinylcarbonyl, imidazolyl, or pyrrolidinyl radical phenyl radical, radicals in which the alkyl groups have 1 to 4 carbon atoms; a pyrrolidinyl radical; a piperidyl radical optionally substituted by a C1-C4 alkyl radical; or a quinuclidine radical
soit un radical pyrrolidinyle, un radical morpholino ou un radical pipérazinyle éventuellement substitué par un radical alkyl C1-C4 ou pipéridyle, soit un radical 0-phényle, O-pyridyle, ou 0-alkyle substitué par un radical amino, alkylamino ou dialkylaminoeither a pyrrolidinyl radical, a morpholino radical or a piperazinyl radical optionally substituted by a C1-C4 alkyl or piperidyl radical, or a 0-phenyl, O-pyridyl, or 0-alkyl radical substituted by an amino, alkylamino or dialkylamino radical
20 - Composés selon l'une quelconque des revendications 1 à 19 caractérisés en ce quand Ari et Ar2 sont identiques, Ari et Ar2 représentent un groupe choisi parmi les groupes 4-amino- ou 4-méthylamino- ou 4-diméthylamino- quinolyl,- isoquinolyl, quinolinium ou isoquinolinium dont le noyau quinolyle, isoquinolyl, quinolinium ou isoquinolinium est éventuellement substitué par un ou plusieurs groupe (s) méthyle lié (s) à un atome de carbone ou d'azote du cycle.20 - Compounds according to any one of claims 1 to 19, characterized in that when Ari and Ar 2 are identical, Ari and Ar 2 represent a group chosen from the groups 4-amino- or 4-methylamino- or 4-dimethylamino-quinolyl - isoquinolyl, quinolinium or isoquinolinium in which the quinolyl, isoquinolyl, quinolinium or isoquinolinium ring is optionally substituted by one or more methyl group (s) linked to a carbon or nitrogen atom in the ring.
21 - Composés selon l'une quelconque des revendications 1 à 19 caractérisés en ce quand ri et Ar2 sont différents21 - Compounds according to any one of Claims 1 to 19, characterized in that when ri and Ar 2 are different
Ari représente :Ari represents:
• un motif quinoléine ou isoquinoléine substitué par au moins un groupe N(Ra) (Rb) dans lequel Ra et Rb identiques ou différents représentent l'hydrogène ou un radical alkyle en C1-C4 ou un groupe alkoxy ou alkyle à chaîne courte contenant 1 à 4 atomes de carbone ou • une quinoléine ou isoquinoléine possédant un atome d'azote sous forme quaternaire ou• a quinoline or isoquinoline unit substituted by at least one N (Ra) (Rb) group in which Ra and Rb, which are identical or different, represent hydrogen or a C1-C4 alkyl radical or a short chain alkoxy or alkyl group containing 1 with 4 carbon atoms or • a quinoline or isoquinoline having a nitrogen atom in quaternary form or
• une benzamidine sauf dans le cas où A représente la diéthylamine, l'hydrogène ou un groupe a iné ou • une pyridine attachée en position -4 ou fusionnée avec un groupe aryle ou hétéroaryle• a benzamidine except in the case where A represents diethylamine, hydrogen or an inated group or • a pyridine attached in position -4 or fused with an aryl or heteroaryl group
Ar2 représenteAr 2 represents
* un noyau tel que défini ci-dessus mais différent ou* a nucleus as defined above but different or
* un noyau phényle éventuellement substitué par un groupement halogène, méthoxy, cyano, carbonylamino, guanyl, méthylthio, amino, méthyla ino, diméthylamino, morpholine, alkylèneamino en C1-C4 ou alkénylèneamino en C2-C4 * un noyau' quinoline ou isoquinoline, benzimidazole, indole, benzothiophène, benzofurane, benzothiazole, benzoxazole, carbazole, quinazoline, quinoxaline éventuellement substitué par un ou plusieurs groupes alkyle en C1-C4 ou par des groupes alkylène en C1-C4 ou alkénylène en C2-C4* a phenyl nucleus optionally substituted by a halogen, methoxy, cyano, carbonylamino, guanyl, methylthio, amino, methyla ino, dimethylamino, morpholine, C1-C4 alkylene or C2-C4 alkeneamino group * A ring 'quinoline or isoquinoline, benzimidazole, indole, benzothiophene, benzofuran, benzothiazole, benzoxazole, carbazole, quinazoline, quinoxaline optionally substituted by one or more alkyl C1-C4 or by alkylene groups, C1-C4 alkyl or alkenylene C2 C4
22 - Composés selon l'une quelconque des revendications 9 à 21 caractérisés en ce que A représente un radical amino substitué par un radical choisi parmi les groupes suivants : les radicaux 4-amino- ou 4-méthylamino- ou 4- diméthylamino- quinolyl ou quinolinium dont le noyau quinolinium est éventuellement substitué par un groupe méthyle ; les radicaux alkyle en C1-C4 substitués par un radical amino, alkylamino, dialkylamino, (phényl) (alkyl) amino, ' (alkylphényl) (alkyl) amino, pyrrolidinyle ou pyridyle ; ou le radical quinuclidine22 - Compounds according to any one of Claims 9 to 21, characterized in that A represents an amino radical substituted by a radical chosen from the following groups: 4-amino- or 4-methylamino- or 4-dimethylamino-quinolyl radicals or quinolinium, the quinolinium nucleus of which is optionally substituted by a methyl group; C1-C4 alkyl radicals substituted by an amino, alkylamino, dialkylamino, (phenyl) (alkyl) amino, ' (alkylphenyl) (alkyl) amino, pyrrolidinyl or pyridyl radical; or the quinuclidine radical
23 - Composés selon l'une quelconque des revendications 9 à 21 caractérisés en ce que A représente soit un radical amino substitué par un ou plusieurs radicaux tels que définis à l'une quelconque des revendications 9 à 21 soit un radical pipérazinyle, homopipérazinyle, piperidinyle ou pyrrolidinyle éventuellement substitué (s) par un ou plusieurs radicaux tels que définis à l'une quelconque des revendications 9 à 2123 - Compounds according to any one of Claims 9 to 21, characterized in that A represents either an amino radical substituted by one or more radicals as defined in any one of Claims 9 to 21 or a piperazinyl, homopiperazinyl, piperidinyl radical or pyrrolidinyl optionally substituted with one or more radicals as defined in any one of Claims 9 to 21
24 - Composés selon l'une quelconque des revendications 9 à 21 caractérisés en ce que A représente un radical 0(ou S) -cycle aromatique ou un' radical- 0(ou S) -alkyle avec alkyle éventuellement substitué.24 - Compounds according to any one of claims 9 to 21, characterized in that A represents an O (or S) -aromatic ring radical or an ' O- (or S) -alkyl radical with optionally substituted alkyl.
25 - Composés selon l'une quelconque des revendications 9 à 21 caractérisés en ce que A représente un radical O-phényle, O-pyridyle, O-pyrimidinyle ou 0-alkyle substitué par un radical amino, alkylamino ou dialkylamino ou bien un radical S-phényle, S-pyridyle, S- pyrimidyle ou S quinoleinyl.25 - Compounds according to any one of Claims 9 to 21, characterized in that A represents an O-phenyl, O-pyridyl, O-pyrimidinyl or O-alkyl radical substituted by an amino, alkylamino or dialkylamino radical or else an S-phenyl, S-pyridyl, S-pyrimidyl or S quinoleinyl radical.
26 - Composés selon l'une quelconque des revendications 1 et 2 répondant aux produits suivants :26 - Compounds according to any one of claims 1 and 2 corresponding to the following products:
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (3-diméthylamino-propyl) amino- [1,3,5] triazine (exemple 1)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (3-dimethylamino-propyl) amino- [1,3,5] triazine (example 1)
le 2, 4, 6-tris- (4-amino-2-méthyl-quinolin-6-yl) amino- [1, 3, 5] triazine (exemple 2)2, 4, 6-tris- (4-amino-2-methyl-quinolin-6-yl) amino- [1, 3, 5] triazine (example 2)
- le 2, 4-bis- (4-amino-2-méthyl-quinolin-6-yl) amino-6- (4- diméthylamino-2-méthyl-quinolin-6-yl) amino-- 2,4-bis- (4-amino-2-methyl-quinolin-6-yl) amino-6- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-
[1, 3, 5] triazine (exemple 11)[1, 3, 5] triazine (example 11)
le 2, 4-bis- (4-amino-2-méthyl-quinolin-6-yl) amino-6- (quinuclidin-3-yl) amino- [1, 3, 5] triazine (exemple 17)2,4-bis- (4-amino-2-methyl-quinolin-6-yl) amino-6- (quinuclidin-3-yl) amino- [1, 3, 5] triazine (example 17)
- le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (l-méthyl-pipéridin-4-yl) -[1,3,5] triazine (exemple 19)- 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (1-methyl-piperidin-4-yl) - [1,3,5] triazine (example 19 )
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (l-méthyl-pipérazin-4-yl) -[1,3,5] triazine (exemple 20)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (1-methyl-piperazin-4-yl) - [1,3,5] triazine (example 20)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (pyridin-4-yl) méthylamino- [1, 3, 5] triazine (exemple 27)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (pyridin-4-yl) methylamino- [1, 3, 5] triazine (example 27)
- le 2, 4-bis- (4-amino-2-méthyl-quinolin-6-yl) amino-6- phénoxy- [1, 3,5] triazine (exemple 29)- 2,4-bis- (4-amino-2-methyl-quinolin-6-yl) amino-6-phenoxy- [1, 3,5] triazine (example 29)
- le 2, -bis- (4-amino-2-méthyl-quinolin-6-yl) amino-6- (3- diméthylamino-propyl) oxy- [1, 3,5] triazine (exemple 31) le 2, 4-bis- (4-amino-2-méthyl-quinolin-6-yl) amino-6- (pyridin-4-yl) oxy- [1, 3, 5] triazine (exemple 32)- 2, -bis- (4-amino-2-methyl-quinolin-6-yl) amino-6- (3-dimethylamino-propyl) oxy- [1, 3,5] triazine (example 31) 2,4-bis- (4-amino-2-methyl-quinolin-6-yl) amino-6- (pyridin-4-yl) oxy- [1, 3, 5] triazine (example 32)
le 2, 4-bis- (4-amino-2-méthyl-quinolin-6-yl) amino-6- (phénylméthyl) oxy- [1, 3, 5] triazine (exemple 33).2,4-bis- (4-amino-2-methyl-quinolin-6-yl) amino-6- (phenylmethyl) oxy- [1, 3, 5] triazine (Example 33).
27 - Composés selon l'une quelconque des revendications 1 et 2 répondant aux produits suivants :27 - Compounds according to any one of claims 1 and 2 corresponding to the following products:
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (3-diméthylamino-propyl) amino- [1,3,5] triazine (exemple 1)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (3-dimethylamino-propyl) amino- [1,3,5] triazine (example 1)
- le '2, 4, 6-tris- (4-amino-2-méthyl-quinolin-6-yl) amino- [1, 3, 5] triazine (exemple 2).- the ' 2, 4, 6-tris- (4-amino-2-methyl-quinolin-6-yl) amino- [1, 3, 5] triazine (example 2).
- le 2, 4-bis- (4-amino-2-méthyl-quinolin-6-yl) amino-6- (4- diméthylamino-2-méthyl-quinolin-6-yl) amino- [1, 3, 5] triazine (exemple 11)- 2,4-bis- (4-amino-2-methyl-quinolin-6-yl) amino-6- (4-dimethylamino-2-methyl-quinolin-6-yl) amino- [1, 3, 5 ] triazine (example 11)
- le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (l-méthyl-pipérazin-4-yl) -[1,3,5] triazine (exemple 20)- 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (1-methyl-piperazin-4-yl) - [1,3,5] triazine (example 20 )
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (pyridin-4-yl) oxy- [1, 3, 5] triazine (exemple 115)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (pyridin-4-yl) oxy- [1, 3, 5] triazine (example 115)
le 2,4-bis- (4-amino-2-méthyl-quinolin-6-yl) amino-6- (quinolin-2-yl) thio- [1, 3, 5] triazine (exemple 128)2,4-bis- (4-amino-2-methyl-quinolin-6-yl) amino-6- (quinolin-2-yl) thio- [1, 3, 5] triazine (example 128)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6-phényl- [1, 3, 5] triazine (exemple 134)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6-phenyl- [1, 3, 5] triazine (example 134)
- le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6-[l- (2-dipropylamino-ethyl)pipérazin-4-yl] - [1,3, 5] triazine (exemple 137) le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6-{ [1-2- (2-hydroxy-éthyl) oxy-éthyl] pipérazin-4- yl}- [1, 3, 5] triazine (exemple 141)- 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [1- (2-dipropylamino-ethyl) piperazin-4-yl] - [1,3, 5 ] triazine (example 137) 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- {[1-2- (2-hydroxy-ethyl) oxy-ethyl] piperazin-4-yl} - [1, 3, 5] triazine (example 141)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- [2 (S) - (ρyrrolidin-l-yl)méthyl-pyrrolidin-l- yl] - [1, 3, 5] triazine (exemple 149)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [2 (S) - (ρyrrolidin-1-yl) methyl-pyrrolidin-1-yl] - [1 , 3, 5] triazine (example 149)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (quinolin-2-yl) thio- [1,3,5] triazine (exemple 133)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (quinolin-2-yl) thio- [1,3,5] triazine (example 133)
- le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (l-méthyl-homopipérazin-4-yl) -[1,3,5] triazine (exemple ' 135)- 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (1-methyl-homopiperazin-4-yl) - [1,3,5] triazine (example ' 135)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- [1- (3-diméthylamino-propyl) -pipérazin-4-yl] - [1, 3, 5] triazine (exemple 136)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [1- (3-dimethylamino-propyl) -piperazin-4-yl] - [1, 3, 5 ] triazine (example 136)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- [N- (l-méthyl-pipéridin-4-yl) -N-méthyl-amino] - [1, 3, 5] triazine (exemple 138)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [N- (1-methyl-piperidin-4-yl) -N-methyl-amino] - [1 , 3, 5] triazine (example 138)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6-{l- [3- (pyrrolidin-l-yl)propyl-homopipérazin-4- yl) - [1, 3, 5] triazine (exemple 139)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- {l- [3- (pyrrolidin-1-yl) propyl-homopiperazin-4-yl) - [1 , 3, 5] triazine (example 139)
le 2, -bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- [1- (pyridin-4-yl) -pipérazin-4-yl] - [1, 3, 5] triazine (exemple 144)2, -bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [1- (pyridin-4-yl) -piperazin-4-yl] - [1, 3, 5] triazine (example 144)
28 - Composés selon l'une quelconque des revendications 1 et 2 répondant aux produits suivants :28 - Compounds according to any one of claims 1 and 2 corresponding to the following products:
le 2,4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (l-méthyl-pipérazin-4-yl) - [1, 3, 5] triazine (exemple 20) le 2,4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (quinolin-2-yl) thio- [1,3, 5] triazine (exemple 133) r le 2,4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- (l-méthyl-homopipérazin-4-yl) - [1, 3, 5] triazine (exemple 135)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (1-methyl-piperazin-4-yl) - [1, 3, 5] triazine (example 20) 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (quinolin-2-yl) thio- [1,3, 5] triazine (example 133) r le 2 , 4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (1-methyl-homopiperazin-4-yl) - [1, 3, 5] triazine (example 135)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- [1- (3-diméthylamino-propyl) -pipérazin-4-yl] - [1, 3, 5] triazine (exemple 136)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [1- (3-dimethylamino-propyl) -piperazin-4-yl] - [1, 3, 5 ] triazine (example 136)
- le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- [N- (l-méthyl-pipéridin-4-yl) -N-méthyl-amino] - [1, 3, 5] triazine (exemple 138)- 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [N- (1-methyl-piperidin-4-yl) -N-methyl-amino] - [ 1, 3, 5] triazine (example 138)
- le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6-{l- [3- (pyrrolidin-l-yl)propyl-homopipérazin-4- yl) - [1, 3, 5] triazine (exemple 139)- 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- {l- [3- (pyrrolidin-1-yl) propyl-homopiperazin-4-yl) - [ 1, 3, 5] triazine (example 139)
le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- [1- (pyridin-4-yl) -pipérazin-4-yl] - [1, 3, 5] triazine (exemple 144)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [1- (pyridin-4-yl) -piperazin-4-yl] - [1, 3, 5 ] triazine (example 144)
- le 2, 4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- [4- (pipéridin-4-yl) -pipérazin-1-yl] -- 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6- yl) amino-6- [4- (piperidin-4-yl) -piperazin-1-yl] -
[1, 3, 5] triazine (exemple 199)[1, 3, 5] triazine (example 199)
le 2,4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- [4- (pipéridin-1-yl) butyl] amino- [1,3, 5] triazine (exemple 200)2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [4- (piperidin-1-yl) butyl] amino- [1,3, 5] triazine (example 200)
- le 2,4-bis- (4-diméthylamino-2-méthyl-quinolin-6- yl) amino-6- [ (imidazol-l-yl)méthyl] amino- [1, 3, 5] triazine (exemple 202)- 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [(imidazol-1-yl) methyl] amino- [1, 3, 5] triazine (example 202 )
29 - Compositions pharmaceutiques comprenant à titre de principe actif un produit selon la revendication 1 ou 2. 30 - Compositions pharmaceutiques comprenant à titre de principe actif un produit selon les revendications 26, 27 ou 28 .29 - Pharmaceutical compositions comprising, as active principle, a product according to claim 1 or 2. 30 - Pharmaceutical compositions comprising, as active principle, a product according to claims 26, 27 or 28.
31 - Composés de la revendication 1 ou 2 caractérisés en ce qu' ils ont une activité inhibitrice des télomérases .31 - Compounds of claim 1 or 2 characterized in that they have a telomerase inhibiting activity.
32 - Composés selon l ' une quelconque des revendications précédentes caractérisés en ce qu' ils ont une activité anticancéreuse .32 - Compounds according to any one of the preceding claims, characterized in that they have an anticancer activity.
33 - Utilisation des composés de la revendication 32 comme produit pharmaceutique à usage humain .33 - Use of the compounds of claim 32 as a pharmaceutical product for human use.
34 - Associations thérapeutiques constituées d' un composé selon la revendication 1 ou 2 et d' un autre composé anticancéreux .34 - Therapeutic combinations consisting of a compound according to claim 1 or 2 and another anticancer compound.
35 - Associations selon la revendication 34 caractérisées en ce que le composé anticancéreux est choisi parmi les agents alkylants , les dérivés du platine, les agents antibiotiques , les agents antimicrotubules , les anthracyclines , les topoiso érases des groupes I et II , les fluoropyrimidines , les analogues de cytidine, les analogues d' adénosine , les enzymes et composés divers tels que la L-asparaginase, l' hydroxyurée, l' acide trans- rétinoique, la suramine , l' irinotecan, le topotecan, la dexrazoxane, l' amifostine, l' herceptin ainsi que les hormones oetrogéniques , androgéniques , les agents antivasculaires .35 - Associations according to claim 34 characterized in that the anticancer compound is chosen from alkylating agents, platinum derivatives, antibiotic agents, antimicrotubule agents, anthracyclines, topoisoerases from groups I and II, fluoropyrimidines, cytidine analogues, adenosine analogs, enzymes and various compounds such as L-asparaginase, hydroxyurea, trans-retinoic acid, suramin, irinotecan, topotecan, dexrazoxane, amifostine, herceptin as well as oetrogenic and androgenic hormones, antivascular agents.
36 - Association thérapeutique constituée d' un composé selon la revendication 1 ou 2 et de radiations .36 - Therapeutic combination consisting of a compound according to claim 1 or 2 and radiation.
37 - Associations selon l' une quelconque des revendications 34 à 36 caractérisées en ce que chacun des composés ou des traitements est administré simultanément, séparément ou séquentiellement . 37 - Combinations according to any one of claims 34 to 36 characterized in that each of the compounds or of treatments is administered simultaneously, separately or sequentially.
EP02720068A 2001-03-23 2002-03-22 Chemical derivatives and their use as anti-telomerase agent Withdrawn EP1373252A1 (en)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
FR0103916 2001-03-23
FR0103916A FR2822468B1 (en) 2001-03-23 2001-03-23 CHEMICAL DERIVATIVES AND THEIR APPLICATION AS ANTI-TELOMERASE AGENT
FR0110370 2001-08-02
FR0110370 2001-08-02
PCT/FR2002/001005 WO2002076975A1 (en) 2001-03-23 2002-03-22 Chemical derivatives and their use as anti-telomerase agent

Publications (1)

Publication Number Publication Date
EP1373252A1 true EP1373252A1 (en) 2004-01-02

Family

ID=26212933

Family Applications (1)

Application Number Title Priority Date Filing Date
EP02720068A Withdrawn EP1373252A1 (en) 2001-03-23 2002-03-22 Chemical derivatives and their use as anti-telomerase agent

Country Status (11)

Country Link
EP (1) EP1373252A1 (en)
JP (1) JP2004524349A (en)
AR (1) AR034297A1 (en)
AU (1) AU2002251140B2 (en)
CA (1) CA2442012A1 (en)
CO (1) CO5380035A1 (en)
IL (2) IL158056A0 (en)
MX (1) MXPA03008269A (en)
MY (1) MY130957A (en)
PE (1) PE20020959A1 (en)
WO (1) WO2002076975A1 (en)

Families Citing this family (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002096903A2 (en) * 2001-05-28 2002-12-05 Aventis Pharma S.A. Chemical derivatives and the use thereof as an anti-telomerase agent
US7173032B2 (en) * 2001-09-21 2007-02-06 Reddy Us Therapeutics, Inc. Methods and compositions of novel triazine compounds
AU2002361846A1 (en) * 2001-12-21 2003-07-15 Bayer Pharmaceuticals Corporation Quinazoline and quinoline derivative compounds as inhibitors of prolylpeptidase, inducers of apoptosis and cancer treatment agents
AU2003253735A1 (en) * 2002-06-25 2004-01-06 The Center For Blood Research, Inc. Vacuolins
FR2850970B1 (en) * 2003-02-07 2006-07-07 Aventis Pharma Sa CHEMICAL DERIVATIVES BINDING VERY SPECIFIC TO G-QUADRUPLEX DNA STRUCTURES AND THEIR APPLICATION AS A SPECIFIC ANTICANCER AGENT
WO2006074147A2 (en) 2005-01-03 2006-07-13 Myriad Genetics, Inc. Nitrogen containing bicyclic compounds and therapeutical use thereof
US8309562B2 (en) 2003-07-03 2012-11-13 Myrexis, Inc. Compounds and therapeutical use thereof
US8258145B2 (en) 2005-01-03 2012-09-04 Myrexis, Inc. Method of treating brain cancer
JP2008540585A (en) * 2005-05-19 2008-11-20 プロメティック・バイオサイエンスィズ・インコーポレーテッド Compounds for treating metastatic melanoma and other cancers, compositions containing such compounds, and methods of treatment
US8138338B2 (en) * 2006-07-31 2012-03-20 Glaxosmithkline Llc Aurora kinase inhibitors from an encoded small molecule library
US8415340B2 (en) * 2007-07-25 2013-04-09 Bristol-Myers Squibb Company Triazine kinase inhibitors
FR2948686B1 (en) * 2009-07-30 2011-08-19 Biomerieux Sa NEW PEPTIDASE SUBSTRATES
US20210024455A1 (en) * 2018-03-20 2021-01-28 Hiroshima University Compound which inhibits telomere-binding protein, and telomere-binding protein inhibitor containing same

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB9206768D0 (en) * 1992-03-27 1992-05-13 Jarman Michael New compounds for use in the treatment of cancer
JPH1160573A (en) * 1997-08-22 1999-03-02 Nippon Kayaku Co Ltd Triazine derivative and telomerase inhibitor
US6262053B1 (en) * 1999-06-23 2001-07-17 Parker Hughes Institute Melamine derivatives as potent anti-cancer agents
SK7402002A3 (en) * 1999-11-29 2002-11-06 Aventis Pharma Sa Arylamine derivatives and their use as anti-telomerase agent
KR100875362B1 (en) * 2002-02-05 2008-12-22 아스텔라스세이야쿠 가부시키가이샤 2,4,6-triamino-1,3,5-triazine derivative

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO02076975A1 *

Also Published As

Publication number Publication date
MY130957A (en) 2007-07-31
PE20020959A1 (en) 2002-12-17
WO2002076975A1 (en) 2002-10-03
MXPA03008269A (en) 2004-10-15
IL158056A (en) 2010-02-17
AU2002251140B2 (en) 2007-03-15
CA2442012A1 (en) 2002-10-03
IL158056A0 (en) 2004-03-28
JP2004524349A (en) 2004-08-12
CO5380035A1 (en) 2004-03-31
AR034297A1 (en) 2004-02-18

Similar Documents

Publication Publication Date Title
EP1244650B1 (en) Arylamine derivatives and their use as anti-telomerase agent
JP7121660B2 (en) Use of EZH2 inhibitors to treat cancer
EP2125803B1 (en) Pyrrolo[2,3-b]pyridine compounds, azaindole compounds used for synthesizing said pyrrolo[2,3-b]pyridine compounds, methods for the production thereof, and uses thereof
EP2964223A1 (en) Compounds inhibiting leucine-rich repeat kinase enzyme activity
EP1401833A2 (en) Chemical derivatives and the use thereof as an anti-elomerase agent
US20090226411A1 (en) Chemical derivatives and their application as antitelomerase agents
EP1373252A1 (en) Chemical derivatives and their use as anti-telomerase agent
EP3630759B1 (en) Compounds useful as ion channel inhibitors for the treatment of cancer
CH633796A5 (en) THERAPEUTICALLY ACTIVE DIPYRIDOINDOLES.
JP2019524711A (en) Substituted hydantoin and thiohydantoin derivatives as androgen receptor antagonists
FR2850970A1 (en) New quaternary aromatic nitrogen heterocycle derivatives that fix the G-quadruplex structure of DNA or RNA are telomerase inhibitors, useful in the treatment of cancers and some genetic disorders
EP4163277A1 (en) Novel pyrazole derivatives
KR20010013826A (en) Novel tricyclic sulfonamide inhibitors of farnesyl-protein transferase
FR2819255A1 (en) CHEMICAL DERIVATIVES AND THEIR APPLICATION AS ANTITELOMERASE AGENT
FR2822468A1 (en) New arylamino-substituted triazine or diazine derivatives, used as telomerase inhibiting anticancer agents, by fixing the G-quadruplex structure of DNA or RNA
JP2003055376A (en) Pyrazoloquinoline derivative as protein kinase c inhibitor
WO2002068408A1 (en) Chemical derivatives and the use thereof as an anti-elomerase agent
WO2002012194A1 (en) Phenantridine derivatives and their use as anti-telomerase agent
US20240132490A1 (en) Inhibitors of protein kinase a
JP4537710B2 (en) 1,8-Annelated Quinoline Derivatives Substituted with Carbon-Linked Triazoles as Farnesyltransferase Inhibitors
FR2801588A1 (en) Diarylamino diazine and triazine derivatives are telomerase inhibitors and G-quadruplex stabilizers, useful in the treatment of cancers
FR2825090A1 (en) New compounds as telomerase inhibitors that fix the G-quadruplex structure of DNA or RNA, useful in the treatment of cancers
JP2004505082A (en) Use of a polycyclic aromatic compound for producing a drug capable of inhibiting telomerase
CN114805350A (en) Benzo-heterocycle-pyridone derivatives and preparation method and application thereof

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20031023

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

RIN1 Information on inventor provided before grant (corrected)

Inventor name: CAULFIELD, THOMAS

Inventor name: HAMY, FRANEOIS

Inventor name: MERGNY, JEAN-LOUIS

Inventor name: DOERFLINGER, GILLES

Inventor name: RIOU, JEAN-FRANEOIS

Inventor name: LAOUI, ABDELAZIZE

Inventor name: MAILLIET, PATRICK

17Q First examination report despatched

Effective date: 20040415

17Q First examination report despatched

Effective date: 20040415

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20100612