CA2442012A1 - Chemical derivatives and their use as anti-telomerase agent - Google Patents

Abstract

The present invention relates to cancer therapy and relates to new anticancer agents having a very specific mechanism of action. It also relates to new chemical compounds as well as their therapeutic application in humans.

Description

CHEMICAL DERIVATIVES AND THEIR APPLICATION AS AN AGENT
antitelomerase The ~ present invention relates to therapy of cancer and coricerne new anticancer agents having a very specific mechanism of action. It relates to also new chemical compounds and their therapeutic application in humans.
The present invention relates to the use of new non-nucleotide chemicals that interact with specific acid structures deoxyribonucleic (DNA) or ribonucleic acid (RNA). These new compds are made up of an agent distributor linked to two aminoaromatic groups. These new compounds are useful in the treatment of z5 cancers and act in particular as agents inhibitor ~ rs of telomerase. They are particularly useful for stabilizing DNA in G-quadruplex structure (guanine tetrads). The therapeutic application of inhibition of telomerase via stabilization of these G-quadruplexes is the arrest of cell mitosis and the death of rapidly dividing cells such as cancer cells and possibly the induction of cancer cell senescence.
The compounds of the present invention exhibit the therapeutic advantage of blocking the telomerase. From a biological point of view, telomerase allows the addition of TTA type repeat DNA sequences GGG, called telomeric sequences, at the end of the telomeres, during cell division. By this action telomerase makes the cell immortal. In Indeed, in the absence of this enzymatic activity, the cell loses at each division 100 to 150 bases, which the quickly descends. At the onset of rapidly dividing cancer cells it turned out that

2 these cells had telomeres maintained at a length stable during cell division. In these cancer cells appeared as telomerase was strongly activated and that it allowed the addition repeating patterns of telomeric sequences at the end of telomer and therefore allowed the conservation of the length of the telomer in cancer cells. I1 has appeared for some time that more than 85 ~ of cancer cells tested positive for presence of telomerase while somatic cells do not have this characteristic.
So telomerase is a very coveted target to treat cancer cells. The first one obvious approach to block telomerase has been the use of nucleotide structures (Chen et al., Proc. Natl. Acad. Sci. USA 93 (7), 2635-239). From non-nucleotide compounds that have been used in prior art include diaminoanthraquinones (Sun et al. J. Med. Chem. 40 (14), 3113-6) or 2o diethyloxadicarbocyanines (Wheelhouse RT Et al. J. Am.
Chem. Soc. 1998 (120) 3261-2).
WO 99/40087 describes the use of compounds that interact with structures G-quadruplexes which are perylenic compounds and carb ~ cyanines containing at least seven cycles including two heterocycles.
It was quite surprising that simple structures allowed to obtain a result at least equivalent with much less structures chemically complicated. The compounds of the present invention that meet the intended objective that is, which fix the G-quadruplex structure of DNA
or RNA and in particular the G-quadruplex structure of tel.omères and therefore have activity

3 telomerase inhibitor respond to formula next general.
nitrogen aromatic cycle - NR3 - distributor - NR'3 - cycle aromatic in which ~ the nitrogen aromatic cycle represents.
0 quinoline or isoquinoline optionally substituted by at least one radical chosen from a group N (Ra) (Rb) in which Ra and Rb, identical or different represent hydrogen or a C1-C4 alkyl radical, and a or more) alkoxy or chain alkyl short in C1-C4 linked) to a carbon atom or quinoline or isoquinoline nitrogen 0 a quinoline or isoquinoline having a nitrogen atom in quaternary form or 0 a benzamidine or 0 a pyridine ~ the aromatic cycle represents 0 quinoline or isoquinoline optionally substituted by at least one radical chosen from a group N (Ra) (Rb) in which Ra and Rb, identical or different represent hydrogen or a C1-C4 alkyl radical, and a or more) alkoxy or chain alkyl short in C1-C4 linked) to a carbon atom or quinoline or isoquinoline nitrogen or 0 a quinoline or isoquinoline having a nitrogen atom in quaternary form or 3o 0 a benzamidine or 0 a pyridine or

4 0 an optionally substituted phenyl ring by a halogen group; C1- alkoxy C4; cyano; .carbonylamino possibly substituted by one or more groups ~ C1-C4 alkyl; guanyl; alkylthio in C1-C4; amino, C1-C4 alkylamino, C1-C4 alkylamino for each group alkyl and whose alkyl parts can together form a C3-C8 cycle, vitro;
1o C1-C4 alkyleneamino; alkënylèneamino in C2-C4;
0 a heterocyclic ring mono or bi or tricyclic with 0 to 2 heteretomy per cycle provided that at least one heteroatom is present in at least one cycle optionally substituted with um or several C1-C4 alkyl groups or by C1-C4 alkylene groups or C2-C4 alkenylene ~ R3 and R'3, identical or different, represent independently of each other hydrogen or a C1-C4 alkyl radical ~ the dispatcher represents.
a triazine group possibly substituted by an aromatic ring such as defined above or by a radical XR1 (R2) in which X represents a nitrogen atom N to form NR1R2, an alkyl radical linear or branched in C1-C6 to form 3o alkRl.R2, an oxygen atom 0 to form OR1 or a sulfur atom S to form SR L, with R1 and R2 identical or different are chosen from the hydrogen atom;

WO 02/07697

5 PCT / FR02 / 01005 an optionally C1-C8 alkyl radical substituted by one or more radicals identical or different; a cycle aromatic as defined above 5 optionally substituted; a radical quinuclidine; a pyrrolidinyl radical itself possibly substituted by a alkyl or phenylalkyl radical with alkyl in ~ C1-C4; a piperazinyl radical or 2o homopiperazinyl itself possibly substituted by an alkyl radical, cycloalkyl or phenylalkyl; a radical morpholinyl; a pyridyl radical, piperidinyl or a piperidyl radical optionally substituted with one or several alkyl or phenylalkyl radicals with C1-C4 alkyl; a radical indazolyl; a naphthyl radical; a benzotriazole radical; a radical benzoimidazolyl; a pyrimidinyl radical optionally substituted with one or several alkyls with C1-C4 alkyl; a acenaphthene radical; an amino radical itself possibly substituted with a two identical or different radicals chosen from alkyl, phenylalkyl, alkylaminoalkyl and dialkylaminoalkyl, it being understood that when XR1R2 represents NR1R2, then R1 and R2 identical do not 3o do not both represent hydrogen or unsubstituted C1-C4 alkyl and R1 and R2 different don't represent one hydrogen and the other C1-C4 alkyl not substituted

6 or when X represents N or alkyl, R1 and R2 form together with X at which they are linked a monocyclic radical of 3 with 6 links or bicyclic from 8 to 10 saturated or unsaturated links containing possibly one or two heteroatoms identical or different chosen from N, 0 or S, this radical possibly being substituted - a diazine group possibly substituted by the same groups as the triazine or one of its salts, these compounds being in all the isomeric forms possible racemates, enantiomers and diastereoisomers.
The subject of the present invention is compounds such as defined above characterized in that they respond to the following general formula.
nitrogen aromatic cycle - NR3 - distributor - NR'3 - cycle aromatic in which ~ the nitrogen aromatic cycle represents.
0 quinoline or isoquinoline optionally substituted by at least one radical chosen from a group N (Ra) (Rb) in which Ra and Rb, identical or different represent hydrogen or a C1-C4 alkyl radical, and a C1-C4 alkoxy or short chain alkyl or.
0 a quinoline or isoquinoline having a nitrogen atom in quaternary form or

7 0 a benzamidine or 0 a pyridine ~ the aromatic cycle represents 0 an optionally substituted quinoline by at least one radical chosen from a group N (Ra) (Rb) in which. Ra and Rb, identical or different represent hydrogen or a radical C1-C4 alkyl, and an alkoxy or alkyl group short chain in C1-C4 or l0 0 a quinoline having a nitrogen atom in quaternary form or 0 a benzamidine or 0 a .pyridine or 0 an optionally substituted phenyl ring by a halogen group; C1- alkoxy C4; cyano; carbonylamino possibly substituted by one or more groups C1-C4 alkyl; guanyl; alkylthio in C1-C4; amino, C1-C4 alkylamino, 2o C1-C4 dialkylamino for each group alkyl and whose alkyl parts can together form a C3-C ~, nitro cycle;
C1-C4 alkyleneeamino; alkénylèneamino in C2-C4;
0 a heterocyclic ring mono or bi or tricyclic with 0 to 2 heteroatoms per cycle provided that at least ûn heteroatom is present in at least one - cycle possibly substituted by one or 3o several C1-C4 alkyl groups or by C1-C4 alkylene groups or C2-C4 alkenylene

8 ~ R3 and R'3, identical or different, represent independently of each other hydrogen or a C1-C4 alkyl radical ~ the dispatcher represents.
- a triazine group possibly substituted by an aromatic ring such as defined above or by a radical XR1 (R2) in which X represents a nitrogen atom N to form NR1R2, an alkyl radical 1o linear or branched in C1-C6 to form alkRlR2, an oxygen atom 0 to form OR1 or a sulfur atom S to form SR1, with R1 and R2 identical or different are chosen from the hydrogen atom;
an optionally C1-C8 alkyl radical substituted by one or more radicals identical or different; a cycle aromatic as defined above; a ~ ~ quinuclidine radical; a radical pyrrolidinyl itself possibly substituted by an alkyl radical or phenylalkyl with C1-C4 alkyl; a piperazinyl radical itself, if any-Lement substituted by an alkyl radical, cycloalkyl or phenylalkyl; a radical morpholinyl; a pyridyl radical or a piperidyl radical optionally substituted by one or more radicals 3o alkyl or phenylalkyl with C1-C.4 alkyl;
an indazolyl radical; a radical naphthyl; a benzotriazole radical; a pyrimidinyl radical optionally

9 substituted by one or more alkyl with C1-C4 alkyl; an acenaphthene radical, it being understood that when XR1R2 represents NR1R2, then R1 and R2 identical do not , not both represent hydrogen or unsubstituted C1-C4 alkyl and R1 and R2 different don't represent one hydrogen and the other C1-C4 alkyl not substituted 1o or else when X represents N or, alkyl, R1 and R2 form together with X at which they are linked a monocyclic radical of 3 with 6 links or bicyclic from 8 to 10 saturated or unsaturated links containing possibly one or two heteroatoms identical or different chosen from N, 0 or S,.
- a diazine group possibly substituted by the same groups as the triazine or one of its salts, rt these compounds being in all the isomeric forms possible racemates, enantiomers and diastereoisomers.
Among the compounds of the present invention, one can cite the compounds as defined above characterized in that when one or both of R1 and R2 represent) a C1-C8 alkyl radical optionally substituted by one or more radicals identical or different, these radicals are chosen from 3o the following radicals. the amino radical itself optionally substituted by one or two radicals identical or different chosen from radicals alkyl, hydroxyalkyl, alkoxyalkyl, alkylphenylalkyl, phenylalkyl, carboxyalkyl, hydroxycarboxyalkyl, acyl, naphthyl, phenyl and alkylphenyl; The radical trialkylammonio; the radicals h ~ droxy; C1-C4 alkoxy;
thioalkoxy; trifluoromethyl; acyl; free carboxy, 5 salified, esterified or amidified; imidazolyl;
pyrrolidinyl optionally substituted with C1- alkyl C4; piperidyl and piperazinyl optionally substituted) by alkyl or phenylalkyl with C1- alkyl C4; morpholinyl; pyridyle; naphthyl or phenyl

10 itself optionally substituted by one or more radicals chosen from C1-C4 alkoxy radicals, halogen or the optionally substituted amino radical as defined above.
Among the compounds of the present invention, one can cite the compounds as defined above characterized in that the distributor represents.
- a triazin group possibly substituted by an aromatic ring such as defined above or by an XR1 (R2) radical 2o in which X represents a nitrogen atom N to form NR1R2, an alkyl radical linear or branched in Cl-C6 to form alkRlR2, an oxygen atom 0 to form OR1 or a sulfur atom S to form SR1, with R1 and R2 identical or different are chosen from the hydrogen atom;
C1-C8 alkyl optionally substituted by one or more radicals chosen from '' amino, alkylamino, dialkylamino radicals, alkoxyalkylamino, alkoxyalkylamino, hydroxyalkylamino, dihydroxyalkylamino, hydroxycarboxyalkylamino, trialkylamino +, naphthylamino; phenylamino, acylamino,

11 (alkyl) (phenylalkyl) amino, . (Phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino, hydroxy, alkoxy in C1-C4, thioalkoxy in Cl-C4, trifluoromethyl, acyl, carboxy lbre, salified, esterified or amidified, imidazolyl, pyrrolidinyl optionally substituted by C1-C4 alkyl, piperidyl, piperazinyl and possible homopiperazinyl-~ Lement substituted) by alkyl or phenylalkyl. - with C1-C4 alkyl, morpholinyl, pyridyle, naphthyl or phenyl optionally substituted) with a or several radicals chosen from among C1-C4 alkoxy, halogen, amino, alkylamino and dialkylamino; a cycle aromatic as defined above; a quinuclidine radical; a radical pyrrolidinyl itself possibly 2o substituted by an alk ~ radical or phenylalkyl with C1-C4 alkyl; a piperazinyl radical itself, if any-Lement substituted by an alkyl radical, cycloalkyl or phenylalkyl; a radical morpholinyl; a pyridyl radical or a radical piperidyl possibly substituted by one or more radicals alkyl or phenylalkyl with C1-C4 alkyl;
an indazolyl radical; a radical naphthyl, a benzotriazole radical; a pyrimidinyl radical optionally substituted by one or more alkyl with C1-C4 alkyl; an acenaphthene radical, it being understood that when XR1R2 represents NR1R2, then Rl and R2 identical do not

12 not both represent hydrogen or unsubstituted C1-C4 alkyl and R1 and R2 different do not represent one hydrogen and the other C1-C4 alkyl not substituted or when X represents N or alkyl, R1 and R2 form together with X at which they are linked a radical chosen from among them following radicals. piperazinyl or 1o homopipërazinyle optionally substituted by one or more identical radicals or different; pyrrolidinyl optionally substituted by C1-C4 alkyl or alkoxy, hydroxy, acylamino, pyrrolidinylalkyl, pyridinyl and pyridyle ~ 1,2,3,4-tetra-hydroquinoline and 1,2,3,4-tetrahydro-isoquinolinyl; diazepine if any-lament substituted by alkyl or pyrrolidinyl-alkyl; piperidyl or 2o piperidinyl optionally substituted by one or more radicals chosen from alkyl, alkoxy, alkoxyalkyl, pyrrolyl-alkyl, piperidinyl, piperidyl, hydroxy and cycloalkyl-alkyl; morpholinyl;
thiomorpholinyl; imidazolinyl possible-alkyl substituted, - or a diazine group possibly substituted by the same groups as the triazine or, one of its salts, these compounds being in all the isomeric forms possible racemates, enantiomers and diastereoisomers.

13 Among the compounds of the present invention, one can cite the compounds as defined above characterized in that XRl (R ~) is such that when X
represents N, that is one of R1 and R2 represents the atom hydrogen or a radical C1-C4 alkyl optionally substituted by amino, alkylamino, dialkylamino or phenyl, and the other of R1 and R2 is chosen from the values defined for Rl and R2 to any of claims 1 to 5 either R1 and R2 form together with l0 the nitrogen atom to which they are linked a radical ~
cyclic chosen from the following radicals: a radical piperazinyl or optionally substituted homopiperazinyl by one or more radicals chosen from alkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, phenylalkyl, alkoxyalkyl, hydroxyalkyl, dihydroxyalkyle, hydroxyalkoxyalkyle avec alkoxy, imidazolylaminoalkyle, imidazolylalkylaminoalkyle, imidazolylhydroxyalkylaminoalkyle, pyridylalkyle, pyridinylalkyle, imidazopyridinylalkyle, 2o pyrrolidinylalkyle, imidazolylalkyle possibly substituted by one or more alkyl radicals or phenyl, morpholinylalkyl, benzoimidazolalkyl optionally substituted by alkyl or hydroxyalkyl, C3-C8 cycloalkyl, pyrazinyl, pyrimidinyl, pyridyl, piperidyle, furylcarbonyle, furfurycarbonyle, quinolyle or isoquinolyl; an optionally pyrrolidinyl radical substituted by C1-C4 alkyl or alkoxy, ~ hydroxy, acylamino, pyrrolidinylalkyl, pyridinyl and pyridyl; a 1,2,3,4-tetrahydroquinoline linear 1,2,3,4- or tetrahydroisoquinoline; a diazepine radical optionally substituted by alkyl or pyrrolidinyl-alkyl; an optionally substituted piperidyl radical by one or more radicals chosen from .the radicals alkyl, alkoxy, alkoxyalkyle, ~ pyrrolylalkyle, piperidinyl, hydroxy, cycloalkylalkyl and piperidyl;

14 a piperidinyl radical optionally substituted by piperidinyl; a morpholinyl or thio radical morpholinyl; an imidazolinyl radical optionally substituted by alkyl.
Among the compounds defined above, mention may be made of compounds characterized in that when one or both of R1 and R2 represent) a C1-C8 alkyl radical optionally substituted by one or more radicals identical or different, these radicals are chosen from 1o the amino radical itself possibly substituted by a or two identical or different radicals chosen from alkyl, hydroxyalkyl, alkoxyalkyl radicals, phenylalkyl, carboxyalkyl, hydroxycarboxyalkyl, acyl, naphthyl, phenyl and alkylphenyl; The radical trialkylammonio; hydroxy radicals; C1-C4 alkoxy;
thioalkoxy; trifluoromethyl; free, salified carboxy, esterified or amidified; pyrrolidinyl optionally substituted with C1-G4 alkyl; piperidyl; piperazinyl optionally substituted by alkyl or phenylalkyl with 2o C1-C4 alkyl; morpholinyl; pyridyle ~ naphthyle or phenyl itself optionally substituted with one or several radicals chosen from alkox radicals ~ en C1-C4, ~ halogen or the amino radical possibly substituted as defined above.
Among the defined compounds. above, we can in particular cite the compounds characterized in that the dispatcher represented .
- a triazin group possibly substituted by an aromatic ring such as defined above or by an XR1 (R2) radical in which X represents a nitrogen atom N to form NR1R2, an alkyl radical linear or branched in C1-C6 to form alkRlR2, an oxygen atom 0 to form 'I 5 OR1 or a sulfur atom S to form SR1, with R1 and R2 identical or different are chosen from the hydrogen atom;
C1-C alkyl ~ possibly substituted by one or more radicals chosen from amino, alkylamino, dialkylamino radicals, dialkoxyalkylamino, dihydroxyalkylamino, alkoxyalkylamino, hydroxyalkylamino, s0 hydroxycarboxyalkylamino, trialkylamino, naphthylamino, phnylamino, acylamino, (alkyl) (phnylalkyl) amino, (phnyl) (alkyl) amino, (alkylphnyl) (alkyl) amino, hydroxy, C1-C4 alkoxy, C1-C4 thioalkoxy, trifluoromthyle, free carboxy, salified, estrifi or amidifi, pyrrolidinyle possibly substituted by C1- alkyl C4, pipridyle, pipra ~ possible inyle-substituted by alkyl or 2o phnylalkyle with C1-C4 alkyl, morpholinyl, pyridyle, naphthyl or phnyle possibly substituted by one or several radicals chosen from among C1-C4 alkoxy, halogen, amino, . alkylamino and dialkylamino; a cycle aromatics as defined above a quinuclidine radical; a radical pyrrolidinyl itself possibly substituted by an alkyl radical or phnylalkyl with C1-C4 alkyl; a . radical pipra ~ inyle. himself possible-substituted by an alkyl radical, cycloalkyl or phnylalkyl; a radical .morpholinyl; a pyridyle oil radical a pipridyle radical possibly substituted by one or more radicals alkyl or phenylalkyl with C1-C4 alkyl;
an indazolyl radical; a radical naphthyl, a benzotriazole radical; a pyrimidinyl radical optionally substituted by one or more alkyl with C1-C4 alkyl; an acenaphthene radical, it being understood that when XR1R2 represents NR1R2, then R1 and R2 identical do not 1o do not both represent hydrogen or unsubstituted C1-C4 alkyl and R1 and R2 different don't represent one hydrogen and the other C1-C4 alkyl not substituted or when X represents N or alkyl, R1 and R2 form together with X at which they are linked a radical chosen from among following radicals. piperazinyl optionally substituted with one or several identical radicals or different ; pyrrolidinyl optionally substituted by C1-C4 alkyl or alkoxy, hydroxy, acylamino, pyrrolidinylalkyl and pyridyle: 1,2,3,4-tetrahydroiso-quinoline: diazepine optionally substituted by alkyl or pyrrolidinyl-alkyl; piperidyl possibly substituted by alkyl, alkoxy or alkoxyalkyl, hydroxy and cycloalkyl-3o alkyl; morpholinyl; imidazolinyl optionally substituted by alkyl, - or a diazine group possibly substituted by the same groups as the triazine or one of its salts, these compounds being in all the isomeric forms possible racemates, enantiomers and diastereoisomers.
Among the compounds defined above, mention may be made of compounds characterized in that XR1 (R2) is such that when X represents N, let one of R1 and R2 represent hydrogen atom or C1-C4 alkyl radical optionally substituted with an amino radical, alkylamino, dialkylamino or phenyl and the other of R1 and R2 1o is chosen from the values defined for R1 and. R2 to 1 ° any one of claims 1 to 8 or R1 and R2 together form with the nitrogen atom to which they are linked a piperazinyl radical optionally substituted by one or more radicals chosen from alkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, phenylalkyl, alkoxyalkyl, hydroxyalkyl, hydroxyalkoxy-alkyl with alkoxy, pyrrolidinylalkyle, cycloalkyle en C3-C8, pyrazinyl, pyrimidinyl, pyridyl, furylcarbonyl, furfurycarbonyl, quinolyl;
pyrrolidinyl optionally substituted by alkyl or C1-C4 alkoxy, hydroxy, acylamino, pyrrolidinylalkyl and pyridyle; 1,2,3,4-tetrahydroisoquinolinyl; diazepine optionally substituted by alkyl or pyrrolidinylalkyl; piperidyl optionally substituted by alkyl, alkoxy or alkoxyalkyl, hydroxy and cycloalkylalkyl; morpholinyl; imidazolinyl optionally substituted with alkyl.
The subject of the present invention is the compounds fixing the G-quadruplex structure of telomeres characterized in that that they correspond to the general formula as defined above.

The present invention thus relates to compounds such as as defined above characterized in that they meet to the following general formula.
nitrogen aromatic cycle - NR3 - distributor - NR'3 - cycle aromatic in which ~ the nitrogen aromatic cycle represents.
0 a quinoline optionally substituted by at least one group N (Ra) (Rb) in which Ra and 1o Rb, identical or different represent hydrogen or a C1-C4 alkyl radical, (or) a C1-C4 alkoxy or short chain alkyl or 0 a quinoline having a nitrogen atom in quaternary form or 0 a benzamidine or 0 a pyridine ~ the aromatic cycle represents 0 an optionally substituted quinoline by at least one group N (Ra) (Rb) in which Ra and Rb, identical or different represent hydrogen or a C1-C4 alkyl radical, (or) a C1-C4 alkoxy or short chain alkyl or 0 a quinoline having a nitrogen atom in quaternary form or 0 a benzamidine or 0 a pyridine or 0 an optionally substituted phenyl ring 3o by a halogen group; C1- alkoxy C4; cyano; carbonylamino possibly substituted by one or more groups C1-C4 alkyl; guanyl; alkylthio in C1-C4; amino, C1-C4 alkylamino, C1-C4 dialkylamino for each group ~ alkyl and whose alkyl parts can together form a C3-C8, nitro ring;
C1-C4 alkyleneeamino; alkénylèneamino in C2-C4, 0 a heterocyclic ring mono or bï or tricyclic with 0 to 2 heteroatoms per cycle provided that at least one heteroatom 'is present in at least one cycle optionally substituted by one or several C1-C4 alkyl groups or 'by C1-C4 alkylene groups or C2-C4 alkenylene ~ R3 and R'3, identical or different, independently of each other hydrogen or a C1-C4 alkyl radical ~ the dispatcher represents.
- a triazine group possibly substituted by a radical XR1 (R2) in which X represents a nitrogen atom N
to form NR1R2, an alkyl radical linear or branched in C1-C6 to form alkRlR2, an oxygen atom 0 to form 0R1 or a sulfur atom S to form SR1, with Rl and R2 identical or different are chosen from the hydrogen atom C1-C8 alkyl optionally substituted by an amino, alkylamino radical, dialkylamino, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino, C1- alkoxy C4, C1-C4 thioalkoxy, trifluoromethyl, pyrrolidinyl, piperidyl, piperazinyl, morpholinyl, pyridyl or phenyl; a aromatic cycle as defined above;
5 a quinuclidine radical, a radical pyrrolidinyl, piperazinyl, morpholinyl, pyridyl or a piperidyl radical optionally substituted with C1-C4 alkyl it being understood that identical R1 and R2 do not 1o do not both represent hydrogen or unsubstituted C1-C4 alkyl and R1 and R2 different don't represent one hydrogen and the other C1-C4 alkyl not substituted or when X represents N or alkyl, R1 and R2 form together with X at which they are linked a monocyclic radical of 3 6-link or bicyclic from 5 to 10 saturated or unsaturated links containing 2o possibly one or two heteroatoms .identical or different chosen from N, 0 or S, - a diazine group possibly substituted by the same groups as the 25 triazine or one of its salts, these compounds being in all the isomeric forms possible racemates, enantiomers and diastereoisomers.
We mean in the sense of the above formula by cycled 3o aromatic nitrogen a heterocycle ~ comprising at least one nitrogen atom or an aromatic group not having of heteroatom in the cycle but containing at least one nitrogen atom in a hydrocarbon drain linked to the cycle like for example a guanidino or guanyl chain.
The aromatic cycle represents in particular a radical quinaldine, quinoleine, benzamidine, pyridine and phenyl as defined above and optionally substituted as shown above.
As a C3-C8 cycle that the parties can form alkyls of the dialkylamino radicals defined above, we can cite for example ~. azirididine, azetidine cycles, l0 pyrrolidine, oxazolidine, thiazolidine, piperidine, piperazine, morpholine, thiomorpholine or even azepine.
In the products above and below, the chemical radicals have their usual meanings that we find in the working documents of the skilled person and in particular meet the following definitions:
- ~ the term alkyl radical denotes radicals linear or branched, in particular methyl radicals, ethyl, ~ propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, hexyl, isohexyl and also heptyle, octyl, nonyl and decyl as well as their linear position isomers or branched - the term alkoxy radical designates radicals linear or branched in particular - methoxy radicals, ethoxy, propoxy, isopropoxy, linear butoxy, secondary or tertiary, pentoxy or hexoxy and their isomers linear or branched positions, - the term halogen atom designates the atoms of chlorine, fluorine, bromine or iodine, and especially chlorine and fluorine the term cycloalkyl radical denotes the radicals cyclohexyl, cyclopropyl, cyclobutyl and also the cycloheptyl and cyclooctyle radicals the term alkylphenyl denotes a phenyl radical substituted by one or more alkyl radicals such as defined above linear or branched preferably containing not more than 4 carbon atoms the terms NH (alk) and N (alk) (alk) denote a amino radical substituted respectively by one or two alkyl radicals, such alkyl radicals being linear or branched and preferably containing at most 4 atoms of carbon the term acylamino denotes the radicals -C (O) -NH2, -C (0) -NH (alk) and -C (0) -N (alk) (alk) in which the NH (alk) and N (alk) (alk) radicals have the meaning indicated above -the term acyl denotes a radical RC (0) - in which R represents a radical chosen from the atom hydrogen, linear or branched alkyl radicals Containing not more than 8 carbon atoms or one radical carbocyclic or heterocyclic saturated or not, chosen by example among the aromatic cycles defined above or non-aromatic. the term acyle thus denotes by example formyl, acetyl, propionyl radicals, butanoyl, pentanoyl, hexanoyl, benzoyl, pyrrolidinyl-carbonyl, pyrazinylcarbonyl, piperazinylcarbonyl, furylcarbonyl or furfurylcarbonyl.
The carboxy radical (s) of the products of formula (I) can be salified or esterified by various groups known to those skilled in the art from which can be cited, for example.
- among the salification compounds, bases 3o minerals such as, for example, an equivalent of sodium, potassium, lithium, calcium, magnesium or ammonium or organic bases such that, for example, methylamine, propylamine, trimethylamine, diethylamine, triethylamine, N, N-dimethylethanolamine, tris (hydroxymethyl) amino methane, ethanolamine, pyridine, picoline, dicyclohexylamine, 1a morpholine, benzylamine, procaine, lysine, arginine, histidine, N-methyl, - among the esterification compounds, the radicals alkyl to form alkoxy carbonyl groups such as, for example, methoxycarbonyl, ethoxycarbonyl, tert-butoxycarbonyl or benzyloxycarbonyl, these radicals 1o alkyls which can be substituted by selected radicals for example among atoms. halogen, radicals hydroxyl, alkoxy, acyl, acyloxy, alkylthio, amino or aryle as, for example, in groupings chloromethyl, hydroxypropyl, methoxymethyl, propionyl-oxymethyl, methylthiomethyl, dimethylaminoethyl, benzyl or phenethyl.
Zes of addition with mineral acids or organic products of formula (I) can be, for example,. the salts formed with hydrochloric acids, hydrobromic, hydroiodic, nitric, sulfuric, phosphoric, propionic, acetic, trifluoroacetic, formic, benzoic, malefic, fumaric, succinic, tartaric, citric, oxalic, glyoxylic, aspartic, ascorbic, alkylmonosulfonic acids such as by example. methanesulfonic acid, acid ethanesulfonic, propanesulfonic acid, acids alkyl disulfonics such as for example acid methanedisulfonic, alpha acid, beta-ethane-disulfonic, arylmonosulfonic acids such as benzenesulfonic acid and aryldi- acids sulfonic.
Pharmaceutical salts. acceptable products of formula (I) are in particular salts usable, non-toxic. such salts of the products of formula (I) as defined above can be obtained by ordinary methods known to man of the trade, for example by combining a compound of formula (I) with an organic or inorganic acid or a base in a solvent or dispersant or from another salt by cation or anion exchange.
We can recall that stereoisomerism can be broadly defined as the isomerism of compounds having the same formulas developed, but whose l0 different groups are arranged differently in space, such as in particular in cyclohexanes monosubstituted whose substituent can be in position axial or equatorial, and the different conformations possible rotational ethane derivatives.
However, there is another type of stereoisomerism, due with different spatial arrangements of substituents fixed either on double bonds or on cycles, which is often called geometric isomerism or cis-trans isomerism. The term stereoisomers is used 2o in the present application in its broadest sense and therefore relates to all of the compounds indicated above.
The subject of the present invention is in particular the compounds as defined above characterized in that the dispatcher represents - - a triazine group possibly substituted by a radical XR1 (R2) in which X represents a nitrogen atom N
to form NR1R2, an oxygen atom O
to form OR1 or a sulfur atom S
3o to form SR1, with R1 and R2 identical or different are chosen from the hydrogen atom;
C1-C8 alkyl optionally substituted by an amino, alkylamino radical, dialkylamino, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino, C1- alkoxy C4, by a pyrrolidinyl, pyridyl radical or by a phenyl radical; a cycle 5 aromatic as defined above; a quinuclidine radical, a radical pyrrolidyl or a piperidyl radical optionally substituted with C1-C4 alkyl it being understood that identical R1 and R2 do not 1o do not both represent hydrogen or unsubstituted C1-C4 alkyl and R1 and R2 different don't represent one hydrogen and the other C1-C4 alkyl not substituted

15 or when X represents N, R1 and R2 together form with X to which they are linked a piperazinyl, piperidyl radical, pyrrolidinyl, morpholinyl or thiomorpholinyl, 20 ~ - possibly a diazine group substituted by the same groups as the triazine or one of its salts, these compounds being in all isomeric forms 25 possible racemates, enantiomers and diastereoisomers.
The present invention particularly relates to compounds as defined above characterized in that that the diazine groups are pyrimidines or quinazolines.
3o The subject of the present invention is more particularly the compounds as defined above, characterized in what XR1 (R2) is such that when X represents N, let one of R1 and R2 represents the hydrogen atom and the other of R1 and R2 is chosen from the defined values for R1 and R2 either R1 and R2 form together with the atom nitrogen to which they are linked a piperazinyl radical, pyrrolidinyl, piperidyl or morpholino.
The present invention relates particularly to compounds as defined above, characterized in that that they meet the formula (I) below.
AT
N '\ N
- R3N N NR'3 Are ar2 in which .
A represents an XR1 (R2) radical in which X represents a nitrogen atom, oxygen, sulfur or an alkyl radical in C1-C6 to form one of the radicals following.
NR1R2 with identical R1 and R2 or 2o different are chosen from the atom hydrogen; a C1-C8 alkyl radical optionally substituted with one or several identical radicals or different ; an aromatic cycle such as . defined above; a radical quinuclidine; a pyrrolidinyl radical itself possibly substituted with a alkyl or phenylalkyl radical with alkyl in C1-C4; a piperazinyl radical or 3o homopiperazinyl itself possibly substituted by an alkyl radical, cycloalkyl or phenylalkyl; a radical morpholinyl; a pyridyl radical, piperidinyl or a piperidyl radical optionally substituted with one or several alkyl or phenylalkyl radicals with C1-C4 alkyl; a radical indazolyl; a naphthyl radical; a benzotriazole radical; a radical benzimidazolyl; 1-pyrimidinyl radica optionally substituted with one or 'several alkyl with C1-C4 alkyl; a acenaphthene radical; an amino radical itself possibly substituted with a two identical or different radicals choose alkyl, phenylalkyl, alkylaminoalkyl and dialkylaminoalkyl, it being understood that when XR1R2 represents NR1R2, then R1 and R2 identical do not both represent hydrogen or unsubstituted C1-C4 alkyl and R1 and R2 2o different do not represent one hydrogen and the other C1-C4 alkyl not substituted or when X represents N or alkyl, R1 and R2 form together with X at which they are linked a monocyclic radical of 3 with 6 links or bicyclic from 8 to 10 saturated or unsaturated links containing possibly one or two heteroatoms identical or different chosen from N, 0 or S, ~ a group 0R1 or SR1 in which R1 has the same meaning as previously understood that R1 does not represent hydrogen or C1-C4 alkyl unsubstituted, or ~ an alkyl group containing 1 to 6 atoms of carbon substituted by R1 R2 as defined above - R3 and R'3, identical or different, represent independently of each other hydrogen or a C1-C4 alkylen group - Arl and Ar2 identical or different represent * when Arl and Ar2 are identical.
~ a quinoline or isoquinoline motif 1o optionally substituted by at least one '' radical chosen from a group N (Ra) (Rb) in which Ra and Rb, identical or different represent hydrogen or a C1-C4 alkyl radical, and one or 15 or more groups) alkoxy or alkyl to short chain in Cl-C4 linked) to an atom carbon or nitrogen from the quinoline ring or isoquinoline or ~ a quinoline or isoquinoline having 2o a nitrogen atom in quaternary form or ~ a benzamidine or ~ a pyridine attached in position -4 or fused with an aryl group or heteroaryl optionally substituted with 25 a C1-C4 alkyl group * when Arl and Ar2 are different ~ Arl and Ar2 both represent one possibilities mentioned above for Arl and Ar2 or 30 ~ Arl represents one of the possibilities above and Ar2 represents a phenyl ring optionally substituted by a halogen group, C1-C4 alkoxy, cyano, carbonylamino optionally substituted with one or several C1-C4 alkyl groups, guanyl, C1-C4 alkylthio, amino, C1-C4 alkylamino, C1- dialkylamino C4 for each alkyl, nitro, C1-C4 alkyleneamino, (or) alkenylene-1o amino in C2-C4, or a radical piperazinyl optionally substituted by a C1-C4 alkyl radical, a mono or bi heterocyclic ring or tricyclic with 0 to 2 heteroatoms per cycle provided that at least one heteroatom is present in at least a cycle optionally substituted by a or more C1-C4 alkyl groups or by C1-C4 alkylene groups or 2o C2-C4 alkenylene or a salt thereof, these compounds of formula (I) being under all possible racemic isomeric forms, enantiomers and diastereoisomers.
Mention may be made, among the compounds of formula (I), such as defined above, the compounds characterized in that when one or both of R1 and R2 represent) a C1-CS alkyl radical optionally substituted by a or more identical or different radicals, these radicals are chosen from the amino radical itself 3o optionally substituted by one or two radicals identical or different chosen from radicals alkyl, hydroxyalkyl, alkoxyalkyl, phenylalkyl, carboxyalkyl, hydroxycarboxyalkyl, acyl, naphthyl, phenyl and alkylphenyl; the trialkylammonio radical;

hydroxy radicals; alkoxy; thioalkoxy;
trifluoromethyl; acyl; free, salified carboxy, esterified or amidified; ~ imidazolyl; pyrrolidinyl optionally substituted with C1-C4 alkyl;
5 piperidyl and piperazinyl optionally substituted) by alkyl or phenylalkyl with C1-C4 alkyl;
morpholinyl; pyridyle; naphthyl or phenyl itself optionally substituted by one or more radicals chosen from C1-C4 alkoxy, halogen or 1o the amino radical optionally substituted as defined above.
Mention may in particular be made, among the compounds of formula (I) as defined above, the compounds characterized in what XR1 (R2) is such that when X represents N, let One of R1 and R2 represents the hydrogen atom and the other of R1 and R2 is chosen from the defined values above for R1 and R2 either R1 and R2 form together with the nitrogen atom to which they are linked a radical piperazinyl, homopiperazinyl, pyrrolidinyl, 20 piperidyl, pyridinyl, morpholinyl, thomomorpholinyl, imidazolinyl, diazepine, 1,2,3,4-tetrahydroquinoline or 1,2,3,4-tetrahydroisoquinoline, all these radicals being optionally substituted by one or more radicals as defined above.
25 Mention may in particular be made, among the compounds of formula (I) as defined above, the compounds characterized in what A represents an aromatic cycle as defined above or a radical XR1 (R2) in which X represents a nitrogen atom N to form NR1R2, an alkyl radical 30 linear or branched C1-C6 to form alkRlR2, a oxygen atom 0 to form OR1 or a sulfur atom S
to form SRl, with R1 and R2 identical or different are chosen from the hydrogen atom; C1-C8 alkyl optionally substituted by one or more radicals chosen from amino, alkylamino, dialkylamino, dialkoxyalkyl-amino, dihydroxyalkylamino, alkoxyalkylamino, hydroxyalkylamino, hydroxycarboxyalkylamino, trialkyl-ammonio, naphthylamino, phenylamino, acylamino, alkyl) (phenylalkyl) amino, (phenyl) (alkyl) amino, alkylphenyl) (alkyl) amino, hydroxy, C1-C4 alkoxy, Cl-C4 thioalkoxy, trifluoromethyl, acyl, carboxy free, salified, esterified or amidified, imidazolyl, pyrrolinyl optionally substituted with C1- alkyl C4, piperidyl and piperazinyl optionally substituted) by alkyl or phenylalkyl with alkyl in C1-C4, morpholinyl, pyridyl, naphthyl or phenyl optionally substituted by one or more radicals chosen from C1-C4 alkoxy, halogen, amino, alkylamino and dialkylamino; an aromatic cycle as defined above; a quinuclidine radical; a pyrrolidinyl radical itself optionally substituted by an alkyl or phenylalkyl radical with C1- alkyl C4; a piperazinyl radical itself possibly substituted by an alkyl, cycloalkyl or phenylalkyl; a morpholinyl radical; a radical pyridyl or a piperidyl radical optionally substituted by one or more alkyl radicals or phenylalkyl with C1-C4 alkyl; an indazolyl radical;
a naphthyl radical, a benzotriazole radical; a pyrimidinyl radical optionally substituted by one or several alkyls with C1-C4 alkyl; a radical acenaphthene, it being understood that when XR1R2 represents NR1R2, then R1 and R2 are not the same hydrogen or unsubstituted C1-C4 alkyl and R1 and R2 one does not represent hydrogen and the other unsubstituted C1-C4 alkyl or when X represents N or alkyl, R1 and R2 form together with X at which they are linked a radical chosen from among following radicals, piperazinyl or ~ homopiperazinyl optionally substituted by one or more identical radicals or different ; pyrrolidinyl optionally substituted by C1-C4 alkyl or alkoxy, hydroxy, acylamino, pyrrolidinylalkyl, 1o pyridinyl and pyridyl; 1,2,3,4 tetrahydroquinoline and 1,2,3,4-tetrahydroisoquinolinyl; diazepine optionally substituted by alkyl or pyrrolidinyl-alkyl; piperidyl or 25 piperidinyl optionally substituted with one or more radicals chosen from alkyl, alkoxy, alkoxyalkyl, pyrrolylalkyl, piperidinyl, piperidyl, hydroxy and cycloalkyl-alkyl;
2o morpholinyl; thiomorpholinyl;
imidazolinyl optionally substituted with alkyl Mention may be made in particular of the compounds of formula (I) as defined above, the compounds 25 characterized in that XR1 (R2) is such that when X
represents N, that is one of R1 and R2 represents the atom of hydrogen ~ or a C1-C4 alkyl radical optionally substituted by amino, alkylamino, dialkylamino radical or phenyl and the other of R1 and R2 is chosen from 3o values defined for R1 and R2 at any of claims 1 to 8 either R1 and R2 form together with the nitrogen atom to which they are linked a radical piperazinyl or optionally substituted homopiperazinyl by one or more radicals chosen from alkyl, Aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, phenylalkyl, alkoxyalkyl, hydroxyalkyl, hydroxy alkyl, hydroxyalkoxyalkyl with C1-C6 alkoxy, imidazolyl-aminoalkyl, imidazolylalkylaminoalkyl, imidazolyl-hydroxyalkylaminoalkyl, pyridylalkyl, pyridinylalkyle, imidazopyrïdinylalkyle, pyrrolidinyl-alkyl, imidazolyl-alkyl optionally substituted with or more alkyl or phenyl radicals, morpholinylalkyl, benzoimidazolalkyle optionally substituted by alkyl or hydroxyalkyl, C3- cycloalkyl lo C8, pyrazinyl, pyrimidinyl, pyridyl, piperidyl, furylcarbonyl, furfurycarbonyl, quinolyl or isoquinolyl; a pyrrolidinyl radical, optionally substituted by C1-C4 alkyl or alkoxy, hydroxy, acylamino, pyrrolidinylalkyl, pyridinyl and pyridyl; a 1,2,3,4-tetrahydroquinoline linear 1,2,3,4- or tetrahydroisoquinolinyl; a diazepine radical optionally substituted by alkyl or pyrrolidylalkyl; a piperidyl radical optionally substituted by one or more radicals chosen from alkyl, alkoxy, alkoxyalkyl, pyrrolylalkyl radicals, piperidinyl, hydroxy, cycloalkylalkyl and piperidyl; a piperidinyl radical possibly substituted by piperidinyl; u: n morpholinyl radical or y thïo morpholinyl; an imidazolinyl radical possibly substituted by alkyl.
The present invention particularly relates to compounds of formula (I) as defined above characterized in that they correspond to the formula next:
3 0, 4 N '\ N
RN "N" NR ' Are ar2 in which .
A represents a radical XRl (R2) in which X represents a nitrogen atom, oxygen, sulfur or an alkyl radical in C1-C6 to form one of the radicals following.
NR1R ~ with identical R1 and R2 or different are chosen from the atom hydrogen; C1-C8 alkyl 1o possibly substituted by one or several identical radicals or different ~ an aromatic cycle such as defined above; a radical quinuclidine; a pyrrolidinyl radical itself possibly substituted with a alkyl or phenylalkyl radical with alkyl in C1-C4; a piperazinyl radical itself optionally substituted with a alkyl, cycloalkyl or phenylalkyl; a morpholinyl radical;
a pyridyl radical or a radical piperidyl optionally substituted by one or more alkyl radicals or phenylalkyl with C1-C4 alkyl; a indazolyl radical; a naphthyl radical;
a benzotriazole radical; a radical pyrimidinyl optionally substituted with one or more alkyl with alk ~ le in Cl-C4; an acenaphthene radical, . it being understood that when XR1R2 represents NR1R ~, then R1 and R2 identical do not not both represent hydrogen or unsubstituted C1-C4 alkyl and R1 and R2 different don't represent one hydrogen and other C1-C4 alkyl no substituted or when X represents N or alkyl, R1 and R2 form together with X at which 5 ~ they are linked a monocyclic radical of 3 with 6 links or bicyclic from 8 to 10 saturated or unsaturated links containing possibly one or two heteroatoms identical or different chosen from N, 10 0 or S, ~ an OR1 or SR1 group in which R1 has the same meaning as before being understood that R1 does not represent hydrogen or C1-C4 alkyl unsubstituted, or 15 ~ an alkyl group containing 1 to 6 atoms of 'carbon substituted by R1 R2 such as' defined above - R3 and R'3, identical or different, represent independently of each other hydrogen or a 2o C1-C4 alkyl group - Arl and Ar2 identical or different represent * when Arl and Are are identical.
~ a quinoline motif possibly substituted by at least one N (Ra) (Rb) group 25 in which Ra and Rb are identical or different represent hydrogen or a C1-C4 alkyl radical, (or) a group alkoxy or al, short chain kyle containing 1 to 4 carbon atoms or 30 ~ a quinoline having a nitrogen atom in quaternary form or ~ a benzamidine or ~ a pyridine attached in position -4 or fused with an aryl group or heteroaryl optionally substituted with a C1-C4 alkyl group * when Arl and Ar2 are different ~ Arl and Ar2 both represent one possibilities mentioned above for Arl and Ar2 or ~ Arl represents one of the possibilities 1o above and Are represents a phenyl ring optionally substituted by a halogen group, C1-C4 alkoxy, cyano, carbonylamino optionally substituted with one or several C1-C4 alkyl groups, guanyl, C1-C4 alkylthio, amino, C1-C4 alkylamino, C1- dialkylamino C4 for each alkyl group, vitro, a.lkylèneamino in C1-C4, (or) C2-C4 alkenyleneamino, or a radical pipera ~ inyl optionally substituted by a C1-C4 alkyl radical, a heterocyclic nucleus .mono or bi or tricyclic with 0 to 2 heteroatoms per cycle provided that at least one heteroatom is present in at least a cycle possibly substituted by a or more C1-C4 alkyl groups or by C1-C4 alkylene groups or 3o C2-C4 alkenylene or a dense salt, these compounds of formula (I) being under all possible racemic isomeric forms, enantiomers and diastereoisomers.

The present invention relates in particular to the compounds as defined above characterized in that when one or both of R1 and R2 represent) a radical C1-C8 alkyl optionally substituted with one or several identical or different radicals, these radicals are ch ~ isis among the amino radical itself optionally substituted by one or two radicals identical or different chosen from radicals alkyl, hydroxyalkyl, alkoxyalkyl, phenylalkyl, 1o carboxyalkyle, hydroxycarboxyalkyle, acyle, naphthyle, phenyl and alkylphenyl; the trialkylammonio radical; the hydroxy radicals; alkoxy; thioalkoxy; trifluoro-methyl; free, salified, esterified or amidified carboxy;
pyrrolidinyl optionally substituted with C1- alkyl C4; piperidyl; piperazinyl optionally substituted by alkyl or phenylalkyl with C1-C4 alkyl;
morpholinyl; pyridyle; naphthyl or phenyl itself optionally substituted by one or more radicals chosen from C1-C4 alkoxy, halogen or the amino radical optionally substituted as defined above.
The present invention thus relates to compounds such as as defined above characterized in that XR1 (R2) is such that when X represents N, be one of R1 and R2 represents the hydrogen atom and the autx of R1 and R2 is chosen from the values defined for R1 and R2, ie R1 and R2 form together with the nitrogen atom to which they are linked a piperazinyl, pyrrolidinyl radical, piperidyl, morpholinyl, thiomorpholinyl, 3o imidazolinyl, diazepine or 1,2,3,4-tetrahydro-isoquinoline, all these radicals possibly being substituted by one or more radicals.
The present invention relates in particular to the compounds as defined above characterized in that A

represents an aromatic cycle as defined above or a radical XRl (R2) in which X represents an atom N nitrogen to form NR1R ~, a linear alkyl radical or branched at C1-C6 to form alkRlR2, an atom of oxygen 0 to form OR1 or a sulfur atom S to train SR1, with R1 and R2 identical or different are chosen from the hydrogen atom; C1-C8 alkyl optionally substituted by one or more radicals chosen from 1o amino, alkylamino, dialkylamino, dialkoxyalkyl- radicals amino, dihydroxyalkylamino, alkoxyalkylamino, hydroxyalkylamino, hydroxycarboxy-alkylamino, trialkylammonio, naphthylamino, phenylamino, acylamino, (alkyl) (phenylalkyl) amino, (phenyl) (alkyl) amino, z5 (alkylphenyl) (alkyl) amino, hydroxy, C1-C4 alkoxy, C1-C4 thioalkoxy, trifluoromethyl, free carboxy, salified, esterified or amidified, pyrrolidinyl optionally substituted with C1-C4 alkyl, piperidyl, piperazinyl optionally substituted with alkyl or 2o phenylalkyl with C1-C4 alkyhe, morpholinyl, pyridyl; naphthyl or optionally substituted phenyl by one or more radicals chosen from the radicals C1-C4 alkoxy, halogen, amino, alkylamino and dialkylamino; an aromatic cycle as defined 25 above; a quinuclidine radical; a radical pyrrolidinyl itself optionally substituted by a alkyl or phenylalkyl radical with C1-C4 alkyl; a piperazinyl radical itself optionally substituted by an alkyl, cycloalkyl or phenylalkyl radical; a 3o morpholinyl radical; a pyridyl radical or a radical piperidyl optionally substituted by one or more alkyl or phenylalkyl radicals with C1-C4 alkyl; a .indazolyl radical; a naphthyl radical, a radical benzotriazole; a pyrimidinyl radical optionally substituted by one or more alkyl with C1- alkyl C4; an acenaphthene radical, it being understood that when XR1R3 represents NR1R2, then R1 and R2 are not the same hydrogen or unsubstituted C1-C4 alkyl and R1 and R2 one does not represent hydrogen and the other unsubstituted C1-C4 alkyl or when X represents N or alkyl, R1 and R2 together form with X to which they are linked a radical 1o chosen from the following radicals. piperazinyl optionally substituted by one or more radicals identical or different; pyrrolidinyl optionally substituted by C1-C4 alkyl or alkoxy, hydroxy, acylamino, pyrrolidinylalkyl and pyridyl; 1,2,3,4 tetrahydroisoquinolinyl; diazepine possibly substituted by alkyl or pyrrolidinylalkyl; piperidyl optionally substituted by alkyl, alkoxy or alkoxyalkyl, hydroxy and cycloalkylalkyl;
morpholinyl; imidazolinyl optionally substituted with 2o alkyl.
The present invention thus relates to compounds such as as defined above characterized in that XR1 (R2) is such that when X represents N, that is one of R1 and R2 represents the hydrogen atom or an alkyl radical in Cl-C4 optionally substituted with an amino radical, alkylamino, dialkylamino or phenyl and the other of R1 and R2 is chosen from the values defined for R1 and R2 to any of claims 1 to 8 be Rl and R2 together form with the nitrogen atom to which they are linked a piperazinyl radical optionally substituted by one or more radicals chosen from alkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, phenylalkyl, alkoxyalkyl, hydroxyalkyl, hydroxyalkoxy-alkyl with alkoxy, pyrrolidinylalkyle, cycloalkyle en C3-C8, pyrazinyl, pyrimidinyl, pyridyl, furylcarbonyl, furfurycarbonyl and quinolyl;
pyrrolidinyl optionally substituted by alkyl or C1-C4 alkoxy, hydroxy, acylamino, pyrrolinylalkyl and 5 pyridyl; 1,2,3,4-tetrahydroisoquinolinyl; diazepine optionally substituted by alkyl or pyrrolidinyl alkyl; piperidyl optionally substituted with alkyl, alkoxy or alkoxyalkyl, hydroxy and cycloalkylalkyl;
morpholinyl; imidazolinyl optionally substituted with 1o alkyl.
The present invention thus relates to the defined compounds above fixing the G-quadruplex structure of telomeres characterized in that they correspond to formula (I) below .

N '\ N.
RN "N" NR ' Are ar2 20 in which.
A represents an XR1 (R2) radical in which X represents a nitrogen atom, oxygen, sulfur or an alkyl radical in C1-C6 to form one of the radicals 25, following.
NR1R2 with identical R1 and R2 or different are chosen from the atom hydrogen; C1-C8 alkyl optionally substituted by an amino radical, 3o alkylamino, 'dialkylamino, (phenyl) (alkyl) - amino, (alkylphenyl) (alkyl) amino, alkoxy in C1-C4, thioalkoxy in Cl-C4, trifluoromethyl, pyrrolidinyl, piperidyle, pipéra2inyle, morpholinyle, pyridyl or phenyl; an aromatic cycle as defined in claim 1; a quinuclidine radical, a radical pyrrolidinyl, piperazinyl, morpholinyl, pyridyle or a piperidyle radical optionally substituted with C1-C4 alkyl it being understood that identical R1 and R2 do not represent 1o both hydrogen or unsubstituted C1-C4 alkyl and R1 and different R2 don't represent one hydrogen and the other unsubstituted C1-C4 alkyl or when X represents N or alkyl, R1 and R2 together form with X to which they are linked a radical monocyclic from 3 to 6 links or bicyclic from 8 to 10 saturated or unsaturated links possibly containing a or two identical or different heteroatoms chosen among N, 0 or S, ~ an OR1 or SR1 group in which R1 has the 2o same meaning as previously understood that R1 does not represent hydrogen or C1-C4 alkyl unsubstituted, or ~ an alkyl group containing 1 to 6 atoms of carbon substituted by R1 R2 such as defined above - R3 and R'3, identical or different, represent independently of one another hydrogen or a C1-C4 alkyl group - Ar1 and Ar2 identical or different represent 1. when Ar1 and Ar2 are identical.
~ a quinoline motif possibly substituted by at least one N (Ra) (Rb) group in which Ra and Rb are identical or different represent hydrogen or a C1-C4 alkyl radical, (or) a group alkoxy or short chain alkyl containing 1 to 4 carbon atoms or ~ a quinoline having a nitrogen atom in quaternary form or ~ a benzamidine or ~ a pyridine attached in position -4 or fused with an aryl group or heteroaryl optionally substituted with a C1-C4 alkyl group 2. when Arl and Are are different ~ Ar1 and Ar2 both represent one of the possibilities mentioned above for Arl and Ar2 or ~ Arl represents 1 ° one of the possibilities above and Ar2 represents * a phenyl ring possibly substituted by a halogen group, 2o C1-C4 alkoxy, cyano, carbonylamino optionally substituted with one or several C1-C4 alkyl groups, guanyl, C1-C4 alkylthio, amino, C1-C4 alkylamino, C1- dialkylamino C4 for each alkyl group, vitro, C1-C4 alkyleneamino, (or) S
- C2-C4 alkenyleneamino, or a radical piperazinyl optionally substituted by a C1-C4 alkyl radical, 3o * a heterocyclic ring mono or bi or tricyclic with 0 to 2 heteroatoms per cycle provided that at least one heteroatom is present in at least a cycle possibly substituted by a or more C1-C4 alkyl groups or by C1-C4 alkylene groups or C2-C4 alkenylene or a salt thereof, these compounds of formula (I) being under all possible racemic isomeric forms, enantiomers and diastereoisomers.
The present invention also relates to new compounds characterized in that they respond to the formula (L) below.
AT
N '\ N
RN '_N' _NR ' Are ar2 in which .
A represents a radical XR1 (R2) in which X represents a nitrogen, oxygen, sulfur atom or a radical C1-C6 alkyl to form one of the following radicals.
~ NR1R2 with identical R1 and R2 or different are chosen from the atom hydrogen; C1-C8 alkyl optionally substituted by an amino radical, alkylamino, dialkylamino, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino, C1-C4 alkoxy, C1- thioalkoxy C4, trifluoromethyl, pyrrolidinyl, piperidyl, piperazinyl, morpholinyl, pyridyl or phenyl;
an aromatic cycle as defined in claim 1; a quinuclidine radical, a '' pyrrolidinyl, piperazinyl, morpholinyl radical, 3o pyridyle or a piperidyle radical optionally substituted by C1-C4 alkyl it being understood that identical R1 and R2 do not not both represent hydrogen or C1 alkyl Unsubstituted C4 and different R1 and R2 do not not one hydrogen and the other alkyl C1-C4 unsubstituted or when X represents N or alkyl, R1 and R2 together form X with which they are linked a 3- to 6-membered monocyclic radical or 8 to 10 membered saturated or unsaturated bicyclic 1o possibly containing one or two heteroatoms identical or different chosen from N, 0 or S, ~ a group 0R1 or SR1 in which R1 has the same meaning as previously understood that R1 does not represent hydrogen or C1-C4 alkyl unsubstituted, or ~ an alkyl group containing 1 to 6 atoms of carbon substituted by R1 R2 as defined above above - R3 and R '3, identical or different, represent 2o independently of one another hydrogen or a C1-C4 alkyl group - Arl and Arz identical or different represent * when Arl and Ar2 are identical ~ a quinoline motif possibly substituted by at least one N (Ra) (Rb) group in which Ra and Rb are identical or different represent hydrogen or a C1-C4 alkyl radical, (or) a group alkoxy or short chain alkyl containing 1 to 4 carbon atoms or ~ a quinoline having a nitrogen atom in quaternary form or ~ a benzamidine or ~ a pyridine attached in position -4 or fused with an aryl group or heteroaryl optionally substituted with 5 a C1-C4 alkyl group * when Arl and Ar2 are different ~ Arl and Ar2 both represent one possibilities mentioned above for Arz and Ar2 or 10 ~ Arl represents one of the possibilities above and Ar2 represents a phenyl ring optionally substituted by a halogen group, C1-C4 alkoxy, cyano, carbonylamino 15 optionally substituted with one or several C1-C4 alkyl groups, guanyl, C1-C4 alkylthio, amino, C1-C4 alkylamino, C1- dialkylamino C4 for each alkyl, nitro, 2o C1-C4 alkyleneamino, (or) C2-C4 alkenyleneamine, or a radicla piperazinyl optionally substituted by a C1-C4 alkyl radical, a mono or bi heterocyclic ring or 25 tricyclic with 0 to 2 heteroatoms per cycle provided that at least one heteroatom is present in at least a cycle possibly substituted by a or more C1-C4 alkyl groups or 3o by C1-C4 alkylene groups or C2-C4 alkenylene or a salt thereof, these compounds of formula (I) being under all possible racemic isomeric forms, enantiomers and diastereoisomers.
The present invention relates in particular to the compounds of formula (I) as defined above in which A
represents a radical XR1 (R2) in which X represents a nitrogen atom N to form NR1R2, an oxygen atom O
to form OR1 or a sulfur atom S to form SR1 as following .
l0 ~ NR1R2 with identical R1 and R2 or different are chosen from the atom hydrogen; C1-CS alkyl optionally substituted by an amino radical, alkylamino, dialkylamino, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino, C1-C4 alkoxy, by a radical pyrrolidinyl, pyridyl or by a phenyl radical;
an aromatic cycle as defined in claim 1; a quinuclidine radical, a pyrrolidinyl radical or a piperidyl radical 2o optionally substituted with C1-C4 alkyl it being understood that identical Rl and R2 do not not both represent hydrogen or C1 alkyl Unsubstituted C4 and different R1 and R2 do not not one hydrogen and the other alkyl C1-C4 unsubstituted, or when X represents N, R1 and R2 form together with X to which they are linked a radical piperazinyl, piperidyl, pyrrolidinyl, morpholinyl or thiomorpholinyl, ~ or a group OR1 or SR1 in which R1 has the same meaning as before being understood that R1 does not represent hydrogen or unsubstituted C1-C4 alkyl.

As indicated above, R1 or R2 can also represent an alkyl radical substituted by a radical imidazolyl.
As indicated above, R1 and R2 can form together with the nitrogen atom to which they are linked a radical piperazinyl, homopiperazinyl, pyrrolidinyl, piperid ~ le or optionally substituted morpholinyl, for example by alkyl or piperidyl.
The present invention relates more precisely to 1o compounds of formula (I) as defined above in which when A represents NR1R2 be one of Rl and R2 represents the hydrogen atom and the other of R1 and R2 is chosen from the values defined for R1 and R2, ie R1 and R2 form together with the nitrogen atom to which they are linked a piperazinyl, pyrrolidinyl radical, piperidyl or morpholinyl.
The present invention also relates to the compounds defined above characterized in that Arl and Ar2 represent a group chosen from the groups following. 4-amino- or 4-methylamino- or 4-dimethylamino-quinolyl, -isoquinolyl, quinolinium or isoquinolinium of which the quinolyl, isquinolyl, quinolinium or isoquinolinium is optionally substituted with one or several methyl group (s) linked to a carbon atom or cycle nitrogen; or optionally substituted phenyl by one or more halogen atoms.
The subject of the present invention is therefore the compounds defined above characterized in that group A
represented .
3o is an amino radical substituted by a chosen radical among the following groups. 4-amino- or 4-methylamino-or 4-dimethylaminoquinolyl, -isoquinolyl, quinolinium or isoquinolinium whose quinolyl nucleus, isoquinolyl, quinolinium or isoquinolinium is optionally substituted by one or more) methyl groups linked) to a ring carbon or nitrogen atom; pyridyle;
phenyl optionally substituted by one or more halogen atoms or by a piperazinyl radical or alkylpiperazinyl; C1-C4 alkyl substituted with amino, alkylamino or dialkylamino radical, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino, alkoxy 1o at C2-C4, with an alkylpiperazinylcarbonyl radical, imidazolyl, pyrrolidinyl or with a phenyl radical, radicals in which the alkyl groups have 1 to 4 carbon atoms; a pyrrolidinyl radical; a radical piperidyle optionally substituted by an alkyl radical in C1-C4; or a quinuclidine radical either a pyrrolidinyl radical, a morpholino radical or a piperazinyl radical optionally substituted by a C1-C4 alkyl or piperidyl radical, is an O-phenyl, O-pyridyl, or O-alkyl radical substituted by an amino, alkylamino or dialkylamino The subject of the present invention is therefore the compounds defined above characterized in that when Arl and Ar2 are identical, Arl and Ar2 represent a group chosen from 4-amino- or 4-methylamino- or 4-dimethylamino-quinolyl, -isoquinolyl, quinolinium or isoquinolinium including the quinolyl nucleus, isoquinolyl, quinolinium or isoquinolinium is optionally substituted by one or more) methyl groups) linked to 3o an atom ~ of carbon or nitrogen of the cycle.
The present invention relates even more precisely the compounds of formula (I) as defined above in which ~ group A represents.

either an amino radical substituted by a chosen radical among the following groups. 4-amino- or 4-methylamino-or 4-dimethylamino-quinolyl or quinolinium whose nucleus quinolinium is optionally substituted with a group methyl; pyridyle; phenyl optionally substituted with one or more halogen atoms or by a radical piperazinyl or alkylpiperazinyl; C1-C4 alkyl substituted by an amino, alkylamino or dialkylamino, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) 10 amino, C2-C4 alkoxy, by a pyrrolidinyl radical or by a phenyl radical, radicals in which the alkyl groups have 1 to 4 carbon atoms; a pyrrolidinyl radical; a piperidyl radical optionally substituted with a C1-C4 alkyl radical;
or a quinuclidine radical either a pyrrolidinyl radical, a morpholino radical or a piperazinyl radical optionally substituted by a C1-C4 alkyl radical either a, 0-phenyl, 0-pyridyl, or 0-alkyl radical 2o substituted by an amino, alkylamino or dialkylamino Among the compounds defined above, we cite particularly the compounds characterized in that Ar1 and Ar2 represent a group chosen from the groups following s. 4-amino- or 4-methylamino- or 4-dimethylamino-quinolyl or quinolinium whose quinolinium nucleus is optionally substituted with a methyl group; or phenyl optionally substituted by one or more halogen atoms.
3o Among the compounds defined above, we also cite particularly the compounds characterized in that the group A represents.

either an amino radical substituted by a chosen radical among the following groups. 4-amino- or 4-methylamino-or 4-dimethylamino-quinolyl or quinolinium whose nucleus quinolinium is optionally substituted with a group 5 methyl; pyridyle: phenyl optionally substituted by one or more halogen atoms or by a radical piperazinyl or alkylpiperazinyl; C1-C4 alkyl substituted by an amino, alkylamino or dialkylamino, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) Zo amino, C2-C4 alkoxy, by a pyrrolidinyl radical or by a phenyl radical, radicals in which the alkyl groups have 1 to 4 carbon atoms; a pyrrolidinyl radical; a piperidyl radical optionally substituted with a C1-C4 alkyl radical;
15 or a quinuclidine radical either a pyrrolidinyl radical, a morpholino radical or a piperazinyl radical optionally substituted by a C1-C4 alkyl radical either a 0-phenyl, O-pyridyl, or 0-alkyl radical 2o substituted by an amino, alkylamino or dialkylamino.
Among the compounds defined above, we also cite particularly the compounds characterized in that when Arz and Ar2 are identical, Arl and Ar2 represent A group selected from 4-amino- or 4-methylamino- or 4-dimethylamino-quinolyl or quinolinium whose quinolinium nucleus is possibly substituted with a methyl gouge.
Among the compounds defined above, we cite 3o particularly the compounds characterized in that when Arl and Ar2 are different 1. Arl represents.

~ a quinoline motif substituted by at least a group N (Ra) (Rb) in which Ra and Rb identical or different represent hydrogen or a C1-C4 alkyl radical or an alkoxy or chain alkyl group short containing 1 to 4 carbon atoms or ~ a quinoline having a nitrogen atom in quaternary form or ~ a benzami-dine except in the case where A
1o represents diethylamine, hydrogen or an amine group or ~ a pyridine attached in position -4 or fused with an aryl group or heteroaryl 25 2. Ar2 represents a nucleus as defined above but different or a phenyl ring optionally substituted by a halogen group, 2o methoxy, cyano, carbonylamino, guanyl, methylthio, amino, methylamino, dimethylamino, morpholine, alkyleneamino in C1-C4 or alkenyleneamino in C2-C4 a quinoline, benzimidazole ring, 25 'indole, benzothiophene, benzofuran, benzothiazole, benzoxazole, carbazole, quinazoline, possibly quinoxaline substituted by one or more groups C1-C4 alkyl or by groups 3o C1-C4 alkylene or C2-C4 alkenylene Among the compounds defined above, more particularly the compounds characterized in that A

represents an amino radical substituted by a radical chosen from the following groups. 4-amino radicals or 4-methylamino- or 4-methylamino-quinolyl or quinolinium whose quinolinium nucleus is possibly substituted with a methyl group; the alkyl radicals in C1-C4 substituted by an amino radical, alkylamino, dialkylamino, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino, pyrrolidinyl or pyridyl; or the radical quinuclidine.
2. Among the compounds of the present invention, mention is made in particular the compounds characterized in that A
represents either an amino radical substituted by one or several radicals as defined above be a piperazinyl, homopiperazinyl, piperidinyl or pyrrolidinyl optionally substituted) with one or several radicals as defined above.
Among the compounds defined above, mention is made. also the compounds characterized in that A represents either a amino radical substituted by a pyridyl radical; phenyl optionally substituted by a piperazinyl radical or alkylpiperazinyl; a piperidyl radical optionally substituted by a C1-C4 alkyl radical or a radical piperazinyl optionally substituted with a radical C1-C4 alkyl.
Mention is made in particular of the compounds as defined above characterized in that A represents a radical 0 (or S) -aromatic ring or an O (or S) -alkyl radical with alkyl possibly substituted.
Mention is made more particularly of the compounds such as s ~ 3o defined above characterized in that A represents a O-phenyl, 0-pyridyl, 0-pyrimidinyl or 0-alkyl radical substituted by an amino, alkylamino or dialkylamino or an S-phenyl, S-pyridyl radical, S-pyrimidyl or S-quinoleinyl.
Among the compounds defined above, the following are also cited:
compounds characterized in that A represents a radical 0-phenyl, 0-pyridyl, or 0-alkyl substituted by a amino, alkylamino or dialkylamino radical.
It is evident that the motifs which are inoline can be substituted by any other group not involved in the intended application, such as acridin groups or 1o isoquinolines or quinazolines or quinoxalines or phthalazines or benzothiazines or benzoxazines or phenoxazines or phenothiazines are included in the definition of quinoline groups.
Preferred among the compounds of formula (I) above. those with two selected heterocycles from the 4-aminoquinolyl, 4-aminoquinolinium or quinolinium whose quinolinium nucleus is possibly substituted with a methyl group.
Among the preferred products as defined above, mention may be made of the products of Examples 1, 2, 11, 17, 19, 20, 27, 29, 31, 32 and 33 of Table 1 below which therefore correspond respectively to compounds whose names follow.
- 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (3-d.iméthylamino-propyl) amino- [1,3,5] triazine (example 1) - 2,4,6-tris- (4-amino-2-methyl-quinolin-6-yl) amino-[1,3,5] triazine (example 2) - 2,4-bis- (4-amino-2-methyl-quinolin-6-yl) amino-6- (4-3o dimethylamino-2-methyl-quinolin-6-y1) amino-[1,3,5] triazine (example 11) - 2,4-bis- (4-amino-2-methyl-quinolin-6-yl) amino-6-(quinuclidin-3-yl) amino- [1,3,5] triazine (example 17) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (1-methyl-piperidin-4-yl) - [1,3,5] triazine (example 19) - 1e 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (1-methyl-piperazin-4-yl) - [1,3,5] triazine (example 20) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (pyridin-4-yl) methylamino- [1,3,5] triazine (example 27) - 2,4-bis- (4-amino-2-methyl-quinolin-6-yl) amino-6-phenoxy- [1,3,5] triazine (example 29) - 2,4-bis- (4-amino-2-methyl-quinolin-6-yl) amino-6- (3-dimethylamino-propyl) oxy- [1,3,5] triazine (example 31) - 2,4-bis- (4-amino-2-methyl-quinolin-6-yl) amino-6-(pyridin-4-yl) oxy- [1,3,5] triazine (example 32) - 2,4-bis- (4-amino-2-methyl-quinolin-6-yl) amino-6-(phenylmethyl) oxy- [1,3,5] triazine (Example 33).
Among the preferred products of this invention as defined above, there may be mentioned particularly the products in table 1 below which correspond to the compounds whose names follow.
- 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (3-dimethylamino-propyl) amino- [1,3,5] triazine (example 1) - 2,4,6-tris- (4-amino-2-methyl-quinolin-6-yl) amino-[1,3,5] triazine (example 2) - 2,4-bis- (4-amino-2-methyl-quinolin-6-yl) amino-6- (4-dimethylamino-2-methyl-quinolin-6-yl) amino [1,3,5] triazine (example 11) - ~ 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-5 yl) amino-6- (1-methyl-piperazin-4-yl) - [1,3,5] triazine (example 20) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-y1) amino-6- (pyridin-4-yl) oxy- [1,3,5] triazine (example 115) 10 - 1st 2,4-bis- (4-amino-2-methyl-quinolin-6-yl) amino-6-(quinolin-2-yl) thio- [1,3,5] triazine (example 128) - 1e 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6-phenyl- [1,3,5] triazine (example 134) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-15 yl) amino-6- [1- (2-dipropylamino-ethyl) piperazin-4-yl] -[1,3,5] triazine (example 137) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6 - {[1-2- (2-hydroxyethyl) oxy-ethyl] piperazin-4-yl} - [1,3; 5] triazine (example 141) 20 - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [2 (S) - (pyrrolidin-1-yl) methyl-pyrrolidin-1-yl] - [1,3,5] triazine (example 149) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6 yl) amino-6- (quinolin-2-yl) thio- [1,3,5] triazine (example 25,133) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (1-methyl-homopiperazin-4-yl) - [1,3,5] triazine (example 135) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (quinolin-2-yl) thio- [1,3,5] triazine (example 133) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (1-methyl-homopiperazin-4-yl) - [1,3,5] triazine (example 135) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [1- (3-dimethylamino-propyl) -piperazin-4-yl] -[1,3,5] triazine (example 136) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [N- (1-methyl-piperidin-4-yl) -N-methyl-amino] -[1,3,5] triazine (example 138) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6 yl) amino-6- {1- [3- (pyrrolidin-1-yl) propyl-homopiperazin-4 yl) - [1,3,5] triazine (example 139) - 1e 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [1- (pyridin-4-yl) -piperazin-4-yl] -[1, 3, 5] triazine (example 144) - 2,4-bis- (4-amino-2-methyl-quinolin-6-yl) amino-6- [1-(2-hydroxy-ethyl) -piperazin-4-yl] - [1,3,5] triazine (example 154) - the ~, 4-bis- (4-amino-2-methyl-quinolin-6-yl) amino-6- (4-hydroxy-piperidin-1-yl) - [1,3,5] triazine (example 155) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (3-hydroxy-pyrrolidin-1-yl) - [1,3,5] triazine (example 162) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-y1) amino-6- [1- (2-hydroxyethyl) -piperazin-4-yl] -[1,3,5] triazine (example 163) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (4-hydroxy-piperidin-1-yl) - [1,3,5] triazine (example 164) - 2,4-bïs- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (3-hydroxy-piperidin-1-yl) - [1,3,5] triazine (example 169) - N- [2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino- [1,3,5] triazin-6-yl] - (Z) -serine (example 171) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-1o yl) amino-6 - [(2S) -2,3-dihydroxy-1-phenyl-propyl] amino-[1,3,5] trïazine (example 172) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (morpholin-4-yl) methylamino- [1,3, 5] triazine (example 179) - 1e 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (piperidin-1-yl) methylamino- [1,3,5] triazine (example 180) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [2- (pyridin-3-yl) pyrrolidin-1-yl] -[1,3,5] triazine (example 181) -- 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-y1) amino-6- [4- (2-dimethylamino-ethyl) piperazin-1-yl] -[1,3,5] triazine (example 182) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6 yl) amino-6- (piperidin-4-yl) thio- [1,3,5] triazine (example 183) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (pyridin-2-yl) amino- [1, 3, 5] triazine (example 188) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (4-methoxyphenyl) amino- [1,3,5] triazine (example 191) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (isopropylamino) methylamino- [1,3,5] triazine (example 192) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin- ~ -yl) amino-6- [2- (2-methyl-pyrrolidin-1-yl) ethylamino [1,3,5] triazine (example 198) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [4- (piperidin-4-yl) -piperazin-1-yl] -[1,3,5] triazine (example 199) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6 yl) amino-6- [4- (piperidin-1-yl) butyl] amino- [1,3,5] triazine (example 200) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6 - [(imidazol-1-yl) methyl] amino- [1,3,5] triazine (example 202) Among the preferred products of this invention as defined above, mention may be made of any particularly the products in table 1 below which correspond to the compounds whose names follow.
- 1e 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (1-methyl-piperazin-4-yl) - [1,3,5] triazine (example 20) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (quinolin-2-yl) thio- [1,3,5] triazine (example 133).

- 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (1-methyl-homopiperazin-4-yl) - [1,3,5] triazine (example 135) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [1- (3-dimethylamino-propyl) -piperazin-4-yl] -[1,3,5] triazine (example 136) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [N- (1-methyl-piperidin-4-yl) -N-methyl-amino] -[1,3,5] triazine (example 138) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- ~ 1- [3- (pyrrolidin-1-yl) propyl-homopiperazin-4-yl) - [1,3,5] trïazine (example 139) - 1e 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [1- (pyridin-4-yl) -piperazin-4-yl] -[1,3,5] triazine (example 144) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [4- (piperidin-4-yl) -piperazin-1-yl] -[1, 3, 5] triazine (example 199) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6 yl) amino-6- [4- (piperidin-1-yl) butyl] amino- [1,3,5] triazine (example 200) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6 - [(imidazol-1-yl) methyl] amino- [1,3,5] triazine (example 202) Another object of the present invention relates to the use of the compounds of formula (I) as pharmaceutical product for human use.
The present invention particularly relates to pharmaceutical compositions comprising as active ingredient a product of formula (I) such as defined above.
The present invention particularly relates to pharmaceutical compositions comprising as 5 active ingredient a product of formula (I) of table 1 below.
The present invention particularly relates to pharmaceutical compositions comprising as active ingredient a product of formula (I) chosen from 10 those whose names are cited above.
The invention therefore extends to pharmaceutical compositions containing as active ingredient at least one of drugs as defined above.
These pharmaceutical compositions can be administered 15 very oral, parenteral or oral topical application to the skin and mucous membranes or by intravenous injection or intramuscular.
These compositions can be solid or liquid and are 2o present in all pharmaceutical forms commonly used in human medicine like, by example, single or coated tablets, pills, tablets, capsules, drops, granules, injections, ointments, 25 creams or gels; they are prepared according to usual methods. The active ingredient can be there incorporated into excipients usually used in these pharmaceutical compositions, such as talc, gum arabic, lactose, starch, stearate 3o magnesium, cocoa butter, aqueous vehicles or no, fatty substances of animal or vegetable origin, paraffinic derivatives, glycols, various agents wetting, dispersing or emulsifying agents, preservatives.
The processes for preparing the compounds of formula (I) AT
NI \ N
Ar ~. ~ NR3 NN 3 10 are described below.
General method 1 According to a first process for the preparation of compounds of general formula (I) in which Arl and Ar2.
on the one hand and R3 and R'3 on the other hand are identical and defined as above and R represents an atom halogen such as chlorine or fluorine, an amino function, alkylamino or dialkylamino of which the alkyl parts straight or branched contain from 1 to 4 atoms of carbon, alkyloxy or alkylthio including the alkyl parts straight or branched contain from 1 to 4 atoms of carbon, alkyloxy or alkylthio including the alkyl parts straight 'or branched contain 1 to 4 atoms of carbon, can be obtained by amination of a dihalotriazine, very generally a dichloro-s-triazine, of general formula (B) in which A is defined as above by an aromatic amine or heteroaromatic of general formula (C) in which Ar is defined as above by operating according to the figure 1.

\ N + Ar- NH - ~ Art ~ ~ ~ Ar X "N" X R3 NNN
X = CI (or F or Br or I) Rs Rs (B) (C) (A) Diagram 1 In the case where A represents a halogen atom, it useful to react 2,4,6-trihalogéno-s-triazine corresponding of general formula (B) with the amine aromatic or heteroaromatic ArNHR3 of general formula (VS) .
We generally operate by condensing a mole of dihalo-s-triazin, or trihalo-s-triazine, with 2 moles of aromatic or heteroaromatic amine. The reaction takes place in an inert medium under the conditions of the reaction. Among the inert solvents that may be mentioned optionally aqueous acetone or an alcohol possibly aqueous such as ethanol, or a solvent halogenated such as dichloromethane, or an ether such as ethyl oxide or oxane, or a solvent polar product such as DMF, DMSO or NMP. We preferably operates at a temperature between 20 ° C
and reflux, in the presence in particular of an organic base, such as triethylamine, or mineral, such as soda or sodium or potassium carbonate. I1 is also possible not to use base when amination reaction, and isolate a hydrochloride from product of general formula (A), the base of which can then be released.
Halo or trihalo-s-triazine zes general formula (B) are either commercial or known, and can be obtained under the conditions described in the litterature.

The aromatic or heteroaromatic amines of general formula (C) are either known, or can be easily prepared by known methods of synthesis aromatic or heteroaromatic amines.
In the case where Arl and Ar2 are different, the triazine of general formula (A) can be obtained by sequential displacement of halogen atoms, very generally chlorine atoms, products of general formula (B) with the amines ArINHR3 then Ar2NHR '3 1o of general formula (C) according to diagram 2.
R
N '\ N + Ar - NH - ~ Ar NN
9 ~ 1 ~

X = CI (or F or Br or I) (B) (C) (C) Ar2- i H (C) R ~ s R
N '\ N
Are ~ ~ ~ Ar2 NR3 N NR'3 Diagram ~
Generally we operate with 1 mole of dihalo-s-triazine, or trihalo-s-triazine, and 1 mole of amine ArINHR3. It is preferred to operate in an inert solvent such as optionally aqueous acetone or an alcohol possibly aqueous, such as ethanol, or a solvent halogenated, such as dichloromethane, or an ether such as diethyl ether or dioxane, or a solvent polar aprotic such as DMF, DMSO or NMP. according to 2o a better way of implementing the invention on operates at a temperature between 20 ° C and 50 ° C.
Then 1 mole of amine Ar2NHR'3 is added to the product of general formula (D), which can be optionally isolated.
We operate in particular at a temperature between 50 ° C.
and reflux.
Advantageously, one can operate under the conditions described in J. Fluor. Chem., 1988, 39 (1), 117-123.
General method 2 According to a second method, the products of formula general (A) in which ArINHR3 and Ar2NHR '3 are defined as above and R represents a group 1o NR1R2 or OR1 or SR1 or alkRlR2 can also be prepared by nucleophilic displacement of an atom halogen, usually a chlorine atom, of a product of general formula (A) in which R represents an atom halogen according to scheme 3.
RR
N '\ NR ~ R2NH or RIO- or RAS- N' \ N
Ar ~~ ~ ~ ~ Ar ~ or R ~ R2alk-M Ar ~~ ~ ~ ~ Ar2 NR3, N NR'3 NR3 N NR'3 (A) '(A) R = CI (or F or Br or i) R = NR ~ R2 or ORS or SRS or R ~ R ~ alk Diagram 3 We. generally operates by condensing 1 mole of product of general formula (A) in which R represents a halogen atom, preferably an atom of 2o chlorine, with 1 mole of amine R1R2NH or alcoholate R10- or thioalcoholate R1S or organometallic RlR2alkM, M
can represent for example magnesium or lithium or zinc. The reaction takes place in an inert medium under the conditions of the reaction. We can cite among inert solvents possibly aqueous acetone or an optionally aqueous alcohol such as ethanol, or a halogenated solvent such as dichloromethane, or an ether such as ethyl oxide or deoxane or tetrahydrofuran, it being understood that these ethers are the solvents that can be used when using a 5 organometallic RlR2alkM, or an aprotic solvent polar such as DMF, DMSO or NMP. When the incoming group represents an R1R2NH group, we operate from preferably at a temperature between ~ 0 ° C and reflux, in the presence in particular of an organic base, such 10 as triethylamine, or mineral, such as sodium hydroxide or sodium or potassium carbonate. he is also possible not to use base during the reaction amination, and to isolate a hydrochloride from the product of general formula (A), the base of which can then be 15 released. When the incoming group represents a group R10- or R1S- we preferentially operate with an alcoholate or an alkali or alkaline earth thioalcoholate, such as sodium or potassium or lithium or ammonium salt or cesium or barium, in an aprotic solvent 20 polar such as DMF or DMSO or NMP, at a temperature between 50 ° C and reflux. When the incoming group represents an RlR2alk group we operate very preferably in an ether such as oxide of diethyl or. dioxane or tetrahydrofuran to a 25 temperature between -70 ° C and the reflux of the medium réaotïonnel.
It is understood that the s-trsazines of formula general can be obtained in the form of libraries, by applying the methods described in diagrams 1, 30 2, or 3 in parallel and / or complementary chemistry in phase liquid or solid phase, it being understood that when works in solid phase, any of the reactants is previously fixed on a solid support, chosen in function, of the chemical reaction involved, and that said chemical reaction is followed by an operation of cleavage of the reaction product from the solid support.
The present invention also relates to the compositions containing a compound according to the invention, in combination with a pharmaceutically acceptable carrier according to the 1st mode of administration chosen. The composition pharmaceutical can be in solid form, liquid or liposomes.
Among the solid compositions, mention may be made of:
powders, capsules, tablets. Among the forms oral we can also include protected solid forms vis-à-vis the acidic environment of the stomach. Media used for solid forms are made up in particular of mineral supports such as phosphates, carbonates or organic supports such as lactose, celluloses, starch or polymers. Shapes liquids. consist of suspension solutions or dispersions. They contain as a dispersive support either water or an organic solvent (ethanol, NMP or 2o others) or mixtures of surfactants and solvents or complexing agents and solvents.
The administered dose of the compounds of the invention will be adapted by the practitioner according to the route administration and the patient's condition.
The compounds of the present invention can be administered alone or mixed with others cancer. Among the possible associations one can to quote.
~ alkylating agents and in particular 3o cyclophosphamide, melphalan, ifosfamide, chlorambucil, busulfan, thiotepa, prednimustine, carmustine, lomustine, semustine, steptozotocin, decarbazine, temozolomide, procarbazine and hexamethylmelamine ~ platinum derivatives such as in particular cisplatin, carboplatin or oxaliplatin ~ antibiotic agents such as in particular bleomycin, mitomycin, dactinomycin, ~ anti-microtubule agents such as including vinblastine, vincristine, 1o viridesine, vinorelbine, taxoides (paclitaxel and docetaxel) ~ anthracyclines such as in particular doxorubicin, daunorubicin, idarubicin, epirubicin, mitoxantrone, losoxantrone ~ group I and II topoisomerases such. that etoposide, teniposide, amsacrine, irinotecan, topotecan and tomudex, ~ fluoropyrimidines such. that the 5-fluorouracil, UFT, floxuridine,.
~ cytidine analogues such as 5-azacytidine, cytarabine, gemcitabine, 6-mercaptomurine, 6-thioguanine ~ adenosine analogs such as pentostatin, cytarabine or phosphate fludarabine ~ methotrexate and folinic acid ~ various enzymes and compounds such as L-asparaginase, hydroxyurea, trans-3o retinoic, suramin, dexrazoxane, amifostine, herceptin and hormones oetrogenic, androgenic ~ anti-vascular agents such as combretastatin or colchicine derivatives and their pro-drugs.
T1 is also possible to combine with the compounds of the present invention treatment with radiation. These treatments can be administered simultaneously, separately, sequentially. The treatment will be adapted to the patient to be treated by the practitioner.
1o The stabilization activity of G-quadruplexes can be determined by a method using training of a complex with fluorescein whose protocol experimental is described below.
~ liaonucléotides All olignucleotides, modified or not, have been synthesized by Eurogentec SA, Seraing, Belgium.
The oligonucleotide FAM + DABCYL carries the reference catalog, OL-0371-0802. It has the sequence:
GGGTTAGGGTTAGGGTTAGGG corresponding to 3.5 repetitions of the 2o human telomeric motif (rich strand, in G). The fluororescein is attached to the 5 'end, DABCYL to the 3 'end, by the chemical arms described by Eurogentec. The concentration of the samples is verified by spectrophotometry, recording the absorbance spectrum between 220 and 700 nm and using the molar extinction coefficient provided by the provider.
tampons All the experiments were carried out in a 3o sodium cacodylate buffer 10 mM pH 7.6 containing 0.1 M
Lithium Chloride (or Sodium Chloride).
The absence of fluorescent contamination in the buffer has been previously checked. The fluorescent oligonucleotide is added to the final concentration of 0.2 µM.
Fluorescence study All fluorescence measurements have been performed on a Spex Fluorolog DM1B device, in using an excitation line width of 1.8 nm and an emission line width of 4.5 nm. The samples are placed in a micro quartz cuvette 0.2 x 1 cm. Sample temperature is l0 controlled by an external water bath. The oligonucleotide only was analyzed at 20, 30, 40, 50, 60, 70 and 80 ° C. The emission spectra are recorded using a excitation wavelength of 470 nm. Specters of excitation are recorded using either 515 nm or 588 nm as, emission wavelength. The spectra are corrected for the response of the instrument by reference curves. A significant extinction (80-90 ~) fluorescence of fluorescein at temperature ambient is observed, in agreement with a decline 2o intramolecular of the oligonucleotide at 20 ° C in the form of a G-quadruplex, which induces a juxtaposition of its ends 5 'and 3', ~~ respectively linked to the fluorescein and DABCYL. This juxtaposition leads to an already described phenomenon of fluorescence quenching, used for "Molecular Beacons".
Tm in fluorescence A stock oligonucleotide solution at the 0.2 µM strand concentration in 0.1 M LiCl buffer 10 mM cacodylate pH 7.6 is previously prepared, 3o briefly heated to 90 ° C and slowly cooled to 20 ° C, then distributed by aliquots of 600 ~ Zl in the tanks of fluorescence. 3 u1 of water (for control) or 3 u1 of product to be tested (stock at 200 uM, final concentration 1 µM) are then added and mixed. The samples are then incubated for at least 1 hour at 20 ° C before each measurement. The use of time longer incubation periods (up to 24 hours) did not 5 of influence on the result obtained.
Each experiment only allows the measurement of a single sample. This is first incubated at a initial temperature of 20 ° C, raised to 80 ° C in 38 minutes, left for 5 minutes at 80 ° C, then cooled to 20 ° C in l0 62 minutes. During this time, the fluorescence is measured simultaneously at two emission wavelengths (515 nm and 588 nm) using 470 nm as the wavelength excitation. A measurement is made every 30 seconds. The temperature of the water bath is recorded 15 in parallel, and the fluorescence profile as a function of the temperature is reconstituted from these values.
The fluorescence profiles are then normalized between 20 ° C and 80 ° C, and the temperature at which the intensity of emission at 515 nm is the average of those at high and 2o low temperature is called Tm. Under these conditions, the Tm of the reference sample without addition of product is 44 ° C in a Lithium Chloride buffer. This temperature raised to over 55 ° C in a buffer Sodium chloride. Addition of a stabilizing compound 25 G-quadruplex induces an increase in Tm.
increase is considered significant if it is greater than 3 °.
Biological activity, antitelomerase is determined by the following experimental protocol.
30 Preparation of the extract enriched with activity human telomerase The HZ60 leukemia line is obtained from ATCC (Americam Type Culture Collection, Rockville USA).
hes cells are grown in suspension in medium RPMI 1640 container, 2 mM L-Glutamine, Penicillin 200 U / ml, streptomycin 200 ug / ml, gentamycin 50 ug / ml and added 10 ô of fatal calf serum inactivated by the heat.
An aliquot of 10 ~ cells is centrifuged at 3000xG and the supernatant discarded. The cell pellet is resuspended by several successive pipetting in 200 u1 lysis buffer containing CHAPS 0.5 ~, Tris-HC1 pH 7.5 10 mM, lmM MgCl2, 1 mM EGTA, (3-mercaptoethanol 5 mM, PMSF 0.1 mM and glycerol 10 ~ and is stored in ice for 30 minutes. The lysate is centrifuged at

16 OOOOxG for 20 minutes at 4 ° C and 160 u1 of supernatant is recovered. The dosage of protein the extract is made by the Bradford method.
The extract is stored at -80 ° C.
Determination of telomerase activity Inhibition of telomerase activity is determined by an extension protocol of the oligonucleotide TS (S ~ AATCGTTCGAGCAGAGTT3 ~), in the presence a cell extract enriched in telomerase activity and compounds that are added to different concentrations (10, 1, 0.1 and 0.01 uM). The reaction extension is followed by PCR amplification of extension products using TS oligonucleotides and CXext (~~ GTGCCCTTACCCTTACCCTTACCCTAA3 ~).
The reaction medium is prepared according to the following composition.
Tris HC1 pH 8.3 20 mM
1.5 mM MgCl2 Tween 20 0.005 ~ (W / V) EGTA 1 mM
dATP 50 uM

dGTP 50 µM
dCTP 50 µM
dTTP 50 µM
Oligonucleotide TS 2 ug / ml CXext oligonucleotide 2 ug / ml Bovine albumin serum 0.1 mg / ml Taq DNA polymerase 1 U / ml alpha 32P dCTP (3000 Ci / mmol) 0.5 u1 Telomerase extract 200 ng in one volume 1o of 10 ~ .1 Test product or solvent in a volume of 5 ~ l . Bi-distilled water QS 50 u1 The oligonucleotides are obtained from from Eurogentec (Belgium) and are stored at -20 ° C at a stock concentration of 1 mg / ml in distilled water.
The reaction samples are assembled in 0.2 ml PCR tubes and a drop of paraffin is deposited on each of the reactions of the experiment before the tubes are closed.
2o The reaction samples are then incubated in a Cetus 4800 PCR device according to the following temperature conditions.
15 minutes at 30 ° C, 1 minute at 90 ° C, followed by 30 cycles of, seconds at 94 ° C, 30 ~ seconds at 50 ° C, and 1 minute 30 seconds at 72 ° C, followed by a final cycle of 2 minutes at 72 ° C.
For each of the samples, an aliquot of 10 u1 is pipetted under the oil flask and mixed with 5 u1 of a deposit buffer containing.

glycerol 32 ~ (W / V) Bromophenol blue 0.03 Xylene cyanol 0.03 The samples are then analyzed by 1o 12 ~ acrylamide gel electrophoresis in a buffer TBE 1X for 1 hour at a voltage of 200 volts, at using a Novex electrophoresis system.
The acrylamide gels are then dried on a sheet of Whatmann paper 3 mm at 80 ° C for 1 hour.
The analysis and quantification of the products of the reaction are performed using a device InstantImager (Pacard).
For each concentration of compound tested, the results are expressed as a percentage of inhibition of the reaction and calculated from the en2ymatic control no treated and sample without enzyme (white) according to the following formula.
(Compound Value - blank value / Control Value enzymatic - white value) x 100.
The concentration of compound inducing a 50 ~ inhibition of the telomerase reaction (IC50) is determined using a semi graphic representation logarithmic of the inhibition values obtained in a function of ~ each of the concentrations of compound tested.
A compound is considered to be active as as anti-lomerase agent when the amount inhibiting 50 telomerase reaction is notably less than ~ xM.
Cytotoxic biologic activity on cell lines human tumor is determined according to protocol 5 next experimental.
The A549 human cell lines are from the ATCC (Americam Type Culture Collection, Rockville USA). A549 cells are grown in layer in culture flask in RPMI 1640 medium, 1o L-Glutamine at 2 mM, Penicillin 200 U / ml, streptomycin 200 ~ .g / ml and added 10 ~ fortal calf serum inactivated by heat. KB cells are grown in layer in culture flask in medium of Dulbelco's container, L-Glutamine 2 mM, Penicillin 200 U / ml, streptomycin 200 ug / ml and added to 10 ô
fatal heat-inactivated calf serum.
Cells in exponential growth phase are trypsinized, washed in 1X PBS and are seeded in 96-well microplates (Costar) due to 4x104 cells / ml for A549 and 1.5x104 cells / ml (0.2 ml / well) then incubated for 96 hours in the presence varying concentrations of product to be studied (10, 1, 0.1 and 0.01 ~ M, each point in quadruplicate). 16 hours before the end of the incubation, 0.02 ~ final red neutral is added to each well. At the end of incubation, the cells are washed with 1 × PBS and high schools with 1 ~ sodium lauryl sulfate.
The cellular incorporation of the dye, which reflects the cell growth, is evaluated by spectrophotometry 30 'at a wavelength of 540 nm for each sample at using a Dynatech MR5000 reading device.
For each concentration of compound tested, the results are expressed as a percentage of inhibition of cell growth and calculated from control untreated and cell-free culture medium (white) according to the following formula.
(Compound Value - blank value / Control Value 5 cells - white value) x 100 The concentration of compound inducing a 50 ~ inhibition of growth (IC50) is determined using a semi graphic representation logarithmic of the inhibition values obtained in 10 as a function of each of the concentrations of compound tested.
A compound is considered to be active as an agent cytotoxic if the 50 ~ inhibitory concentration of growth of the tumor cells tested is notably less than 10 ~ M.
15 The following non-limiting examples are given to illustrate the invention.
Table 1 below gives the structures chemicals as well as G-quartet activities, antitomeromer and cytotoxic of 202 products which 2o constitute, in chronological order where this table the states, Examples 1 to 202 of the present invention which illustrate the present invention without, however, limit. We indicate 'none' in table 1 below when the product does not have a substituent in the 25 corresponding column in accordance with the definition chemical ~ of the products of the present invention.
Example 1. Preparation of 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (3-dimethylamino propyl) amino- [1,3,5] triazine 3o In a 250 mL flask containing 50 mL of DMF, under stirring, 0.5g (0.0036 mol) is successively charged with potassium carbonate, 1 g (0.00189 mol) of 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6-chloro-[1,3,5] triazine prepared according to patent W0 001561 and 1 mL (0.0078 mol) of N, N-dimethyl-1,3-propanediamine, then it is heated for 15 hours at 100 ° C. The reaction medium is concentrated, taken up in 100 mL of water. The precipitate formed is filtered, washed with 2x50 mL of NaOH O.1N puïs dried. 1.2 g of N, N'-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) -N "- (3-dimethylamino-propyl) - [1,3,5] triazine, which is purified by flash chromatography on 30 g of silica (35-70 µm) 1o eluting with a mixture (85/10/5) of dichloromethane, methanol and triethylamine. We then obtain, after vacuum drying at 40 ° C, 0.45 g (41 ô) 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (3-dimethylamino-propyl) amino- [1,3,5] triazine, in the form of a yellow powder whose characteristics are following.
- elementary analysis. ~ C = 64.845 ~ H = 6.855 (Cal = 66.3) ;

(cal = 7.13); % N = 25.275 (cal = 26.58) ;

- NMR spectrum (300 MHz, (CD3) 2S0 d6, 1H S in ppm) 1.73 (mt 2H); 2, (s. 6H) 2, 33 (t wide, = 7 Hz:
. 17; J

2H); 2.53 (broad s 6H); 2.92 (mf. 12H); 3.43 . (mt.

2H); 6, ~ 51 and 6, 53 s wide. 2 hours in total); 7 (2 06 (mf. 1H); 7, 51 "2H); from 8, 10 8, 30 (mt. 3H) (mt.;

8.38 (mf. 1H); 9.24 (broad s. 1H); 9.37 (s wide .

1H).

Examples 1 to 28 Examples 1 to 28 described in Table 1 can be prepared by parallel synthesis in a liquid medium.
In a magnetic heating reactor with condenser ~ ymark, type STEM RS2050 containing 25 wells in parallel with a 50 ml glass tube, we introduce 50 mg of a product corresponding to the following formula.

R3 R '~
Are N ~ N ~ N ~ Ar2 N \ / N
~ C'l this formula representing in particular. products following.
NH HH NH ~ N ~ HH ~ N ~
IIZII
\ \ N ~ N ~ N ~ \ \ or. I \ \ N ~ N ~ N ~ \ \
NII ~ N / Nid Ni ~ N \ / N /
CI '~ C'I
4 mole-equivalents of R1-NH-R2 and 30 mg of carbonate potassium in 5 mL of OMF. It is heated to 80 ° C for one night. After cooling, dilute with 30 mZ of water and the precipitate obtained is filtered. The gross product thus insulated is generally clean (LC / MS purity> 90 ~), it l0 can however be purified by ZC / MS using a C18 Waters Xterra 3.5 ~ M silica column, diameter 3 mm and length 50 mm, eluting with a gradient linear elution constituted at the initial time (t0 = 0 min) with water with 0.05 ~ TFA added and at the time final (tf = 4 min) with acetonitrile containing 0.05 of TFA.
Example 20, 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (4-methyl-piperazin-1-yl) -[1,3,5] trïazine, can also be advantageously 2o prepared in the following manner.
Stir overnight at room temperature, tricol of 1 Z, a solution containing 3 g of 4-dimethylamino-2-methyl-quinoline-6-amine, 2.75 g of 2,4,6-trichloro-s-triazine and 4 g of carbonate potassium in 300 ml of tetrahydrofuran. The middle reaction is filtered, then the filtrate is concentrated under reduced pressure, 5.1 g (98%) of 4,6-dichloro-2- (4-dimethylamino-2-methyl-quinolin-6-yl) amino- [1,3,5) triazin, as a brown solid which ~ are the following.
- mass spectrum (EI / DCI) - 349 (M +) - 1 H NMR spectrum (300 MHz, (CD3) 2S0 d6.8 in ppm).
2.55 (s. 3H); 3.01 (s. 6H); 6.78 (s. 1H); 7, 68 (dd large, J = 9 and 2.5 Hz. 1H); 7.81 (d, J = 9 Hz. 1H);
10 8.41 (mf. 1H); from 11.00 to 11.80 (mf spread. 1H).
In a three-necked flask, dissolve in 500 ml of dioxane, 5.1 g of 4,6-dichloro-2- (4-dimethylamino-2-methyl-quinoline-6-yl) amino- [1,3,5) triazine obtained previously, then 2.94 g of 4-methylamino-2- are added methyl-quinoline-6-amine and 4 g of carbonate potassium. The heated reaction medium, with stirring, at the reflux of dioxane for 16 hours, then cooled and filtered, then the filtrate is concentrated to dryness. We obtain thus 7.5 g (99%) of 6-chloro-2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino- [1,3,5) trïazïne, in the form a solid brown whose characteristics are following.
- mass spectrum (EI / DCI) - 514 (M +) - 1 H NMR spectrum (400 MHz, (CD3) 2S0 d6 at one temperature of 383 K, S in ppm). 2.57 (s. 6H); 2.95 (s. 12H); 6.72 '(s. 2H); 7.77 (d, J - 9 Hz. 2H);
7.94 (dd, J = 9 and 2 Hz. 2H); 8.31 (d, J = 2 Hz. 2H);
9.90 (mf. 2H).
In a 500 mL three-necked flask, dissolve in 200 mL of 3o dimethylformamide, 7.5 g 6-chloro-2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino [1,3,5) triazin, previously obtained. Then we add 6 mL of ~ 4-methyl-piperazine and 4 g of carbonate potassium. The reaction medium is then heated to 100-105 ° C for 20 hours. After concentration under reduced pressure, the residue is precipitated in 200 mL
of water. The raw product is then purified by flash-s chromatography on 300 g of silica (35-70 mesh), in eluting with a mixture of dichloromethane, methanol and of triethylamine (85/10/5 by volume). Fractions containing most of the expected product are concentrated under reduced pressure, then taken up in 10 60 ml of water, to remove the triethylamine. We obtain thus, after drying, 3.1 (37 ~) of 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (4-methyl-piperazin-1-yl) - [1,3,5] pure trïazine, in the form of a beige solid whose characteristics are 15 following.
- melting point - 256-60C
(bench Kofler) - 1 H NMR spectrum (400 MHz, (CD3) zS0 d6 a temperature of 383 K, ~ ppm). 2.30 (s. 3H) 2.47 (t in ;

large, J = 5 z. 4H); 55. 6H); 2, 94. 12H) H 2, (s (s;

20 3.89 (t J = 5 Hz 4H) 6.75 (s. 2H) 7.74 large, . ; ; (D, J = 9 Hz. 2H); 7.99 (dd, ~ J and 2 Hz. 2H) 8.40 =; (D, J = 2 Hz. 2H); 8.70 9.00 (mf. 2H).

Examples 29 to 33. examples 29 to 33 described in the Table 1 can be prepared by parallel synthesis in 25 liquid medium.
In a magnetic heating reactor with condenser Zymark, type STEM RS2050 containing 25 wells in parallel with a 50 ml glass tube, we introduce 2 mole-equivalent of sodium hydride and 2 mole-3o equivalents of R10H in 5 mL of dioxane. We bring to 40 ° C
during 30 minutes. Then add 50 mg of a product responding to the following formula.

R3 R'3 Are N ~ N ~ N ~ 'Ar2 N \ / N
~ C'l this formula representing in particular the products following.
NH2 HH NH2 ~ N ~ HH ~ N ~
\ \ NvN '/ N ~ \ \ DU ~ \ \ N ~ N ~ N ~ \ \
N ~ N '/ N / Nest N ~ INI ~ N
~ C'I CI
5 and heated to reflux overnight. After cooling, dilute with 30 mL of water and filter the precipitate obtained. The raw product thus isolated is purified by LC / MS using a C18 silica column Waters Xterra 3.5 uM, diameter 3 mm and length 10 50 mm, eluting with a linear elution gradient constituted at the initial time (t0 - 0 min) by water added with 0.05 ~ TFA and at the final time (tf - 4 mn) with acetonitrile containing 0.05 ~ of TFA.
Examples 34 to 108 can be obtained by operating 15 as described above for examples 1 to 28.
Examples 103 to 115 and Example 196 can be obtained by operating as described above for examples. 29 to 33..
Examples 116 to 133, 177 and 183 can be obtained 20 by operating as described above for examples 29 to 33, but replacing R10H with R1SH.
Example 134 can be obtained by operating in the manner next'.

In a 250 mL knit, dissolve in 100 mL of dioxane, 1 g of 2,4-dichloro-6-phenyl- [1,3,5] -trïazine which can be obtained by operating according to Tetrahedron 2000, 56, 9705-9711. Then 0.9 of 4-dimethylamino-2- is added methyl-quinoline-6-amine and 1.2 g of carbonate potassium, then the reaction medium is heated to 80 ° C.
for 18 hours. After cooling, the solvent is evaporated under reduced pressure and the residue is taken up by 100 mL of water. The precipitate formed is drained, washed with water 1o and dried under reduced pressure. 1.5 g are thus obtained.
(89%) of 2-chloro-4- (4-methylethyl-2-methyl-quinoline-6-yl) amino-6-phenyl- [1,3,5] -triazine, in the form of a yellow solid whose characteristics are following.
- mass spectrum (EI / DCI) - 390 (M +) - 1 H NMR spectrum (400 MHz, (CD3) ~ SO d6, one temperature of 353K, 8 in ppm). 2.60 (s .; of 2.95 3H) ~

3.10 (broad s. 6H); 6, (broad s. 1H); 7, 62 (t wide, J = 8 Hz. 2H); 7, (t large, J Hz. 1H) 69 = 8;

7.8 ~ (d, J = 9 Hz. 1H) 7.92 (dd wide, J 9 and 2 Hz ; =.

1H); 8.43 (d wide, J - 8 Hz (mf. 1H) . ;
2H) ;
8.70 10, 76 (mf. 1H).

To a solution of 0.75 g of 2-chloro-4- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6-phenyl- [1,3,5] triazine 0.39 g of 4-methylamino-2- is added to 30 ml of DMF
methyl quinoline-6-amine and 0.7 g of carbonate potassium. Then the reaction medium is heated for 18 hours at 140 ° C. After cooling and diluting with 100 mL of water, the precipitate formed is drained, then purified 3o by flash chromatography on 50 g of silica gel (35-70 mesh), eluting with a mixture of dichloromethane, methanol and triethylamine (96/2/2 by volume). We thus obtains 0.12 g (11 ~) of 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6-phenyl- [1,3,5] triazine pure, in the form of a yellow solid whose features are as follows.
- melting point (Kofler bench) - 172 ° C
- 1 H NMR spectrum (400 MHz, (CD3) 2S0 d6, with adding a few drops of CD3COOD d4, to a temperature of 353K, ~ in ppm). 2.51 (broad s. 6H);
3.20 (s. 12H); 6.76 (s. 2H); 7.55 (wide t, J = 8 Hz. 2H); 7.60 (broad t, J - 8 Hz. 1H); 7.87 (d, J = 8.5 Hz. 2H); 8, 3 ~ 0 (dd large, J = 8, 5 and 2 Hz 10 2H); 8.40 (broad d, J = 8 Hz. 2H); 8.69 (d, J = 2 Hz.
2H).
Example 178 can be obtained by operating as in Example 134 but from 2,4-dichloro-6 phenylmethyl- [1,3,5] -triazine which can be obtained by operating according to Tetrahedron 2000, 56, 9705-9711.
Examples 135-to 176, 178 to 182, 184, 187 to 195 and 197 to 202 can be obtained by operating as described previously for examples 1 to 28, except that the DMF volume is reduced by 5 to 2 mL and that the 2o heating temperature is increased from 80 to 108-110 ° C.
Example 185, 2 - ((4-dimethylamino-2-methyl-quinoline-6-yl) amino) -4 - ((4-dimethylamino-1,2-dimethyl-6-quinolinyl yl) amino) 6- (4-ethoxyethyl-piperazin-1-yl) -[1,3,5] triazine, can be advantageously prepared from next way.
20 ml of 1,4-dioxane are added to a 50 ml knitted fabric and 200 mg (0.57 mmol) of 4,6-dichloro-2- (4-dimethylamino-2-methyl-quinolin-6-yl) amino- [1,3,5] tri-azine, which can be prepared as in Example 20. We 3o agitates the reaction, then 122 mg are successively added (0.70 mmol) of 1- [2- (2-hydroxyethoxy) ethyl] piperazine and 100 x 1 (0.57 mmol) of N, N-isopropylethyl-amine. We heats for 48 hours at 110 ° C under argon. After concentration of the reaction medium, take up with dichloromethane, washed with saturated solution of ammonium chloride and concentrated under pressure scaled down. 0.23 g of 2 - ((4-dimethylamino-2-methyl-quinolin-6-yl) amino) -4-chloro-6- (4-éthoxyéthyl-piperazin-1-yl) - [1,3,5] trïazine, used as is in the next step, the characteristics of which are following.
1o - mass spectrum (EI) - 488 (M + ').
In a magnetic heating reactor with condenser Zymark, type STEM RS2050 containing 25 wells in parallel, each provided with a 50 ml glass tube, introduced 24 mg (0.05 mmol) of 2 - ((4-dimethylamino-2-methyl-quinolin-6-yl) amino) -4-chloro-6- (4-éthoxyéthyl-piperazin-1-yl) - [1,3,5] triazine. In tube 1, we successively add 5 ml of DMF, 1 ml of 1,4-dioxane, 9 ~, l (0.05 mmol) of N, N-di-isopropylethylamine and 19 mg (0.10 mmol) 4-dimethylamino-1,2-dimethyl- chloride 2o quinoline-6-yl) amine, prepared according to the patent W0001561. The reaction medium is heated to 120 ° C under argon for 48 hours. After cooling, the contents of the tube are evaporated under reduced pressure, taken up per 5 ml of water, filtered and washed with oxide of Diethyl. The crude product obtained is then purified by ZC / MS using a C18 Waters silica column Xterra 3.5 ~ zM, diameter 3 mm and length 50 mm, eluting with a linear elution gradient formed at initial time (to - 0 min) with water containing 0.05 3o of trifluoroacetic acid and at the final time (tf - 4 min) with acetonitrile containing 0.05 ~ acid trifluoroacetic. Thus, after purification, 18.8 mg 2 - (((4-dimethylamino-2-methyl-) chloride quinolin-6-yl) amino) -4 - ((4-dimethylamino-1,2-dimethyl-quinolinium-6-yl) amino) -6- (4-ethoxyethyl-piperazin-1-yl) - [1,3,5] triazine, the characteristics of which are following.
- mass spectrum (DAD-TIC) - 639 (MH +) Example 186, 2,4-bis - ((4-dimethylamino-2-methyl-quinolin-6-y1) amino) -6- (4-cyclopentyl-piperazin-1-yl) -[1,3,5] triazine, can be advantageously prepared from next way.
1.10 g of 2,4,6-trichloro-s-triazine and 25 ml are added of 1,4-dioxane in a three-necked flask of 100 ml. We shake it 1o reaction until 2,4,6-trichloro-s- dissolves triazine. We put the tricolor in an ice bath. After minutes, add 930 mg of 1-cyclopentyl-piperazine and 640 mg of sodium carbonate. After 4 hours, the bath ice is removed. After return to temperature ambient, the solid which is precipitated is filtered. We 1.496 g of 2,4-dichloro-6- (4-cyclopentyl-piperazin-1-yl) - [1,3,5] triazine, used as is in the next step, the characteristics of which are following.
- mass spectrum (EI) - 303 (M + ') In a 50 ml knit, 906 mg of 2,4-dichloro-6- (4-cyclopentyl-piperazin-1-yl) -[1,3,5] tria-zine, obtained above, and 25 ml of 1,4-dioxane. The reaction is stirred. We then add, successively, 603 mg of 4-dimethylamino-2-methyl-quinoline-6-ylamine, which can be prepared according to J. Med.
Chem. 1992, 35, 252, and 414 mg of sodium carbonate. We heats to 110 ° C under argon for 18 hours. After filtration then washing of the precipitate with methanol, after concentration 1.06 g of 2-chloro-4- (4-dimethylamino-2-methyl-quinolin-6-ylamine) -6- (4-cyclopentyl-piperazin-1-yl) - [1,3,5] triazine, used as is in the next step, whose features are as follows.
- mass spectrum (EI) - 465 (M + ').
In a magnetic heating reactor with condenser 5 Zymark, of type STEM RS2050 containing 25 wells in parallel, each provided with a 50 ml glass tube, introduces 25 mg (0.05 mmol) of 2-chloro-4- (4-dimethylamino-2-methyl-quinolin-6-ylamine) -6- (4-cyclopentyl-piperazin-1-yl) - [1,3,5] triazine, obtained 1o above. In the first tube, we add successively 5 ml of DMF, 1 ml of 1,4-dioxane, 9 ~ .l (0.05 mmol) of N, N-diisopropylethylamine. and 19 mg (0.10 mmol) of (4-dimethylamino-1,2-dimethyl-quinolinyl-6-yl) amine. The reaction medium is heated to 120 ° C under argon for 15 48 hours. After cooling, the contents of the tube are evaporated under reduced pressure, taken up in 5 ml of water, filtered and washed with diethyl ether. The product crude obtained is then purified by ZC / MS using a C18 Waters Xterra 3.5 pM silica column, diameter 20 3 mm and length 50 mm, eluting with a gradient linear. of elution formed at the initial time (to = 0 min) with water containing 0.05 ~ trifluoroacetic acid and at the final time (tf - 4 min) with acetonite.rile containing 0.05 ~ trifluoroacetic acid. We obtain Thus, after purification, 18.8 mg of 2,4-bis-{(4-dimethylamino-2-methyl-quinolin-6-y1) amino) -6- (4-cyclopentyl-piperazin-1-yl) - [1,3,5] triazine, the features are as follows.
- mass spectrum (DAD-TIC) - 619 (MH +) 3o Examples 203. By operating as in Example 185, by parallel synthesis, but it being understood that it is possible to successively introduce any one of the three side chains, identical or different, are advantageously prepared the tria ~ ines of formula general (Ib) below.
AT
N '\' N
(Ib) BN
in which .
- B represents an ArlNR3 radical, a selected radical among the radicals 1. (4-amino-2-methyl-quinoline-6-yl) amino 2. (2-methyl-4-methylamino-quinoline-6-yl) amino 3. (4-dimethylamino-2-methyl = quinoline-6-yl) amino, 10 4. ([2,4-bis (dimethylamino) -quinoline-6-yl] amino 5. (4-dimethylamino-2-methylamino-quinoline-6-yl) amino 6. (4-dimethylamino-2-methyl-quinoline-7-yl) amino - C ~ represents ~ an Ar2NR3 radical chosen from radicals.
1. (4-amino-2-methyl-quinoline-6-yl) amino 2. (2-methyl-4-methylamino-quinoline-6-yl) amino 3. (4-dimethylamino-2-methyl-quinoline-6-yl) amino 4. ([2,4-bis (dimethylamino) -quinoline-6-yl] amino 5. (4-dimethylamino-2-methylamino-quinoline-6-yl) amino 6. (4-dimethylamino-2-methyl-quinoline-7-yl) amino 7 .. (4-phenylmethylamino-2-methyl-quinoline-6-yl) amino 8. (4-diethylamino-2-methyl-quinoline-6-yl) amino 9. (4-isopropylamino-2-methyl-quinoline-6-yl) amino 1Ø [4- (2-methoxy-ethyl) amino-2-methyl-quinolin-6-yl] amino 11. [4- (4-aCetylamino-phenyl) amino-2-methyl-quinolin-6-yl] amino 10 12. [4- (azetidin-1-yl) -2-methyl-quinoline-6-yl) amino 13.- [2-methyl-4- (pyrrolidin-1-yl.) - quinoline-6-yl) amino 14. (6-dimethylamino-phenanthridin-2-y1) amino 15. (1-dimethylamino-isoquinoline-7-yl) amino 16. [N- (4-d.imethylamino-2-methyl-quinoline-6-yl) -N-methyl] amino

17. (4-dimethylamino-2-phenyl-quinoline-6-yl) amino

18. (4-amino-2-isopropyl-quinoline-6-yl) amino

19. (2,7-dimethyl-4-dimethylamino-quinoline-6-yl) amino

20. (2-methyl-1H-benzoimidazol-5-yl) amino

21. (2-dimethylamino-1H-benzoimidazol-5-yl) amino

22. (2-dimethylamino-3-methyl-3H-benzoimidazol-5-yl) amino

23. (2-dimethylamino-1-methyl-1H-benzoimidazol-5-yl) amino

24. (1-dimethylamino-3-methyl-isoquinoline-7-yl) amino

25. [1- (2-Dimethylamino-ethyl) -1H-indol-5-yl] amino

26. (9-dimethylamino-acridin-2-yl) amin

27. (4-dimethylamino-quinazolin-6-yl) amino

28. (4-amino-1,2-dimethyl-quinolëinio-6-yl) amino

29: (Naphthalen-2-yl) amino

30. (naphththalen-2-yl) methylamino

31. 2- (Naphthalen-2-yl) ethylamino

32. (anthracen-2-yl) amino

33. diphenylmethylamino

34. (3,4,5-trimethoxy-phenyl) amino

35. (3,4,5-trimethoxy-phenyl) methylamino 3 ~ 6. (4-trifluoromethylphenyl) amino 37. (4-trifluoromethyl-phenyl) methylamino 38. (4-cyanophenyl) amino 39. (4-cyanophenyl) methylamino 40. (4-methylammonio-phenyl) amino 41. (2-trimethylammonioethyl) amino 42. (1-methyl-pyridinio-4-yl) amino 43. (4-amidinophenyl) amino - A represents a radical chosen from the radicals.
1: (4-amino-2-methyl-quinoline-6-yl) amino 2. (2-methyl-4-methylamino-quinoline-6-yl) amino 3. (4-methylamino-2-methyl-quinoline-6-yl) amino 4. ([2,4-bis (dimethylamino) -quinoline-6-yl] amino 10 5. (4-dimethylamino-2-methylamino-quinoline-6-yl) amino 6. (4-dimethylamino-2-methyl-quinoline-7-yl) amino 7. (4-amino-1,2-dimethyl-quinoline-6-yl) amino 8. [N- (1-methyl-piperidin-4-yl)] - N-methyl] amino l5 9. 4- (pyridin-4-yl) piperazin-1-yl 1 ~ 0. 4- (2-hydroxyethyl) piperazin-1-yl 11. 4- (3-dimethylamino-propyl) homopiperazine-1-yl 12. 4- [3- (pyrrolidin-1-yl) propyl] piperazin-1-2 o y1 13. (2,3-dihydroxy-1-phenyl-prop-1-yl) amino 14. 4- [2- (pyrrolidin-1-yl) ethyl] piperazin-1-yl 15. 4- [2- (pyrrolidin-1-yl) ethyl) homopiperazin-1-yl 16. 4- [2- (1H-imidazol-1-yl) ethyl] homopiperazin-1-yl 5 17. 4- [2- (1-H-imidazol-1-yl) ethyl] piperazin-1-yl 18. 4- [3- (1-H-imidazol-1-yl) propyl] homopiperazin-1-yl 19. 4- [3- (1-H-imidazol-1-yl) propyl] piperazin-10 1-yl 20. 4- [2- (2-phenyl-1-H-imidazol-1-yl) ethyl] homopiperazin-1-yl 21. 4- [2- (2-phenyl-1-H-imidazol-1-yl) ethyl] piperazin-1-yl i5 22. 4- [3- (2-phenyl-1-H-imidazol-1-yl) propyl] homopiperazin-1-yl 23. 4- [3- (2-phenyl-1-H-imidazol-1-yl) propyl] piperazin-1-yl 24. 4- [2- (morpholin-1-yl) ethyl] homopiperazin-20 1-yl 25. 4- [2- (morpholin-1-yl) ethyl] pipërazin-1-yl 26. 4- [3- (morpholin-1-yl) propyl] homopiperazin-1-yl 27. 4- [3- (morpholin-1-yl) propyl] piperazin-1-yl 25 28. 4- [2- (1H-imidazo [4,5b] pyridin-1-yl) ethyl] homopiperazin-1-yl 29. 4- [2- (1-H-imidazo [4,5b] pyridin-1-yl) ethyl] piperazin-1-yl 30. 4- [3- (1-H-imidazo [4,5b] pyridin-1-yl) propyl] homopiperazin-1-yl 31. 4- [3- (1-H-imidazo [4,5b] pyridin-1 yl) propyl] piperazin-1-yl 32. 4- [2- (1H-benzoimidazol-1 yl) ethyl] homopiperazin-1-yl 33. 4- [2- (1-H-benzoimidazol-1-yl) ethyl] piperazin-1-yl 34. 4- [3- (1-H-benzoimidazol-1 yl) propyl] homopiperazin-1-yl 35. 4- [3- (1-H-benzoimidazol-1-yl) propyl] piperazin-1-yl

36. 4- [2- (2-hydroxymethyl-1H-benzoimidazol-1-yl) ethyl] homopiperazin-1-yl

37. 4- [2- (2-hydroxymethyl-1-H-benzoimidazol-1-yl) ethyl] piperazin-1-yl

38. 4- [3- (2-hydroxymethyl-1-H-benzoimidazol-1-2o yl) propyl] homopiperazin-1-yl

39. 4- [3- (2-hydroxymethyl-1-H-benzoimidazol-1-yl) propyl] piperazin-1-y1

40. 4- [2- (1H-imidazol-2-yl) amino-ethyl] homopiperazin-1-yl

41. 4- [2- (1-H-imidazol-2-yl) amino ethyl] piperazin-1-yl

42. 4- [3- (1-H-imidazol-2-yl) amino-propyl] homopiperazin-1-yl 4 ~ 3. 4- [3- (1-H-imidazol-2-yl) amino-propyl] piperazin-1-yl 44. 4- {2- [2- (1H-imidazol-2-yl) -1-hydroxymethyl-eth ~ yl] amino} ethyl homopipérazin-1-yl 45. 4- {2- [2- (1H-imidazol-2-yl) -1-hydroxymethyl-ethyl] amino-ethyl} piperazin-1-yl 46. 4- {3- [2- (1H-imidazol-2-yl) -1-hydroxymethyl-ethyl] amino-propyl} homopipérazin-1-yl 47. 4- {3- [2- (1H-imidazal-2-yl) -1-hydroxymethyl-ethyl] amino} propyl-piperazin-1-yl 48. 4- (pipridin-4-yl) pipridin-1-yl 49. (1-H-benzoimidazol-1-yl) mthylamino 50. (pipridin-1-yl) mthylamino 51. 2- (pyridin-2-yl) pyrrolidin-1-y1 52. 4- (2-dimthylamino-thyl) piprazin-1-yl 53. (1-methyl-pipridin-4-yl) amino 54. (quinuclidin-3-yl) amino 55. (4-methyl-homopiprazin-1-yl) amino 56. [N- (2-dimthylamino-thyl) -N-. (Phnylmthyl) amino] mthylamino 57. (diisopropylamino) mthylamino 58. (dithylamino) mthylamino 59. (pyridin-2-yl) amino 60. (pyrimidin-2-yl) amino 61. (pipridin-1-yl) mthylamino 62. (1-phnylmthyl-pyrrolidin-3-yl) amino 63. (2-dimthylamino-thyl) oxy 64. phnyloxy 65. (pyridin-2-yl) oxy 66. (pyrimidin-2-yl) oxy Zo 67. phnylsulfanyl 68. (pyridin-2-yl) sulfanyl 69. (pyrimidin-2-yl) sulfanyl 70. (quinolin-2-yl) sulfanyl Zines, alcohols or phnols and thiols or thiophnols, necessary for the introduction of radicals of type B, C or A of products of general formula (Ib), are .

~ either commercial, ~ be prepared as described in the literature.
~ 0 2-methyl-quinoline-4,6-diylamine (A1 / B1 / C1) according to J. Med. Chem. 1992, 35, 0 2-methyl-4-methylamino-quinoline-6-amine (A2 / B2 / C2) according to J. Med. Chem. 2000, 43, 0 4-dimethylamino-quinoline-6-amine (A3 / B3 / C3) according to WO 0140218 0 4-phenylmethylamino-quinoline-6-amine (B7) according to J. Med. Chem. 1992, 35, 252-258 0 2-dimethylamino-1-methyl-1H-benzoimidazol 5-amine (B23) according to Khim Geterosikl.
1o Soedin. 1969, 543-546 0 4-dimethylamino-quinazolin-6-amine (B27) according to W0 9738983 o 1,2-methyl-quinolinium-4,6- chloride diamirie (B28 / C7) according to WO 0140218 0 4- [2- (1H-imidazol-1-yl) ethyl] piperazine (C17) according to W0 0196323 0 4- [3- (1H-imidazol-1-yl) propyl] pipërazine (C19) according to EP 350 145 ~ be prepared as below.
o Za 4-diethylamino-2-methyl-quinoline-6-amino (B8), 4-isopropylamino-2-methyl-quinoline-6-amine (B9), 4- (2-metho ~ y-ethyl) amino-2-methyl-quinoline-6-amine (B10), 4- (4-acetylamino-phenyl) amino-2-methyl-quinolin 25. 6-amine (B11), 4- (azetidin-1-yl) -2-methyl-quinoline-6-amine (B12) and 2-methyl-4-(pyrrolidin-1-y1) -quinoline-6-amine (B13) can be prepared by parallel synthesis by operating in the following manner.

Step 1 . Parallel substitution of 4-chloro-2-methyl-6-quinoline In a 24-well stainless steel reactor, heating, agitable and pressurizable, it is introduced by 5 wells the following amines.
0.094 g isopropylamine 0.173 g of diethylamine hydrochloride 0.120 g of 2-methoxyethylamine 0.091 g azetidine l0 0.114 g of pyrrolidine 0.296 g of 4-aminoacetanilide hydrochloride Then 1.35 ml of a solution are added to each well mother prepared from 2.67 g of 4-chloro-2-methyl-6-nitro-quinoline in 30 ml of N-methylpyrrolidinone and 15 of 10.1 ml of triethylamine. This operation is reproduced in 4 wells, for each substituent amine.
The apparatus is closed then pressurized under 10BAR of argon and stirred for 5 hours at 100 ° C. After cooling, we brings together the solutions of wells of the same composition, 2o then these solutions are diluted with 30 ml of water. We wring out the insoluble material formed on a porous plate, rinse it with 15 ml of water and air dry it. The products are purified by LCMS under the following conditions.
Platform MICROMASS mass spectrometer 25 Agilent HPZC .2100 chain (Hewlett Packard) THERMO Hypersil 50X4 column. 6 mm 5 u hyPURITy C1 ~
Elution gradient (water / acetonitrile by volume) t = 0 min (95-5) ~ t - 3.5 min (10/90) ~ t - 4 min (10/90) ~ t = 4.5 min (95/15); t = 6 min 595/5).
The following pure products are thus obtained.
0.323 g of 4-isopropylamino-2-methyl-6-nitro-quinoline (ZCMS retention time. 3.04 min) 0.386 g ~ of 4-diethylamino-2-methyl-6-nitro-quinoline (ZCMS retention time. 2.98 min) 0.365 g of 4- (2-methoxy-ethyl) amino-2-methyl-6-nitro-quinoldene (LCMS retention time. 2.69 min) 0.258 g of 4- (a ~ etidin-1-yl) -2-methyl-6-nitro-quinoline (LCMS retention time. 2.87 min) 0.275 g of 4- (pyrrolidin-1-yl) -2-methyl-6-nitro-quinoline (LCMS retention time '. 3.04 min) 0.461 g of 4- (4-acetylamino-phenyl) -2-methyl-6-nitro-quinoline (LCMS retention time. 2.96 min) 2nd step . Parallel reduction of 6-vitro-quinolines 1o The products described above are distributed each in 4 wells. Their reduction is carried out in the device described above, by introducing into each well 0.050 g of 10 ~ palladium on carbon and 1.5 ml of a methanol / dichloromethane solution (80/20 in volumes). After obturation and inerting, the mixture is stirred for 6 hours at 20 ° C under 6 bars of hydrogen. The solutions wells of the same composition are grouped together, the catalyst is filtered and then rinsed with 5 ml of methanol. The the filtrate is then concentrated under reduced pressure. The 2o products are purified by LCMS under the conditions described in step 1. We thus obtain.
0.289 g of 4-isopropylamino-2-methyl-quinoline-6-amine (LCMS retention time. 3.07 min) 0.487 g of 4-dithylamino-2-methyl-quinolin-6-amine (LCMS retention time. 2.62 min) 0.323 g of 4- (2-mthoxy-thyl) amino-2-mthyl-quinol in-6-amine (LCMS retention time 2.78 mins) 0.035 g of 4- (aztidin-1-yl) -2-methyl-quinolin-6-amine (LCMS retention time 1.74 min) 0.20 g of 4- (pyrrolidin-1-yl) -2-methyl-quinolin-6-amine (LCMS retention time. 2.53 min) 0.170 g of 4- (4-acetylamino-phenyl) -2-methyl-quinoline-6-amine (LCMS retention time 2.76 min.
o 2,4-bis (dimethylamino) -quinoline-6-amine (A4 / B4 / C4) can be prepared by operating from next way.
180 mg 2,4-bis (dimethylamino) -6-vitro-quinoline dissolved in 12 mL of a methanol mixture dichloromethane (3/1 by volume) is placed under hydrogen atmosphere (5 bars) in the presence of 15 mg of palladium on carbon at 10 ~ for 12 hours. After Celite filtration, the filtrate is concentrated under reduced pressure. This gives 186 mg of 2,4-bis (dimethylamino) -quinoline-6-amine in the form of hydrochloride whose characteristics are following.
1 H NMR spectrum 0300 MHz, (CD3) 2S0 d6, 8 in ppm). 3.12 (s. 6H); 3.28 (s. 6H); 5.48 (mf. 2H);
6.04 (s. 1H); 7.06 (dd, J - 9 and 2.5 Hz. 1H); 7, 11 (d, J = 2.5 Hz. 1H); 7.81 (d, J = 9 Hz. 1H).
Mass spectrum.
EI (70eV) m / z = 230 M + 'base peak m / z = 215 [M - CH3] +
m / z = 2 01 [215 - CH2] +
m / z = 187 [M - NC ~ HS] +.
2,4-bis (dimethylamino) -6-nitroquinoline can be prepared as follows. 300 mg 2,4-dichloro-6-vitro-quinoline is dissolved in 12 mL DMF in the presence of 853 mg of carbonate 3o potassium and 1 g of dimethylammonium hydrochloride.
The reaction mixture is stirred at 100 ° C for 3 hours. After returning to room temperature, the insoluble material is removed by filtration and the filtrate is concentrated under reduced pressure. The residue is hydrolyzed by adding water and the precipitate obtained is recovered by filtration and then dried under reduced pressure. We obtain thus 180 mg of 2,4-bis (dimethylamino) -6-vitro-quinoline in the form of a yellow powder whose mass spectrum is the next .
EI (70eV) m / z = 260 M + 'base peak m / z = 245 [M - CH3] +
m / z = 231 [245 - CH2] +
10 m / z = 217 [M - NC2H5] +.
m / z = 19 9 [2 4 5 - N02] +.
2,4-dichloro-6-vitro-quinolein can be prepared. as follows. A solution of 500 mg of 6-vitro-quinoline-2,4-diol in 10 mL 'of POC13 is brought to reflux for 3 hours. After returning to room temperature, the reaction mixture is concentrated under reduced pressure and then taken up with the water. The pH of the aqueous phase is brought to 8 by addition of an aqueous ammonia solution at 28 ~ and the phase aqueous solution is extracted with dichloromethane. The sentence organic is then dried over magnesium sulfate and then concentrated under reduced pressure. 300 mg are thus obtained 2,4-dichloro-6-vitro-quinoline as a yellow powder with the following mass spectrum.
EI (70eV) m / z = 242 M + 'base peak, massive dichlor isotopic m / z = 212 [M NO] + isotopic mass of the peak -dichloroethane m / z = 196 [M N02] + isotopic mass of the peak -dichloroethane m / z = 184 [M CN02] + isotopic mass of the peak -dichloroethane m / z = 161 [196 - Cl] + 'isotopic mass of peak monochloroacetic 6-nitro-quinoline-2,4-diol can be prepared from the following way. 500 mg of 2,4-quinoline diol are placed in solution in 6 mL of concentrated sulfuric acid at 0 ° C. 314 mg of potassium nitrate is then added and the reaction mixture is stirred at 0 ° C
for 1 hour then overnight at room temperature. he is then thrown into a water-ice mixture and the pH of the aqueous solution thus obtained is brought to pH 7 by addition of an aqueous ammonia solution at 28 ~. The 1o aqueous phase is then extracted with dichloromethane and the resulting organic phase is washed with the water . a precipitate forms in the organic phase which is collected by filtration and dried under pressure scaled down. 357 mg of 6-nitro-quinoline- are then obtained.
2,4-diol in the form of a yellow powder with a spectrum of mass is as follows.
EI (70eV) m / z = 206 M ~ ' m / z = 176 [M - NO] +
m / z = 160 [M - N02] +
m / z = 36 [HCl] '' ~ 'base peak, presence HC1 in the middle o 4-dimethylamino-2-methylamino-quinoline-6-amine (A5 / B5 / C5) can be prepared by operating as follows .
150 mg of 4-dimethylamino-2-methylamino-6-nitro-quinoline in solution in 4 mL of a methanol-dichloromethane (3/1 by volume) is placed under hydrogen atmosphere (5 bars) in the presence of 20 mg of palladium on carbon at 10 ~ for 12 hours. After filtration on velite, the filtrate is concentrated under reduced pressure. 122 mg of 4-dimethylamino-2-methylamino-quinoline-6-amine under form of hydrochloride whose characteristics are following.

1 H NMR spectrum (300 MHz, (CD3) 2S0 d6, 8 in ppm). 3.02 (s. 3H); 3.05 (s. 6H); 5.44 (mf. 2H);
6.10 (s. 1H); 7.03 (dd, J = 9 and 2.5 Hz. 1H); 7, 10 (d, J - 2.5 Hz. 1H); 7.64 (d, J - 9 Hz. 1H); 8, 27 (mf. 1H); 11.97 (spread mf: 1H).
Mass spectrum. .
EI (70eV) m / z = 216 M + 'base peak m / z = 187 [M - NCH3j +.
m / z = 172 [187 - CH3j +
1o 4-methylethyl-2-methylamino-6-nitro-quinoline can be prepared as follows. 188 mg of 4-chloro-2-methylamino-6-nitro-quinoline is used solution in 8 mL of DMF in the presence of 546 mg of potassium carbonate and 645 mg hydrochloride dimethyl. The reaction mixture is stirred at 100 ° C for 10 hours. After return to temperature ambient, it is hydrolyzed by adding water and the phase thus obtained is extracted with dichloromethane. The organic phase is dried over magnesium sulfate then concentrated under pressure scaled down. 150 mg of 4-methylamino-2- are thus obtained.
methylamino-6-nitro-quinoline in powder form yellow whose mass spectrum is as follows.
EI (70eV) m / z = 246 M + 'base peak m / z = 217 [M - NCH3j +. ' 4-chloro-2-methylamino-6-nitro-quinoline can be prepared as follows. 600 mg 2,4-dichloro-6-nitro-quinoline is dissolved in 10 mL of THF in the presence of 2.15 mL of a 2M solution of dimethylamine in THF. The reaction mixture is stirred at 90 ° C for 3 hours. After return to temperature ambient, the reaction medium is concentrated under reduced pressure. A fraction of the residue obtained is purified by HPLC on a Chromasil column (C18, 5 ~ .. ~ .M, 100x20mm) with a water-acetonitrile mixture containing 0.07% TFA (gradient 95/5 to 60/40 in volumes in 20 minutes at a flow rate of 20 mL / min) as eluent. We obtains 188 mg of (4-chloro-2-methylamino-6-nitro-quinoline in the form of a yellow powder whose spectrum mass is as follows.
EI (70eV) m / z = 237 M + 'base peak, isotopic massif monochlorine woodpecker 1o m / z = 208 [M - NCH3j + 'isotopic mass of the peak monochlorinated 2,4-dichloro-6-nitro-quinoline may be prepared as described in the previous example.
o 4-dimethylamino-2-methyl-quinoline-7-amine (A6 / B6 / C6) can be prepared by operating from next way.
52 mg of N7-benzhydrylidene-4-dimethylamino-2-methyl-quinoline-7-amine in solution in 500 ~ L of THF, is added 25 ~, L of an aqueous acid solution 2o hydrochloric 2M. After 2 hours of agitation at room temperature, the reaction mixture is added with an aqueous solution of hydrochloric acid 0.5M and washed with an ethyl acetate-cyclohexane mixture (1/2 by volume). The aqueous phase is then brought to pH 8 by adding a 1M aqueous sodium hydroxide solution and then extracted with dichloromethane. The organic phase thus obtained is dried over magnesium sulphate concentrated under reduced pressure. 29 mg are thus obtained of 4-dimethylamino-2-methyl-quinoline-7-amine in the form 3o of a beige oil whose characteristics are following.
1 H NMR spectrum. (300 MH ~, (CD3) 2S0 d6, 8 in ppm). 2, ~ 5 (s. 3H); 2.91 (s. 6H); 5.53 (s. 2H);

6.45 (s. 1H); from 6.75 to 6.70 (mt. 2H); 7.70 (d, J = 9 Hz. 1H). .
Mass spectrum.
EI (70eV) m / z = 201 M + 'base peak m / z = 18 6 [M - CH3] +
m / z = 158 [M - NC2H5] +.
N7-benzhydrylidene-4-dimethylamino-2-methyl-quinoline-7-amine can be prepared in this way next . 100 mg of 7-chloro-4-dimethylamino-2-methyl-10 quinoline mixed with 5-chloro-4-dimethylamino-2-methyl quinoline in proportions 70/30 (in moles), dissolved in 2 mL of 1,2-dimethoxyethane is added to a mixture of 41.2 mg of tris (dibenzylideneacetone) dipalladium, 35.4 mg of 2-cyclohexylphosphino-2 '(N, N-dimethylamino) -biphenyl and 221.2 mg of cesium carbonate under argon. 90.6 ~ L of benzophenone imine is then added and the mixture reaction is heated at 100 ° C for 72 hours. After return to ambient temperature, the reaction medium is hydrolyzed by adding water and the aqueous phase as well obtained is extracted with dichloromethane. The sentence organic is then dried over magnesium sulfate, then concentrated under reduced pressure. After chromatography on a silica column with a dichloroethane mixture methanol (gradient 100/0 to 94/6 by volume) as eluent, 52 mg of N7-benzhydrylidene-4-dimethylamino-2- are obtained methyl-quinoline-7-amine as a beige solid whose mass spectrum is as follows.
EI (70eV) m / z = 365 M + ' 3o m / z = 364 [M - H] + base peak m / z = 288 [M - C6Hy] +
7-chloro-4-dimethylamino-2-methyl-quinoline can be prepared as follows. 500 mg of 4,7-dichloro-2-methyl-quinoline mixed with 4,5-dichloro-2-methyl-quinoline in the proportions 70/30 (in mole), is dissolved in 12 ml of DMF in presence of 1.63 g of potassium carbonate and 1.96 g dimethylammonium hydrochloride. The mixture The reaction is stirred at 100 ° C for 3 hours. .After return to room temperature, the insoluble material is eliminated by filtration and the filtrate is concentrated under pressure scaled down. The residue is hydrolyzed by adding water and the 1o aqueous phase thus obtained is extracted with dicholorométhane. The organic phase is then dried on magnesium sulphate then concentrated under pressure scaled down. This gives 623 mg of 7-chloro-4-dimethylamino-2-methyl-quinoline mixed with 5-chloro-4-dimethylamino-2-methyl-quinoline in 70/30 proportions in the form of an orange oil, the mass spectrum is as follows.
EI (70eV) m / z = 220 M ~ 'base peak, isotopic massif monochlorine woodpecker 2o m / z = 184, [M - HC1] + ' m / ~ = 169 [18 4 - CH3] ~
4,7-dichloro-2-methyl-quinoline may be prepared as follows. A solution of 500 mg of 7-chloro-2-methyl-quinolin-4-ol, mixed with 5-chloro-2-methyl-quinolin-4-ol in proportions 70/30 (in moles), in 7.6 mL of POC13 is brought to reflux for 3 hours. After return to temperature ambient, the reaction mixture is concentrated under reduced pressure and then taken up with water. The pH of the 3o aqueous phase is brought to 8 by adding a solution saturated aqueous with sodium hydrogencarbonate and the precipitate thus obtained is recovered by filtration, washed with water and then dried under reduced pressure. We thus obtains 539 mg of 4,7-dichloro-2-methyl-quinoline mixed with 4,5-dichloro-2-methyl-quinoline in the proportions 70/30 (in moles) in the form of a solid purple whose mass spectrum is as follows.
EI (70eV) m / z = 211 M + 'base peak, massive dichlorinated peak isotope m / z = 176 [M - Cl] + isotopic mass dw peak monochlorinated m / z = 140 [176 - Cl] +
7-chloro-2-methyl-quinolin-4-ol can be prepared 1o as described in patents EP 97585 and EP 56765.
o 6-methylamino-phenanthridin-2-amine (C14) can be prepared by operating in the manner next . .
210 mg of 6-dimethylamino-2-nitro-phenanthridine in solution in 5 mL of a methanol-dichloromethane mixture (3/1 by volume) is placed under a hydrogen atmosphere (5 bars) in the presence of 20 mg of palladium on carbon at 10% for 12 hours. After filtration on celite, the filtrate is concentrated under reduced pressure. We obtain thus 186 mg of 6-dimethylamino-phenanthridin-2-amine in the form of a yellow foam whose characteristics are the following .
1 H NMR spectrum (300 MHz, (CD3) 2S0 d6, 8 in ppm). 3.07 (s. 6H); from 5.50 to 6.50 (very spread mf.
2H); 7.05 (dd, J = 9 and 2.5 Hz. 1H); 7.64 (d, J = 9 Hz. 1H); 7.65 (d, J = 2.5 Hz. 1H); 7, 71 (large t, J =
8 Hz. 1H); 7.87 (broad t, J - 8 Hz. 1H); 8.25 (d wide, J = 8 Hz. 1H); 8.47 (large d, J = 8 Hz. 1H).
Mass spectrum.
EI (70eV) m / z = 237 M + 'base peak m / z = 222 [M - CH3] +
m / z = 208 [222 - CH2] +
m / z = 194 [M - NC2H5] +

Za 6-dimethylamino-2-vitro-phenanthridine can be prepared as follows. 211 mg 6-chloro-2-nitro-phenanthridine is dissolved in 4 mZ of DMF in the presence of 600 mg of potassium carbonate and 711 mg of dimethylammonium hydrochloride. Ze mixture The reaction is stirred at 100 ° C for 3 hours. After back to room temperature, it is hydrolyzed by adding of water and the aqueous phase thus obtained is extracted with dichloromethane. The organic phase is dried over magnesium sulfate then concentrated under pressure scaled down. 211 mg of 6-dimethylamino-2- are thus obtained nitro-phenanthridine in the form of a yellow powder of which the mass spectrum is as follows.
EI (70eV) m / z = 267 M + ' m / z = 266 [M-- H] + base peak m / z = 252 [M - CH3] +
m / z = 220 [266 - N02] +
m / z = 177 [220 - NC2H5] +
Za 6-chloro-2-vitro-phenanthridine may be 2o prepared as follows. A solution of 200 mg of 2-vitro-6 (5H) -phenanthridinone in 2 mZ of POC13 est brought to reflux for 3 hours. After returning to room temperature, the reaction mixture is added with cyclohexane until a precipitate which is recovered by filtration and then taken up with water. The pH of the aqueous phase thus obtained is brought to 8 by adding an aqueous solution of ammonia at 28 ~ and the resulting precipitate is recovered by filtration, washed with water and then dried 3o under reduced pressure. 215 mg are thus obtained. of 6-chloro-2-vitro-phenanthridine in powder form white whose mass spectrum is as follows.
EI (70eV) m / z = 258 M + 'base peak, massive isotopic peak monochlorine m / z = 228 [M NO] + isotopic mass of - peak monochloroacetic m / z = 212 [M N02] + isotopic mass of - peak monochloroacetic m / z = 200 [M CN02] + isotopic mass of - peak monochloroacetic m / z = 177 [212 - C1] +.

o Za ~ 1-dimethylamino-isoquinoline-7-amine (C15) can be prepared by operating in the manner next .
390 mg of 1-dimethylamino-7-nitro-isoquinoline in mixture with 1-dimethylamino-5-nitro-isoquinoline in proportions 40/60 (in moles) in solution in 8 mZ of a methanol-dichloromethane mixture (3/1 in volumes) is placed under a hydrogen atmosphere (5 bars) in the presence of 40 mg of palladium on carbon at 10 for 12 hours. After filtration on celite, the filtrate is concentrated under reduced pressure. After chromatography on a silica column with a mixture cyclohexane-isopropanol (gradient 100/0 to 90/10 in volumes) as eluant, 50 mg of 1-dimethylamino-isoquinoline-7-amine in the form of a brown powder whose characteristics are following.
1 H NMR spectrum (300 MHz, (CD3) 2S0 d6, b en ppm). 2.91 (s. 6H); 5.57 (br s. 2H); from 7.05 to 7.20 (mt. 3H); 7.56 (d, J = 9 Hz. 1H); 7.74 (d, J = 6 Hz. 1H).
Mass spectrum.
EI (70eV) 'm / z = 187 M +' m / z = 186 [M - H] +
m / z = 172 [M - CH3] +
m / z = 158 [172 - CH2] + base peak m / z = 14 4 [M - C2H5N] +

m / z = 116 [144 - CH2N] +
1-dimethylamino-7-vitro-isoquinoline may be prepared as follows. 375 mg of 1-chloro-7-nitro-isoquinoline mixed with 1-chloro-5-nitro-isoquinoline in proportions 40/60 (in moles) is dissolved in 6 mL of DMF in the presence of 1.24 g of potassium carbonate and 1.46 g of hydrochloride dimethyl. The reaction mixture is stirred at 100 ° C for 3 hours. After return to temperature 1o ambient, it is hydrolyzed by adding water and the phase thus obtained is extracted with dichloromethane. The organic phase is dried over magnesium sulfate then concentrated under pressure scaled down. 390 mg of 1-dimethylamino-7- are thus obtained vitro-isquinoline mixed with 1-dimethylamino-5-nitro-isoquinoline in proportions 40/60 (in moles) in the form of a red powder whose mass spectrum is the next .
EI (70eV) m / z = 217 M + ' m / z = 216 [MH] + base peak -m / z = 202 [M CH3] +
-m / z = 188 [202 - CH2] +

m / z = 170 [216 - N0 ~] +

m / z = 156 [170 - CH2] +

1-chloro-7-vitro-isoquinoline can be prepared as follows . A solution of 580 mg of 7-nitro-isoquinolin-1-ol, mixed with 5-vitro-isoquinolin-1-0l in proportions 40/60 (in mole), in 6 mL of POC13 is brought to reflux for 3 hours. After return 3o at room temperature, the reaction mixture is added with cyclohexane until a precipitate which is recovered by filtration and then taken up with water. The pH of the aqueous phase thus obtained is brought to 8. by adding an aqueous solution of ammonia at 28 ô and the resulting precipitate is recovered by filtration, washed with water and then dried under reduced pressure. This gives 412 mg of 1-chloro-7-vitro-isoquinoline mixed with 1-chloro-5-vitro-isoquinoline in proportions 40/60 (in mole) in the form of a white powder whose spectrum mass is as follows.
EI (70eV) m / z = 208 M + 'base peak m / z = 178 [M NO] + ' -1o m / z = 173 [M Cl] +
-m / z = 162 [M N02] +.
-m / z = 150 [178 -CO] + ' m / z = 12 6 [- HN02] +.

m / z = 99 [126 - HCN] +

7-vitro-isoquinolin-1-ol can be prepared from next way. 500 mg of 1-isoquinolinol are placed in solution in 5 mL of concentrated sulfuric acid at 0 ° C.
348 mg of potassium nitrate is then added and the reaction mixture is stirred at 0 ° C for 1 hour then overnight at room temperature. He is then thrown into a water-ice mixture and the pH of the aqueous solution thus obtained is brought to pH 8 by adding a solution aqueous ammonia at 28 â. ~ The precipitate obtained is recovered by filtration, washed with water and then dried under reduced pressure. We then obtain 580 mg of 7-vitro-isoquinolin-1-ol mixed with 5-nitro-isoquinolin-1-ol in proportions 40/60 (in moles) under form of a yellow powder whose mass spectrum is the next DCI (NH3) m / z = 208 MNH4 +
m / z = 191 MH +
m / z = 161 [M - NO] +
m / z = 146 M'H + corresponds to the start o 4-dimethylamino-2-methyl-quinoline-6-N-methylamine (C16) can be prepared by operating as follows .
170 mg 4-dimethylamino-2-methyl-quinoline-6-N-methyl acetamide is brought to reflux in 3 mL of a mixture of a hydrochloric acid solution concentrated at 37 ~ w / w-water (2/1 by volume) for 2 hours. After return to room temperature, the pH is brought to 8 by addition of an aqueous ammonia solution at 28 ~ and the 1o aqueous phase is extracted with dichloromethane. The organic phase is dried over magnesium sulfate and then concentrated under reduced pressure. 120 mg are thus obtained.
of 4-dimethylamino-2-methyl-quinoline-6-N-methylamine in the form of a yellow oil whose characteristics are the following .
1 H NMR spectrum (300 MHz, (CD3) 2S0 d6, $ in ppm). 2.48 (s. 3H); 2.79 (d, J - 5 Hz. 3H); 2.89 (s. 6H); 6.00 (q, J - 5 Hz. 1H); 6.71 (mt. 2H);
7.06 (dd, J - 9 and 2.5 Hz. 1H); 7.57 (d, J = 9 Hz 1H).
Mass spectrum.
EI (70eV) m / z = 215 M + 'base peak m / z = 200 [M - CH3j +
m / z = 18 5 [M - NHCH3 j +.
DCI (NH3) m / z = 216 MH +
4-dimethylamino-2-methyl-quinoline-6-N-methyl-acetamide can be prepared as follows. at 250 mg of 4-dimethylamino-2-methyl-quinoline-6-acetamide dissolved in 2 mL DMF at 0 ° C, are added 45 mg of sodium hydride at 60 ~ in oil. After 20 minutes of agitation at room temperature, the medium reaction is again cooled to 0 ° C and 77 ~ .L
methyl iodide are added. After 2 hours stirring at room temperature, water is added and the aqueous phase is extracted with dichloromethane. The organic phase is dried over sulphate. magnesium and concentrated under reduced pressure.
After chromatography on a silica column with a chloromethane-methanol mixture (gradient 100/0 to 90/10 by volume) as eluent, 170 mg of 4-dimethylamino-2-methyl-quinolin-6-N-methylacetamide in the form of a yellow oil whose mass spectrum is the following .
EI (70eV) m / z = 357 M + 'base peak m / z = 215 [M - COCH3] +
m / z = 18 5 [M - CH3CONCH3 j +.
DC I (NH3) m / z = 316 MH +
4-methylethyl-2-methyl-quinoline-6-acetamide can be prepared as follows. at 300 mg of 4-dimethylamino-2-methyl-quinoline-6-amine in solution in 3 mL of dichloromethane are added 415 ~, L of triethylamine, 211 ~ .L of acetic anhydrides and 9 mg of DMAP. The reaction mixture is brought to reflux for 2 hours. After returning to room temperature, water is added and the aqueous phase is extracted with dichloromethane. The organic phase is dried over magnesium sulfate then concentrated under pressure scaled down. 263 mg of 4-methylethyl-2- is thus obtained.
methyl-quinoline-6-acetamide in the form of a foam beige with the following mass spectrum.
EI (70eV) m / z = 243 M + 'base peak m / z = 2 01 [M - COCH2) +.
m / z = 43 [COCH3j +
4-methylethyl-2-methyl-quinoline-6-amine can be prepared as described in patent WO 0140218.

o 4-dimethylamino-2-phenyl-quinoline-6-amine (C17) can be prepared by operating from next way.
360 mg of 4-dimethylamino-2-phenyl-quinoline-6-acetamide is brought to reflux in 6 mL of a mixture concentrated hydrochloric acid-water (2/1 by volume) during 2 hours. After returning to room temperature, the pH is brought to 8 by adding an aqueous solution of ammonia at 28 ~ and the aqueous phase is extracted with 1o of dichloromethane. The organic phase is dried over magnesium sulfate then concentrated under pressure scaled down. 310 mg of 4-dimethylamino-2- are thus obtained.
phenyl-quinoline-6-amine as a brown oil the characteristics of which are as follows.
1 H NMR spectrum (300 MHz, (CD3) ~ SO d6, 8 in ppm). 2.96 (s. 6H); 5.57 (br s. 2H); 7.05 (d, J =
2.5 Hz. 1H); 7.10 (dd, J - 9 and 2.5 Hz. 1H); 7.28 (s. 1H); 7.42 (tt, J = 7.5 and 1.5 Hz. 1H): 7.50 (t, J = 7.5 Hz. 2H); 7.72 (d, J - 9 Hz. 1H); 8.05 (d wide, J = 7.5 Hz. 2H).
Mass spectrum.
EI (70eV) m / z = 263 M + '~ base peak m / z = 248 [M - CH3] +
m / z = 219 [M - N (CH3) 2] + ' DCI (NH3) m / z = 264 MH +
4-methylamino-2-phenyl-quinoline-6-acetamide can be prepared as follows. 400 mg. Of 4-chloro-2-phenyl-quinoline-6-acetamide is set solution in 15 mL of DMF in the presence of 1.86 g of 3o potassium carbonate and 1.10 g of hydrochloride dimethyl. The reaction mixture is stirred at 150 ° C for 6 hours. After return to temperature ambient, it is hydrolyzed by adding water and the phase thus obtained is extracted with dichloromethane. The organic phase is dried over magnesium sulphate can concentrated under pression scaled down. 360 mg of 4-dimethylamino-2 is thus obtained phenyl-quinoline-6-acetamide in the form of an oil brown with the following mass spectrum.
EI (70eV) m / z = 305 M +, base peak m / z = 262 [M - COCH3] +.
m / z = 2 4 6 [2 62 - CH2] +
m / z = 43 [COCH3] +
1o 4-chloro-2-phenyl-quinoline-6-acetamide can be prepared as follows. A solution of 380 mg of 4-hydroxy-2-phenyl-quinoline-6-acetamide in 2 mL of POC13 is brought to reflux for 3 hours. After return at room temperature, the reaction mixture is added with cyclohexane until a precipitate which is recovered by filtration and then taken up with water. The pH of the aqueous phase thus obtained is brought to 8 by adding an aqueous solution of ammonia at 28 ~ and the resulting precipitate is recovered by filtration, washed with water and then dried under reduced pressure. 400 mg of 4-chloro-2-phenyl-quinoline-6-acetamide in the form of a yellow powder with the following mass spectrum.
EI (70eV) m / z = 296 M + ' m / z = 254 [M - COCH2] + 'base peak m / z = 219 [254 - Cl] +
m / z = 43 [COCH3] +
4-hydroxy-2-phenyl-quinoline-6-acetamide can be prepared as follows. 1 g of 3- (4-acetylamino-phenylamino) -3-ethyl phenyl-acrylate is thrown into 20 mL of dowtherm A at reflux. After 45 minutes, it returns to room temperature and the cyclohexane is added to the reaction medium up to formation of a precipitate which is recovered by filtration, washed with cyclohexane then dried under pressure scaled down. 688 mg of 4-hydroxy-2-phenyl are thus obtained quin.olein-6-acetamide in the form of an ocher powder of which the mass spectrum is as follows.
EI (70eV) m / z = 278 M + ' m / z = 236 [M - COCH3] +.
m / z = 43 [COCH3] + base peak 3- (4-acetylamino-phenylamino) -3-phenyl-acrylate 1o of ethyl can be prepared as follows. at 500 mg of 4-aminoacetanilide in 2 mL of absolute ethanol are added 634 mL of ethyl benzoylacetate, 6 drops of acetic acid and 1.13 g. of drierite. The reaction mixture is brought to reflux for 48 hours. After returning to room temperature, the insoluble material is removed by filtration and the filtrate is concentrated under reduced pressure. 1.03 g is thus obtained 3- (4-acetylamino-phenylamino) -3-phenyl-acrylate ethyl in the form of a yellow powder whose spectrum of mass is as follows.
EI (70eV) m / z = 263 M + 'base peak m / z = 2 4 8 [M - CH3] +
m / z = 219 [M - N (CH3) ~] +.
DCI (NH3) m / z = 264 MH +
o 4-dimethylamino-2-isopropyl-quinoline-6-amine (C18) can be prepared by operating on next way.
315 mg 4-dimethylamino-2-isopropyl-6-vitro-quinoline mixed with 4-dimethylamino-2-isopropyl-8-nitro-quinoline in proportions 8.5 / 1.5 in solution in 4 mL of a methanol-dichloromethane mixture (2/1 in volumes). is placed under a hydrogen atmosphere (5 bars) in the presence of 20 mg of palladium on carbon at 10 ô

for 12 hours. After filtration on celite, the filtrate is concentrated under reduced pressure. After chromatography on a silica column with a mixture dichloromethane-methanol (gradient 95/5 to 85/15 in volumes) as eluent, 142 mg of 4-dimethylamino-2-isopropyl-quinoline-6-amine in the form a brown wax whose characteristics are following.
1 H NMR spectrum (300 MHz, (CD3) 2S0 d6, 8 in ppm). 1, 29 (d, J - 7 Hz. 6H) ~ 2.88 (s. 6H) ~ 3, 02 (mt. 1H); 5.38 (br s. 2H); 6.68 (s. 1H); from 6, 95 at 7.10 (mt. 2H); 7.58 (d, J = 9 Hz. 1H).
Mass spectrum.
EI (70eV) m / z = 229 M + 'base peak m / z = 214 [M - CH3] ~
m / z = 201 [214 - CH] + ' DC I (NH3) 'm / z = 2 3 0 MH +
4-dimethylamino-2-isopropyl-6-vitro-quinoline can be prepared as follows. 450 mg of 4-chloro-2-isopropyl-6-vitro-quinoline mixed with 4-chloro-2-isopropyl-8-vitro-quinoline in 8.5 / 1.5 proportions is dissolved in 12 mL of DMF in the presence of 1.2 g of potassium carbonate and 1.47 g of dimethylammonium hydrochloride. The mixture The reaction is stirred at 100 ° C for 3 hours. After return to room temperature, i1 is hydrolyzed by addition of water and the aqueous phase thus obtained is extracted with dichloromethane. The organic phase is dried over magnesium sulfate then concentrated under pressure 3o reduced. This gives 317 mg of 4-dimethylamino-2-isopropyl-6-vitro-quinoline mixed with 4-dimethylamino-2-isopropyl-8-vitro-quinoline in 8.5 / 1.5 proportions (in moles) in the form of a wax brown with the following mass spectrum.

EI (70eV) m / z = 259 M + ' m / z = 244 [M - CH3] + base peak m / z = 231 [244 - CH] + ' m / z = 212 [M - HN02] +
m / z = 198 [244 -N02] +
4-chloro-2-isopropyl-6-vitro-quinoline may be prepared as follows. A solution of 475 mg of 2-isopropyl-6-vitro-quinolin-4-ol, mixed with 2-isopropyl-8-vitro-quinolin-4-ol in proportions 8.5 / 1.5 (in moles), in 4 mL of POC13 is brought to reflux for 3 hours. After return to temperature ambient, the reaction mixture is added with water and of cyclohexane and the pH of the aqueous phase is brought to 8 par.addition of an aqueous solution of ammonia at 28 ô.
A precipitate is formed which is recovered by filtration and the aqueous phase is extracted with dichloromethane. The the combined organic phases are dried over magnesium then concentrated under reduced pressure solids thus obtained are combined and dried under pressure scaled down. 450 mg of 4-chloro-2-isopropyl- are then obtained 6-vitro-quinoline mixed with 4-chloro-2-isopropyl-8-vitro-quinoline in proportions 8.5 / 1.5 (in mole) in the form of a solid burgundy whose spectrum mass is as follows.
EI (70eV) m / z = 250 M + ' m / z = 235 [M 0] + base peak -m / z = 222 [235 - CH] + ' m / z = 203 [M HNO ~] +
. -m / z = 189 [203 - CH3] +

DCI (NH3) m / z = 251 MH +

2-isopropyl-6-vitro-quinolin-4-ol can be prepared as follows. 450 mg of 2-isopropyl-1H-quinolin-4-ove are placed in solution in 5 mL of acid concentrated sulfuric at 0 ° C. 243 mg nitrate potassium is then added and the reaction mixture is stirred at 0 ° C for 1 hour then overnight at ambient temperature. I1 is then thrown into a mixture water-ice and the pH of the aqueous solution thus obtained is brought to pH 8 by adding an aqueous solution 28% ammonia. A precipitate is formed which is recovered by filtration and dried under reduced pressure.
510 mg of 2-isopropyl-6-vitro-quinolin- are then obtained l0 4-0l mixed with 2-isopropyl-8-vitro-quinolin-4-ol in proportions 8.5 / 1.5 (in moles) in the form of a yellow powder with the following mass spectrum.
EI (70eV) m / z = 232 M + 'base peak m / z = 217 [M - CH3] +
m / z = 204 [M - CO] + ' m / z = 18 6 [M - N02] + _ m / z = 171 [186 - CH3] +
2-isopropyl-1H-quinolin-4-ove can be prepared as follows . 4,098 of 2-isopropyl-4-triisoprbpylsilanyloxy-2H-quinoline-1-carboxylate benzyl in solution in 115 mZ of methanol is placed under a hydrogen atmosphere (5 bars) in the presence of 400 mg of palladium on carbon at 10 ~ for 12 hours.
After filtration on celite, the filtrate is concentrated under reduced pressure. After column chromatography silica with a dichloromethane-methanol mixture (gradient 100/0 to 95/5 by volume) as eluent, we obtains 750 mg of 2-isopropyl-1H-quinolin-4-ove under form of a white powder whose mass spectrum is 3o the following.
EI (70eV) m / z = 187 M + ' m / z = 172 [M - CH3] + base peak m / z = 159 [M - CO] + ' m / z = 14 4 [M - C3H ~] + ' 2-isopropyl-4-triisopropylsilanyloxy-2H-benzyl quinoline-1-carboxylate can be prepared from the following way. a mixture of 750 mg of 4-oxo-4H-benzyl quinoline-1-carboxylate and 1.5 mL of triisopropylsilyltrifluoromethanesulfonate is agitated slowly for 1 hour under argon. 15.5 mL of dichloromethane are then added together with 0.65 mL
of 2,6-lutidine. The reaction mixture is then cooled to 0 ° C and 2.8 mL of a 2M chloride solution 10 isopropylmagnesium in THF are added dropwise drop by drop. The reaction mixture is stirred for 1 hour at room temperature then hydrolyzed by addition of a water-ice mixture. The aqueous phase thus obtained is extracted with dichloromethane and the phase organic is dried over magnesium sulfate and then concentrated under reduced pressure. After chromatography on silica column. with dichloromethane as eluent, 596 mg of 2-isopropyl-4- is obtained triisopropylsilanyloxy-2H-quinoline-1-carboxylate benzyl in the form of a colorless oil whose spectrum mass is as follows.
EI (70eV) m / z = 479 M + 'base peak m / z = 436 [M - C3H ~] +
m / z = 392 [436 - C3H $] +
Benzyl 4-oxo-4H-quinoline-1-carboxylate can be prepared as follows. at 500 mg of 4-hydroxyquinoline in 3 mL of tert-butanol at 30 ° C are added 179 mg of sodium hydride at 60 ~ in the oil then the reaction mixture is heated to 50 ° C.
until the end of gas evolution. We then return to room temperature and we add 673 ~ .L of benzyl chloroformate drop by drop then stirred during 3 hours. The reaction medium is then hydrolyzed with 10 mL of water and the pH is brought to 4 by addition of a 0.5 M aqueous solution of hydrochloric acid.
The aqueous phase thus obtained is extracted with dichloromethane, dried over magnesium sulfate and then concentrated under reduced pressure. After chromatography on a silica column with a dichloromethane mixture methanol (gradient 100/0 to 97/3 by volume) as eluent, 890 mg of 4-oxo-4H-quinoline-1-carboxylate are obtained benzyl in the form of a white viscous oil, the mass spectrum is as follows.
EI (70eV) m / z = 279 M + ' m / z = 91 [C ~ H ~] + '~ base peak DCI (NH3) m / z = 280 MH +
o Za 2,7-dimethyl-4-dimethylamino-quinoline-6 amine (C19) can be prepared by operating on next way.
472 mg 2,7-dimethyl-4-dimethylamino-6-nitro-quinoline-6-amine mixed with 2,7-dimethyl-4-dimethylamino-8-nitro-quinoline-6-amine in proportions 35/65 (in moles) dissolved in 8 mZ of a dichloromethane-methanol mixture (1/3 by volume) is placed under a hydrogen atmosphere (5-bars) in the presence 45 mg of palladium on carbon at 10 ~ for 12 hours. After filtration on this, the filtrate is concentrated under reduced pressure. After chromatography on a silica column with a dichloromethane mixture methanol (gradient 100/0 to 75/25 by volume) as eluent, 168 mg of 2,7-dimethyl-4- are obtained dimethylamino-quinoline-6-amine in powder form caramel with the following characteristics.
1 H NMR spectrum (300 MHz, (CD3) 2S0 d6, ~ en ppm). 2.29 (s. 3H); 2.57 (s. 3H); 3.24 (s. 6H) 5.59 (mf. 2H); 6.70 (s. 1H); 7.33 (br s. 1H);
7.50 (width 1h wide).

Mass spectrum.
EI (70eV) m / z = 215 M + ' base peak m / z = 200 [M - CH3] +
m / z = 184 [200 - NH2] +
m / z = 172 [M - CZHSN] +
Za 2,7-dimethyl-4-dimethylamino-6-vitro-quinoline-6-amine can be prepared as follows. 500 mg of 4-chloro-2,7-dimethyl-6-nitroquinoline mixed with 4-chloro-2,7-dimethyl-8-vitro-quinoline in proportions 35/65 (in moles) is dissolved in 8 mL
DMF in the presence of 1.46 g of potassium carbonate and 1.72 g of dimethylammonium hydrochloride. The mixture The reaction is stirred at 100 ° C for 3 hours. After return to room temperature, i1 is hydrolyzed by addition s5 of water and the aqueous phase thus obtained is extracted with dichloromethane. The organic phase is dried over magnesium sulfate then concentrated under pressure scaled down. This gives 476 mg of (2,7-dimethyl-4-dimethylamino-6-vitro-quinoline-6-amine mixed with 2,7-dimethyl-4-dimethylamino-8-vitro-quinoline-6-amine in proportions 35/65 (in moles) in the form of a caramel solid with the following mass spectrum.
EI (70eV) m / z = 245 M + 'base peak m / z = 228 [M - OH] +
. m / z = 215 [M - NO] + ' m / z = 199 [M - NO2] +.
m / z = 18 3 [M - HN02-CH3] +.
4-chloro-2,7-dimethyl-6-vitro-quinoline can be prepared as follows. A solution of 660 mg 2,7-dimethyl-6-vitro-quinolin-4-ol, mixed with 2,7-dimethyl-8-vitro-quinolin-4-ol in proportions 35/65 (in moles), in 5 mL of POC13 is brought to reflux for 3 hours. After returning to room temperature, the reaction mixture is added with cyclohexane until a precipitate which is recovered by filtration and then taken up with water. The pH of the aqueous phase thus obtained is brought to 8 by adding an aqueous solution of ammonia at 28 ~ and the resulting precipitate is recovered by filtration, washed with water and then dried under reduced pressure. 516 mg of 4-chloro-2,7-dimethyl-6-nitroquinoline mixed with 4-chloro-2,7-dimethyl-8-nitro-quinoline in 1o proportions 35/65 (in mole) in the form of a powder brown with the following mass spectrum.
EI (70eV) m / z = 236 M ~ "'base peak m / z = 219 [M - OH] +
m / z = 206 [M - NO] + ' m / z = 19 0 [M - N02] +.
m / z = 155 [M - N02-C1] +
2,7-dimethyl-6-nitro-quinolin-4-ol can be prepared as follows. 625 mg 2,7-dimethyl-quinolin-4-ol are placed in solution in 6 mL of acid 2o concentrated sulfuric at 0 ° C. 365 mg nitrate potassium is then added and the reaction mixture is stirred at 0 ° C for 1 hour then overnight at ambient temperature. It is then thrown into a mixture water-ice and the pH of the aqueous solution thus obtained is brought to pH 7 by adding an aqueous solution of ammonia at 28 ô. The precipitate obtained is recovered by filtration, washed with water and then dried under pressure scaled down. 787 mg of 2,7-dimethyl-6-nitro- are then obtained.
quinolin-4-ol mixed with 2,7-dimethyl-8-nitro-quinolin-4-ol in proportions 35/65 (in moles) under the form of a yellow powder whose spectrum of. mass is the following .
EI (70eV) m / z = 218 M + 'base peak m / z = 201 [M - OH] +

m / z = 172 [M - N02] + ' m / z = 144 [M - HN02-CO] + ' 2,7-dimethyl-quinolin-4-ol can be prepared from the following way. 3.54 g 3-m-tolylamino-but-2-enoate ethyl is thrown into 30 ml of dowtherm A at reflux.
After 45 minutes, it returns to room temperature and the reaction medium is added with cyclohexane up to formation of a precipitate which is recovered by filtration, washed with cyclohexane then dried under pressure 1o reduced. After chromatography on a silica column with a cycohexane-isopropanol mixture (gradient 95/5 to 60/40 by volume) as eluent, 416 mg of 2.7- is obtained dimethyl-quinolin-4-ol in the form of a white powder whose mass spectrum is as follows.
EI (70eV) m / z = 173 M + '~ base peak m / z = 144 [M - CHO] +
Ethyl 3-m-tolylamino-but-2-enoate can be prepared as follows. 2 mL of m-toluidine in 8 mL of absolute ethanol are added 2.59 mL
2o ethyl acetoacetate, 24 drops of acetic acid and 6.29 g of drierite. The reaction mixture is brought to reflux for 48 hours. After return to temperature ambient, the insoluble material is removed by filtration and the filtrate is concentrated under reduced pressure. We obtain thus 3.54 g of ethyl 3-m-tolylamino-but-2-enoate under colorless oil whose mass spectrum is next .
EI (70eV) m / z = 219 M + ' m / z = 174 [M - OEt] + base peak m / z = 146 [M - COOEt] +
m / z = 107 [C ~ H9N] + ' m / z = 91 [C ~ H ~] +

o 2-dimethylamino-1H-benzoimidazol-5-amine (C21) can be prepared by operating next way.
250 mg ~ 2-dimethylamino-5-nitro-1H-benzoimidazole dissolved in 3.2 mL of a dichloromethane-methanol (1/3 by volume) is placed under an atmosphere of hydrogen (1 bar) in the presence of 25 mg of palladium on charcoal at 10 ~ for 12 hours. After filtration on celite, the filtrate is concentrated under reduced pressure.
1o After chromatography on a silica column with a dichloromethane-methanol / 2M ammonia mixture (gradient 100/0 to 90/10 by volume) as eluent, 66 mg is obtained 2-dimethylamino-1H-benzoimidazol-5-amine in the form of a brown oil whose characteristics are following.
NMR spectrum, 1H (300 MHz, (CD3) 2S0 d6.8 in ppm).
We observe the 50/50 mixture of position isomers NH in 1 and NH in 3.
2.97 and 2.98 (2 sec. 6 hrs in total) ~ 4.40 and 4.50 (2 2o mfs. 2 hours in total); 6.70 and 6.77 (2 d wide, J = 9 Hz. 1 hour in total); 6, 65 and 6, 66 (2 s. 1H in all); 6, 81 and 6, 88 (2 d wide, J - 9 Hz. 1H in all); 10.68 and 10.80 (2 mfs. 1 hour in total).
Mass spectrum.
EI (70eV) m / z = 176 M + 'base peak m / z = 161 [M - CH3] +.
m / z = 14 7 [161 - CH2] + ' m / z = 133 [M - C2H5N] + ' 2-Dimethylamino-5-vitro-1H-benzoimidazole can 3o be prepared as follows. 500 mg of 2-chloro-5-vitro-1H-benzoimidazole in solution in 4 mL of DMF in presence of 825 mg of dimethylmmonium hydrochloride and 395 mg of p-toluenesulfonic acid is heated to 100 ° C for 20 hours. After return to temperature ambient, water is added and the aqueous phase is extracted with dichloromethane. The organic phase is washed with a 1N aqueous sodium hydroxide solution, dried over magnesium sulfate and concentrated under pressure scaled down. 239 mg of 2-dimethylamino-5- is thus obtained nitro-1H-benzoimidazole as a brown solid whose mass spectrum is as follows.
EI (70eV) m / z = 206 M + 'base peak m / z = 191 [M - CH3] +.
1 om / z = 17 7 [191 - CH2] + ' DCI (NH3) m / z = 2 0 7 MH +
m / z = 177 [MH - NO] + base peak 2-chloro-5-vitro-1H-benzoimidazole can be prepared as described in the literature (Jung, F.;
Delvare, C.; Boucherot, D.; Hamon, AJ Med. Chem.
1991, 34 (3), 1110-1116 o 2-dimethylamino-3-methyl-3H-benzoimidazol-5-amine (C22) can be prepared by operating on next way.
314 mg of 2-dimethylamino-5-vitro-1H-benzoimidazole is added to a solution of 122 mg hydride 60% sodium in oil in 6 mL DMF. After addition of 110 ~ L of iodomethane, the reaction mixture is stirred at room temperature for 3 hours then added with a saturated aqueous chloride solution ammonium. The aqueous phase is extracted with dichloromethane. The organic phase is dried over magnesium sulfate and concentrated under reduced pressure.
The residue in solution in 12 mL of a mixture dichloromethane-methanol (1/3 by volume) is placed under hydrogen atmosphere (1 bar) in the presence of 32 mg of palladium on carbon at 10 ~ for 12 hours. After Celite filtration, the filtrate is concentrated under reduced pressure. After chromatography on a column of silica with a dichloromethane-methanol / ammonia mixture 2M (gradient 100/0 to 90/10 by volume) as eluent, we obtains 46 mg of 2-dimethylamino-3-methyl-3H-benzoimidazol-5-amine in the form of a brown oil of which the characteristics are as follows.
1 H NMR spectrum (300 MHz, (CD3) 2S0 d6, 8 in ppm). 2.81 (s. 6H); 3.48 (s. 3H) ~ 4.75 (mf. 2H);
6.40 (dd, J = 9 and 2.5 Hz. 1H); 6.46 (d, J = 2.5 Hz 1o 1H); 7.05 (d, J = 9 Hz. 1H).
Mass spectrum.
EI (70eV) m / z = 190 M + 'base peak m / z = 175 [M - CH3] +.
m / z = 161 [175 - CH2] + ' m / z = 147 [M - C2HSN] + ' Ze 2-dimethylamino-5-nitro-1H-benzoimidazole can be prepared as described in the previous example.
o Za 1-dimethylamino-3-methyl-isoquinoline-7 amine (C24) can be prepared by operating on 2o as follows.
190 mg of 1-dimethylamino-3-methyl-7-nitro-isoquinoline in solution in 12 mh of a mixture dichloromethane-methanol (1/3 by volume) are placed under a hydrogen atmosphere (5 bars) in the presence of 18 mg of palladium on carbon at 10 ~ for 12 hours. After Celite filtration, the filtrate is concentrated under reduced pressure. After chromatography on a column of silica with a dichloromethane-methanol / ammonia mixture 2M (gradient 100/0 to 90/10 by volume) as eluent, we obtains 42 mg of 1-dimethylamino-3-methyl-isoquinoline-7-amine in the form of an orange paste, the features are as follows.

1 H NMR spectrum (300 MHz, (CD3) 2S0 d6, & en ppm). 2.37 (s. 3H); 2.90 (s. 6H); 5.42 (s broad.
2H); 6.92 (s. 1H); 7.03 (dd, J = 9 and 2.5 Hz. 1H);
7.09 (d, J = 2.5 Hz. 1H); 7.45 (d, J = 9 Hz. 1H).
Mass spectrum. .
EI (70eV) m / z = 201 M + 'base peak m / z = 18 6 [M - CH3] +.
m / z = 172 [186 - CH2] + ' m / z = 158 [M - C2H5N] + ' l0 DCI (NH3) m / z = 202 MH +
1-dimethylamino-3-methyl-7-nitro-isoquinoline can be prepared as follows. 810 mg of 2- (1-acetyl-2-oxo-propyl) -5-vitro-benzonitrile is heated to 40 ° C for 16 hours in 10 mL of an aqueous solution of dimethylamine at 40 ~. After return to temperature ambient, 30 mL of an aqueous acid solution 2.5N hydrochloric acid are added, then the aqueous phase is washed with ethyl acetate. The aqueous phase is brought back to pH 9 by adding an aqueous solution of 2o 5N sodium hydroxide and the resulting precipitate is recovered by filtration and dried under reduced pressure. We obtain thus 190 mg of 1-dimethylamino-3-methyl-7-nitro-isoquinoline in the form of an orange powder, the mass spectrum is as follows.
EI (70eV) m / z = 231 M + 'base peak m / z = 216 [M - CH3] + ' m / z = 202 [216 - CH2] +.
DCI (NH3) m / z = 232 MH + base peak m / z = 202 [M - NO] H +
3o 2- (1-acetyl-2-oxo-propyl) -5-vitro-benzonitrile can be prepared as described in the literature (Shinkai, H; Ito, T.; Iida, T.; Kitao, Y.; Yamada, H.; Uchida, IJMed.Chem. 2000, 43 (24), 4667-4677).

o 9-dimethylamino-acridin-2-amine (C26) can be prepared by operating in the manner next .
385 mg of 9-phenoxy-acridin-2-amine are heated to 120 ° C for 15 hours in 12 mL of a 2M solution of dimethylamine in THF. After return to temperature ambient and concentration under reduced pressure, dichloromethane is added and the organic phase is washed with a 1N aqueous sodium hydroxide solution and then dried 1o on magnesium sulfate and concentrated under pressure scaled down. After chromatography on a silica column with a dichloromethane-methanol mixture (gradient 100/0 to 95/5 by volume) as eluent, 47 mg of 9-dimethylamino-acridin-2-amine in the form of a lacquer yellow with the following characteristics.
1 H NMR spectrum (300 MHz, (CD3) 2S0 d6, 8 in ppm). 3.22 (s. 6H); 5.77 (br s. 2H); 7, 15 (d, J =
2.5 Hz. 1H); 7.31 (dd, J = 9 and 2.5 Hz. 1H); 7, 45 (t wide, J = 8 Hz. 1H); 7.59 (wide t, J = 8 Hz. 1H);
7.86 (d, J = 9 Hz. 1H); 7.88 (broad d, J = 8 Hz. 1H);
8.17 (d wide, J = 8 Hz. 1H).
Mass spectrum.
EI (70eV) m / z = 237 M + 'base peak m / z = 222 [M - CH3] +.
m / z = 207 [222 - CH3] +.
m / z = 195 [222 - HCN] + '.
DC I (NH3) m / z = 2 3 8 MH +
9-phenoxy-acridin-2-amine can be prepared from the following way. 494 mg 9-phenoxy-acridin-2-trifluoroacetamide in solution in 50 mL of methanol is supplemented with 3 mL of water and 940 mg of carbonate potassium. The reaction medium is brought to reflux for 5 hours. After returning to room temperature and concentration under reduced pressure, water is 1.27 added and the aqueous phase is extracted with dichloromethane. The organic phase is dried over magnesium sulfate and concentrated under reduced pressure.
385 mg of 9-phenoxy-acridin-2-amine are thus obtained under shape of an orange mouse whose mass spectrum is next .
EI (70eV) m / z = 286 M + 'base peak m / z = 209 [M - C6H5j +.
DCI (NH3) m / z = 287 MH +
1o Za 9-phenoxy-acridin-2-trifluoroacetamide can be prepared as follows. 770 mg 9-chloro-acridin-2-trifluoroacetamide is heated to 100 ° C for hours in 2.23 g of phenol. After returning to room temperature, dichloromethane is added 15 and the organic phase is washed successively with a 1N aqueous sodium hydroxide solution and water, then dried on magnesium sulfate. and concentrated under pressure scaled down. This gives 594 mg of 9-phenoxy-acridin-2 trifluoroacetamide in the form of a red powder, the 2o mass spectrum is as follows.
DCI (NH3) m / z = 383 MH +
m / z = 287 M'H + other product (M - COCF3 + H) Ze 9-chloro-acridin-2-trifluoroacetamide can be prepared as follows. A solution of 725 mg of 2-trifluoroacetamido-acridone in 7 mZ of P0C13 est brought to reflux for 30 minutes. After returning to ambient temperature and concentration under pressure scaled down,. a saturated aqueous solution in sodium hydrogen carbonate is added and the resulting precipitate is recovered by filtration, washed with water and then dried under reduced pressure. We thus obtains 770 mg 9-chloro-acridin-2-trifluoroacetamide in the form of a yellow powder, the mass spectrum is as follows.
EI (70eV) m / z = 324 M + 'base peak m / z = 254 [M - HCF3] +.
m / z = 227 [M - COCF3] +.
m / z = 200 [227 - HCN] + ' m / z = 164 [200 - HCl] + ' 2-trifluoroacetamido-acridone can be prepared in the following way. at ~ 400 mg of 2-aminoacridone in solution in 6.5 mL of dichloromethane at 0 ° C, are added 535 μL ~ of triethylamine, 405 ~, L of anhydride trifluoroacetic and 13 mg DMAP. The mixture is stirred at room temperature for hours. After concentration under reduced pressure, Water is added and the resulting precipitate is recovered by filtration and then dried under reduced pressure.
580 mg of 2-trifluoroacetamido-acridone is thus obtained in the form of a yellow powder whose mass spectrum is the next .
2o EI (70eV) m / z = 306 M + 'base peak m / z = 237 [M - CF3] +.
m / z = 209 [237 - CO] +.
o 1-dimethylamino-3-methyl-isoquinoline-7 amine (C24) can be prepared by operating on next way.
190 mg of 1-dimethylamino-3-methyl-7-nitro-isoquinoline in solution in 12 mL of a mixture dichloromethane-methanol (1/3 by volume) is placed under hydrogen atmosphere (5 bars) in the presence of 18 mg of 3o palladium on carbon at 10 ~ for 12 hours. After Celite filtration, the filtrate is concentrated under reduced pressure. After chromatography on a column of silica with a dichloromethane-methanol / ammonia mixture 2M (gradient 100/0 to 90/10 by volume) as eluent, we obtains 42 mg of 1-dimethylamino-3-methyl-isoquinoline-7-amine in the form of an orange paste, the features are as follows.
1 H NMR spectrum (300 MHz, (CD3) 2S0 d6, 8 in ppm). 2.37 (s. 3H); 2.90 (s. 6H); 5.42 (s large 2H); 6.92 (s. 1H) ~ 7.03 (dd, J = 9 and 2.5 Hz. 1H);
7.09 (d, J = 2.5 Hz. 1H); 7.45 (d, J = 9 Hz. 1H).
Mass spectrum.
1o EI (70eV) m / z = 201 M + 'base peak m / z = 18 6 [M - CH3] +.
m / z = 17 2 [18 6 - CH2] +.
m / z = 158 [M - C ~ H5N] +.
DCI (NH3) m / z = 202 MH +
1-dimethylaminb-3-methyl-7-nitro-isoquinoline 'can be prepared as follows. 810 mg of 2- (1-acetyl-2-oxo-propyl) -5-nitro-benzonitrile is heated to 40 ° C for 16 hours in 10 mL of an aqueous solution of dimethylamine at 40 ~. After return to temperature 2o ambient, 30 mL of an aqueous acid solution 2.5N hydrochloric acid are added, then the aqueous phase is washed with ethyl acetate. The aqueous phase is brought back to pH 9 by adding an aqueous solution of 5N sodium hydroxide and the resulting precipitate is recovered by filtration and dried under reduced pressure. We obtain thus 190 mg of 1-dimethylamino-3-methyl-7-nitro-isoquinoline in the form of an orange powder, the mass spectrum is as follows.
EI (70eV) m / z = 231 M + ', basic piece ~ ~ m / z = 216 [M - CH3] +.
m / z = 202 [216 - CH2] + ' DCI (NH3) m / z = 232 MH + base peak m / z = 202 [M - NO] H +

2- (1-acetyl-2-oxo-propyl) -5-vitro-benzonitrile can be prepared as described in the literature (Shinkai, H; Ito, T.; Iida, T.; Kitao, Y.; Yamada, H.; Uchida, IJMed.Chem. 2000, 43 (24), 4667-4677) ~ Products in which C represents a [1- (2-dimethylamino-ethyl) -1H- radical indol-5-yl] âmino can be prepared by alkylation of the corresponding products in which C represents a radical (1H-lo indol-5-yl) amino, which are themselves prepared by operating as in Example 185, operating under the conditions below below, To a suspension of 0.22 mmol of sodium hydride in 0.2 ml of DMF under argon is added 0.2 mmol of product in which C represents a radical (1H-indol-5-yl) amino. The reaction mixture is stirred at temperature room until the end of gas evolution. A solution 0.22 mmol of dimethylaminoethyl chloride in 0.5 mL of DMF is then added, the solution itself obtained by adding 0.22 mmol of hydrochloride dimethylaminoethyl chloride in a suspension of 0.24 mmol of sodium hydride in DMF. A completion of the reaction, the reaction mixture is hydrolyzed by a saturated aqueous solution of ammonium chloride. The aqueous phase thus obtained is extracted with dichloromethane and the organic phase is dried over magnesium sulfate then concentrated under pressure scaled down. The corresponding product in which C
3o represents a radical [1- (2-dimethylamino-ethyl) -1H-indol-5-yl] amino is thus obtained after purification on silica.

~ Products in which C represents a [1- (2-dimethylamino-ethyl) -1H- radical indol-5-yl] amino can also be prepared from products correspondents in which C represents a radical ([1- (2-hydroxy-ethyl) -1H-indol-5-yl] amino by operating under the conditions below .
To a solution of 0.2 mmol of the product in which C
1o represents a radical ([1- (2-hydroxy-ethyl) -1H-indol-5-yl] amino in 3 mL of a dichloromethane-THF mixture (2/1 0.24 mmol of triethylamine is added) as well as 0.22 mmol of methanesulfonyl chloride.
After completion of the reaction and concentration under '15 reduced pressure, the residue obtained is hydrolyzed by addition of water and the pH of the aqueous phase is brought to 8 by addition of an aqueous ammonia solution at 28%.
The resulting precipitate is recovered by filtration, dried, then redissolved in 3 mL of methanol and 2o supplemented with 1 mL of a 2M solution of dimethylamine in methanol. After heating to 80 ° C for hours in an autoclave, the reaction mixture is concentrated under reduced pressure and then purified to lead to the product in which C represents a radical [1- (2-dimethylamino-ethyl) -1H-indol-5-yl] amino.
~ Products in which C represents a radical ([1- (2-hydroxy-ethyl) -1H-indol-5-yl] amino sbnt themselves prepared in operating as in example 185 from 5-amino-1- (2-hydroxy-ethyl) -indole, itself-even can be prepared by operating in the following conditions.

5-nitro-1- (2-hydroxy-ethyl) -indole can be prepared as follows. A solution of 1 mmol of 5-nitro-1- (2-tert-butyldimethylsilyloxy-ethyl) -indol in 2 mL of methanol containing 120 ~, L of a solution concentrated aqueous hydrochloric acid (37 ~ w / w) is stirred at room temperature for 15 hours. The 1 ml of a reaction mixture is then added.
28% aqueous ammonia solution then concentrated under reduced pressure. 5-vitro-1- (2-hydroxy-ethyl) -indole 1o is thus obtained after purification on silica.
5-vitro-1- (2-tert-butyldimethylsilyloxy-ethyl) -indole can be prepared as follows. To one suspension of 1.1 mmol of sodium hydride in 2 mL of DMF under argon is added 1 mmol of 5-nitroindole. The reaction mixture is stirred at room temperature until end of gas evolution then 1.2 mmol of (2-bromoethoxy) -tert-butyldimethylsilane is added.
Upon completion of the reaction, the reaction mixture is hydrolyzed with a saturated aqueous chloride solution ammonium. The aqueous phase thus obtained is extracted with dichloromethane and the organic phase is dried on magnesium sulphate then concentrated under pressure scaled down. 5-vitro-1- (2-tert-butyldimethylsilyloxy ethyl) -indole is thus obtained after purification on silica.
~ Products in which C represents a radical 4- [2- (pyrrolidin-1-yl) ethyl] piperazin-1-yl (A14) or 4- [2- (pyrrolidin-1-yl) ethyl] homopiperazine-1-yl (A15) or 4- [2- (1H-imidazol-1-yl) ethyl] homopiperazine-1-yl (A16) or ~ 4- [2- (1H-imidazol-1-yl) ethyl] piperazin-1-yl (A17), or 4- [3- (1H-imidazol-1-yl) propyl] homopipé-razin-1-yl (A18) or 4- [3- (1H-imidazol-1-yl) propyl] piperazin-1-yl (A19) or 4- [2- (2-phenyl-1-H-imidazol-1-yl) ethyl] homopiperazin-1-yl (A20), or 4- [2- (2-phenyl-1-H-imidazol-1-yl) ethyl]

piperazin-1-yl (A21), or 4- [3- (2-phenyl-1-H-imidazol-1-yl) propyl] homopiperazin-1-yl (A22), or 4- [3- (3-phenyl-1-H-imidazol-1-yl) propyl] piperazin-1-yl (A23), or 4- [2-(morpholin-1-yl) ethyl] homopiperazin-1-yl (A24) or 4- [2-(morpholin-1-yl) ethyl] piperazin-1-yl (A25) or 4- [3-(morpholin-1-yl) propyl] homopiperazin-1-yl (A26) or 4- [3-(morpholin-1-yl) propyl] piperazin-1-yl (A27) or 4- [2- (1H-imidazo [4,5b] pyridin-1-yl) ethyl] homopiperazin-1-yl (A28) or 4- [2- (1-H-imidazo [4,5b] pyridin-1-yl) ethyl] piperazin-1-lo y1 (A29) or 4- [3- (1-H-imidazo [4,5b] pyridin-1-yl) propyl]
homopiperazin-1-y1 (A30) or 4- [3- (1-H-imidazo [4,5b]
pyridin-1-yl) propyl] piperazin-1-yl (A31) or 4- [2- (1H
benzoimidazol-1-yl) ethyl] homopiperazin-1-yl (A32) or 4 [2- (1-H-benzoimidazol-1-yl) ethyl] piperazin-1-yl (A33) or 4- [3- (1-H-benzoimidazol-1-yl) propyl] homopiperazin-1-yl (A34) or 4- [3- (1-H-benzoimidazol-1-yl) propyl] pipé-razin-1-yl (A35) or 4- [2- (2-hydroxymethyl-1H-benzoimidazol-1-yl) ethyl] homopiperazin-1-yl (A36) or 4- [2- (2-hydroxy-methyl-1-H-benzoimidazol-1-yl) ethyl] pipé-razin-1-yl (A37) or 4- [3- (2-hydroxymethyl-1-H-benzoimidazol-1-yl) propyl]
homopiperazin-1-yl (A38) or 4- [3- (2-hydroxymethyl-1-H-benzoimidazol-1-yl) propyl] pi-pérazin-1-yl (A39) or 4- [2-(1H-imidazol-2-yl) amino-ethyl] homopiperazin-1-yl (A40) or 4- [2- (1-H-imidazol-2-yl) amino-ethyl] piperazin-1-yl (A41) 35 or 4- [3 ~ - (1-H-imidazol-2-yl) amino-propyl] homopiperazin-1-yl (A42) or 4- [3- (1-H-imidazol-2-yl) aminopropyl]
piperazin-1-yl (A43) or 4- {2- [2- (1H-imidazol-2-yl) -1-hydroxymethyl-ethyl] amino-ethyl} homopiperazin-1-yl (A44) or 4- {2- [2- (1H-imidazol-2-yl) -1-hydroxymethyl-ethyl]
amino-ethyl} piperazin-1-yl (A45) or 4- {3- [2- (1H-imidazol-2-yl) -1-hydroxymethyl-ethyl] amino} propyl-homopiperazin-1 yl (A46) or 4- {3- [2- (1H-imidazol-2-yl) -1-hydroxymethyl-ethyl] amino-propyl} piperazin-1-yl (A47).
Amines necessary for the introduction of radicals of type A of general formula (lb), are ~ either commercial.
0 1- (2-pyrrolidinoethyl) piperazine (A14) 0 1- (2-morpholinoethyl) piperazine (A25) 0 1- (3-morpholinopropy) piperazine (A27) ~ be prepared as written in the literature.
0 1- (2-1H-imidazolo-1-ethy) piperazine (A17) according to 0 1- (3-1H-imidazolo-1-propyl) piperazine (A19) according to their. Pat. Appl. EP 350145 ~ be prepared as below.
It is expected that the products may be advantageously prepared by parallel synthesis in solid phase. In this case it is particularly advantageous to produce group A first, operating in the following manner.
o, In a knit of 100 mZ we add successively 5 g of substituted Wang resin by an imidazole carbonyl group (prepared according to Wang and Hauske Tetrahedron hetters, 1997, , 37, 6529-32), 50 mZ of tetrahydrofuran and 1.44 g of 2- (1,4-diazepan-1-yl) ethan-1-ol. We shake reaction with a magnetic stirrer. After 14 hours, filter and wash successively with THF six times. We add the product obtained above in a 50 ml knit. We successively add 50 ml of pyridine, and 1.91 g of para-toluenesulfonyl chloride. We stir the reaction with a magnetic stirrer.
After 14 hours, filter and wash successively with pyridine 1 time and then with THF six times. We add the product obtained above in a 50 ml knit. We successively add 50 ml of DMF and 1.2 tsp imidazole. The reaction is stirred with a magnetic stirrer when heating to 80 ° C.
After 14 hours, filter and wash successively with DMF 2 times and then with THF six times. The product obtained is added above in a 25 ml flask. We add 25 mZ of TFA. We stir. After 1.5 hours we filters the reaction. We keep the filtrate and wash the solid with 20 ml of CH2Cl2. We mix them filtrates and dried. The TFA salt is obtained from 4- [2- (1H-imidazol-1-yl) ethyl] homopiperazin-1-yl (A16).
Example 204 ~ G-quartet, antitelomerase and cytotoxic of the various compounds exemplified 1 to 176, given in table 1 are determined according to the operating protocols described above.

ô o ”. m ~ y ° n ~ o co U
U 7. ~ p ~ NMN CM N
U
this. ~ ° ~ ~ ''? ao ~ mn o 0 U ~ tE ~ r- ~ rï ~ cï ~ ï ch ZZZZZZZ
/ \ ill r \ - / ~ z xzzzzz. zz zzzzzzz m i / \ / \ / \ iiii â z / ~ Z = / ~ Z / ~ Z ~ / \ ~ I \ ~ / \ ~ / \
Z '~ /
ZZZZZ = Z
-iiiiiii / \ / \ / \ / \ / \ / \ / \
r-at . % / vZ = / vs / v = / v = / v = / v = / v ~ r- NM tt u7 CO h ôm ô ~ o ~ j Q ~
~ ~. ri ô ô ô ô ô ô
~ r .: ° U mo o> v ~ t N ~ r U â ~. = Ca ~ oi H
ZZZZZ
1 ~ ~ l ~~ _ -. / \ z ~ / \ ~ .--. z zz z- / z-i zzzzzzz ZSZZZZZ
LL
i ¿ii ~ i / ~ / ~ / ~ /
NOT
QV / - ~ _ / \ S /, \ S / \ S / \ s / \ 1 ~ / \
Z z ZZZ z ZZ z Z z Z
ZSTSSIZ
i ~ iaar / ~ / ~ / ~ / ~ / ~ /
Q = / \ Z / \ z = / \ ._ / \ z / \ z / \ z / \
zz ~ _ zzzzzzzzzz ûI o ° '° r ~ ~ r Ö ~ O ~ N 000 MM
~ Q ~ r NNOO
Ö w- N
Ö O- Ö O
U
° t ~ co '' vt m N h ~ N ch CO
Z x ZZZZ

s ~ ~ i w ~ - ~ / \ z zx z z VS
xzzzzzzz '''x. zxzzxz iiiii ii / \ / \ / \ / \ / \ / \ / \
â = / \ _ / \ _ / \ \ / \ ~ / \ ~ / \ \ '/ \
zzzzz, z ~ z ~ z ~ z ~ z ZZZZZZS
iiiiii / \ / \ / \ / \ / \ / \ / \
T
Q z / \ zz / \ zz / \ z ~ / \ z ~ / \ z ~ / \ z ~ / \ z ti ~ ~ ~ ~ oo .-NN

oh my.
ô ~ 0 0 r d o co N ~ co o ri r "N ~ - ô
U
v - r ~ cv_ nc ~ co ~ im ai ~ rv "
ZZZ
1 ~~ ~~ ~ 1 z = ~ s / ~ ~ z X zzzzzz zzzzzz iiiiii / \ / \ / \ / \ / \ / \
NOT
Q z / ~ zz / ~ zz / ~ zz / ~ zz / ~ zz / ~ z / / / / / /
SZZZZZ
iiiiii / \ / \ / \ / \ / \ / \
<-Q z / ~ zz / ~ zz / ~ zz / ~ zz / ~ zz / ~ z / / / / / /
LIJ NNNNNN

oh my. o Q
y ° n ~ ~? c ~ i ~ '= N mm ~ t ~ U ~. o ô o .- ~ ô ô 0 V co m, nm ~ cn o 0 0 o N, ~: ~ ui ~ ô ô
CCCCC

fa N ta t4 N
\ /
'z. ~ ~ -. ~. ~
z_ zb , ~, z ZZZZZZZ
iiiiiii l \ r \ r \ r \ r \ l \ r \
NOT
Q ~ / \ z = / \ z / \ i / \ z / \ i / \ z / \
zzzzzzzzzzzz ii ii iii / \ / \ / \ / \ / \% \ / \
'~ \ _ / \ _ / \ _ / \ _ / \ _ / \ _ / \
Q ~ / zzzzzzzzzzzzz ux. ~ NN ° mc ~ 'c ~ imm ô ~ ô ° ' ~ â ~ m NN ~ NN c ~
(] ~ - OO ~ ~ Ö 0 Ö
V o wn, yn laugh -p H r <- u-z / \
C z o Ç J ~ = z -z _ ~ o -C -J / \
X
i. iiiiii / \ / \ / \ / \ / \ / \ / \
â s / v = / v = / v ~ _ / v = / v = / v = / v zzzzzzzzzzzzzz x. zz _ ~ zz iiiiiii / \ / \ / \ / \ / \ / \ / \
a = / v = / v = / v = / v = / v = / v = / v zzzzzzzzzzzzzz û! c ~ i ~ mc ~ mm ° 1 oh U
av ° n ~ ô ~ ~ M ci, ~ U s ~ ~ ô o '- ô ô
U m.
U a ~ ~
at H .-zzzg z rz -z ~ ~ \ / z ~ ~ z-X ~ ZZZZZZZ
TZ r. ZZZS
/ \ / \ / \ / \ / \ / \ / \
NOT
Q z / \ s / \ x "/ \ z / \ s / \ z / \ s / \
zzzzzzzzzzzzzz ZZZZZZZ
/ \ / \ / \ / \ / \ / \ / \
â = / \ _ / \ _ / \ _ / \ _ / \ ~ / \ _ / \
zzzzzzzzzzzzzz w ~ v ~ vv oh ~ ~.
ô, ~ O
~ Q ~
at NNM
1- U ~ - O ô ~ - O ô
O ~ <~ ~ CG
O
ZZ = ~ Z
~ Z
T ~ Z
s /
- ;;
ZTZZSS
i ~ i ~ iii / \ / \ / \ / \ / \ / \
NOT
I
Q / \ x "/ \ x" / \ z / \ z / \ x / \
zzzzzzzzzzzz iiiiii / \. / \ / \ / \ / \ / \
The xH / \ x / \ x / \ x / \ x / \ x / \
zz Z zzzzzzz Z z u1 ~ u ~ ui m ui w oh ~ ~.
~ Q ~ m NMMN ~ O
U ~. ~ ~ O ô ô M
(. ~ 9.: °. U i.yn co ~ co Z. Z
~ Z ~
._ - '\ / ~ --i fZ-2Z ~
Z \
ZZZZZZ
ZZZZ '!' Z
iiiiii l \ l \ r \ v \ r \ r \
NOT
Q z / \ zz / \ zz / \ zz / \ zz / \ zz / \ z ZSZZZZ
iiiii i.
/ \ / \ / \ / \ / \ / \
The Q = / \ _ / \ _ / \ _ / \ 2 / \ 2 / \
zzzzzzzzzzzz W

ô a ~ ~.
O, o ~
ai ° N ~ ô m ~ ~. ~ - ~ - N
ô ô ~ ô
V, y on c ~ ° 'E ~ ~ ~ ~ i ZS ~ ~ S
z - ~ ~ z ~ z -. ~ ~, i SSSSSS
iiiiii / \ / \ / \ / \ / \ / \
NOT
Q z / \ zz / \ zz / \ zz / \ zz / \ zz / \ z SSSSSS
iiiiii / \ / \ / \ / \ / \ / \
T
The QZ / \ _ / \ _ / \ 2 / \ 2 / \ Z / \
zzzzzzzzzzzz W

ô ° '_ ~ ~ r Q ~ r ~
ô ~ c ~ ° nmi odd ô ô
U
° ~ n yn U ~ E c ~ ~ ° r- oi oi H
z . ow ~, -!

CJ, O
ZZZZZ ~ Z
Zzzzzs NOT
Q z ~ \ zz ~ \ zz ~ \ zz ~ \ zz ~ \ zz ~ \ z The Q = ~ \ S ~ \ S ~ \ S ~ \ Z ~ \
zzzzzzzzzzzz X
lIJ c ~ 0 W c ~ o O ~ O
~ Â~
~ ° n ~ i to ~ ô
V ~ - ô ô ô do <r. ~ UW a ayn C ~ ~ E oi ai r ~ H
NOT
Ö ~ ~ - \
Z
C z ~ ~ z ~ ~
L ~
z ZZZZTZ
NOT
x "" ~ \ z ~ \ z ~ \ x "~ \ z ~ \ z ~ \
zzzzzzzzzzzz ZZZSZZ
Q z ~ \ _ / \ z ~ \ x "~ \ z ~ \ z ~ \
zzzzzzzzzzzz tL ~ ~ r ~ '-ô a ~ ~.
ô, nod 'co f0 NV: c0 NN O7 ~ ~. ch. . = .- r ~ cv ai ~ U
â ~
H
Z. ZZZZZZ
'' ~ '--C ~
'r ~~'Z>, o-zzzz. zzz '°' szzzzzz r 'r' r 'r' r 'r' rv Q zr \ zz / \ zzr \ zzr \ zz / \ zz / \ zzr \ z ZSZ 'SZZZ
i l \ r 'r' r 'r' l 'l' Q = r \ _ l \ = r \ = r \ = r \ _ l \
zzzzzzzzzzzzzz LL ~ ~ o ~ o ~ oM0 a ~ 'D

~ XO, o ~ 3. mo co ~ oô N
d U ~. d ~ r 'NM m vM, ~
r ô ô ô 0 co ~ = ~ ai ZZZZ
~ z -z 1 vr ~ ~ ~
y-zzzzzzz ZSZZZZZ
mid rv rv rv rv rv rv rv zr ~ zzr ~ zzr ~ zzr ~ zzr ~ zzr ~ zzr ~ z ZZZZSZZ
i r ~ r ~ r ~ r ~ r ~ r ~ r ~
z Q zr ~ zzr ~ zzr ~ zzr ~ zzr ~ zzr ~ zzr ~ z IT o ~ o aND ~ ~ mm Ç ~ m Ö ~ OM
~ Â~
M ~ ~ VO, 'COO MO
d ô ô 0 ô ô °
U

H
ZZZZZZZ
r- ~ ~ ~ z- ~ ~ ~ ~ z \, T = _ = T
NOT
Q z ~ \ z ~ \ S ~ \ z ~ \ 2 ~ \ 2 ~ \ S ~ \
ZZ zz ZZ zzz Z zzz Z
ZZZ ~ ZZZ
The QS ~ \ 2 ~ \ 2 ~ \ S ~ \ 2 ~ \ S ~ \ S ~ \
zzzzzzzzzzzzzz oM ~ ~ ~ m ~ m rn 'd ~ MM t¿
~ a ~ ~ ~, -ao in <- ~ m ~ r tn ~ d; a0 tn NNNN
O Ö O Ö ~ Ö Ö
~ U
C ~ ~ E ~ d '~ r H
CCCC
ZZ = ~ 7 7 f0 N f0 c0 -Z -Z
\ i - \ - ~ _ '' ~ \ ~ ~ - O
'/ \
zzzo 0 0, o ZSZZ = ZZ
iiiiiii / \ / \ / \ / \ / \ / \ / \
a = / v = / v = / v = / v = / v = / v = / v z zzzxzzz iiiiiii / \ ~ / \ / \ / \ / \ / \ / \
a 2w / ~ '~ / ~ Z / ~ S / ~ 2n / ~ Z / ~ 2S ~ /
zzzzzzzzzzzzzz o NM and tn c0 0 ô 0 0 0 0 0 e <- ~ -oh my.
O ~ o V = ci M m cô ~ cNn ô d ô ô ô ô ô
U

NN r 'c0 CCCCCCC
NOT
NNNNNN
NOT
Z-\ l - ~ Z - ~ --- ~ z ~ O - ~ -s /
0 oao 0 0 0 m ZZZZZZZ
/ \ / \ / \ / \ / \ / \ / \
NOT
az / ~ zz / ~ zz / ~ zz / ~ zz / ~ zz / ~ zz / ~ z m ZZSZSZS
i ~ ii ~ ii / \ / \ / \ / \ / \ / \ / \
The a ~ '/ v = / v = / v = / v = / v = / v = I v zzzzzzzzzzzzzz r. co a ~ o ~ N m 0 0 0 .- ~ - r- .-T r TT rr r ' ô ~ ~ m ~ Q ~ ~ <-at ton g N tn m N o ~ r °°
Z ~ Ö u- r ~ - ~ ch Ö
U
~ r = - ° ° p T ~ m nn tf tai ~ ~ U ~ ~ ~ ~
tD NNNN t0 t0 - '~ ~, -'. ~ ~ ~ - "v / -CJ \
0 C) ZZZZZZ
/ \ / \ /. ~ / \ / \ / \ / \
z / ~ z ~ / ~ zz / ~ zz / ~ zz / ~ zz / ~ zz / ~ z Z z ZSZZZ
i ~ ii ~ i / \ / \ / \ / \ / \ / \ / \
z / ~ z ~ / ~ zz / ~ zz / ~ zz / ~ zz / ~ zz / ~ z t ~ ~ rn o r r ~ r OO ~ - c0 N ~ I; m Ö ~ O rr r C ~ r ~ ~. ô m M ~ ô mc ~ o, sea 0 ô 0 0 ô
V o ~
C7 ~ ~ t cv m cn md: o ~
rrr CCCCCCC
N ~ ~ ~ ~ ~ ~ ~

NN CO t0 (QN c6 O
--- GZ - ~ --Q> -Qr ~ ~ - ~ ~~ z ~ ~~ z-2. ZZZSZZ
~ y ~ ~ ~ a rv rv rv rv rv rv rv a = r ~ = r ~ = r ~ = r ~ = r ~ = r ~ = r zzzzzzz is rw rvrvrvrvrvrv r a = r ~ = r ~ = r ~ = r ~ = r ~ = r ~ = f NNNNNN
rr a- rr oh ~ ~. co.
o ~ oom ~ Q ~ N ô
y ° rW m .Nro M m ~ t; ° r ° m I- U ~ - d ô ô ô od ô
~ ~ U
ru ~
C ~, ô ~ ~ ~. ~ No.
N ~ 7 ~ 7 3 7 7 NN Nf ~ 6N (= 6 N
Q
\ / z ~ / ~~ / \ ~ - \ /
ZSZZZZZ
i ~ ~ ~ ~ ~ ~
/ \ / \ / ~ / \ / \ / \ / \
NOT
Q z ~ ~ zz / ~ zz / ~ zz / ~ ~ zz / ~ z ~ / ~ z ~ / ~ z / \ / \ / \ / \ / \ / \ / \
z / ~ zz / ~ zz / ~ zz / ~ zz / ~ z ~ / ~ zj ~ ~ z 00 0 ~ o you c ~ c ~ mmmmm T i ~ t 't ~ r' rr oh my. ~ W an oo ~ N co ô, ~ o ô o ~ - ô ô ~ n ô
~ a Q ~ o ~ ~ o ô e ô
co ~ rc ~ mo ~
U ~. ô ô '- o ô' - ô
V 'NUN ~ CO CV M ° ln t ~
0 .. ' Z

J
~ CZ_ ~ JL ~
\ /
xzzzzz, zz m iiiiiii / \ / \ / \ / \ / \ / \ / \
Q z / \ zz / \ zz / \ zz / \ zz / \ zz / \ zz / \ z / - / - / - '/ - / _ / - / -Z z ZZZZZ
iiiiiii / \ / \ / \ / \ / \ / \ / \
Q% / \ z% / \ z% / \ z% / \ z% / \ z% / \ z% / \ z MMM c ~ MV
r- ~ - <- c- c-c0 NO ~ r Ö ~ O ~ ~ pd; ~ N
~ a ~ rdd O do at vm co ~ ~. r 'ô ô' - ~ '' ~ U
~ n co H
ZZ ûJ
r \ iZ
\ i-X zzzzzz mzzzzz -! -iiiiii / \ / \ / \ / \ / \ / \
NOT
az / ~ zz / ~ zz / ~ zz / ~ zz / ~ zz / ~ z / / / / / /
ZSSZZZ
iiiiii / \ / \ / \ / \ / \ / \
r a ~ / ~ z ~ / ~ z ~ / ~ z ~ / ~ z ~ / ~ z ~ / ~ z v ~ T ~ ° v rrrrr ô ~ ô u ~ ô
ciao ° ~ ~ ~ ~ ~ ~ ~ ~ N
S. ~ CV CV p Ö OO
~ U
V ° = N ~ 6p u) u ~ p O) C ~ C ~ W r-O
S
S
f ~ SZ ~ OO
u x xxx ST xx iiiiiii / \ / \ / \ / \ / \ / \ / \
NOT
Q \ / \ \ / \ \ / \ z / \ z / \ s / \ z / \
z ~ z ~ zzzzzzzzz zzzxzxx iiiiiii / \ / \ / \ / \ / \ / \ / \
/ \ z ~ / \ z ~ / \ zz / \ zz / \ zz / \ zz / \ z 0o a ~ o Llj '~' dwn ~ t7 t ~ ~ t7 rr T t ~ r 'rt ~

oh ~ ~.
from om ~ Qu ° W 'ni U
at ° WMN '~: ~ o ~ o V ~ 'O r-' - Ö O Ö
ô In tp ln u7 of r. r TOO Ö
H
VS
- °

-O ~ ô CC
xzzzzzzz zzxzzzz i ~ ii ~ iiii / \ / \ / \ / \ / \ / \ ~ -. \
â = / ~ _ / ~ _ / ~ _ / ~ _ / ~ _ / v \ / v zzzzzzzzzzzzzz zxzzzzx iiiiiii / \ ~ / \ / \ / \ / \ / \ / \
_ / v = / v = / v = / v = / v '~ / v \ / v zzzzzzzzzzzzzz / -IJj ~ tnd t ~ r7 ~ nc7 c ~ 0 tô
t 't rrr N ~ ~ ~ OD 00 Ot ~ O.
V ~ ô d ô ô
at u ° W ~ N co ~ rd; ~ -U ~. .- ~ - r r- ~ <.r V ~ Wn, naked "
U ~ ~ ~ ~ ~ ~ i NOT
O
d ~ 1 O
vs-~ S
/ O
XZ, ZZZZZZ
ZZSZZZS
iiiiiii / \ / \ / \ / \ / \ / \ / \
NOT
Q
zz Z z ZZZZ z Z z ZZZ
/ - / - / ~ - / - / - / - / -ZZZZZZZ
iiiiiii / \ / \ / \ / \ / \ / \ / \
/ v \ / v \ / v \ / / \ / vv / v \ / v zzzzzzzzzzzzzz / - / - / - / - / - / - / -ô ô ô ~ ô

~ r Q ~ ô. m ô ô m ô
NMOMN c0 U ~. 0 ~ V. 07 c0 N
O Ö Ö Ö
at Cp M ~ N f0 M
ZZZZZZ
~ _ _ _ ~ 1 = ~ l 1 ~: ~
ô o ~ ô = / \ ~ ô = / \
xzzzzz z. z M
iiiiiii / \ / \ / \ / \ / \ / \ / \
NOT
/ ~ z ~ / ~ z ~ / ~ z ~ / ~ zz / ~ zz / ~ z ~ / ~ z SZZZZZZ
iiiiiii / \ / \ / \ / \ / \ / \ / \
â \ / v \ / v \ / v \ / v = / v = / v \ / v z ~ z ~ -z ~ zzzzz ~ -z w ~ - ~ - ~ -, - ~ .-"'' MN 000 O ~ OM
~ QV ô ô ô ô
g M mm M ~ N '' ~ U ~. ô cry ~ ô o °
RV ~ ~ o ° m ~ r ~ r a ~
vs Z. ? ZZZ

/ s ~ \
, \ <
r \
.XZ c ~ ~ ZZZZ
'-''zzzz-rzz iiiiiii / \ / \ / \ / \ / \ / \ / \
â \ / v \ / v \ / v \ / v \ / v \ / v \ / v zzzzzzzzzzzzzz /. / - / - / - /. / - / -ZSIZZZZ
of iiiiiii / \ / \ / \ / \ / \ / \ / \
\ / \ \ / v \ / v \ / \ \ / \ \ / \ \ / \
z ~ z ~ z ~ z ~ z ~ z ~ z x ~ N
r ô o ”.
p N ~ ~ O ~ D
~ Q ~ <ô ô
Ö
ô ~ 'ô ô d ô
U
O ~ r C9 ~ ~ r 07 ~ n ai ~ r H
VS
ZZ
f 0 S
O
_ ~ ~ ~ -i Z ~ ~ -i ~ ~ i_ \ / Z ~ / Zv /
x cn 'zzzzz ZZ ~ ZSZ
ii / \ / \ / \ / \ / \ / \
/ = N /
z v'z- zv z-Q z / ~ zz / ~ zz / ~ zz / ~ z / - / - / ~. / '-VV
zsszsz iiiiii / \ / \ / \ / \ / \ / \
Q z. / ~ zz / ~ zz / ~ zz / ~ zz / ~ zz / ~ z / - / - / ~ / - / _. /
o ~ o rrr Ö p 3 O ~ h V 'MI ~ 47 tn pmrrr ~ (~ pp V ô M r ô r ô
this u ° W ô ô ô ~ '''<'° _ ô ô ô. ~ ô ô
V o ~ od:
r â ~ ~ ~ rr ~ C. ~ r ZZZZZZZ
1 ~ ~ _ \ i \ _ \ .z Z ~ i ~ /
\ /
zzz MTZSZZZZ
iiiiiii t \ / \ f \. ! \ / \ / \ / \
NOT
â v / vv / vv / vv / vv / vv / vv / v z ~ z ~ z ~ z ~ z ~ z ~ z zzzszzz iiiiiii / \ / \ / \ / \ / \ / \ / \
r â v / vv / vv / vv / vv / vv / vv / v zzzzzzzzzzzzzz l _ i - i _ i _ i _ l - i rrr r- r gm s U
~ A ~
d ~ ° n ~ m r. d; m ~ t; o ~
Ö Ö o Ö rr d. ~ V ~ no 0 0 0 (~ N ~ ~ ~ T cÖ N m N ~ (7 'û ~ r N r N
VS
NOT
ZZZ
NOT
O ~ // ~ '~~ Z
OZ ~ ~ .- / ~ Z
~ Zo ~ ~ ~ i z xoz, zzzzz iiiiiii / \ / \ / \ / \ / \ / \ / \
NOT
Q z / ~ zz / ~ zz / ~ zz / ~ zz / ~ zz / ~ zz / ~ z / / / / / / /
SSZZZZZ
iiiiiii / \ / \ '/ \ / \ / \ / \ / \
r Q z / ~ zz / ~ zz / ~ zz / ~ zz / ~ zz / ~ zz / ~ z / / / / / / /
m ~ ~ ~ ô ô ô
r NNN

Claims (37)

1 - Compounds fixing the G-quadruplex structure of DNA or of RNA characterized in that they correspond to the formula following general:
nitrogen aromatic cycle - NR3 - distributor - NR'3 - cycle aromatic in which .cndot. the nitrogen aromatic cycle represents:
~ quinoline or isoquinoline optionally substituted by at least one radical chosen from a group N (Ra) (Rb) in which Ra and Rb, identical or different represent hydrogen or a C1-C4 alkyl radical, and a or more alkoxy or chain alkyl group (s) short in C1-C4 linked to a carbon atom or quinoline or isoquinoline nitrogen or ~ a quinoline or isoquinoline having a nitrogen atom in quaternary form or ~ a benzamidine or ~ a pyridine .cndot. the aromatic cycle represents ~ quinoline or isoquinoline optionally substituted by at least one radical chosen from a group N (Ra) (Rb) in which Ra and Rb, identical or different represent hydrogen or a C1-C4 alkyl radical, and a or more alkoxy or chain alkyl group (s) short in C1-C4 linked to a carbon atom or quinoline or isoquinoline nitrogen or ~ a quinoline or isoquinoline having a nitrogen atom in quaternary form or ~ a benzamidine or ~ a pyridine or ~ an optionally substituted phenyl ring by a halogen group; C1- alkoxy C4; cyano; carbonylamino possibly substituted by one or more groups C1-C4 alkyl; guanyl; alkylthio in C1-C4; amino, C1-C4 alkylamino, C1-C4 dialkylamino for each group alkyl and whose alkyl parts can together form a C3-C8, nitro ring;
C1-C4 alkyleneeamino; alkénylèneamino in C2-C4;
~ a heterocyclic ring mono or bi or tricyclic with 0 to 2 heteretomas per cycle provided that at least one heteroatom, is present in at least one cycle optionally substituted by one or several C1-C4 alkyl groups or by C1-C4 alkylene groups or C2-C4 alkenylene .cndot. R3 and R'3, identical or different, represent independently of each other hydrogen or a C1-C4 alkyl radical .cndot. the dispatcher represents:
- a triazine group possibly substituted by an aromatic ring such as defined above or by an XR1 (R2) radical in which X represents a nitrogen atom N to form NR1R2, an alkyl radical linear or branched in C1-C6 to form alkR1R2, an oxygen atom O to form OR1 or a sulfur atom S to form SR1, with R1 and R2 identical or different are chosen from the hydrogen atom;
an optionally C1-C8 alkyl radical substituted by one or more radicals identical or different; a cycle aromatic as defined above optionally substituted; a radical quinuclidine; a pyrrolidinyl radical itself possibly substituted with a alkyl or phenylalkyl radical with alkyl in C1-C4; a piperazinyl radical or homopiperazinyl itself possibly substituted by an alkyl radical, cycloalkyl or phenylalkyl; a radical morpholinyl; a pyridyl radical, piperidinyl or a piperidyl radical optionally substituted with one or several alkyl or phenylalkyl radicals with C1-C4 alkyl; a radical indazolyl; a naphthyl radical; a benzotriazole radical; a radical benzoimidazolyl; a pyrimidinyl radical optionally substituted with one or several alkyls with C1-C4 alkyl; a acenaphthene radical; an amino radical itself possibly substituted with a two identical or different radicals chosen from alkyl, phenylalkyl, alkylaminoalkyl and dialkylaminoalkyl, it being understood that when XR1R2 represents NR1R2, then R1 and R2 identical do not not both represent hydrogen or unsubstituted C1-C4 alkyl and R1 and R2 different don't represent one hydrogen and the other C1-C4 alkyl not substituted or when X represents N or alkyl, R1 and R2 form together with X at which they are linked a monocyclic radical of 3 with 6 links or bicyclic from 8 to 10 saturated or unsaturated links containing possibly one or two heteroatoms identical or different chosen from N, O or S, this radical possibly being substituted - a diazine group possibly substituted by the same groups as the triazine or one of its salts, these compounds being in all the isomeric forms possible racemates, enantiomers and diastereoisomers. 2 - Compounds fixing the G-quadruplex structure of telomeres characterized in that they respond to the general formula as defined in claim 1. 3 - Compounds according to claim 1 or 2 characterized in that when one or both of R1 and R2 represent) an optionally C1-C8 alkyl radical substituted by one or more identical radicals or different, these radicals are chosen from the radicals following: the amino radical itself possibly substituted by one or two identical radicals or different ones chosen from alkyl radicals, hydroxyalkyl, alkoxyalkyl, alkylphenylalkyl, phenylalkyl, carboxyalkyl, hydroxycarboxyalkyl, acyl, naphthyl, phenyl and alkylphenyl; The radical trialkylammonio; hydroxy radicals; C1-C4 alkoxy;

thioalkoxy; trifluoromethyl; acyl; free carboxy, salified, esterified or amidified; imidazolyl;
pyrrolidinyl optionally substituted with C1- alkyl C4; piperidyl and piperazinyl optionally substituted by alkyl or phenylalkyl with C1- alkyl C4; morpholinyl; pyridyle; naphthyl or phenyl itself possibly substituted by one or more radicals chosen from C1-C4 alkoxy radicals, halogen or the optionally substituted amino radical as defined above. 4 - Compounds according to claim 1 or 2 characterized in that the dispatcher represents:

- a triazine group possibly substituted by an aromatic ring such as defined above or by an XR1 (R2) radical in which X represents a nitrogen atom N to form NR1R2, an alkyl radical linear or branched in C1-C6 to form alkR1R2, an oxygen atom O to form OR1 or a sulfur atom S to form SR1, with R1 and R2 identical or different are chosen from the hydrogen atom;

C1-C8 alkyl optionally substituted by one or more radicals chosen from amino, alkylamino, dialkylamino radicals, alkoxyalkylamino, dialcoxyalkylamino, hydroxyalkylamino, dihydroxyalkylamino, hydroxycarboxyalkylamino, trialkylammonium, naphthylamino, phenylamino, acylamino, (Alkyl) (phenylalkyl) amino, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino, hydroxy, alkoxy in C1-C4, thioalkoxy in C1-C4, trifluoromethyl, acyl, free carboxy, salified, esterified or amidified, imidazolyl, pyrrolidinyl optionally substituted by C1-C4 alkyl, piperidyl, piperazinyl and homopiperazinyl optionally substituted by alkyl or phenylalkyl with C1-C4 alkyl, morpholinyl, pyridyle, naphthyl or phenyl optionally substituted with or several radicals chosen from among C1-C4 alkoxy, halogen, amino, alkylamino and dialkylamino; a cycle aromatic as defined above; a quinuclidine radical; a radical pyrrolidinyl itself possibly substituted by an alkyl radical or phenylalkyl with C1-C4 alkyl; a piperazinyl radical itself optionally substituted by a radical alkyl, cycloalkyl or phenylalkyl; a morpholinyl radical; a pyridyl radical or an optionally piperidyl radical substituted by one or more radicals alkyl or phenylalkyl with C1-C4 alkyl;
an indazolyl radical; a radical naphthyl, a benzotriazole radical; a pyrimidinyl radical optionally substituted by one or more alkyl with C1-C4 alkyl; an acenaphthene radical, it being understood that when XR1R2 represents NR1R2, then R1 and R2 identical do not not both represent hydrogen or unsubstituted C1-C4 alkyl and R1 and R2 different don't represent one hydrogen and the other C1-C4 alkyl not substituted or when X represents N or alkyl, R1 and R2 form together with X at which they are linked a radical chosen from among following radicals: piperazinyl or optionally substituted homopiperazinyl by one or more identical radicals or different; pyrrolidinyl optionally substituted by C1-C4 alkyl or alkoxy, hydroxy, acylamino, pyrrolidinylalkyl, pyridinyl and pyridyl; 1,2,3,4-tetra-hydroquinoline and 1,2,3,4-tetra-hydroisoquinolinyl; diazepine optionally substituted by alkyl or pyrrolidinyl-alkyl; piperidyl or piperidinyl optionally substituted with one or more radicals chosen from alkyl, alkoxy, alkoxyalkyl, pyrrolylalkyl, piperidinyl, piperidyl, hydroxy and cycloalkyl-alkyl morpholinyl; thiomorpholinyl;
imidazolinyl optionally substituted with alkyl, - or a diazine group possibly substituted by the same groups as the triazine or one of its salts, these compounds being in all the isomeric forms possible racemates, enantiomers and diastereoisomers.

- Compounds according to any one of claims 1 to 4 characterized in that the diazine groups are pyrimidines and quinazolines. 173 6 - Compounds according to any one of claims 1 to 5 characterized in that XR1 (R2) is such that when X
represents N, that is one of R1 and R2 represents the atom hydrogen or a C1-C4 alkyl radical optionally substituted by amino, alkylamino, dialkylamino or phenyl, and the other of R1 and R2 is chosen from the values defined for R1 and R2 to any of claims 1 to 5 either R1 and R2 form together with the nitrogen atom to which they are linked a radical cyclic chosen from the following radicals: a radical piperazinyl or optionally substituted homopiperazinyl by one or more radicals chosen from alkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, phenylalkyl, alkoxyalkyl, hydroxyalkyl, dihydroxyalkyle, hydroxyalkoxyalkyle avec alkoxy, imidazolylaminoalkyle, imidazolylalkylaminoalkyle, imidazolylhydroxyalkylaminoalkyle, pyridylalkyle, pyridinylalkyle, imidazopyridinylalkyle, pyrrolidinylalkyle, imidazolylalkyle optionally substituted by one or more alkyl radicals or phenyl, morpholinylahkyle, benzoimidazolalkyle optionally substituted by alkyl or hydroxyalkyl, C3-C8 cycloalkyl, pyrazinyl, pyrimidinyl, pyridyl, piperidyle, furylcarbonyle, furfurycarbonyle, quinolyle or isoquinolyl; an optionally pyrrolidinyl radical substituted by C1-C4 alkyl or alkoxy, hydroxy, acylamino, pyrrolidinylalkyl, pyridinyl and pyridyl; a 1,2,3,4-tetrahydroquinoline linear 1,2,3,4- or tetrahydroisoquinolinyl; a diazepine radical optionally substituted by alkyl or pyrrolidinylalkyl; a piperidyl radical optionally substituted by one or more radicals chosen from alkyl, alkoxy, alkoxyalkyl, pyrrolylalkyl radicals, piperidinyl, hydroxy, cycloalkylalkyl and piperidyl;
a piperidinyl radical optionally substituted by piperidinyl; a morpholinyl or thio radical morpholinyl; an imidazolinyl radical optionally substituted by alkyl. 7 - Compounds according to claim 1 or 2 characterized in that they meet the following general formula:
nitrogen aromatic cycle - NR3 - distributor - NR'3 - cycle aromatic in which the nitrogen aromatic cycle, the cycle aromatic and R3 and R'3 have the meanings indicated to any of the preceding claims, and the dispatcher represents:
- a triazine group possibly substituted. by a radical XR1 (R2) in which X represents a nitrogen atom N
to form NR1R2, an alkyl radical linear or branched in C1-C6 to form alkR1R2, an oxygen atom O to form OR1 or a sulfur atom S to form SR1, with R1 and R2 identical or different have the meanings indicated in one any of the preceding claims, - a diazine group possibly substituted by the same groups as the triazine or one of its salts, these compounds being in all the isomeric forms possible racemates, enantiomers and diastereoisomers. 8 - Compounds according to claim 1 or 2 characterized in that the dispatcher represents:

- a triazine group possibly substituted by a radical XR1 (R2) in which X represents a nitrogen atom N
to form NR1R2, an oxygen atom O
to form OR1 or a sulfur atom S
to form SR1, with R1 and R2 identical or different are chosen from the hydrogen atom;
C1-C8 alkyl optionally substituted by an amino, alkylamino radical, dialkylamino, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino, C1- alkoxy C4, an acyl radical, a radical imidazolyl, with a pyrrolidinyl radical, pyridyl or with a phenyl radical; a aromatic cycle as defined in claim 1; a quinuclidine radical, a pyrrolidinyl radical or a radical piperidyl optionally substituted with C1-C4 alkyl it being understood that identical R1 and R2 do not not both represent hydrogen or unsubstituted C1-C4 alkyl and R1 and R2 different don't represent one hydrogen and the other C1-C4 alkyl not substituted or when X represents N, R1 and R2 together form with X to which they are linked a piperazinyl radical, homopiperazinyl, - piperidyl, pyrrolidinyl, morpholinyl or thiomorpholinyl, optionally substituted by one or more radicals, - or a diazine group possibly substituted by the same groups as the triazine or one of its salts, these compounds being in all the isomeric forms possible racemates, enantiomers and diastereoisomers 9 - Compounds according to claim 1 or 2 characterized in that they correspond to formula (I) below:

in which :
A represents an XR1 (R2) radical in which X represents a nitrogen atom, oxygen, sulfur or an alkyl radical in C1-C6 to form one of the radicals following:
NR1R2 with identical R1 and R2 or different are chosen from the atom hydrogen; a C1-C8 alkyl radical optionally substituted with one or several identical radicals or different ; an aromatic cycle such as defined above a radical quinuclidine; a pyrrolidinyl radical itself possibly substituted with a alkyl or phenylalkyl radical with alkyl in C1-C4; a piperazinyl radical or homopiperazinyl itself possibly substituted by an alkyl radical, cycloalkyl or phenylalkyl; a radical morpholinyl; a pyridyl radical, piperidinyl or a piperidyl radical optionally substituted with one or several alkyl or phenylalkyl radicals with C1-C4 alkyl; a radical indazolyl; a naphthyl radical; a benzotriazole radical; a radical benzimidazolyl; a pyrimidinyl radical optionally substituted with one or several alkyls with C1-C4 alkyl; a acenaphthene radical; an amino radical itself possibly substituted with a two identical or different radicals chosen from alkyl, phenylalkyl, alkylaminoalkyl and dialkylaminoalkyl, it being understood that when XR1R2 represents NR1R2, then R1 and R2 identical do not not both represent hydrogen or unsubstituted C1-C4 alkyl and R1 and R2 different don't represent one hydrogen and the other C1-C4 alkyl not substituted or when X represents N or alkyl, R1 and R2 form together with X at which they are linked a monocyclic radical of 3 with 6 links or bicyclic from 8 to 10 saturated or unsaturated links containing possibly one or two heteroatoms identical or different chosen from N, O or S, .cndot. an OR1 or SR1 group in which R1 has the same meaning as before being understood that R1 does not represent hydrogen or C1-C4 alkyl unsubstituted, or .cndot. an alkyl group containing 1 to 6 atoms of carbon substituted by R1 R2 as defined above - R3 and R'3, identical or different, represent independently of each other hydrogen or a C1-C4 alkyl group - Ar1 and Ar2 identical or different represent * when Ar1 and Ar2 are identical:
.cndot. a quinoline or isoquinoline motif optionally substituted with at least one radical chosen from a group N (Ra) (Rb) in which Ra and Rb, identical or different represent hydrogen or a C1-C4 alkyl radical, and one or several alkoxy or alkyl group (s) to short chain in C1-C4 linked to an atom carbon or nitrogen from the quinoline ring or isoquinoline or .cndot. a quinoline or isoquinoline having a quaternary nitrogen atom or .cndot. a benzamidine or .cndot. a pyridine attached in position -4 or fused with an aryl group or heteroaryl optionally substituted with a C1-C4 alkyl group * when Ar1 and Ar2 are different .cndot. Ar1 and Ar2 both represent one possibilities mentioned above for Ar1 and Ar2 or .cndot. Ar1 represents one of the possibilities below above and Ar2 represents * a phenyl ring possibly substituted by a halogen group, C1-C4 alkoxy, cyano, carbonylamino optionally substituted with one or several C1-C4 alkyl groups, guanyl, C1-C4 alkylthio, amino, C1-C4 alkylamino, C1- dialkylamino C4 for each alkyl, nitro, C1-C4 alkyleneamino, (or) C2-C4 alkenyleneamino, or a radical piperazinyl optionally substituted by a C1-C4 alkyl radical, * a heterocyclic ring mono or bi or tricyclic with 0 to 2 heteroatoms per cycle provided that at least one heteroatom is present in at least a cycle possibly substituted by a or more C1-C4 alkyl groups or by C1-C4 alkylene groups or C2-C4 alkenylene or a salt thereof, these compounds of formula (I) being under all possible racemic isomeric forms, enantiomers and diastereoisomers. - Compounds according to Claim 9, characterized in that that when one or both of R1 and R2 represents (nt) a C1-C8 alkyl radical optionally substituted by one or more identical or different radicals, these radicals are chosen from the amino radical itself optionally substituted by one or two radicals identical or different chosen from radicals alkyl, hydroxyalkyl, alkoxyalkyl, phenylalkyl, carboxyalkyl, hydroxycarboxyalkyl, acyl, naphthyl, phenyl and alkylphenyl; the trialkylammonio radical;
hydroxy radicals; alkoxy; thioalkoxy;
trifluoromethyl; acyl; free, salified carboxy, esterified or amidified; imidazolyl; pyrrolidinyl optionally substituted with C1-C4 alkyl;
piperidyl and optionally substituted piperazinyl by alkyl or phenylalkyl with C1-C4 alkyl;
morpholinyl; pyridyle; naphthyl or phenyl itself optionally substituted by one or more radicals chosen from C1-C4 alkoxy, halogen or the amino radical optionally substituted as defined above. 11 - Compounds according to any one of claims 1 to 10 characterized in that XR1 (R2) is such that when X
represents N, that is one of R1 and R2 represents the atom of hydrogen and the other of R1 and R2 is chosen from values defined for R1 and R2 at any of claims 1 to 10 or R1 and R2 together form with the nitrogen atom to which they are linked a radical piperazinyl, homopiperazinyl, pyrrolidinyl, piperidyl, pyridinyl, morpholinyl, thiomorpholinyl, imidazolinyl, diazepine, 1,2,3,4-tetrahydroquinoline or 1,2,3,4-tetrahydroisoquinoline, all these radicals being optionally substituted by one or more radicals as defined in any one of claims 1 to 10. 12 - Compounds according to claim 9 characterized in that that A represents an aromatic cycle as defined above or a radical XR1 (R2) in which X represents a nitrogen atom N to form NR1R2, an alkyl radical linear or branched in C1-C6 to form alkR1R2, a oxygen atom O to form OR1 or a sulfur atom S
to form SR1, with R1 and R2 identical or different are chosen from the hydrogen atom; C1-C8 alkyl optionally substituted by one or more radicals chosen from amino, alkylamino, dialkylamino, dialkoxyalkyl-amino, dihydroxyalkylamino, alkoxyalkylamino, hydroxyalkylamino, hydroxycarboxyalkylamino, trialkylammonio, naphthylamino, phenylamino, acylamino, (alkyl) (phenylalkyl) amino, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino, hydroxy, C1-C4 alkoxy, C1-C4 thioalkoxy, trifluoromethyl, acyl, carboxy free, salified, esterified or amidified, imidazolyl, pyrrolidinyl optionally substituted with C1- alkyl C4, piperidyl and piperazinyl optionally substituted by alkyl or phenylalkyl with alkyl in C1-C4, morpholinyl, pyridyl, naphthyl or phenyl optionally substituted by one or more radicals chosen from C1-C4 alkoxy, halogen, amino, alkylamino and dialkylamino; an aromatic cycle as defined above; a quinuclidine radical; a pyrrolidinyl radical itself optionally substituted by an alkyl or phenylalkyl radical with C1- alkyl C4; a piperazinyl radical itself possibly substituted by an alkyl, cycloalkyl or phenylalkyl; a morpholinyl radical; a radical pyridyl or a piperidyl radical optionally substituted by one or more alkyl radicals or phenylalkyl with C1-C4 alkyl; an indazolyl radical;
a naphthyl radical, a benzotriazole radical; a pyrimidinyl radical optionally substituted by one or several alkyls with C1-C4 alkyl; a radical acenaphthene, it being understood that when XR1R2 represents NR1R2, then R1 and R2 are not the same hydrogen or unsubstituted C1-C4 alkyl and R1 and R2 one does not represent hydrogen and the other unsubstituted C1-C4 alkyl or when X represents N or alkyl, R1 and R2 form together with X at which they are linked a radical chosen from among following radicals: piperazinyl or optionally substituted homopiperazinyl by one or more identical radicals or different; pyrrolidinyl optionally substituted by C1-C4 alkyl or alkoxy, hydroxy, acylamino, pyrrolidinylalkyl, pyridinyl and pyridyl; 1,2,3,4-tetra-hydroquinoline and 1,2,3,4-tetra-hydroisoquinolinyl; diazepine optionally substituted by alkyl or pyrrolidinyl-alkyl; piperidyl or piperidinyl optionally substituted with one or more radicals chosen from alkyl, alkoxy, alkoxyalkyl, pyrrolylalkyl, piperidinyl, piperidyl, hydroxy and cycloalkyl-alkyl;
morpholinyl; thiomorpholinyl;
imidazolinyl optionally substituted with alkyl, 13 - Compounds according to claim 9 characterized in that that XR1 (R2) is such that when X represents N, let one of R1 and R2 represents the hydrogen atom or a radical C1-C4 alkyl optionally substituted by a radical amino, alkylamino, dialkylamino or phenyl and the other of R1 and R2 is chosen from the values defined for R1 and R2 to any one of claims 1 to 8 or R1 and R2 form together with the nitrogen atom to which they are linked a piperazinyl or homopiperazinyl radical optionally substituted by one or more radicals chosen from alkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, phenylalkyl, alkoxyalkyl, hydroxyalkyl, dihydroxyalkyl, hydroxyalkoxyalkyl with C1-C6 alkoxy, imidazolylaminoalkyl, imidazolyl-alkylaminoalkyle, imidazolylhydroxyalkylaminoalkyle, pyridylalkyle, pyridinylalkyle, imidazopyridinylalkyle, pyrrolidinylalkyle, imidazolylalkyle optionally substituted by one or more alkyl or phenyl radicals, morpholinylalkyl, benzoimidazolalkyle optionally substituted by alkyl or hydroxyalkyl, C3- cycloalkyl C8, pyrazinyl, pyrimidinyl, pyridyl, piperidyl, furylcarbonyl, furfurycarbonyl, quinolyl or isoquinolyl; an optionally pyrrolidinyl radical substituted by C1-C4 alkyl or alkoxy, hydroxy, acylamino, pyrrolidinylalkyl, pyridinyl and pyridyl; a 1,2,3,4-tetrahydroquinoline linear 1,2,3,4- or tetrahydroisoquinolinyl; a diazepine radical optionally substituted by alkyl or pyrrolidinylalkyl; a piperidyl radical optionally substituted by one or more radicals chosen from alkyl, alkoxy, alkoxyalkyl, pyrrolylalkyl radicals, piperidinyl, hydroxy, cycloalkylalkyl and piperidyl;
a piperidinyl radical optionally substituted by piperidinyl; a morpholinyl or thio radical morpholinyl; an imidazolinyl radical optionally substituted by alkyl. 14 - Compounds according to claim 9 characterized in that that they meet the formula (I) below.
in which .

A represents an XR1 (R2) radical in which X represents a nitrogen atom, oxygen, sulfur or an alkyl radical in C1-C6 to form one of the radicals following:
.cndot. NR1R2 with identical R1 and R2 or different are chosen from the atom hydrogen; C1-C8 alkyl optionally substituted by an amino radical, alkylamino, dialkylamino, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino, C1-C4 alkoxy, C1- thioalkoxy C4, trifluoromethyl, pyrrolidinyl, piperidyl, piperazinyl, morpholinyl, pyridyl or phenyl;
an aromatic cycle as defined in claim 1; a quinuclidine radical, a pyrrolidinyl, piperazinyl, morpholinyl radical, pyridyl or a piperidyl radical optionally substituted by C1-C4 alkyl it being understood that identical R1 and R2 do not not both represent hydrogen or C1- alkyl Unsubstituted C4 and different R1 and R2 do not not one hydrogen and the other alkyl C1-C4 unsubstituted or when X represents N or alkyl, R1 and R2 together form X with which they are linked a 3- to 6-membered monocyclic radical or 8 to 10 membered saturated or unsaturated bicyclic possibly containing one or two heteroatoms identical or different chosen from N, O or S, .cndot. an OR1 or SR1 group in which R1 has the same meaning as before being understood that R1 does not represent hydrogen or C1-C4 alkyl unsubstituted, or .cndot. an alkyl group containing 1 to 6 atoms of carbon substituted by R1 R2 as defined above - R3 and R'3, identical or different, represent independently of each other hydrogen or a C1-C4 alkyl group - Ar1 and Ar2 identical or different represent * when Ar1 and Ar2 are identical:
.cndot. a quinoline motif possibly substituted by at least one N (Ra) (Rb) group in which Ra and Rb are identical or different represent hydrogen or a C1-C4 alkyl radical, (or) a group alkoxy or short chain alkyl containing 1 to 4 carbon atoms or .cndot. a quinoline having a nitrogen atom in quaternary form or .cndot. a benzamidine or .cndot. a pyridine attached in position -4 or fused with an aryl group or heteroaryl optionally substituted with a C1-C4 alkyl group * when Ar1 and Ar2 are different .cndot. Ar1 and Ar2 both represent one possibilities mentioned above for Ar1 and Ar2 or .cndot. Ar1 represents one of the possibilities below above and Ar2 represents a .noteq. phenyl nucleus possibly substituted by a halogen group, C1-C4 alkoxy, cyano, carbonylamino optionally substituted with one or several C1-C4 alkyl groups, guanyl, C1-C4 alkylthio, amino, C1-C4 alkylamino, C1- dialkylamino C4 for each alkyl, nitro, C1-C4 alkyleneamino, (or) C2-C4 alkenyleneamino, or a radicla piperazinyl optionally substituted by a C1-C4 alkyl radical, * a heterocyclic ring mono or bi or tricyclic with 0 to 2 heteroatoms per cycle provided that at least one heteroatom is present in at least a cycle possibly substituted by a or more C1-C4 alkyl groups or by C1-C4 alkylene groups or C2-C4 alkenylene or a salt thereof, these compounds of formula (I) being under all possible racemic isomeric forms, enantiomers and diastereoisomers. 15 - Compounds according to Claim 9, characterized in that that they correspond to formula (I) below:

in which:
A represents an XR1 (R2) radical in which X represents a nitrogen atom, oxygen, sulfur or an alkyl radical in C1-C6 to form one of the radicals following:

NR1R2 with identical R1 and R2 or different are chosen from the atom hydrogen; C1-C8 alkyl optionally substituted by an amino radical, alkylamino, dialkylamino, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino, C1-C4 alkoxy, C1-C4 thioalkoxy, trifluoromethyl, pyrrolidinyl, piperidyl, piperazinyl, morpholinyl, pyridyl or phenyl; an aromatic cycle as defined in claim 1; a quinuclidine radical, a radical pyrrolidinyl, piperazinyl, morpholinyl, pyridyle or a piperidyle radical optionally substituted with C1-C4 alkyl it being understood that identical R1 and R2 do not represent both hydrogen or unsubstituted C1-C4 alkyl and R1 and different R2 don't represent one hydrogen and the other unsubstituted C1-C4 alkyl or when X represents N or alkyl, R1 and R2 together form with X to which they are linked a radical monocyclic from 3 to 6 links or bicyclic from 8 to 10 saturated or unsaturated links possibly containing a or two identical or different heteroatoms chosen among N, O or S, .cndot. an OR1 or SR1 group in which R1 has the same meaning as before being understood that R1 does not represent hydrogen or C1-C4 alkyl unsubstituted, or .cndot. an alkyl group containing 1 to 6 atoms of carbon substituted by R1 R2 as defined above - R3 and R'3, identical or different, represent independently of each other hydrogen or a C1-C4 alkyl group - Ar1 and Ar2 identical or different represent * when Ar1 and Ar2 are identical:
.cndot. a quinoline motif possibly substituted by at least one N (Ra) (Rb) group in which Ra and Rb are identical or different represent hydrogen or a C1-C4 alkyl radical, (or) a group alkoxy or short chain alkyl containing 1 to 4 carbon atoms or .cndot. a quinoline having a nitrogen atom in quaternary form or .cndot. a benzamidine or .cndot. a pyridine attached in position -4 or fused with an aryl group or heteroaryl optionally substituted with a C1-C4 alkyl group * when Ar1 and Ar2, are different .cndot. Ar1 and Ar2 both represent one possibilities mentioned above for Ar1 and Ar2 or .cndot. Ar1 represents one of the possibilities below above and Ar2 represents * a phenyl ring possibly substituted by a halogen group, C1-C4 alkoxy, cyano, carbonylamino optionally substituted with one or several C1-C4 alkyl groups, guanyl, C1-C4 alkylthio, amino, C1-C4 alkylamino, C1- dialkylamino C4 for each alkyl, nitro, C1-C4 alkyleneamino, (or) C2-C4 alkenyleneamino, or a radicla piperazinyl optionally substituted by a C1-C4 alkyl radical, * a heterocyclic ring mono or bi or tricyclic with 0 to 2 heteroatoms per cycle provided that at least one heteroatom is present in at least a cycle possibly substituted by a or more C1-C4 alkyl groups or by C1-C4 alkylene groups or C2-C4 alkenylene or a salt thereof, these compounds of formula (I) being under all possible racemic isomeric forms, enantiomers and diastereoisomers. 16 - Compounds according to any one of claims 9 to 15 characterized in that A represents a radical XR1 (R2) in which X represents a nitrogen atom N to form NR1R2, an oxygen atom 0 to form OR1 or a sulfur atom S to form SR1 as following:
.cndot. NR1R2 with identical R1 and R2 or different are chosen from the atom hydrogen; C1-C8 alkyl optionally substituted by an amino radical, alkylamino, dialkylamino, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino, C1-C4 alkoxy, by a radical imidazolyle, pyrrolidinyle, pyridyle or by a phenyl radical; an aromatic cycle such as defined in claim 1; a radical quinuclidine, a pyrrolidinyl radical or a piperidyl radical optionally substituted by C1-C4 alkyl it being understood that identical R1 and R2 do not not both represent hydrogen or C1- alkyl Unsubstituted C4 and different R1 and R2 do not not one hydrogen and the other alkyl C1-C4 unsubstituted, or when X represents N, R1 and R2 form together with X to which they are linked a radical piperazinyl, piperidyl, pyrrolidinyl, morpholinyl or thiomorpholinyl, .cndot. or a group OR1 or SR1 in which R1 has the same meaning as before being understood that R1 does not represent hydrogen or unsubstituted C1-C4 alkyl, or a salt thereof, these compounds being in all of the possible racemic isomeric forms, enantiomers and diastereoisomers. 17 - Compounds according to any one of claims 9 to 15 characterized in that when A represents NR1R2 either one of R1 and R2 represents the hydrogen atom and the other of R1 and R2 is chosen from the defined values for R1 and R2 either R1 and R2 form together with the atom nitrogen to which they are linked a piperazinyl radical, pyrrolidinyl, piperidyl or morpholinyl optionally substituted by alkyl or piperidyl. 18 - Compounds according to any one of claims 1 to 17 characterized in that Ar1 and Ar2 represent a group chosen from the following groups: 4-amino- or 4-methylamino- or 4-dimethylaminoquinolyl, -isoquinolyl, quinolinium or isoquinolinium whose quinolyl nucleus, isoquinolyl, quinolinium or isoquinolinium est possibly substituted by one or more group (s) methyl linked to a carbon or nitrogen atom in the ring;
or phenyl optionally substituted by one or more halogen atoms. 19 - Compounds according to any one of claims 9 to 18 characterized in that group A represents:
either an amino radical substituted by a chosen radical from the following groups: 4-amino- or 4-methylamino-or 4-dimethylamino-quinolyl, -isoquinolyl, quinolinium or isoquinolinium including the quinolyl nucleus, isoquinolyl, quinolinium or isoquinolinium is optionally substituted by one or more methyl group (s) linked to a ring carbon or nitrogen atom; pyridyle;
phenyl optionally substituted by one or more halogen atoms or by a piperazinyl radical or alkylpiperazinyl; C1-C4 alkyl substituted with amino, alkylamino or dialkylamino radical, (phenyl) (alkyl) amino, (alkylphenyl) (alkyl) amino, alkoxy in C2-C4, by an alkylpiperazinylcarbonyl radical, imidazolyl, pyrrolidinyl or with a phenyl radical, radicals in which the alkyl groups have 1 to 4 carbon atoms; a pyrrolidinyl radical; a radical piperidyl optionally substituted with an alkyl radical in C1-C4; or a quinuclidine radical either a pyrrolidinyl radical, a morpholino radical or a piperazinyl radical optionally substituted by a C1-C4 alkyl or piperidyl radical, either an O-phenyl, O-pyridyl, or O-alkyl radical substituted by an amino, alkylamino or dialkylamino 20 - Compounds according to any one of claims 1 to 19 characterized in that when Ar1 and Ar2 are identical, Ar1 and Ar2 represent a group chosen from the groups 4-amino- or 4-methylamino- or 4-dimethylamino-quinolyl, -isoquinolyl, quinolinium or isoquinolinium whose nucleus quinolyle, isoquinolyl, quinolinium or isoquinolinium est possibly substituted by one or more group (s) methyl linked to a carbon or nitrogen atom in the ring. 21 - Compounds according to any one of claims 1 to 19 characterized in that Ar1 and Ar2 are different Ar1 represents:
.cndot. a quinoline or isoquinoline motif substituted by at least one N (Ra) (Rb) group in which Ra and Rb are identical or different represent hydrogen or a C1-C4 alkyl radical or a group alkoxy or short chain alkyl containing 1 to 4 carbon atoms or .cndot. a quinoline or isoquinoline having a nitrogen atom in quaternary form or .cndot. a benzamidine except in the case where A
represents diethylamine, hydrogen or an amine group or .cndot. a pyridine attached in position -4 or fused with an aryl group or heteroaryl Ar2 represents * a nucleus as defined above but different or * a phenyl ring possibly substituted by a halogen group, methoxy, cyano, carbonylamino, guanyl, methylthio, amino, methylamino, dimethylamino, morpholine, alkyleneamino in C1-C4 or alkenyleneamino in C2-C4 * a quinoline or isoquinoline nucleus, benzimidazole, indole, benzothiophene, benzofuran, benzothiazole, benzoxazole, carbazole, quinazoline, quinoxaline optionally substituted with one or several C1-C4 alkyl groups or by C1-C4 alkylene groups or C2-C4 alknylene 22 - Compounds according to any one of claims 9 to 21 characterized in that A represents an amino radical substituted by a radical chosen from the groups following: 4-amino- or 4-methylamino- or 4- radicals dimethylamino-quinolyl or quinolinium whose nucleus quinolinium is optionally substituted with a group methyl; C1-C4 alkyl radicals substituted by a amino, alkylamino, dialkylamino, (phenyl) (alkyl) radical amino, (alkylphenyl) (alkyl) amino, pyrrolidinyl or pyridyle; or the quinuclidine radical 23 - Compounds according to any one of claims 9 to 21 characterized in that A represents either a radical amino substituted by one or more radicals such as defined in any one of claims 9 to 21 either a piperazinyl, homopiperazinyl, piperidinyl radical or pyrrolidinyl optionally substituted with one or more several radicals as defined in any one from claims 9 to 21 24 - Compounds according to any one of claims 9 to 21 characterized in that A represents a radical O (or S) -aromatic cycle or an O (or S) -alkyl radical with optionally substituted alkyl. 25 - Compounds according to any one of claims 9 to 21 characterized in that A represents a radical O-phenyl, O-pyridyl, O-pyrimidinyl or O-alkyl substituted by an amino, alkylamino or dialkylamino or an S-phenyl, S-pyridyl, S- radical pyrimidyl or S quinoleinyl. 26 - Compounds according to any one of claims 1 and 2 responding to the following products:

- 3,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (3-dimethylamino-propyl) amino- [1,3,5] triazine (example 1) - 2,4,6-tris- (4-amino-2-methyl-quinolin-6-yl) amino-[1,3,5] triazine (example 2) - 2,4-bis- (4-amino-2-methyl-quinolin-6-yl) amino-6- (4-dimethylamino-2-methyl-quinolin-6-yl) amino [1,3,5] triazine (example 11) - 2,4-bis- (4-amino-2-methyl-quinolin-6-yl) amino-6-(quinuclidin-3-yl) amino- [1,3,5] triazine (example 17) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (1-methyl-piperidin-4-yl) - [1,3,5] triazine (example 19) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (1-methyl-piperazin-4-yl) - [1,3,5] triazine (example 20) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (pyridin-4-yl) methylamino- [1,3,5] triazine (example 27) - 2,4-bis- (4-amino-2-methyl-quinolin-6-yl) amino-6-phenoxy- [1,3,5] triazine (example 29) - 2,4-bis- (4-amino-2-methyl-quinolin-6-yl) amino-6- (3-dimethylamino-propyl) oxy- [1,3,5] triazine (example 31) - 2,4-bis- (4-amino-2-methyl-quinolin-6-yl) amino-6-(pyridin-4-yl) oxy- [1,3,5] triazine (example 32) - 2,4-bis- (4-amino-2-methyl-quinolin-6-yl) amino-6-(phenylmethyl) oxy- [1,3,5] triazine (Example 33). 27 - Compounds according to any one of claims 1 and 2 responding to the following products:
- 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (3-dimethylamino-propyl) amino- [1,3,5] triazine (example 1) - 2,4,6-tris- (4-amino-2-methyl-quinolin-6-yl) amino-[1,3,5] triazine (example 2) - 2,4-bis- (4-amino-2-methyl-quinolin-6-yl) amino-6- (4-dimethylamino-2-methyl-quinolin-6-yl) amino [1,3,5] triazine (example 11) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (1-methyl-piperazin-4-yl) - [1,3,5] triazine (example 20) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (pyridin-4-yl) oxy- [1,3,5] triazine (example 115) - 2,4-bis- (4-amino-2-methyl-quinolin-6-yl) amino-6-(quinolin-2-yl) thio- [1,3,5] triazine (example 128) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6-phenyl- [1,3,5] triazine (example 134) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [1- (2-dipropylamino-ethyl) piperazin-4-yl] -[1,3,5] triazine (example 137) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6 - {[1-2- (2-hydroxyethyl) oxy-ethyl] piperazin-4-yl} - [1,3,5] triazine (example 141) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [2 (S) - (pyrrolidin-1-yl) methyl-pyrrolidin-1-yl] - [1,3,5] triazine (example 149) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (quinolin-2-yl) thio- [1,3,5] triazine (example 133) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (1-methyl-homopiperazin-4-yl) - [1,3,5] triazine (example 135) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [1- (3-dimethylamino-propyl) -piperazin-4-yl] -[1,3,5] triazine (example 136) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [N- (1-methyl-piperidin-4-yl) -N-methyl-amino] -[1,3,5] triazine (example 138) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- {1- [3- (pyrrolidin-1-yl) propyl-homopiperazin-4-yl) - [1,3,5] triazine (example 139) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [1- (pyridin-4-yl) -piperazin-4-yl] -[1,3,5] triazine (example 144) 28 - Compounds according to any one of claims 1 and 2 responding to the following products:

- 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (1-methyl-piperazin-4-yl) - [1,3,5] triazine (example 20) - 2,4-bis- (4-dimethylamino-quinolin-6-yl) amino - 6- (quinolin-2-yl) thio- [1,3,5] triazine (example 133) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- (1-methyl-homopiperazin-4-yl) - [1,3,5] triazine (example 135) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [1- (3-dimethylamino-propyl) -piperazin-4-yl] -[1,3,5] triazine (example 136) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [N- (1-methyl-piperidin-4-yl) -N-methyl-amino] -[1,3,5] triazine (example 138) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- {1- [3- (pyrrolidin-1-yl) propyl-homopiperazin-4-yl) - [1,3,5] triazine (example 139) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [1- (pyridin-4-yl) -piperazin-4-yl] -[1,3,5] triazine (example 144) 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [4- (piperidin-4-yl) -piperazin-1-yl] -[1,3,5] triazine (example 199) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6- [4- (piperidin-1-y1) butyl] amino- [1,3,5] triazine (example 200) - 2,4-bis- (4-dimethylamino-2-methyl-quinolin-6-yl) amino-6 - [(imidazol-1-yl) methyl] amino- [1,3,5] triazine (example 202) 29 - Pharmaceutical compositions comprising as active ingredient a product according to claim 1 or 2. 30 - Pharmaceutical compositions comprising as active ingredient a product according to claims 26, 27 or 28. 31 - Compounds of claim 1 or 2 characterized in what they have telomerase inhibitory activity. 32 - Compounds according to any one of the claims previous characterized in that they have an activity cancer. 33 - Use of the compounds of claim 32 as a pharmaceutical product for human use. 34 - Therapeutic associations made up of a compound according to claim 1 or 2 and another compound cancer. 35 - Associations according to claim 34 characterized in that the anticancer compound is chosen from alkylating agents, platinum derivatives, agents antibiotics, antimicrotubule agents, anthracyclines, group I and II topoisomerases, fluoropyrimidines, cytidine analogs, adenosine analogs, enzymes and various compounds such as L-asparaginase, hydroxyurea, trans-retinoic, suramin, irinotecan, topotecan, dexrazoxane, amifostine, herceptin as well as oetrogenic, androgenic hormones, agents antivascular. 36 - Therapeutic association made up of a compound according to claim 1 or 2 and radiation. 37 - Associations according to any one of claims 34 to 36 characterized in that each of compounds or treatments is administered simultaneously, separately or sequentially.