CA2514105A1 - Chemical derivatives binding very specifically with g-quadruplex dna structures and use thereof as a specific anti-cancer agent - Google Patents

Abstract

The present invention relates to cancer therapy and relates to novel anticancer agents having a very particular mechanism of action. It also concerns new chemical compounds as well as their therapeutic application in humans. The present invention describes the preparation of heterocyclic diamides of the following general formula (IB), as highly specific DNA ligands in G-quadruplex and their use as telomerase inhibitors: (IB) Nitrogen aromatic ring having a nitrogen atom in form quaternary - (NR¿3?) p - CO- dispatcher - (CO) m - (NR ~ ¿3?) q -X- aromatic or nonaromatic ring.

Description

CHEMICAL DERIVATIVES BINDING IN A VERY SPECIFIC MANNER
DNA STRUCTURES IN G-QUADRUPLEX AND THEIR APPLICATION
AS SPECIFIC ANTICANCER AGENT
The present invention relates to cancer therapy and relates to new anti-cancer agents with a specific mechanism of action.
It also concerns a selection of chemical compounds as well as their therapeutic application in humans.
The present invention relates to the use of novel chemical compounds non-nucleotides that interact with specific structures of deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). These new compounds consist of a two-group binding agent nitrogenous heteroaromatics of which at least one of the nitrogen atoms is quaternized form. They are particularly useful for stabilizing way very selective folded DNA in G-quadruplex structure (guanine tetrads), as well when the G-quadruplex is formed by one, two or four strands DNA. These new compounds are useful in the treatment of cancers and in particular act as inhibitors of telomerase.
The therapeutic application of telomerase inhibition via the stabilization of these G-quadruplexes can be either the arrest of cell mitosis and the death rapidly dividing cells within one to a few weeks by a mechanism of deprotection of telomeric DNA, namely the induction of senescence of cancer cells, ~ as a result of shortening progressive telomeric DNA (Oncogene 2002, 21, 553-63;
2002, 21, 592-97).
Another therapeutic application, in the treatment of cancer, of stabilization of G-quadruplex DNA structures can be done by inactivation of promoter regions, rich in guanine repeats, oncogenes such as c-myc (J. Biol Chem 2001, 276, 4640-46, Proc Natl.
Acad. Sci. USA 2002, 99, 11593-98), H ras or h-TERT.
Another therapeutic application, in the treatment of cancer, of stabilization of DNA structures in G-quadruplexes may be the inhibition of specific helicases of the G-quadruplex DNA structures involved during mitosis. These helicases are also directly involved in various genetic diseases such as Bloom's syndromes (Cell 1995,

2.
83, 655-66), by Werner (Science 1996, 272, 258-62), Rothmund-Thomson (Nature Genetics 1999, 22, 82-4) or ataxia telangiectaxis.
In particular, the compounds of the present invention have the advantage from a therapeutic point of view to block telomerase. From the point of view telomerase allows the addition of repeated DNA sequences from the TTAGGG type, called telomeric sequences, at the end of the telomere, during cell division. By this action telomerase makes the cell immortal. Indeed, in the absence of this enzymatic activity, the cell loses each division 100 to 150 bases, which makes it quickly senescent. During the appearance of rapidly dividing cancer cells, appeared that these cells had telomeres maintained at a stable length during cell division. In these cells cancerous it was found that telomerase was highly activated and that allowed the addition of repeating units of telomeric sequences at the end of telomere and thus allowed the preservation of the length of the telomere. II is appeared for some time that more than 85% of cancer cells presuppose positive tests for the presence of telomerase while Somatic cells do not exhibit this characteristic.
Telomerase is thus a very coveted target to treat cells cancerous. The first obvious approach to blocking telomerase has the use of nucleotide structures (Natl Acad Sci USA

93, 2635-39). Since various approaches have been developed for inhibit telomerase (PharmExp 2002, 8, 2491-504). Among these approaches, the development of G-quadruplex DNA ligands elicits a growing interest (blini Rev, Med Chem.2003, 3, 11-21).
We can note the demonstration of telomestatin, a molecule capable of to attach to a G-quadruplex DNA structure, very selectively compared to double-stranded DNA (J. Amer Chem Soc 2001, 123, 1262-63).
A highly selective molecule of DNA in G-quadruplex will present the double benefit of targeting DNA structures in G-quadruplex while avoiding undesirable toxicity mechanisms related to non-binding selective on the genome.
Patent WO 0296903 describes the preparation of heterocyclic diamides of following general formula (I), as G-quadruplex DNA ligands and their use as telomerase inhibitors

3 (1) Nitrogenous aromatic ring - (NR3) p - (CO) n - dispatcher - (CO) m - (NR'3) q -aromatic or non-aromatic cycle with n, m, p and q identical or different represent the integer 0 or 1, in which ~ the nitrogenous aromatic cycle represents A quinoline optionally substituted by at least a group N (Ra) (Rb) in which Ra and Rb, identical or different represent hydrogen or a C1-C4 alkyl radical or a short-chain alkyl or alkoxy group of C1-C4 or A quinoline having a nitrogen atom in the form of quaternary or 0 a benzamidine or 0 a pyridine The aromatic or non-aromatic cycle represents A quinoline optionally substituted by at least a group N (Ra) (Rb) in which Ra and Rb, identical or different represent hydrogen or a C1-C4 alkyl radical or a C1-C4 short-chain alkyl or alkoxy group or A quinoline having a nitrogen atom in the form of quaternary or 0 a benzamidine or 0 a pyridine or A phenyl ring optionally substituted with a halogen group, C1-C4 alkoxy, cyano, carbonylamino optionally substituted with one or several C 1 -C 4 alkyl groups, guanyl, alkylthio C1-C4, amino, C1-C4 alkylamino, C1-dialkylamino C4 for each alkyl, nitro, alkyleneamino group C1-C4 or alkenyleneamino C2-C4 or An aromatic or non-aromatic heterocyclic ring mono or bi or tricyclic having 0 to 2 heteroatoms

4 per cycle provided that at least one heteroatom is present in at least one optionally substituted cycle by one or more C 1 -C 4 alkyl groups or by C1-C4 alkylene or C2-C4 alkenylene groups ~ R3 and R'3, identical or different, represent independently of one another hydrogen or an alkyl radical in C1-C4 ~ the dispatcher represents A triazine group optionally substituted with one or several radicals chosen from halogen atoms, alkyl radicals having 1 to 4 carbon atoms and thio, oxy or amino radicals themselves substituted with one or more chain alkyl chains short containing 1 to 4 carbon atoms or A heterocyclic radical containing 5 to 6 members containing an atom of sulfur, oxygen or nitrogen Phenyl, -NH-phenyl-NH-, -NH-phenyl-CH2-NH-, -NH-CH2-phenyl-CH2-NH-, -NH-CH2-phenyl-NH-, -CH2-phenyl-CH2-, -CH2-phenyl, -phenyl-CH2-, -CH2-thienyl-, -thienyl-CH2-, the radical -CH = CH-, or 0 a diazine group, heterocyclic radicals, phenyl, -NH-phenyl-NH-, -NH-phenyl-CH 2 -NH-, -NH-CH 2 -phenyl-CH 2 -NH-, -NH-CH 2 -phenyl-NH-, -CH2-phenyl-CH2-, -CH2-phenyl, -phenyl-CH2-, -CH2-thienyl-, -thienyl-CH2-, the radical -CH = CH-, and diazine being possibly substituted by the same groups as triazine it being understood that when the distributor represents phenyl substituted by NH2, that n, m, p and q represent 1 and R3 and R3 'represent hydrogen then the nitrogenous aromatic ring and the aromatic ring does not both represent unsubstituted or substituted quinoline on its nitrogen atom with an alkyl radical containing 1 to 6 carbon atoms, or one of its salts and when the dispatcher represents a triazine and p and q both represent the integer 1, so n and m do not represent both the integer 0.

The present invention describes the preparation of heterocyclic diamides of following general formula (IB), as highly specific DNA ligands in G-quadruplex and their use as telomerase inhibitors (IB)

5 nitrogenous aromatic ring having a nitrogen atom in the form of quaternary - (NR3) p - CO- dispatcher - (CO) m - (NR'3) q X- cycle aromatic or non-aromatic with m, p and q identical or different represent the integer 0 or 1, in which the nitrogenous aromatic ring having a quaternary atom, represent A quinoline optionally substituted by at least a group N (Ra) (Rb) in which Ra and Rb, identical or different represent hydrogen or a C1-C4 alkyl radical or a short-chain alkyl or alkoxy group of C1-C4 or 0 and whose nitrogen atom is quaternized by a chain C1-C4 alkyl, optionally substituted by a hydroxy radical, carboxy; C1-C4 alkoxy, C1-C4 alkylthio, amino, alkylamino C1-C4, C1-C4 dialkylamino for each alkyl group, ~ the aromatic or non-aromatic cycle represents A quinoline optionally substituted by at least a group N (Ra) (Rb) in which Ra and Rb, identical or different represent hydrogen or a C1-C4 alkyl radical or a C1-C4 short-chain alkyl or alkoxy group or A quinoline having a nitrogen atom in the form of quaternary or 0 a benzamidine or 0 a pyridine or A phenyl ring optionally substituted with a halogen group, C1-C4 alkoxy, cyano, carbonylamino optionally substituted with one or several C 1 -C 4 alkyl groups, guanyl, alkylthio

6 C1-C4, amino, C1-C4 alkylamino, C1-dialkylamino C4 for each alkyl, nitro, alkyleneamino group C1-C4 or alkenyleneamino C2-C4 or An aromatic or non-aromatic heterocyclic ring mono or bi or tricyclic having 0 to 2 heteroatoms per cycle provided that at least one heteroatom is present in at least one optionally substituted cycle by one or more C 1 -C 4 alkyl groups or by C1-C4 alkylene or C2-C4 alkenylene groups, and whose heteroatom, when it represents a nitrogen atom, can be optionally in quaternary form.
~ R3 and R'3, identical or different, represent independently of one another hydrogen or an alkyl radical C1-C4 or aralkyl, the alkyl part of which is C1-C4.
~ X represents a single bond, or a straight alkyl radical or branched C1-C4, a C2-C4 alkenyl radical, a radical C2-C4 alkynyl or a phenyl radical.
~ the dispatcher represents A heterocyclic radical containing 5 to 6 members containing an atom of sulfur, oxygen or nitrogen A phenyl radical, or A diazine or triazine group, the heterocyclic radicals, phenyl, diazine or triazine being optionally substituted with one or more radicals selected from halogen atoms, alkyl radicals having 1 to 4 carbon atoms and thio, oxy or amino radicals themselves optionally substituted by a or more short chain alkyl chains containing 1 to 4 carbon atoms carbon.
Said products of formula (IB) may in all isomeric forms possible racemic, enantiomeric and diastereoisomeric, as well as salts of addition with mineral and organic acids or with bases inorganic and organic of said products of formula (IB).
In the compounds described in the present invention the term "alkyl or alk radical" denotes a linear or branched radical containing not more than 12 carbon atoms selected from methyl radicals, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, WO 2004/07202

7 PCT / FR2004 / 000260 isopentyl, sec-pentyl, tert-pentyl, neo-pentyl, hexyl, isohexyl, sec-hexyl, tert-hexyl and also heptyl, octyl, nonyl, decyl, undecyl and dodecyl, and their linear or branched positional isomers, In particular, alkyl radicals having at most 6 carbon atoms are carbon and in particular the methyl, ethyl, propyl and isopropyl radicals, butyl, isobutyl, terbutyl, linear or branched pentyl, linear hexyl or branched.
the term alkenyl radical denotes a linear or branched radical containing at most 12 carbon atoms and preferably 4 carbon atoms carbon selected for example from the following values: ethenyl or vinyl, propenyl or allyl! 1-propenyl, n-butenyl, i-butenyl, 3-methylbut-2-enyl, n-pentenyl, hexenyl, heptenyl, octenyl, cyclohexylbutenyl and decenyl as well as their linear or branched positional isomers.
Among the alkenyl values, allyl values are more particularly or butenyl.
the term alkynyl radical denotes a linear or branched radical containing at most 12 carbon atoms and preferably 4 carbon atoms carbon selected for example from the following values: ethynyl, propynyl or propargyl, butynyl, n-butynyl, i-butynyl, 3-methylbut-2-ynyl, pentynyl or hexynyl as well as their linear positional isomers or branched.
Among the alkynyl values, mention is more particularly made of the value propargyl.
the term "aryl radical" denotes unsaturated, monocyclic radicals or consisting of fused, carbocyclic rings. As examples of such aryl radical, mention may be made of phenyl or naphthyl radicals, More particularly, the phenyl radical is mentioned.
- arylalkyl means the radicals resulting from the combination of previously substituted alkyl radicals and radicals aryls also cited above, which may be substituted:
benzyl, phenylethyl, 2-phenethyl and triphenylmethyl radicals or naphthyleneemethyl.
the term heterocyclic radical denotes a saturated carbocyclic radical (heterocycloalkyl) or unsaturated (heteroaryl) consisting of up to 6 members interrupted by one or more heteroatoms, identical or different, selected from oxygen, nitrogen or sulfur atoms.
As heterocycloalkyl radicals, mention may in particular be made of radicals

8 dioxolane, dioxane, dithiolane, thiooxolane, thiooxane, oxiranyl, oxolanyl, dioxolanyl, piperazinyl, piperidinyl, pyrrolidinyl, imidazolidinyl, pyrazolidinyl, morpholinyl or tetrahydrofuryl, tetrahydrothienyl, chromanyl, dihydrobenzofuranyl, indolinyl, piperidinyl, perhydropyranyl, pyrindolinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl or thioazolidinyl, all these radicals being optionally substituted.
Among the heterocycloalkyl radicals, mention may in particular be made of radicals optionally substituted piperazinyl, optionally substituted piperidinyl, optionally substituted pyrrolidinyl, imidazolidinyl, pyrazolidinyl, morpholinyl or thioazolidinyl.
By heterocycloalkylalkyl radical is meant radicals in which the heterocycloalkyl and alkyl residues have the above meanings Among the 5-membered heteroaryl radicals, mention may be made of furyl radicals such as 2-furyl, thienyl such as 2-thienyl and 3-thienyl, pyrrolyl, diazolyl, thiazolyl, thiadiazolyl, thiatriazolyl, isothiazolyl, oxazolyl oxadiazolyl, S
or 4-isoxazolyl, imidazolyl, pyrazolyl, isoxazolyl.
Among the 6-membered heteroaryl radicals, mention may in particular be made of pyridyl radicals such as 2-pyridyl, 3-pyridyl and 4-pyridyl, pyrimidyl, pyrimidinyl, pyridazinyl, pyrazinyl and tetrazolyl.
As condensed heteroaryl radicals containing at least one heteroatom chosen from sulfur, nitrogen and oxygen, mention may be made of benzothienyl example such as 3-benzothienyl, benzofuryl, benzofuranyl, benzopyrrolyl, benzimidazolyl, benzoxazolyl, thionaphthyl, indolyl, purinyl, quinolinyl, isoquinolinyl and naphthyridinyl.
Among the fused heteroaryl radicals, mention may be made of especially the benzothienyl, benzofuranyl, indolyl or quinolinyl, benzimidazolyl, benzothiazolyl, furyl, imidazolyl, indolizinyl, isoxazolyl, isoquinolinyl, isothiazolyl, oxadiazolyl, pyrazinyl, pyridazinyl, pyrazolyl, pyridyl, pyrimidinyl, pyrrolyl, quinazolinyl, 1,3,4 thiadiazolyl, thiazolyl, thienyl and triazolyl groups, these radicals being optionally substituted as indicated for the heteroaryl radicals.
In the products of formula (IB) as defined above, mention is made more especially those for which R3 and R'3, identical or different, independently of one another represent hydrogen or an alkyl radical C1-C4 or aralkyl in which the alkyl radical is C1-C4, X represents

9 a single bond, a C1-C4 alkyl radical, an alkenyl radical or alkynyl C2-C4 or a phenyl radical, the other substituents being chosen from the values given above.
For the purposes of the above formula, the term "aromatic nitrogen ring" means heterocycle having at least one nitrogen atom or an aromatic group having no heteroatom in the ring but containing at least one nitrogen atom in a hydrocarbon chain linked to the ring as per example a guanidino chain or guanyl.
It is obvious that quinoline units can be substituted by any other group not involved in the intended application, as well as acridin groups or isoquinolines or quinazolines or quinoxalines or phthalazines or benzothiazines or benzoxazines or phenoxazines or phenothiazines are included in the definition of quinoline groups.
Among the above compounds, those having a dispatcher selected from heterocyclic groups such as for example pyridyl, or thienyl, a phenyl radical, a diazine or a triazine, diazine groups it is preferred to use pyridazines.
Particularly preferred among all of the above compounds are those having a meta-disubstituted splitter by the groups "cycle nitrogenous aromatic having a nitrogen atom in quaternary form (NR3) p - CO "and" (CO) m - (NR'3) q - aromatic ring or not as defined above and in which the distributor is of more optionally substituted by a halogen atom.
Among the above compounds, those having a meta-disubstituted dispatcher with the groups "aromatic nitrogen cycle"
possessing a quaternary nitrogen atom - (NR3) p - CO "and (CO) m - (NR'3) q - aromatic or nonaromatic ring "as defined above above.
Among the compounds of the present invention, it is particularly preferred to compounds whose heterocycle in quaternary form is a quinoline.
Among the compounds of the present invention, it is particularly preferred to compounds defined above characterized in that m, p and q represent the whole 1.
Among the compounds of the present invention, it is particularly preferred compounds whose distributor represents a 2,6-disubstituted pyridine or pyridazine-2-6-disubstituted by "aromatic ring" groups nitrogen having a quaternary nitrogen atom in quaternary form - (NR3) p - CO "and" (CO) m - (NR'3) q - aromatic ring or not aromatic "and whose quaternized heterocycle is an N-methyl-quinolinium, 5 and in which the dispatcher is furthermore optionally substituted by a halogen atom.
Among the compounds of the present invention, it is especially preferred compounds whose distributor represents a 2,6-disubstituted pyridine or pyridazine-2-6-disubstituted by aromatic ring groups

Nitrogen containing a quaternary nitrogen atom in quaternary form - (NR3) p - CO "and" (CO) m - (NR'3) q - aromatic ring or not aromatic "and whose quaternized heterocycle is an N-methyl-quinolinium.
The present invention particularly relates in particular to the products of formula (IB) as defined above characterized in that they meet in formula (la) below OAO
m ~ NR3) P ~ NR3) q ira) Are X
Ar 2 with m, p and q identical or different represent the integer 0 or 1 ~ A represents:
A heterocyclic radical containing 5 to 6 members containing an atom of sulfur, oxygen or nitrogen A phenyl radical, or A diazine or triazine group, the heterocyclic radicals, phenyl, diazine or triazine being optionally substituted with one or more radicals selected from halogen atoms, alkyl radicals having 1 to 4 carbon atoms and thio, oxy or amino radicals, which may themselves be substituted by a or more short chain alkyl chains containing 1 to 4 carbon atoms carbon, - Are and Ar2 identical or different represent when Are and Ar2 are identical, they represent a nitrogenous aromatic cycle

11 possessing a quaternary atom represented by a quinoline possibly substituted by at least a group N (Ra) (Rb) in which Ra and Rb, identical or different represent hydrogen or a C1-C4 alkyl radical or a short-chain alkyl or alkoxy group of C1-C4 or 0 and whose nitrogen atom is quaternized by a chain C1-C4 alkyl, optionally substituted by a hydroxy radical, carboxy, C1-C4 alkoxy, C1-C4 alkylthio, amino, alkylamino C1-C4, C1-C4 dialkylamino for each alkyl group, when Are and Ar2 are different Are represents one of the possibilities above and Ar2 represents a phenyl ring optionally substituted by a halogen group, C 1 -C 4 alkoxy, cyano, carbonylamino optionally substituted with one or several C 1 -C 4 alkyl, guanyl, C 1 -C 4 alkylthio, amino, C1-C4 alkylamino, C1-C4 dialkylamino for each alkyl group, nitro, C 1 -C 4 alkyleneamino or C 2 -C 4 alkenyleneamino a benzamidine ~ a pyridyl nucleus an aromatic or nonaromatic heterocyclic ring mono or bi or tricyclic compound having 0 to 2 heteroatoms per ring provided that at least a heteroatom is present in at least one cycle substituted with one or more C1-C4 alkyl groups or by groups C1-C4 alkylene or C2-C4 alkenylene, ~ R3 and R'3, identical or different, represent independently of one another hydrogen or an alkyl radical C1-C4 or aralkyl in which the alkyl radical is C1-C4, ~ X represents a single bond, a C1-C4 alkyl radical, a C 2 -C 4 alkenyl or alkynyl radical or a phenyl radical, said products of formula (Ia) being in all isomeric forms possible racemic, enantiomeric and diastereoisomeric, as well as salts of addition with mineral and organic acids or with bases inorganic and organic of said products of formula (Ia).

12 The subject of the present invention is thus the products of formula (Ia) such that defined above in which X represents a C 1 -C 4 alkyl radical, the other substituents of the products of formula (Ia) being chosen from values indicated above, said products of formula (Ia) being in all isomeric forms possible racemic, enantiomeric and diastereoisomeric, as well as salts of addition with mineral and organic acids or with bases inorganic and organic of said products of formula (Ia).
The subject of the present invention is thus the products of formula (Ia) such that defined above wherein characterized in that A is selected from heterocyclic groups, such as, for example, pyridyl or thienyl, a radical phenyl, a diazine or a triazine as defined above.
The subject of the present invention is thus the products of formula (Ia) such that defined above characterized in that the diazine groups that can represent A are pyrazines.
The present invention thus particularly relates to the products of formula (la) as defined above characterized in that A is meta disubstituted by the groups "nitrogenous aromatic ring having a Nitrogen atom in quaternary form - (NR3) p - CO "and" (CO) m - (NR'3) q -aromatic or nonaromatic cycle 'as defined above and in which A is further optionally substituted by a halogen atom.
The subject of the present invention is thus the products of formula (Ia) such that defined above, characterized in that A is meta-disubstituted by the Nitrogen aromatic ring groups having a nitrogen atom quaternary form = (NR3) p - CO "and" (CO) m - (NR'3) q - aromatic ring or non-aromatic "as defined above.
The subject of the present invention is thus the products of formula (Ia) such that defined above characterized in that the heterocycle in quaternary form is a quinoline.
The present invention thus particularly relates to the products of formula (la) as defined above characterized in that A represents 2,6-disubstituted pyridine or pyridazine-2-6-disubstituted by

13 Nitrogen aromatic ring groups having a nitrogen atom quaternary form - (NR3) p - CO "and" (CO) m - (NR'3) q aromatic or non-aromatic ring "and whose quaternized heterocycle is N-methyl-quinolinium, and in which A is optionally substituted by a halogen atom.
The subject of the present invention is thus the products of formula (Ia) such that defined above characterized in that A st represents a pyridine-2,6-disubstituted or pyridazine-2-6-disubstituted by "ring" groups nitrogenous aromatic having a quaternary nitrogen atom in the form of quaternary - (NR3) p - CO "and" (CO) m - (NR'3) q - aromatic ring or non-aromatic "and whose quaternized heterocycle is an N-methyl-quinolinium.
The subject of the present invention is thus the products of formula (Ia) such that defined above characterized in that p and q represent the integer 1.
The subject of the present invention is thus the products of formula (Ia) such that defined above characterized in that m, p and q represent the integer 1.
The subject of the present invention is in particular the products of formula (Ia) such as defined above characterized in that Ar2 represent a group selected from the following groups: 4-amino- or 4-methylamino-, 4-dimethylamino- or 4-alkoxyquinolyl or quinolinium whose core quinolinium is optionally substituted by one or two groups) methyl.
The subject of the present invention is in particular the products of formula (Ia) such defined above characterized in that R3 and R3 'represent hydrogen.
The subject of the present invention is particularly the products of formula (IB) as defined above whose names follow:
2,6-pyridine-dicarboxylic acid-bis - [(1-methyl-quinolinium) diodide yl) amide]
2,6-pyridinedicarboxylic acid-2 - [(1-methyl-quinolinio) -6-diodide yl) amide] -6 - [(4-dimethylamino-1-methyl-quinaldinio-6-yl) -amide].
2,6-pyrazine-dicarboxylic acid-bis - [(1-methyl-quinolinium) diodide yl) amide]

14 1,3-benzenedicarboxylic acid-bis - [(1-methyl-quinolinio) -6-diiodide yl) amide]
2,6-pyridine-dicarboxylic acid-bis - [(1-methyl-quinaldinium) diodide yl) amide]
- iodide of 2,6-pyridine-2-dicarboxylic acid - [(1-methyl-quinolinium-6) yl) amide] -6 - [(4-aminoquininaldin-6-yl) amide], isolated in its tautomeric form imino below 2,6-benzenedicarboxylic acid-bis - [(1-methyl-quinaldinium) diodide 6-yl) -amide]
2,4-pyridine-dicarboxylic acid-bis- [(1-methyl-quinolin-6) diodide yl) amide]
- iodide of 2,6-pyridine-2-dicarboxylic acid - [(1-methyl-quinolinium-6) yl) amide] -6 - [(1-methyl-quinolinio-3-yl) -amide], - iodide of 2,6-pyridine-2-dicarboxylic acid - [(1-methyl-quinolinium-6) yl) amide] -6 - [(1-methyl-quinolinio-5-yl) amide]
2,6-pyridine-dicarboxylic acid-bis - [(1-methyl-quinolinium) diodide yl) amide]
2,6-pyridinedicarboxylic acid-2 - [(1-methyl-quinolinio) -6-diodide yl) amide] -6- [2 (-1-methyl-piperidin-1-yl) ethylamide] - iodide of the acid 2,6 pyridine dicarboxylic-2 - [(1-methyl-quinolinio-3-yl) -amide] -6- [quinolin-3-yl) amide]
2,6-pyridinedicarboxylic acid-2 - [(1-methyl-quinolinio) -3-diodide) yl) -amide] -6- [1- (2-hydroxyethyl) quinolinio-3-yl) -amide]
- 4-bromo-2,6-pyridine-dicarboxylic acid-bis - [(1-methyl) diodide quinolinio-3-yl) -amide]
said products of formula (I) being in all isomeric forms possible racemates, enantiomers and diastereoisomers, as well as the addition salts with mineral and organic acids or with mineral bases and organic compounds of said formula (I).
The present invention thus particularly relates to the products of formula (IB) as defined above whose names follow 2,6-pyridine-dicarboxylic acid-bis - [(1-methyl-quinolinium) diodide yl) amide]
2,6-pyridinedicarboxylic acid-2 - [(1-methyl-quinolinio) -6-diodide yl) amide] -6 - [(4-dimethylamino-1-methyl-quinaldinio-6-yl) -amide].

2,6-pyrazine-dicarboxylic acid-bis - [(1-methyl-quinolinium) diodide yl) amide]
1,3-benzenedicarboxylic acid-bis - [(1-methyl-quinolinio) -6-diiodide yl) amide]
5 - the 2,6-pyridine-dicarboxylic acid-bis - [(1-methyl) diodide quinaldinio-6-yl) amide]
- iodide of 2,6-pyridine-2-dicarboxylic acid - [(1-methyl-quinolinium-6) yl) amide] -6 - [(4-aminoquininaldin-6-yl) amide], isolated in its tautomeric form imino below The 2,6-benzene-dicarboxylic acid bis-[(1-methyl) diiodide quinaldinio-6-yl) -amide]
2,4-pyridine-dicarboxylic acid-bis - [(1-methyl-quinolin-6) diodide yl) amide]
- iodide of 2,6-pyridine-2-dicarboxylic acid - [(1-methyl-quinolinium-6)

(Yl) amide] -6 - [(1-methyl-quinolinio-3-yl) amide]
- iodide of 2,6-pyridine-2-dicarboxylic acid - [(1-methyl-quinolinium-6) yl) amide] -6 - [(1-methyl-quinolinio-5-yl) amide]
2,6-pyridine-dicarboxylic acid-bis - [(1-methyl-quinolinium) diodide yl) amide] - iodide of 2,6-pyridine-2-dicarboxylic acid - [(1-methyl) quinolinio-3-yl) -amide] -6- [quinolin-3-yl) -amide]
2,6-pyridinedicarboxylic acid-2 - [(1-methyl-quinolinio) -3-diodide) yl) -amide] -6- [1- (2-hydroxyethyl) quinolinio-3-yl) -amide]
- 4-bromo-2,6-pyridine-dicarboxylic acid-bis - [(1-methyl) diodide quinolinio-3-yl) -amide]
or the salts or other salts of these compounds said products of formula (I) being in all isomeric forms possible racemic, enantiomeric and diastereoisomeric, as well as salts of addition with mineral and organic acids or with bases mineral and organic of said products of formula (I).
The subject of the present invention is therefore the product of formula (IB) below 2,6-pyridine-2-dicarboxylic acid - [(1-methyl-quinolinio-6) diodide yl) amide] -6- [2- (1-methyl-piperidinio-1-yl) ethylamide]
this product of formula (I) being in all possible isomeric forms racemates, enantiomers and diastereoisomers, as well as the addition salts

16 with mineral and organic acids or with mineral bases and organic The subject of the present invention is also a process for the preparation of products of formula (IB) according to the present invention;
general method of synthesis as follows.
The subject of the present invention is also a process for the preparation of products of formula (IB) according to the present invention;
general method of synthesis as follows 2St N-methyl-quinolinium.
General Synthesis Method A particularly interesting method in the context of the invention consists in alkylating at the end of synthesis a product of general formula (IA) in product of general formula (IB) using an alkyl halide, or optionally an alkyl sulphate according to the general scheme below (IA) Nitrogen aromatic ring - (NR3) p-CO-dispatcher- (COM) m- (NR'3) qX- cycle aromatic or not aromatic alk-I
(IB) nitrogenous aromatic ring having a nitrogen atom in quaternary form (NR3) p-CO-tartar (CO) m- (NR'3) qX-ring aromatic or nonaromatic Products of general formula (IA) in which X represents a simple may be prepared in any of the following methods:
general synthesis described in WO 0296903.
Products of the general formula (IA) in which X is different from simple bond can advantageously be prepared according to the scheme general below

17 HOOC-distributor-COOH
HOOC-dispatcher- (CO) m- (NR'3) qX-ring aromatic or non-aromatic nitrogenous aromatic ring (NR3) p-CO-COOH-splitter nitrogenous aromatic ring - (NR3) p-CO-dispatcher- (CO) m- (NR'3) qX-aromatic or non-aromatic cycle The subject of the present invention is therefore the products of formula (IB) such that defined above, characterized in that they have an inhibitory activity of telomerase.
The subject of the present invention is therefore the products of formula (IB) such that defined above characterized in that they have anticancer activity.
The subject of the present invention is also, as medicaments, the products of formula (IB) as defined above, as well as their prodrugs, said products of formula (I) being in all isomeric forms possible racemates, enantiomers and diastereoisomers, as well as the addition salts with mineral and organic acids or with mineral bases and pharmaceutically acceptable organic compounds of said products of formula (I).
The subject of the present invention is therefore, as medicaments, the products of formula (la) as defined in the preceding claims as well as their prodrugs, said products of formula (Ia) being in all forms possible racemic, enantiomeric and diastereoisomeric isomers, as well as that the addition salts with the mineral and organic acids or with the pharmaceutically acceptable inorganic and organic bases of said products of formula (la).
The present invention is particularly concerned with medicaments, the products described below in the experimental part, as well as their prodrugs,

18 as well as addition salts with mineral and organic acids or with the pharmaceutically acceptable inorganic and organic bases of these products.
The term patient refers to humans but also others mammals.
The term "Prodrug" refers to a product that can be transformed in vivo by metabolic mechanisms (such as hydrolysis) into a formula product (I). For example, an ester of a product of formula (I) containing a group hydroxyl can be converted by in vivo hydrolysis to its parent molecule. Or still an ester of a product of formula (I) containing a carboxy group may be converted by in vivo hydrolysis into its parent molecule.
The products can be administered parenterally, orally, perlingual, rectal or topical.
The invention also relates to pharmaceutical compositions, characterized in that they contain, as active ingredient, one less medicines of general formula (IB) as defined above and in particular the products described hereinafter in the experimental part.
These compositions can be presented in the form of solutions or injectable suspensions, tablets, coated tablets, capsules, syrups, suppositories, creams, ointments and lotions.
These pharmaceutical forms are prepared according to the usual methods.
The active ingredient can be incorporated into commonly used excipients in these compositions, such as aqueous or non-aqueous vehicles, talc, gum arabic, lactose, starch, magnesium stearate, butter cocoa, animal or vegetable fats, derivatives paraffins, glycols, various wetting agents, dispersants or emulsifiers, preservatives.
The usual dose, variable according to the subject treated and the affection in question, can be, for example, from 10 mg to 500 mg per day in humans, by oral.
The subject of the present invention is also the compositions pharmaceutical products as defined above additionally containing active ingredients of other cancer chemotherapy drugs.

19 The subject of the present invention is also the compositions as defined above characterized in that they are used as drugs, especially for chemotherapy of cancers.
The present invention thus relates to the use of the compounds defined above as a pharmaceutical product for human use.
The present invention also relates to therapeutic combinations consisting of a compound of formula (IB) as defined above and a other anticancer compound.
The present invention thus relates to therapeutic associations such as as defined above characterized in that the anticancer compound is chosen from alkylating agents, platinum derivatives, antibiotics, antimicrotubules, anthracyclines, group I and II topoisomerases, fluoropyrimidines, cytidine, adenosine analogues, enzymes and various compounds such as that L-asparaginase, hydroxyurea, trans-retinoic acid, suramin, irinotecan, topotecan, dexrazoxane, amifostine, herceptin and than oetrogenic and androgenic hormones, antiviral agents.
The present invention also relates to a therapeutic combination composed of a compound of formula (IB) as defined above and of radiation.
The present invention thus relates to associations as defined above.
characterized in that each of the compounds or treatments is administered simultaneously, separately or sequentially.
The present invention thus relates to the use of products of formula (IB) as defined above or pharmaceutically acceptable salts said products of formula (IB) for the preparation of medicaments for to treat cancers, genetic diseases or hair abnormalities.
The present invention thus relates to the use of products of formula (IB) as defined above or pharmaceutically acceptable salts said products of formula (I) for the preparation of a medicament for treat cancers.
The present invention thus relates to the use of products of formula (IB) as defined above or pharmaceutically acceptable salts said products of formula (I) for the preparation of a medicament for 5 treat genetic diseases such as Bloom's syndromes, Werner, Rothmund-Thomson or ataxia telangiectaxis.
The present invention thus relates to the use of products of formula (IB) as defined above or pharmaceutically acceptable salts said products of formula (I) for the preparation of a medicament for 10 treat hair abnormalities such as hyperpilosity.
The present invention particularly relates to the use of formula (IB) as defined above or of pharmaceutically acceptable salts acceptable for said products of formula (I) for the preparation of a drug to treat cancers of the breast, stomach, colon, 15 lungs, ovaries, uterus! brain, kidney, larynx, system lymphatic, thyroid, uro-genital tract, tract including bladder and prostate, bone cancer, pancreas, melanoma and more particularly cancers of the breast, colon or lungs.
The present invention particularly relates to the use of

Formula (IB) as defined above or of pharmaceutically acceptable salts acceptable for said products of formula (I) for the preparation of a medicament for the chemotherapy of cancers and especially for the chemotherapy of cancers used alone or in combination.
The present invention thus relates to the use of products of formula (IB) as defined in any one of the preceding claims or pharmaceutically acceptable salts of said products of formula (IB) for the preparation of medicinal products intended for use alone or combination with chemotherapy or radiotherapy or alternatively combination with other therapeutic agents and in particular such use in which the therapeutic agents can be agents anti-tumors commonly used.
The products of formula (I) according to the present invention can thus

21 also be advantageously used in combination with agents anti-proliferative agents: as examples of such antiproliferative agents but without however, be limited to this list, mention may be made of aromatase inhibitors, the antiestrogens, topoisomerase I inhibitors, inhibitors of topoisomerase II, active agents on microtubules, agents alkylation inhibitors, histone deacetylase inhibitors, inhibitors of farnesyl transferase, COX-2 inhibitors, MMP inhibitors, inhibitors mTOR, antineoplastic antimetabolites, platinum compounds, compounds decreasing the activity of protein kinases and also the antiangiogenic compounds, gonadorelin agonists, androgens, bengamides, biphophonates and trastuzumab.
By way of examples, mention may be made of anti-microtubule agents such as taxoids, vinka-alkaloids, alkylating agents such as cyclophosphamide, DNA-intercalating agents such as cis-platinum, interactive agents on topoisomerase such as camptothecin and derivatives, anthracins like fadriamycin, antimetabolites like 5-fluorouracil and derivatives and the like.
The affinity and the selectivity of the products of general formula (IB) according to the present invention for G-quadruplex DNA structures can be determined by one or more of the following methods Affinity Test # 1: Measurement of Inhibition of Matching a oliaonucléotide likely. to form a G-auadruplex structure with its strand complement measured as inhibitory concentration 50% C150 expressed in μM, by a luminescence method according to the protocol experimental is described below The principle of this test uses the activation of "acceptor" beads by a singlet of oxygen emitted by "donor" balls excited by a laser when the "acceptor" and "donor" beads are nearby. This test was developed by Packard Bioscience under the name Amplified Luminescent Proximity Homogeneous Assay or ALPHA screen.
The "donor" beads are conjugated to streptavidin and the beads acceptors to an anti-digoxigenin antibody (catalog number 6760604).
A strand of DNA, in this case the telomeric strand is coupled to its 5 'end

22 biotin so that it can bind to the "donor" beads, while the complementary strand is coupled with digoxigenin to be able to bind to "acceptor" beads. When pairing the telomeric strand to its strand complementary, the balls are put in proximity and a signal of luminescence is then emitted at a wavelength of 520-620 nm.
The oligonucleotides used in the experiments were synthesized by Perkin Elmer Life Sciences (Finland). The G-rich strand corresponding to repetitive patterns of human telomeric DNA has the sequence G-GTT-TAA-AAT-AAT-TGA-GGG-TTA-GGG-TTA-GGG-TTA-GGG. The strand complementary to the GGT-TTA-AAA-AAT-TTG-CCC-TAA-CCC-sequence TAA-CCC-TAA-CCC -T. Biotin or digoxigenin are added to the 5 'end of the oligonucleotides.
The experiments are carried out in a 50 mM TRIS-HCl buffer pH 7: 4 containing 100 mM KCl and 0.1% BSA.
The measurements are made with an Alphaquest microplate analyze (Fusion a) from Packard Biosciences.
The experiments are carried out in 96-well plates (112 wells) A stock solution of oligonucleotide at the concentration of 25 nM in the Buffer described above is prepared. 10 μl of this solution are distributed in the wells. 10 μl of the test product at different concentrations prepared in the same buffer containing 0.6% of DMSO are then added. 10 μl of buffer + 0.6% DMSO are distributed in the wells controls. Samples are incubated for 15 minutes at room temperature room. After this incubation time, 10 μl of the complementary strand at concentration of 25 nM and 20 μl of a solution containing the 2 types of beads previously diluted to 50 mg / ml are added to the wells. The plaques are incubated at room temperature for 2 hours before reading. In these conditions the telomeric strand can adopt a secondary conformation of the G-quadruplex type that the product according to its affinity for this structure stabilizes, preventing matching to the complementary strand. The emitted signal is minimal. In the absence of product in the control wells, the telomeric strand is similar to the complementary strand which results in a maximum signal.
Selectivity Test No. 7: Measurement of Inhibition of Matching a oliaonucleotide, guelcongue, with its complementary strand measured under

23 inhibitory concentration form 50% C150 expressed in, μM aar a luminescence method according to the experimental protocol is described below The test used is the same as that described above. Only oligonucleotides are different, the telomeric strand being replaced by a oligonucleotide having the following sequence: G-GTT-TAA-AAT-AAT-Biotinylated TGA-GGC-TTA-CCG-TTA-CCG-TTA-CGG at the 5 'end. The strand complement has the sequence: 5'-GGT-TTA-AAA-AAT-TTG -CGG-TAA-CGG-TAA-CGG-TAA-GCC-T labeled with digoxigenin 5 'endextremite.
If the test product has an affinity for the biotinylated DNA sequence, matching to the complementary strand will be prevented and the signal obtained minimal. In the absence of a product or if the latter has no affinity for this DNA, the pairing will be done and the signal will be maximum.
Affinity Test # 2: Measurement of Dissociation Constant Expressed in uM, of the complex between a product of the invention and an oliaonucleotide to form a G-monomeric monomer structure; by a method of fluorescence according to the experimental protocol is described below.
The titrations are carried out at 20 ° C in a quartz tank of 3 ml of useful volume and square section 10x10 mm placed in the compartment thermostatic Spex Fluorolog 3 fluorometer (Jobin-Yvon). The buffer used in all the experiments is a sodium cocolylate pH 7.2 (10 mM) containing 100 mM potassium chloride. To a solution in compound of 0.1 NM are added increasing concentrations of nucleic acid.
After an equilibration time of 3 minutes, an emission spectrum of fluorescence is recorded for each point, using 5 nm slots and an excitation wavelength of 340 nm. Each aliquot represents an additional volume of 3 microliters. Dilution effects are corrected at the end of the experiment after integration of the transmission signal. The curves representing the emission intensity as a function of the acid concentration Nucleic acid are then analyzed and processed with Kaleidagaph 3.52 software for Macintosh.
Selectivity Test # 2: Dissociation Constant Measurement expressed in , μM, of the complex between a product of the invention and a double oliaonucleotide

24 strand auelconaue by a fluorescence method according to the protocol exverimental is described here Titrations are performed according to a protocol identical to that used for the titrations of the previous test.
Affinity Test # 3: Measuring G-Stabilization guadruplexes ~ Tm expressed in ° C by a method using the formation of a complex with fluorescein whose experimental protocol is described below Oliaonucléotides All olignucleotides, modified or unmodified, were synthesized by Eurogentec SA, Seraing, Belgium. The oligonucleotide FAM + DABCYL carries the catalog reference, OL-0371-0802. It has the sequence:
GGGTTAGGGTTAGGGTTAGGG corresponding to 3.5 repetitions of the pattern human telomeric (strand rich in G). Fluorescein is attached to the end 5 ', the DABCYL at the 3' end, by the chemical arms described by Eurogentec.
An FAM + TAMRA oligonucleotide may also be employed. The concentration of the samples is checked by spectrophotometry, in recording the absorbance spectrum between 220 and 700 nm and using the molar extinction coefficient provided by the supplier.
tampons All experiments were performed in a cacodylate buffer 10mM sodium pH 7.6 containing 0.1M Lithium Chloride (or Sodium Chloride). The absence of fluorescent contamination in the buffer was previously verified. The fluorescent oligonucleotide is added at the final concentration of 0.2 μM.
Fluorescence study All fluorescence measurements were made on a Spex Fluorolog DM1 B or Fluoromax 3 device, using a width of excitation line of 1.8 nm and an emission line width of 4.5 or 5 nm.
The samples are placed in a 0.2 x 1 cm micro quartz dish.
The temperature of the sample is controlled by an external water bath.
The oligonucleotide alone was analyzed at 20, 30, 40, 50, 60, 70 and 80 ° C. The emission spectra are recorded using a wavelength excitation of 470 nm. Excitation spectra are recorded in using either 515 nm or 588 nm as the emission wavelength. Spectra are corrected for the instrument response by reference curves.
A significant extinction (80-90%) of fluorescence fluorescence in room temperature is observed, in agreement with an intramolecular fold Of the oligonucleotide at 20 ° C in the form of a G-quadruplex, which induces a juxtaposition of its ends 5 'and 3' respectively related to the fluorescein and to DABCYL. This juxtaposition leads to a phenomenon already described fluorescence quenching, used for "Molecular Beacons".
Tm in fluorescence A stock solution of oligonucleotide at the strand concentration of 0.2 μM in a buffer 0.1 M LiCl 10 mM cacodylate pH 7.6 is previously prepared, heated briefly to 90 ° C and cooled slowly to 20 ° C, then distributed in aliquots of 600 NI in the vats of fluorescence.
3 μl of water (for control) or 3 NI of the product to be tested (200 μM stock, Final concentration (1 μM) are then added and mixed. The samples are then allowed to incubate for at least 1 hour at 20 ° C before each measured. The use of longer incubation times (up to 24 hours) did not no influence on the result obtained.
Each experiment allows the measurement of 1 to 4 samples. It is First incubated at an initial temperature of 20 ° C and brought to 80 ° C in 38 minutes. During this time, the fluorescence is measured simultaneously with a (515 nm) or at two emission wavelengths (515 nm and 588 nm) in using 470 nm gommed excitation wavelength. One measure is performed every 30 seconds or every degree. Bath temperature

25 marie is recorded in parallel, and the fluorescence profile in function of the temperature is reconstituted from these values. Profiles of fluorescence are then normalized between 20 ° C and 80 ° C, and the temperature for which the emission intensity at 515 nm is the average of those at high and low temperature is called Tm. Under these conditions, the Tm of the reference sample without product addition is approximately 44 ° C
in one Lithium chloride buffer. This temperature is raised to over 55 ° C
in a Sodium Chloride buffer. The addition of a stabilizing compound G-quadruplex induces an increase in Tm. This increase is judged significant if it is greater than 3 °.

26 Selectivity test n ° 3: Estimation of the equilibrium distribution a product of the invention between various oliaonucleotides or DNA structures by a Dialysis method according to the experimental protocol is described below.
All polynucleotides are from Amersham-Pharmacia. The Oligonucleotides were synthesized by Eurogentec, Belgium on the scale 1 pmol and used without further purification. 19 structures are tested in parallel (sample numbered 1-19, see table below).
The TC, GA and GT triplexes result from the combination of two strands of different lengths (13 and 30 bases) 5 'GAAAGAGAGGAGG and 5' CCTCCTCTCTTTCCCTTCTTTCTCTCCTCC
(Triplex TC, sample # 1);
5 'CCTCCTCTCTTTC and 5' GAAAGAGAGGAGGCCTTGGAGGAGAGAAAG
(Triplex GA, sample # 2);
5 'CCTCCTCTCTTTC and 5' GAAAGAGAGGAGGCCTTGGTGGTGTGTTTG
(Triplex GT, sample # 3).
The "duplex" GA (sample # 5) results from the pairing of oligonucleotide (5 'GAGAGAGAGAGAGAGAGAGAGAGAGA). The duplex parallel (sample # 6) results from the association of 5'AAAAAAAAAATAATTTTAAATATT with 5 T'lTl'TTTTTTATTAAAATTTATAA. 24 CTG (sample # 7) mime 8 trinucleotide repeats: 5 'CTGCTGCTGCTGCTGCTGCTGCTG. ds26 (sample # 11) is a 26-base autocomplementary duplex 5 ' CAATCGGATCGAATTCGATCCGATTG. 22CT (sample # 13) is a oligonucleotide that mimics the C-rich strand of human telomeres: 5 ' CCCTAACCCTAACCCTAACCCT, while 22AG (sample # 14) is a oligonucleotide that mimics the G-rich strand of human telomeres: 5 ' AGGGTTAGGGTTAGGGTTAGGG. 24620 (T2G ~ oT2, sample # 15) can form an intermolecular quadruplex 5 ' (TTGGGGGGGGGGGGGGGGGGGGTT) 4.
Table of Structures of Nucleic Acids Used in Dialay Number Name Typea (length) Structure Tm (° C) 1 triplexe TC oligos (30 + 13) Triplexe 38 2 triplexe GA Oligos (30 + 13) Triplex 53 3 GT triplex oligos (30 + 13) Triplex 53 WO 2004/0720

27 PCT / FR2004 / 000260 4 poly dA.2polydT poly Triplex 71 GA duplex oligo (24) "Duplex 37 "b parallel duplex oligos. "Duplex 39 (30 + 30) "b 7 24CTG oligo (24) "Duplex 64 "b 5 8 poly d (A-T) pol y Duplex 66 9 poly d (GC) poly Duplex> 90 CT DNA poly Duplex 86 11 ds 26 oligo (26) Duplex 75 12 poly dC poly i-DNA 51 10 13 22CT oligo (22) ss / i-DNA 13 14 22AG, oligo (22) G4 62 24620 oligo (24) G4> 90 16 poly dT poly single-strand -17 poly dA single-strand poly 15 1.8 poly rU poly single-strand -19 poly rA single-strand poly -a: poly = polynucleotide; oligo = oligonucleotide; oligos = formed structure through combination of two different oligonucleotides, lengths are indicated in parentheses. Polynucleotides are more than 700 bases long.
b: These duplexes involve the formation of non-canonical base pairs.
The antelonomerase activity of the products of the invention depending specifically the G-auadruplex structure stabilization measured by the Inhibitory concentration 50% C150 expressed in pM, can be evaluated according to the protocol below Preparation of the extract enriched in human telomerase activity The A549 lung carcinoma line is obtained from the ATCC
(American Type Culture Collection, Rockville USA). The cells are cultured in a layer, in a culture flask in DMEM medium, added of glutamax at 2mM, Penicillin 200 Ulml streptomycin 200 pglml and 10% heat-inactivated fetal calf serum. Cells in phase exponential growths are trypsinized, washed in 1X PBS and aliquot of 106 cells is centrifuged at 3000x6 and the supernatant discarded. The cell pellet is resuspended by several successive pipettings in 200 lysis buffer girl containing CHAPS 0.5%, Tris-HCl pH 7.5 10 mM,

28 1 mM MgCl 2, 1 mM EGTA, 5 mM i-mercaptoethanol, 0.1 mM PMSF and glycerol 10% and is kept in ice for 30 minutes. The lysate is centrifuged at 160000xG for 20 minutes at 4 ° C and 160 μl of the supernatant is recovered. The protein content of the extract is determined by the method of Bradford. The extract is stored at -80 ° C.
Assay of telomerase activity by TRAP-G4 assay Inhibition of telomerase activity is determined by a TRAP protocol modified to measure the extension of telomerase from a oligonucleotide TSG4 (S ~ GGGATTGGGATTGGGATTGGGTT3 ~) which can form an intramolecular G-quadruplex structure, in the presence of an extract cell enriched in telomerase activity and compounds that are added to different concentrations (30, 10, 1, 0.1 and 0.01 μM). The reaction extension is followed by PCR amplification of the extension products using the oligonucleotide CXext (S ~ GTGCCCTTACCCTTACCCTTACCCTAA3 ~). The selectivity of inhibition is measured by amplification of a oligonucleotide TSNT control (S ~ ATTCCGTCGAGCAGAGTTAAAAGGCCGAGAAGCGAT3 ~) by the oligonucleotide TS (5 ~ AATCGTTCGAGCAGAGTT3 ~) and the oligonucleotide NT (S ~ ATCGCTTCTCGGCCTTTT3 ~).
The racial environment is expected in a final volume of 50 pL
according to next composition Tris HCI pH 8.0 20 mM

1.5 mM MgCl2 KCI 63 mM

Tween 20 0.005% (w / v) EGTA 1 mM

dATP 50 pM

dGTP 50 pM

dCTP 50 pM

dTTP 50 pM

Oligonucleotide TSG4 3,5 picomoles Oligonucleotide CXext 22.5 picomoles Oligonucleotide TSNT 0.01 attomoles Oligonucleotide NT 7.5 picomoles Oligonucleotide TS 18 picomoles Srum Bovine Albumin 20 μg / ml

29 Taq DNA polymerase 50 U / ml Extract telomerase 100 ng under a volume of 1 pl Test product or solvent in a volume of 5 Bi-distilled water QS 50 pl The oligonucleotides are obtained from Eurogentec Belgium) and are stored at -20 ° C at a stock concentration of 100 μM in water distilled sterile without ribonucleases and deoxyribonucleases.
The reaction samples are assembled in ice in PCR of 0.2 ml.
The reaction samples are then incubated in a PCR apparatus of Eppendorf Mastercycler according to the following temperature conditions minutes at 30 ° C, 1 minute at 90 ° C, followed by 30 cycles of, 30 seconds at 92 ° C,

30 seconds at 52 ° C, 30 seconds at 72 ° C, followed by a final cycle of 2 minutes at 72 ° C.
After amplification, 8NL of a deposition buffer of the following composition, are added to the samples sucrose 20% (W / V) Bromophenol blue 0.2 Xylene cyanol 0.2 The samples are then analyzed by gel electrophoresis 12% acrylamide / bisacrylamide (19: 1) in 1X TBE buffer 45 minutes under a voltage of 200 volts, using a system Novex electrophoresis.
The gels are stained for 15 minutes in a 1 X solution of SYBR
Green (Roche) and the fluorescence of the PCR products is digitized by a digital camera (Bioprint system).
The disappearance of the band formed by the dimerization of the oligonucleotides TSG4 and Cxext correspond to a stabilization of the G-quadruplex form of the oligonucleotide TSG4 and corresponds to an inhibition of the extension of telomeric repeats from the TSG4 oligonucleotide.
The disappearance of the band formed by the amplification of the oligonucleotide TSNT control corresponds to a nonspecific inhibition of the activity of the Taq polymerase.
For each compound, the results are expressed by the calculation of the concentration (pM) inhibiting 50% of the formation of the TSG4-Cxext band (IC50 TRAP-G4) and by calculating the concentration inhibiting 50% of the formation of the TSNT control band (IC50 Taq), compared to the value of The enzyme sample without compound.
The C150 Taq / C150 TRAP-G4 ratio indicates the selectivity factor of inhibition of telomerase extension by stabilizing G-quadruplex compared to the inhibition of Taq polymerase.
A compound is considered to be active as an antitelomerase agent Stabilizing G-quadruplex DNA when the IC50 TRAP-G4 is in particular less than 5 μM.
The compound is considered to be selective as an antiteromerase agent stabilizing the G-quadruplex when the IC50 TRAP-G4 / IC50 Taq ratio is greater than 3.
The following nonlimiting examples are given to illustrate the invention EXAMPLE 1 Preparation of 2,6-pyridine-dicarboxylic acid diodide bis - [(1-methyl-quinolinio-6-yl) -amide]
. N + I ipp I N +.
1.
i Step 7: In a 50 mL knit with magnetic stirring, dissolve 1 g 2,6-pyridine-dicarboxylic acid and 1.81 g of 6-aminoquinoline in 30 mL of dichloromethane and 5 mL of dimethylformamide (DMF), then add 2.4 g of 1- (3-dimethylaminopropyl) -carbodimide hydrochloride (EDCI) and 162 mg of 1-hydroxybenzotriazole (HOBT). A yellow precipitate transient is formed which slowly resolves itself again. After 1 to 2 hours agitation At room temperature an abundant white precipitate appears. After one night stirring at room temperature, the reaction is complete (control by

31 liquid chromatography coupled with LC / MS mass spectroscopy). The precipitate formed is filtered off, washed successively with dichloromethane and water, then dried under reduced pressure in the presence of anhydride phosphoric. 2.41 g of 2,6-pyridine-dicarboxylic acid-bis-[(quinolin-6-yl) amide], in the form of a white powder used as it is at the next step.
Step 2: In a 25 mL flask, 200 mg of 2,6-pyridine dicarboxylic-bis - [(quinolin-6-yl) amide], obtained in the previous step, in 2 mL of methanol, 4 mL of DMF and 10 mL of iodomethane, then heat to 50 ° for 72 hours during which an orange precipitate forms gradually. After cooling, this precipitate is drained and washed at methanol. After recrystallization from a mixture of ethanol and DMF
(50/50 by volume), 288 mg of 2,6-pyridine acid diodide are obtained.
dicarboxylic-bis - [(1-methyl-quinolinio-6-yl) amide], in the form of crystals yellow-orange, the characteristics of which are as follows - Melting point (Kofler)> 260 ° C
1 H NMR Spectrum (300 MHz, (CD3) 2SO d6, b in ppm): 4.70 (s) broad: 6H); from 8.15 to 8.30 (mt: 2H); from 8.40 to 8.80 (mt: 7H); 9.25 (d, J
= 2 Hz: 2H); 9.37 (broad d, J = 8.5 Hz: 2H); 9.45 (broad d, J = 5.5 Hz: 2H);
11.64 (s wide: 2H).
EXAMPLE 2 Preparation of 2,6-pyridine-dicarboxylic acid diodide 2 - [(1-methyl-quinolinio-6-yl) amide] -6 - [(4-dimethylamino-1-methyl-quinaldinio-6-yl) -amide].
~ NI
+ I ~ oo I, +.
N / \ NIN
I
Step 7: In a 50 mL knit, dissolve in 35 mL of dichloromethane, 1.3 g of n-butyl monoester of 2,6-pyridine dicarboxylic acid, which can be obtained according to Khim. Geterosikl. Soedin 7976 (2), 233-7, and 1.17 g of 6-amino-4-dimethylamino-quinaldine, which can be obtained according to WO 0140218, then 1.35 g of EDCI and 90 mg of HOBT are added.
After 2 to 3 hours, a yellow precipitate appears; agitation is maintained for 36 hours at room temperature, until reaction completes (LC / MS). The reaction medium is diluted with water, the organic phase is

32 decanted and the aqueous phase is extracted with dichloromethane. The phases attached organic compounds are concentrated to dryness under reduced pressure. The residue pasty mixture is taken up with stirring in 20 ml of diisopropyl ether, to form a light beige solid which is wrung out and air dried. We obtain thus 820 mg of n-butyl ester of 2,6-pyridine-6-dicarboxylic acid.
. dimethylamino-quinaldin-6-yl) amide], used as is in the next step.
Step 2: In a 50 mL flask, a solution of 820 mg of ester n-Butyl, 2,6-pyridine-6-dicarboxylic acid - [(4-dimethylamino) quinaldin-6-yl) amide], obtained above, in 30 ml of n.butanol is stirred 16 hours with 2 mL of a 1M aqueous solution of potassium hydroxide. After concentration under reduced pressure, the residue is taken up in 10 ml of water and neutralized to pH = 6 by addition of a 0.1 M aqueous solution of acid hydrochloric. The precipitate formed is drained, washed with water and dried under reduced pressure at 60 ° C in the presence of phosphorus pentoxide. We gets thus 760 mg of 2,6-pyridine-6-dicarboxylic acid - [(4-dimethylamino) quinaldin-6-yl) amide], in the form of a white solid used as it is in step next.
Step 3: In a 50 mL flask, 760 mg of 2,6-pyridine acid is dissolved dicarboxylic acid-6 - [(4-dimethylamino-4-quinolin-6-yl) amide], obtained above, and 360 mg of 6-aminoquinoline in 15 mL of DMF, then 458 mg is added EDCI and 30 mg HOBT. After 72 hours of stirring at room temperature ambient, the solvent is removed under reduced pressure. The residue is taken back water, and the precipitate thus formed is washed with water and then with a solution saturated of sodium hydrogencarbonate. After drying under reduced pressure the presence of phosphorus pentoxide, 852 mg of 2,6-pyridine dicarboxylic-2 - [(quinolin-6-yl) -amide] -6 - [(4-dimethylamino-quinaldin-6-yl) amide], in the form of a beige powder, used as it is in step next.
Step 4: We operate as in Step 2 of Example 1, but from 400 mg of 2,6-pyridine-2-dicarboxylic acid - [(quinolin-6-yl) amide] -6 - [(4-dimethylamino-quinaldin-6-yl) amide], obtained above in 6 mL of methanol and 15 mL of iodomethane. We then obtain after recrystallization in ethanol, 382 mg of 2,6-pyridine-2-dicarboxylic acid diodide [(1-methyl-quinolinio-6-yl) amide] -6 - [(4-dimethylamino-1-methyl-6- quinaldinio yl) amide], in the form of a pale green solid whose characteristics are the following

33 - Melting point (Kofler)> 260 ° C
1 H NMR Spectrum (300 MHz, (CD3) 2 SO d6, in ppm): 2.85 (s) broad: 3H); 3.56 (s: 6H); 4.11 (brs: 3H); 4.71 (brs: 3H); 7.12 (s broad: 1H); 8.20 (broad dd, J = 8.5 and 5.5 Hz: 1H); from 8.30 to 8.80 (mt:
7H);
9.03 and 9.05 (2s wide: 2H in total); 9.36 (broad d, J = 8.5 Hz: 1H);
9.45 (broad d, J = 5.5 Hz: 1H); 11.50 (s wide: 1 H), 11.64 (s wide: 1 H).
EXAMPLE 3 Preparation of 2,6-pyrazine-dicarboxylic acid diodide bis - [(1-methyl-quinolinio-6-yl) amide].
_ ,NOT
I + I ~ N ~ N ~ NI ~ I
i OO +.
N ~ l N
Step 7: We operate as in step 1 of example 1, but from 450 mg of 2,6-pyrazine-dicarboxylic acid, which can be prepared according to J. Med. Chem. (1996), 29, 1452-57, 450 mg of 6-aminoquinoline, 600 mg of EDCI and 40 mg of HOBT in 15 mL of dichloromethane and 10 mL of DMF with stirring for 1 night at room temperature. After purification by preparative LC / MS, 170 mg of 2,6-pyrazine acid are obtained.
dicarboxylic-bis - [(quinolin-6-yl) amide], in the form of a white powder used as is in the next step.
Step 2: The procedure is as in Step 2 of Example 1, but starting with 50 mg of 2,6-pyrazine-dicarboxylic acid-bis - [(quinolin-6-yl) amide], obtained above in 1 mL of DMF and 5 mL of iodomethane. We then obtain recrystallization from ethanol, 51 mg of 2,6-pyrazine acid diodide dicarboxylic-bis - [(1-methyl-quinolinio-6-yl) amide], in the form of a solid pale yellow whose characteristics are as follows - Melting point (Kofler)> 260 ° C
1 H NMR Spectrum (300 MHz, (CD3) ZSO d6, 8 ppm): 4.70 (s) 6H); 8.22 (dd, J = 8.5 and 6 Hz: 2H); 8.70 (s: 4H); 9.21 (brs: 2H);
9.39 (d, J = 8.5 Hz: 2H); 9.46 (d, J = 6 Hz: 2H); 9.71 (s: 2H); 11.62 (s large 2H).
EXAMPLE 4 Preparation of the Diodide of 1,3-Benzenedicarboxylic Acid bis - [(1-methyl-quinolinio-6-yl) -amide]

34 + I ~ oo I +.
N / IN
Step 1: We operate as in Step 1 of Example 1, but from 300 mg of isophthalic acid, 521 mg of 6-aminoquinoline, 727 mg of EDCI and 50 mg of HOBT in 10 mL of DMF with shaking for 1 night at room temperature. 593 mg of 1,3-benzene acid are obtained.
dicarboxylic-bis - [(quinolin-6-yl) amide], in the form of a white powder, used as is in the next step.
Step 2: We operate as in step 2 of example 1, but from 100 mg of 1,3-benzenediobdicarboxylic acid-bis - [(quinolin-6-yl) amide], obtained above in 1 mL of DMF and 6 mL of iodomethane. We then obtain recrystallization from ethanol, 72 mg of 1,3-benzene acid diodide dicarboxylic-bis - [(1-methyl-quinolinio-6-yl) amide], in the form of a solid pale yellow whose characteristics are as follows - Melting point (Kofler)> 260 ° C
1 H NMR Spectrum (300 MHz, (CD3) 4 SO 4, d at ppm): 4.63 (s) 6H); 7.77 (t, J = 7.5 Hz: 1H); 8.07 (dd, J = 8.5 and 6 Hz: 2H); 8.29 (d large, J = 7.5 Hz: 2H); 8.49 (mt: 4H); 8.84 (brs: 1H); 8.99 (s wide: 2H) ;
9.16 (d, J = 8.5 Hz: 2H); 9.28 (d, J = 6 Hz: 2H).
EXAMPLE 5 Preparation of 2,6-pyridine-dicarboxylic acid diodide bis - [(1-methyl-quinaldinio-6-yl) -amide]
'NIN \
+ I i OOI ~ +.
N / IN
Step 1: We operate as in Step 1 of Example 1, but from 500 mg of 2,6-pyridine dicarboxylic acid, 945 mg of 6-aminoquinaldine, which can be prepared according to EP 286277, 1.2 g of EDCI and 100 mg of HOBT in 15 mL of dichloromethane and 3 mL of DMF with stirring for 24 hours at room temperature. 1.47 g of acid are obtained 2,6-pyridinedicarboxylic-bis - [(quinaldin-6-yl) amide], in the form of a white powder used as it is in the next step.

Step 2: We operate as in step 2 of example 1, but from 150 mg of 2,6-pyridine-dicarboxylic acid-bis - [(quinaldin-6-yl) amide], obtained above in 1.5 mL of DMF and 6 mL of iodomethane. We then obtain after recrystallization from ethanol, 161 mg of acid diodide 2,6-pyridine-dicarboxylic-bis - [(1-methyl-quinaldinio-6-yl) amide], under form a yellow solid whose characteristics are as follows - Melting point (Kofler)> 260 ° C
EXAMPLE 6 Preparation of the Iodide of 2,6-pyridine-2-dicarboxylic acid [(1-Methyl-quinolinio-6-yl) -amide] -6 - [(4-aminoquininaldin-6-yl) amide] isolated 10 in its imino tautomeric form below '_ \ NN
~ N
'N + ~ ~ OO ~ ~ NH
i ~ NH2 i Step 7: We operate as in Step 1 of Example 2, but from 500 mg of n-butyl monoester of 2,6-pyridine dicarboxylic acid, 388 mg of 4,6-diaminoquinaldine, which can be obtained according to WO 0140218, 472 mg of EDCI and 30 mg of HOBT in 10 mL of dichloromethane and 5 mL of DMF for 20 hours at room temperature. We get, after purification by flash-chromatography on alumina, eluting with a mixed dichloromethane and methanol (95/5 by volume), 450 mg of ester 2,6-pyridine-6-dicarboxylic acid - [(4-amino-quinaldin-6-) 20 yl) amide], used as is in the next step.
Step 2: We operate as in step 2 of example 2, but from 450 mg of n-butyl ester of 2,6-pyridine-6-dicarboxylic acid - [(4-amino) quinaldin-6-yl) amide], obtained above, in 20 mL and 1.19 mL of a 1M aqueous solution of potassium hydroxide. This gives 243 mg of acid 2,6-pyridinedicarboxylic-6 - [(4-aminoquinidin-6-yl) amide], in the form of a beige solid used tel what to the next step.
Step 3: The procedure is as in Step 3 of Example 2, but from 93 mg 2,6-pyridine-6-dicarboxylic acid - [(4-aminodinaldin-6-yl) amide], obtained above, 41.6 mg of 6-aminoquinoline, 61 mg of EDCI and 14 mg of Of HOBT in 5 mL of dichloromethane and 5 mL of DMF for 48 hours at ambient temperature. In this way 101 mg of 2,6-pyridine acid is obtained.

dicarboxylic-2 - [(quinolin-6-yl) -amide] -6 - [(4-amino-quinaldin-6-yl) -amide], in the form of a beige powder, used as it is in the next step.
Step 4: The procedure is as in Step 2 of Example 1, but starting from 65 mg 2,6-pyridine-2-dicarboxylic acid - [(quinolin-6-yl) amide] -6 - [(4-amino)]
quinaldin-6-yl) -amide, obtained above, in 1 mL of DMF and 5 mL
iodomethane. After recrystallization from ethanol, 58 mg of 2,6-pyridine-2-dicarboxylic acid - [(1-methyl-6-quinolinio)] - iodide yl) amide] -6 - [(4-amino-quinaldin-6-yl) amide], isolated in its tautomeric form imino, in the form of a yellow solid whose characteristics are the following - Melting point (Kofler)> 260 ° C
1 H NMR spectrum (400 MHz, (CD3) ZSO d6, at a temperature of 373K, ppm): 2.64 (s: 3H); 4.70 (s: 3H); 6.71 (s: 1H); 7.95 (d, J
= 9 Fiz: 1H); 8.16 (broad dd, J = 8.5 and 5.5 Hz: 1H); from 8.20 to 8.40 (mf spread 1H); 8.29 (d, J = 8.5 Hz: 1H); 8.43 (t, J = 7.5 Hz: 1H); 8.53 (mt:
2H); 8.63 (d, J = 9.5 Hz: 1H); 8.76 (broad d, J = 9.5 Hz: 1H); 8.86 (s large: 1 H); 9.11 (s wide: 1H); 9.30 (d, J = 8.5 Hz: 1H); 9.41 (d, J = 5.5 Hz: 1H);
11.18 (s broad: 1H); 11.44 (brs: 1H); from 13.00 to 13.50 (spread mf: 1 H).
EXAMPLE 7 Preparation of the Diodide of 2,6-Benzenedicarboxylic Acid bis - [(1-methyl-quinaldinio-6-yl) -amide]
+ I i ~ 0 ~ 1 '~ OI ~ +.
IN
Step 7: We operate as in step 1 of example 1, but from 100 mg of isophthalic acid, 190.5 mg of 6-aminoquinaldine, 242 mg of EDCI and 20 mg of HOBT in 5 mL of DMF with shaking for 20 hours at room temperature. 265 mg of 2,6-benzene acid are obtained.
dicarboxylic-bis - [(quinaldin-6-yl) amide], in the form of a beige powder used as is in the next step.
Step 2: The procedure is as in Step 2 of Example 1, but starting from 95 mg of 2,6-benzenedicarboxylic acid-bis - [(quinaldin-6-yl) amide], obtained above, in 1 mL of DMF and 5 mL of iodomethane. We then obtain recrystallization from ethanol, 83 mg of 2,6-benzene acid diodide dicarboxylic-bis - [(1-methyl-quinaldinio-6-yl) amide], in the form of a solid yellow whose characteristics are as follows - Melting point (Kofler)> 260 ° C
1 H NMR Spectrum (300 MHz, (CD3) 2SO d6, 8 ppm): 3.08 (s) 6H); 4.47 (s: 6H); 7.86 (t, J = 8 Hz: 1H); 8.10 (d, J = 8.5 Hz: 2H);
8.33 and 8.34 (2d, J = 8 Hz: 2H in total); 8.48 (dd, J = 9.5 and 2.5 Hz: 2H);
8.66 (d, J = 9.5 Hz: 2H); 8.70 (brs: 1H); 8.96 (d, J = 2.5 Hz: 2H); 9,13 (d, J =
8.5 Hz: 2H); 11.13 (broad s: 2H).
EXAMPLE 8 Preparation of 2,4-pyridine-dicarboxylic acid diodide bis - [(1-methyl-quinolin-6-yl) -amide]
N ~
- ~ N l ~~~ l if N ~
. + I ~ OOI. +.
N / IN
Step 1: We operate as in Step 1 of Example 1, but from 100 mg of 2,4-pyridine dicarboxylic acid, 181 mg of 6-aminoquinaldine, 241 mg of EDCI and 16 mg of HOBT in 5 mL of DMF with shaking for 20 hours at room temperature. 325 mg of acid are obtained 2,4-pyridine-dicarboxylic-bis - [(quinolin-6-yl) amide], in the form of a beige powder used as it is in the next step.
Step 2: We operate as in step 2 of example 1, but from 300 mg of 2,4-pyridine-dicarboxylic acid-bis - [(quinolin-6-yl) amide], obtained above, in 3 mL of DMF and 10 mL of iodomethane. We then obtain after recrystallization from ethanol, 372 mg of acid diodide 2,4-pyridine dicarboxylic-bis - [(1-methyl-quinolin-6-yl) amide], in the form a yellow solid whose characteristics are as follows - Melting point (Kofler)> 260 ° C
1 H NMR spectrum (400 MHz, (CD3) 2SO d6, at a temperature of 373 K, ppm): 4.61 (s: 3H); 4.68 (s: 3H); 7.93 (dd, J = 8.5 and 5.5 Hz 1H); 8.11 (dd, J = 8.5 and 5.5 Hz: 1H); 8.33 (mt: 2H); 8.43 (d wide, J
= 9.5 Hz: 1H); 8.56 (broad d, J = 9.5 Hz: 1H); 8.75 (wide d, J = 9.5 and 1.5 Hz 1H); 8.79 (d, J = 1.5 Hz: 1H); 8.89 (s: 1H); 8.90 (mt: 1H); 8.99 (d large, J = 8.5 Hz: 1H); 9.10 (mt: 1H); 9.10 (s: 1H); 9.23 (d, J = 8.5 Hz: 1 H);
9.35 (d, J = 5.5 Hz: 1H).

EXAMPLE 9 Preparation of the Iodide of 2,6-pyridine-2-dicarboxylic acid [(1-methyl-quinolinio-6-yl) -amide] -6 - [(1-methyl-quinolinio-3-yl) -amide], I_ ~ N ~ NNW ~
wN + ~ i0 O ~ N + i I_ Step 7: In a 25 mL knit, 1.74 g of 2,6-pyridine acid are dissolved dicarboxylic acid, 500 mg of 4-aminoquinoline, 543 μl of hydrochloride N- (2-chloroethyl) diisopropylamine (DIC) and 469 mg of HOBT in 15 mL of DMF. Upon disappearance in TLC (60F254 silica plate, eluent 90/10 dichloromethane / methanol), the reaction medium is deposited on a 5g cartridge of sulfonic resin (40pM model Varian Mega Bond Elut SCX). The fraction, eluted with a 0.1 M solution of methanol ammonia, is concentrated under reduced pressure. The residue is taken up by 5 ml of dichloromethane, and the precipitate formed is drained and then washed with 1 M aqueous solution of hydrochloric acid. This gives 510 mg of acid 2,6-pyridinedicarboxylic-2 - [(quinolin-6-yl) amide], used as such at step next.
Step 2: The procedure is as in Step 3 of Example 2, but starting from 150 mg of 2,6-pyridine-2-dicarboxylic acid - [(quinolin-6-yl) amide], obtained above, 74 mg of 3-aminoquinoline, which can be prepared according to Tetrahedron. Lett. 2001, 42, 3251-54, 109 mg EDCI and 7 mg HOBT
in 5 mL of dichloromethane and 5 mL of DMF for 48 hours at ambient temperature. In this way 180 mg of 2,6-pyridine acid is obtained.
dicarboxylic-2 - [(quinolin-6-yl) amide] -6 - [(quinolin-3-yl) amide], in the form of a pinkish beige powder, used as it is in the next step.
Step 3: The procedure is as in Step 2 of Example 1, but starting from 150 mg of 2,6-pyridine-2-dicarboxylic acid - [(quinolin-6-yl) amide] -6-[(quinolin-3-yl) -amide], obtained above, in 1 mL of DMF and 5 mL
iodomethane. After recrystallization from ethanol, 162 mg of iodide of 2,6-pyridine-2-dicarboxylic acid - [(1-methyl-quinolinio-6-yl) amide] -6 - [(1-methyl-quinolin-3-yl) amide], in the form of a yellow solid whose the features are as follows - Melting point (Kofler)> 260 ° C

1 H NMR Spectrum (300 MHz, (CD3) 2SO d6, 8 ppm): 4.68 (s) broad: 3H); 4.78 (brs: 3H); 8.07 (broad t, J = 7.5 Hz: 1H); from 8.15 at 8.30 (mt: 1H); 8.20 (dd, J = 8.5 and 5.5 Hz: 1H); from 8.40 to 8.65 (mt: 5H);
8.65 (d broad, J = 9.5 Hz: 1H); 8.75 (broad dd, J = 9.5 and 2 Hz: 1H); 9.22 (d large, J = 2 Hz: 1H); 9.35 (broad d, J = 8.5 Hz: 1H); 9.43 (d wide, J = 5.5 Hz 1H); 9.64 (brs: 1H); 10.10 (mp: 1H), from 11.10 to 12.50 (mf spread:
2H).
EXAMPLE 10 Preparation of the Iodide of 2,6-pyridine-dicarboxylic acid 2 - [(1-methyl-quinolinio-6-yl) -amide] -6 - [(1-methyl-quinolinio-5-yl) amide]
N \ N ~ N /
~ N + ~ i OO, 11+
I. ~ W N ~ I_ Step 7: The procedure is as in Step 3 of Example 2, but starting from 150 mg of 2,6-pyridine-2-dicarboxylic acid - [(quinolin-6-yl) amide], obtained at Step 1 of Example 9, 74 mg of 5-aminoquinoline, 109 mg of EDCI
and 7 mg of HOBT in 5 mL of dichloromethane and 5 mL of DMF during 48 hours at room temperature. 201 mg of acid are thus obtained 2,6-pyridine dicarboxylic-2 - [(quinolin-6-yl) -amide] -6 - [(quinolin-5-yl) amide]
in the form of a beige powder, used as it is in the next step.
Step 2: We operate as in step 2 of example 1, but from 180 mg of 2,6-pyridine-2-dicarboxylic acid - [(quinolin-6-yl) amide] -6-[(quinolin-5-yl) -amide], obtained above, in 1.5 mL of DMF and 5 mL
iodomethane. After recrystallization from ethanol, 203 mg is then obtained.
of 2,6-pyridine-2-dicarboxylic acid - [(1-methyl-quinolinio) -6-iodide yl) amide] -6 - [(1-methyl-quinolin-5-yl) amide] as a yellow solid with the features are as follows - Melting point (Kofler)> 260 ° C
1 H NMR spectrum (400 MHz, (CD3) 2SO d6, at a temperature of 373 K, s in ppm): 4.69 (bs: 6H); 8.08 (very wide dd, J = 8.5 and 5 Hz 1H); 8.14 (dd, J = 8.5 and 5 Hz: 1H); 8.23 (mf: 1H); from 8.30 to 8.45 (mt : 2H);
8.49 (mt: 2H); 8.54 (dd, J = 8 and 0.5 Hz: 1H); 8.61 (d, J = 9.5 Hz: 1H) ; 8.70 (dd, J = 9.5 and 2.5 Hz: 1H); 9.07 (d, J = 2.5 Hz: 1H); 9.26 (d, J = 8.5 Hz 1H); 9.38 (d, J = 5 Hz: 1H); 9.45 (broad d, J = 5 Hz: 1H); 9.60 (d wide, J =
8.5 Hz: 1H).

EXAMPLE 11 Preparation of 2,6-pyridine-dicarboxylic acid diodide bis - [(1-methyl-quinolinio-3-yl) -amide]
H ~ r ~ H
N 'NN
I ~ N ~ 'O
I- II
I
Step 7: We operate as in step 1 of example 1, but from 150 mg of 2,6-pyridine dicarboxylic acid, 945 mg of 3-aminoquinoline, which can be prepared according to Tetrahedron. Lett. 2001, 42, 3251-54, 361 mg of EDCI and 24 mg of HOBT in 10 mL of DMF with shaking for 18 hours at room temperature. 495 mg of 2,6-pyridine acid are obtained dicarboxylic-bis - [(quinolin-3-yl) amide], in the form of a white powder, Used as is in the next step.
Step 2: We operate as in step 2 of example 1, but from 200 mg of 2,6-pyridine-dicarboxylic acid-bis - [(quinolin-3-yl) amide], obtained above in 3 mL of DMF and 10 mL of iodomethane. We then obtain recrystallization from ethanol, 231 mg of 2,6-pyridine acid diodide Dicarboxylic-bis - [(1-methyl-quinolinio-3-yl) amide], in the form of a solid yellow whose characteristics are as follows - Melting point (Kofler)> 260 ° C
1 H NMR Spectrum (300 MHz, (CD3) 2SO d6, in ppm): 4.82 (s) broad: 6H); 8.12 (broad t, J = 8 Hz: 2H); 8.27 (broad t, J = 8 Hz: 2H);
of 8.45 to 8.65 (mt: 7H); 9.68 (brs: 2H); 10.14 (brs; 2H); 11.93 (mf 2H).
EXAMPLE 12 Preparation of 2,6-pyridine-dicarboxylic acid diodide 2 - [(1-methyl-quinolinio-6-yl) -amide] -6- [2- (1-methyl-1-piperidinio yl) ethylamide]
ww N 'NIN ~ / ~ N +
IN ~ 'i OO
I- I
I_ Step 7: The procedure is as in Step 3 of Example 2, but starting from 140 mg of 2,6-pyridine-2-dicarboxylic acid - [(quinolin-6-yl) amide], obtained at Step 1 of Example 9, of 73 μl of 1- (2-aminoethyl) piperidine, 100 mg EDCI and 7 mg HOBT in 5 mL dichloromethane and 5 mL DMF
for 48 hours at room temperature. We thus obtain, after purification by flash-chromatography on silica gel, eluting with a mixture of dichloromethane and methanol (80/20 by volume), 200 mg 2,6-pyridine-2-dicarboxylic acid - [(quinolin-6-yl) amide] -6- [2- (piperidin-1) yl) ethylamide], in the form of a yellow oil, used as it is in step next.
Step 2: We operate as in step 2 of example 1, but from 200 mg of 2,6-pyridine-2-dicarboxylic acid - [(quinolin-6-yl) amide] -6- [2-(piperidin-1-yl) -ethylamide], obtained above, in 2 mL of DMF and 6 mL
iodomethane. After recrystallization from ethanol, 73 mg of 2,6-pyridine-2-dicarboxylic acid - [(1-methyl-quinolinio) -6-iodide yl) amide] -6- [2- (1-methyl-piperidin-1-yl) ethylamide] as a solid yellow whose characteristics are as follows - Melting point (Kofler)> 260 ° C
EXAMPLE 13 Preparation of the Iodide of 2,6-pyridine-dicarboxylic acid 2 - [(1-methyl-quinolinio-3-yl) -amide] -6- [quinolin-3-yl) -amide]
l ~ ~ N ~ NN ~ w Hlli ~ H, i N * pp .N
p ~
106 mg of 2,6-pyridine dicarboxylic acid-bis - [(quinolin-3-yl) amide], obtained In Step 1 of Example 11, are dissolved in 3 mL of DMF, then 36.6 mg of methyl iodide and then heated in a sealed tube of 10 mL, for 5 hours at 80 °. After cooling, 10 ml of oxide are added of Diethyl. The precipitate obtained is drained, washed with diethyl ether and then purified by LC / MS chromatography using a C18 silica column Waters Xterra 3.5 pM, diameter 3 mm and length 50 mm, eluent by a linear elution gradient constituted at the initial time (t0 = 0 mn) by of water with 0.05% TFA and at the final time (tf = 4 min) with acetonitrile containing 0.05% TFA. By collecting the fraction eluted at 2.63 ml, 98 mg of 2,6-pyridine-2-dicarboxylic acid iodide are obtained.
[(1-methyl-quinolinio-3-yl) amide] -6- [quinolin-3-yl] amide], in the form of a yellow solid whose characteristics are as follows - Melting point (Kofler)> 260 ° C
EXAMPLE 14 Preparation of 2,6-pyridine-dicarboxylic acid diodide 2 - [(1-methyl-quinolinio-3-yl) -amide] -6- [1- (2-hydroxyethyl) quinolinio-3-yl) amide]

H ~~~ H
ww N ~ NN iw I i N ~ OO ~ N + I i I_ ~ - I
OH
In a knit of 25 ml, 112.3 mg of iodide of the acid are suspended.
2,6-pyridine dicarboxylic-2 - [(1-methyl-quinolinio-3-yl) -amide] -6- [quinolin-3-yl) amide], obtained as in Example 13, in 5 mL of acetonitrile, are added 1 mL of 2-iodoethanol, and then heated under reflux for 72 hours.
The red insoluble material obtained is drained, washed with acetonitrile and then mixed acetonitrile and ethanol (50-50 by volume), then purified by LC / MS chromatography using a Waters Xterra C18 silica column 3.5 pM, diameter 3 mm and length 50 mm, eluting with a gradient linear elution constituted at the initial time (t0 - 0 min) by water added with 0.05% TFA and at the final time (tf = 4 min) with acetonitrile containing 0.05% TFA. By collecting the fraction eluted at 2.20 min, 30 mg of 2,6-dicarboxylic acid dihydrate are obtained.
2 - [(1-methyl-quinolinio-3-yl) -amide] -6- [1- (2-hydroxyethyl) quinolinio-3-yl) amide], in the form of a beige solid whose characteristics are the following - Melting point (Kofler)> 260 ° C
Example 15 Preparation of 4-bromo-2,6-pyridine acid diodide dicarboxylic-bis - [(1-methyl-quinolinio-3-yl) -amide]
gr I
I ww N ~ NN ~ \
N * ~ ~ ~ N + I i IIII
Step 7: We operate as in step 1 of example 1, but from 502 mg of 4-bromo-2,6-pyridine-dicarboxylic acid, which can be prepared according to Tetrahedron Lett. 2001, 42, 4849-51, and 588 mg of 3-aminoquinoline, which can be prepared according to Tetrahedron. Lett. 2001, 42, 3251-54, 821 mg of EDCI and 55 mg of HOBT in 23 mL of DMF under stirring for 20 hours at room temperature. 935 mg is obtained of 4-bromo-2,6-pyridine-dicarboxylic acid-bis - [(quinolin-3-yl) amide], under form of a gray-green powder, used as it is in the next step.

Step 2: We operate as in step 2 of the exemption 1, but from 300 mg of 4-bromo-2,6-pyridine-dicarboxylic acid-bis - [(quinolin-3) yl) amide], obtained above in 8 mL of DMF and 12.63 mL of iodomethane.
After recrystallization from ethanol, 296 mg of sodium diodide are obtained.
4-bromo-2,6-pyridine-dicarboxylic acid-bis - [(1-methyl-quinolinio-3-yl) amide], in the form of a yellow solid whose characteristics are the following - Melting point (Kofler)> 260 ° C
EXAMPLE 16: PHARMACEUTICAL COMPOSITION
Tablets having the following formula were prepared:
Product of Example 1 .....: .................. 0.2 g Excipient for a tablet finished at .......... 1 g (details of the excipient: lactose, talc, starch, magnesium stearate).

Tablets having the following formula were prepared Product of Example 12 ........................ 0.2 g Excipient for a tablet finished at .......... 1 g (details of the excipient: lactose, talc, starch, magnesium stearate).

Claims (49)

44 1 - Compounds fixing the G-quadruplex structure of DNA or RNA characterized in that they satisfy the following general formula (IB):
nitrogenous aromatic ring having a nitrogen atom in the form of quaternary - (NR3) p - CO- dispatcher - (CO) m - (NR'3) q - X - cycle aromatic or non-aromatic (IB) with m, p and q identical or different represent the integer 0 or 1, in which .cndot. the nitrogenous aromatic ring having a quaternary atom, represent:
~ quinoline, which may be substituted by at least a group N (Ra) (Rb) in which Ra and Rb, identical or different represent hydrogen or a C1-C4 alkyl radical or a short-chain alkyl or alkoxy group of C1-C4 or ~~ and whose nitrogen atom is quaternized by a chain C1-C4 alkyl, optionally substituted by a hydroxy radical, carboxy, C1-C4 alkoxy, C1-C4 alkylthio, amino, alkylamino C1-C4, C1-C4 dialkylamino for each alkyl group, .cndot. the aromatic or non-aromatic cycle represents ~ quinoline, which may be substituted by at least a group N (Ra) (Rb) in which Ra and Rb, identical or different represent hydrogen or a C1-C4 alkyl radical or a C1-C4 short-chain alkyl or alkoxy group or ~ a quinoline having a nitrogen atom in the form quaternary or ~ a benzamidine or ~ a pyridine or ~ a phenyl ring optionally substituted by a halogen group, C1-C4 alkoxy, cyano, carbonylamino optionally substituted with one or several C 1 -C 4 alkyl groups, guanyl, alkylthio C1-C4, amino, C1-C4 alkylamino, C1-dialkylamino C4 for each alkyl, nitro, alkyleneamino group C1-C4 or alkenyleneamino C2-C4 or an aromatic or non-aromatic heterocyclic ring mono or bi or tricyclic having 0 to 2 heteroatoms per cycle provided that at least one heteroatom is present in at least one optionally substituted cycle by one or more C 1 -C 4 alkyl groups or by C1-C4 alkylene or C2-C4 alkenylene groups, and whose heteroatom, when it represents a nitrogen atom, can be optionally in quaternary form.
.cndot. R3 and R'3, identical or different, represent independently of one another hydrogen or an alkyl radical C1-C4 or aralkyl whose alkyl part is C1-C4, .cndot. X represents a single bond, a C1-C4 alkyl radical, a C2-C4 alkenyl radical, C2-C4 alkynyl or phenyl, .cndot. the dispatcher represents:
a heterocyclic radical containing 5 to 6 members containing an atom of sulfur, oxygen or nitrogen a phenyl radical, or ~ a diazine or triazine group, the heterocyclic radicals, phenyl, diazine or triazine being optionally substituted with one or more radicals selected from halogen atoms, alkyl radicals having 1 to 4 carbon atoms and thio, oxy or amino radicals themselves optionally substituted by a or more short chain alkyl chains containing 1 to 4 carbon atoms carbon, it being understood that for the products of formula (IB) in which X
represents a single bond, when the dispatcher represents phenyl optionally substituted with NH2, that m, p and q represent 1 and R3 and R3 ' represent hydrogen then the nitrogenous aromatic ring and the cycle not both an unsubstituted quinoline or substituted on its nitrogen atom by an alkyl radical containing 1 to 6 46 ~

carbon atoms, or one of its salts and when the dispatcher represents a triazine and p and q both represent the integer 1, so m does not represent the integer 0.

said products of formula (IB) being in all isomeric forms possible racemic, enantiomeric and diastereoisomeric, as well as salts of addition with mineral and organic acids or with bases inorganic and organic of said products of formula (IB). 2 - Compounds fixing the G-quadruplex structure of telomeres characterized in what they answer to the general formula as defined in the claim 1. 3 - Compounds as highly specific DNA ligands in G-quadruplexes characterized in that they respond to the general formula such as defined in claim 1. 4 - Compounds according to any one of the preceding claims characterized in that the heterocyclic groups, including Dispatcher can be chosen are the thienyl and pyridyl groups. - Compounds according to claims 1 to 3, characterized in that distributor is chosen from heterocyclic groups, such as, for example pyridyl or thienyl, a phenyl radical, a diazine or a triazine such as defined in claim 1. 6 - Compounds according to any one of the preceding claims characterized in that the diazine groups are pyrazines. 7 - Compounds according to any one of the preceding claims characterized in that the dispatcher is meta-disubstituted by the Nitrogen aromatic ring groups having a nitrogen atom quaternary form - (NR3) p - CO "and" (CO) m - (NR'3) q - aromatic ring or non-aromatic "as defined in claim 1 and the distributor is further optionally substituted by a halogen atom. 8 - Compounds according to any one of the preceding claims characterized in that the heterocycle in quaternary form is a quinoline. 9 - Compounds according to any one of the preceding claims characterized in that the tundish is a 2,6-disubstituted pyridine or a pyrazine-2-6-disubstituted by "aromatic ring" groups nitrogen having a quaternary nitrogen atom in quaternary form - (NR3) p - CO "and" (CO) m - (NR'3) q - aromatic ring or not aromatic "and whose quaternized heterocycle is an N-methyl-quinolinium, and the dispatcher is furthermore optionally substituted by an atom halogen. Compounds according to any one of the preceding claims characterized in that p and q represent the integer 1. 11 - Compounds according to any one of the preceding claims characterized in that m, p and q represent the integer 1. 12 - Compounds according to claim 1 characterized in that they respond to formula (Ia) below with m, p and q identical or different represent the integer 0 or 1 .cndot. A represents:
a heterocyclic radical containing 5 to 6 members containing an atom of sulfur, oxygen or nitrogen ~ a phenyl radical, or ~~
~ a diazine or triazine group, the heterocyclic radicals, phenyl, diazine or triazine being optionally substituted with one or more radicals selected from halogen atoms, alkyl radicals having 1 to 4 carbon atoms and thio, oxy or amino radicals themselves optionally substituted by a or more short chain alkyl chains containing 1 to 4 carbon atoms carbon, Ar1 and Ar2, which are identical or different, represent when Ar1 and Ar2 are identical, they represent an aromatic nitrogen cycle possessing a quaternary atom represented by a quinoline possibly substituted by at least a group N (Ra) (Rb) in which Ra and Rb, identical or different represent hydrogen or a C1-C4 alkyl radical or a short-chain alkyl or alkoxy group of C1-C4 or ~ and whose nitrogen atom is quaternized by a chain C1-C4 alkyl, optionally substituted by a hydroxy radical, carboxy, C1-C4 alkoxy, C1-C4 alkylthio, amino, alkylamino C1-C4, C1-C4 dialkylamino for each alkyl group, when Ar1 and Ar2 are different Ar1 represents one of the possibilities above and Ar2 represents a phenyl ring optionally substituted by a halogen group, C 1 -C 4 alkoxy, cyano, carbonylamino optionally substituted with one or several C 1 -C 4 alkyl, guanyl, C 1 -C 4 alkylthio, amino, C1-C4 alkylamino, C1-C4 dialkylamino for each alkyl group, nitro, C 1 -C 4 alkyleneamino or C 2 -C 4 alkenyleneamino * a benzamidine * a pyridyl core an aromatic or nonaromatic heterocyclic ring mono or bi or tricyclic compound having 0 to 2 heteroatoms per ring provided that at least a heteroatom is present in at least one cycle substituted with one or more C1-C4 alkyl groups or by groups C1-C4 alkylene or C2-C4 alkenylene, .cndot. R3 and R'3, identical or different, represent independently of one another hydrogen or an alkyl radical C1-C4 or aralkyl in which the alkyl radical is C1-C4, .cndot. X represents a single bond, a C1-C4 alkyl radical, a C 2 -C 4 alkenyl or alkynyl radical or a phenyl radical, said products of formula (Ia) being in all isomeric forms possible racemic, enantiomeric and diastereoisomeric, as well as salts of addition with mineral and organic acids or with bases inorganic and organic of said products of formula (Ia). 13 - Products of formula (Ia) as defined in claim 12 in X represents a C 1 -C 4 alkyl radical, the other substituents of products of formula (Ia) being chosen from the values indicated in claim 12, said products of formula (Ia) being in all isomeric forms possible racemic, enantiomeric and diastereoisomeric, as well as salts of addition with mineral and organic acids or with bases inorganic and organic of said products of formula (Ia). 14 - Compounds according to claim 12, characterized in that A is chosen among heterocyclic groups, such as, for example, pyridyl or thienyl, a phenyl radical, a diazine or a triazine as defined in claim 1. 15 - Compounds according to any one of the preceding claims characterized in that the diazine groups that A may represent are pyrazines. 16 - Compounds according to any one of the preceding claims characterized in that A is meta-disubstituted by the "ring" groups nitrogenous aromatic having a nitrogen atom in quaternary form - (NR3) p - CO "and" (CO) m - (NR'3) q - aromatic ring or not as defined in claim 1 and A is furthermore optionally substituted with a halogen atom. 17 - Compounds according to any one of the preceding claims characterized in that the heterocycle in quaternary form is a quinoline. 18 - Compounds according to any one of the preceding claims characterized in that A represents a 2,6-disubstituted pyridine or a pyridazine-2-6- disubstituted by the groups "nitrogenous aromatic cycle"
possessing a quaternary nitrogen atom in quaternary form - (NR3) p -CO "and" (CO) m - (NR'3) q - aromatic or nonaromatic cycle "and the quaternized heterocycle is an N-methyl-quinolinium, and A is in addition optionally substituted with a halogen atom. 19 - Compounds according to the preceding claims, characterized in that m, p and q represent the integer 1. 20 - Compounds according to any one of the preceding claims characterized in that p and q represent the integer 1. 21 - Compounds according to any one of the preceding claims characterized in that Ar2 represents a group selected from groups 4-amino- or 4-methylamino-, 4-dimethylamino- or 4-alkoxy-quinolyl or quinolinium whose quinolinium nucleus is possibly substituted by one or two methyl group (s). 22 - Compounds according to any one of the preceding claims characterized in that R3 and R3 'are hydrogen. 23 - Compounds of formula (I) chosen from:
2,6-pyridine-dicarboxylic acid-bis - [(1-methyl-quinolinium) diodide yl) amide]
2,6-pyridinedicarboxylic acid-2 - [(1-methyl-quinolinio) -6-diodide yl) amide] -6 - [(4-dimethylamino-1-methyl-quinaldinio-6-yl) -amide].
2,6-pyrazine-dicarboxylic acid-bis - [(1-methyl-quinolinium) diodide yl) amide]
1,3-benzenedicarboxylic acid-bis - [(1-methyl-quinolinio) -6-diiodide yl) amide]
2,6-pyridine-dicarboxylic acid-bis - [(1-methyl-quinaldinium) diodide yl) amide]
- iodide of 2,6-pyridine-2-dicarboxylic acid - [(1-methyl-quinolinium-6) yl) amide] -6 - [(4-aminoquininaldin-6-yl) amide], isolated in its tautomeric form imino below 2,6-benzenedicarboxylic acid-bis - [(1-methyl-quinaldinium) diodide 6-yl) -amide]
2,4-pyridine-dicarboxylic acid-bis - [(1-methyl-quinolin-6) diodide yl) amide]
- iodide of 2,6-pyridine-2-dicarboxylic acid - [(1-methyl-quinolinium-6) yl) amide] -6 - [(1-methyl-quinolinio-3-yl) -amide]
- iodide of 2,6-pyridine-2-dicarboxylic acid - [(1-methyl-quinolinium-6) yl) amide] -6 - [(1-methyl-quinolinio-5-yl) amide]

2,6-pyridine-dicarboxylic acid-bis - [(1-methyl-quinolinium) diodide yl) amide]
2,6-pyridinedicarboxylic acid-2 - [(1-methyl-quinolinio) -6-diodide yl) amide] -6- [2 (-1-methyl-piperidin-1-yl) ethylamide] - iodide of the acid 2,6 pyridine dicarboxylic-2 - [(1-methyl-quinolinio-3-yl) -amide] -6- [quinolin-3-yl) amide]
2,6-pyridinedicarboxylic acid-2 - [(1-methyl-quinolinio) -3-diodide) yl) -amide] -6- [1- (2-hydroxyethyl) quinolinio-3-yl) -amide]
- 4-bromo-2,6-pyridine-dicarboxylic acid-bis - [(1-methyl) diodide quinolinio-3-yl) -amide]

or the salts or other salts of these compounds, said products of formula (I) being in all isomeric forms possible racemates, enantiomers and diastereoisomers, as well as the addition salts with mineral and organic acids or with mineral bases and organic compounds of said formula (I). 24 - Compounds according to the preceding claim chosen from:
2,6-pyridine-dicarboxylic acid-bis - [(1-methyl-quinolinium) diodide yl) amide]
2,6-pyridinedicarboxylic acid-2 - [(1-methyl-quinolinio) -6-diodide yl) amide] -6 - [(4-dimethylamino-1-methyl-quinaldinio-6-yl) -amide]
2,6-pyrazine-dicarboxylic acid-bis - [(1-methyl-quinolinium) diodide yl) amide]
1,3-benzenedicarboxylic acid-bis - [(1-methyl-quinolinio) -6-diiodide yl) amide]
2,6-pyridine-dicarboxylic acid-bis - [(1-methyl-quinaldinium) diodide yl) amide]
- iodide of 2,6-pyridine-2-dicarboxylic acid - [(1-methyl-quinolinium-6) yl) amide] -6 - [(4-aminoquininaldin-6-yl) amide], isolated in its tautomeric form imino below 2,6-benzenedicarboxylic acid-bis - [(1-methyl-quinaldinium) diodide 6-yl) -amide]
2,4-pyridine-dicarboxylic acid-bis - [(1-methyl-quinolin-6) diodide yl) amide]

- iodide of 2,6-pyridine-2-dicarboxylic acid - [(1-methyl-quinolinium-6) yl) amide] -6 - [(1-methyl-quinolinio-3-yl) -amide]
- iodide of 2,6-pyridine-2-dicarboxylic acid - [(1-methyl-quinolinium-6) yl) amide] -6 - [(1-methyl-quinolinio-5-yl) amide]
2,6-pyridine-dicarboxylic acid-bis - [(1-methyl-quinolinium) diodide yl) amide] - iodide of 2,6-pyridine-2-dicarboxylic acid - [(1-methyl) quinolinio-3-yl) -amide] -6- [quinolin-3-yl) -amide]
2,6-pyridinedicarboxylic acid-2 - [(1-methyl-quinolinio) -3-diodide) yl) amide] -5- [1- (2-hydroxyethyl) quinolinio-3-yl) -amide]
- 4-bromo-2,6-pyridine-dicarboxylic acid-bis - [(1-methyl) diodide quinolinio-3-yl) -amide]

or the salts or other salts of these compounds said products of formula (I) being in all isomeric forms possible racemates, enantiomers and diastereoisomers, as well as the addition salts with mineral and organic acids or with mineral bases and organic compounds of said formula (I). 2,6-Pyridinedicarboxylic acid-2 - [(1-methyl-quinolinium) diodide 6-yl) -amide] -6- [2- (1-methyl-piperidinio-1-yl) ethylamide]
this product of formula (I) being in all possible isomeric forms racemates, enantiomers and diastereoisomers, as well as the addition salts with mineral and organic acids or with mineral bases and organic 26 - Compounds according to any one of the preceding claims characterized in that they have telomerase inhibitory activity. 27 - Compounds according to any one of the preceding claims characterized in that they have anticancer activity. 28 - As medicaments, the products of formula (IB) as defined the Claims 1 to 27, and their prodrugs, said products of formula (IB) being in all possible racemic isomeric forms, enantiomers and diastereoisomers, as well as the addition salts with mineral and organic acids or with mineral and organic bases pharmaceutically acceptable salts of said products of formula (I). 29 - As medicaments, the products of formula (Ia) as defined the preceding claims and their prodrugs, the said products of formula (Ia) being in all possible racemic isomeric forms, enantiomers and diastereoisomers, as well as the addition salts with mineral and organic acids or with mineral and organic bases pharmaceutically acceptable of said products of formula (Ia). As medicaments, the products as defined in any one of claims 23 to 25 as well as their prodrugs, as well as addition salts with mineral and organic acids or with the pharmaceutically acceptable inorganic and organic bases of these products. 31 - Pharmaceutical compositions containing as active principle, at least one of the medicaments as defined in claims 28 to 30. 32 - Pharmaceutical compositions containing as active principle, at least one of the medicaments as defined in claim 30. 33 - Pharmaceutical compositions as defined in the claims containing, in addition, active ingredients of other medicinal products chemotherapy against cancer. 34 - Pharmaceutical compositions according to any one of preceding claims characterized in that they are used as drugs, especially for chemotherapy of cancers. 35 - Use of Compounds 12 to 27 as a Pharmaceutical Product human use. 36 - Therapeutic associations consisting of a compound according to claim 1 and another anticancer compound. 37 - Associations according to claim 38 characterized in that the anticancer compound is chosen from alkylating agents, derivatives of platinum, antibiotic agents, antimicrotubule agents, anthracyclines, topoisomerases of groups I and II, fluoropyrimidines, cytidine analogues, adenosine analogues, enzymes and compounds such as L-asparaginase, hydroxyurea, trans-retinoic, suramin, irinotecan, topotecan, dexrazoxane, amifostine, herceptin and oetrogenic hormones, androgenic, antiviral agents. 38 - Therapeutic combination consisting of a compound according to claim 1 and radiation. 39 - Associations according to any one of claims 36 to 38 characterized in that each of the compounds or treatments is administered simultaneously, separately or sequentially. 40 - Use of products of formula (IB) as defined in one any of the preceding claims or pharmaceutically acceptable salts said products of formula (I) for the preparation of a medicament for treat cancers, genetic diseases or hair diseases. 41 - Use of products of formula (IB) as defined in one any of the preceding claims or pharmaceutically acceptable salts said products of formula (I) for the preparation of a medicament for treat cancers. 42 - Use of products of formula (IB) as defined in one any of the preceding claims or pharmaceutically acceptable salts said products of formula (IB) for the preparation of a medicinal product to treat genetic diseases such as Bloom syndromes, Werner, Rothmund-Thomson or ataxia telangiectaxis. 43 - Use of products of formula (IB) as defined in one any of the preceding claims or pharmaceutically acceptable salts said products of formula (IB) for the preparation of a medicinal product to treat hyperpilosities. 44 - Use of products of formula (IB) as defined in one any of the preceding claims or pharmaceutically acceptable salts said products of formula (IB) for the preparation of a medicinal product to treat cancers including breast cancer, stomach cancer, colon, lungs, ovaries, uterus, brain, kidney, larynx, lymphatic system, thyroid, uro-genital tract, tract including gallbladder and prostate, bone cancer, pancreas, melanoma. 45 - Use of products of formula (IB) according to the preceding claim in which the disease to be treated is breast cancer, colon cancer or lungs. 46 - Use of products of formula (IB) as defined in one any of the preceding claims or pharmaceutically acceptable salts said products of formula (IB) for the preparation of a medicinal product cancer chemotherapy. 47 - Use of products of formula (IB) as defined in one any of the preceding claims or pharmaceutically acceptable salts said products of formula (IB) for the preparation of medicaments for the chemotherapy of cancers used alone or in combination. 48 - Use of products of formula (IB) as defined in one any of the preceding claims or pharmaceutically acceptable salts said products of formula (IB) for the preparation of medicaments for to be used alone or in combination with chemotherapy or radiotherapy or alternatively in combination with other therapeutic agents. 49 - Use of products of formula (IB) according to the preceding claim wherein the therapeutic agents may be anti-inflammatory agents commonly used tumors.