EP1513937B1 - A method for the stimultaneaous production of multiple proteins; vectors and cells for use therein - Google Patents

A method for the stimultaneaous production of multiple proteins; vectors and cells for use therein Download PDF

Info

Publication number
EP1513937B1
EP1513937B1 EP03733632A EP03733632A EP1513937B1 EP 1513937 B1 EP1513937 B1 EP 1513937B1 EP 03733632 A EP03733632 A EP 03733632A EP 03733632 A EP03733632 A EP 03733632A EP 1513937 B1 EP1513937 B1 EP 1513937B1
Authority
EP
European Patent Office
Prior art keywords
star
sequence
protein
expression
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
EP03733632A
Other languages
German (de)
English (en)
French (fr)
Other versions
EP1513937A2 (en
Inventor
Arie Pieter Otte
Arthur Leo Kruckeberg
Richard George Antonius Bernardus Sewalt
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Chromagenics BV
Original Assignee
Chromagenics BV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Chromagenics BV filed Critical Chromagenics BV
Priority to EP03733632A priority Critical patent/EP1513937B1/en
Publication of EP1513937A2 publication Critical patent/EP1513937A2/en
Application granted granted Critical
Publication of EP1513937B1 publication Critical patent/EP1513937B1/en
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67General methods for enhancing the expression
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/822Reducing position variability, e.g. by the use of scaffold attachment region/matrix attachment region (SAR/MAR); Use of SAR/MAR to regulate gene expression
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8257Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits for the production of primary gene products, e.g. pharmaceutical products, interferon

Definitions

  • the invention relates to the fields of biochemistry, molecular biology, pharmacology and diagnosis. More specifically the present invention relates to the production of proteins in a host cell. Wand even more specifically the invention relates to a method for improving expression of two or more proteins in a (host) cell. The method is suited for production of for example recombinant antibodies that can be used in a pharmaceutical preparation or as a diagnostic tool.
  • Proteins are produced in systems for a wide range of applications in biology and biotechnology. These include research into cellular and molecular function, production of proteins as biopharmaceuticals or diagnostic reagents, and modification of the traits or phenotypes of livestock and crops.
  • Biopharmaceuticals are usually proteins that have an extracellular function, such as antibodies for immunotherapy or hormones or cytokines for eliciting a cellular response. Proteins with extracellular functions exit the cell via the secretory pathway, and undergo post-translational modifications during secretion. The modifications (primarily glycosylation and disulfide bond formation) do not occur in bacteria.
  • the specific oligosaccharides attached to proteins by glycosylating enzymes are species and cell-type specific.
  • Some proteins of biotechnological interest are functional as multimers, i.e. they consist of two or more, possibly different, polypeptide chains in their biologically and/or biotechnologically active form. Examples include antibodies (Wright & Morrison, 1997), bone morphogenetic proteins (Groeneveld & Burger, 2000), nuclear hormone receptors (Aranda & Pascual, 2001), heterodimeric cell surface receptors (e.g., T cell receptors, (Chan & Mak, 1989)), integrins (Hynes, 1999), and the glycoprotein hormone family (chorionic gonadotrophin, pituitary luteinizing hormone, follicle-stimulating hormone, and thyroid-stimulating hormone, (Thotakura & Blithe, 1995)).
  • antibodies Wright & Morrison, 1997), bone morphogenetic proteins (Groeneveld & Burger, 2000), nuclear hormone receptors (Aranda & Pascual, 2001), heterodimeric cell surface receptor
  • Transgene amplification is achieved by including a selectable marker gene such as dihydrofolate reductase (DHFR) with the transgene during integration.
  • DHFR dihydrofolate reductase
  • Increased concentrations of the selection agent in the case of DHFR, the drug methotrexate
  • select for cells that have amplified the number of DHFR genes in the chromosome Since the transgene and DHFR are co-localized in the chromosome, the transgene copy number increases too. This is correlated with an increase in the yield of the heterologous protein (Kaufman, 1990).
  • tandem repeats of transgenes that result from amplification are highly susceptible to silencing (Garrick et al., 1998, Kaufman, 1990, McBurney et al., 2002). Silencing is often due to a decline in transgene copy number after the selection agent is removed (Kaufman, 1990). Removal of the selection agent, however, is routine during industrial biopharmaceutical production, for two reasons. First, cultivation of cells at industrial scales in the presence of selection agents is not economically feasible, as the agents are expensive compounds. Second, and more importantly, concerns for product purity and safety preclude maintaining selection during a production cycle. Purifying a recombinant protein and removing all traces of the selection agent is necessary if the protein is intended for pharmaceutical use. However, it is technically difficult and prohibitively expensive to do so, and demonstrating that this has been achieved is also difficult and expensive. Therefore amplification-based transgenic systems that require continual presence of selections agents are disadvantageous.
  • silencing can be due to epigenetic effects on the transgene tandem repeats, a phenomenon known as Repeat Inducted Gene Silencing (RIGS) (Whitelaw et al., 2001). In these cases the copy number of the transgene is stable, and silencing occurs due to changes in the chromatin structure of the transgenes (McBurney et al., 2002). The presence of a selection agent during cell cultivation may be unable to prevent silencing of the transgene transcription unit because transgene expression is independent of expression of the selectable marker. The lack of a means to prevent RIGS in conventional transgenic systems thus results in costly losses in productivity.
  • RIGS Repeat Inducted Gene Silencing
  • US 6,194,212 relates to the use of scaffold attachment regions (SARs) to increase gene expression in cells.
  • SARs scaffold attachment regions
  • a method for the simultaneous expression of two genes, the RevM10 gene and the Lyt-2 surface marker, linked by an IRES and flanked by scaffold attachment regions (SAR) is disclosed.
  • WO 97/27207 also describes methods for increasing the expression of two foreign genes (NptII and GUS) in a cell by flanking their coding sequences by a scaffold attachment region (in particular RB7 SAR).
  • WO 00/09749 discloses constructs for the simultaneous expression of neomycin phosphotransferase (NPTII) and glucuronidase (GUS) using scs (special chromatin structure) from Drosophilia melanogaster..
  • NPTII neomycin phosphotransferase
  • GUS glucuronidase
  • Auten et al. (Human Gene Therapy, vol. 10(8): 1389-1399, 1999 ) describe the simultaneous expression of a truncated human nerve growth factor receptor and dihyfrofolate reductase (DHFR) by transforming cells with a construct wherein the genes encoding said proteins are linked by an internal ribosome entry site (IRES) and flanked by SARs.
  • IRES internal ribosome entry site
  • the problems associated with conventional transgene expression technologies for protein production and more specifically for multimeric protein production clearly demonstrate a need in the art for a system that overcomes these problems.
  • the present invention relates to a hovel system for creating (host) cells/cell lines that efficiently express two or more proteins, for example two or more polypeptide monomers and optionally produce functional multimeric proteins from them.
  • Important examples of heterologous multimer proteins are recombinant antibodies.
  • the invention takes advantage of proprietary DNA elements that protect transgene from silencing, termed STabilizing Anti-Repressor (STAR or STARTM; the terms will be used interchangeably herein) elements, for the production of two or more protein.
  • STabilizing Anti-Repressor STAR or STARTM; the terms will be used interchangeably herein
  • the invention also discloses a novel configuration of transcriptional and translational elements and selectable marker genes.
  • the invention uses antibiotic resistance genes and protein translation initiation sites with reduced translation efficiency (for example an Internal Ribosome Binding Site, IRES) in novel ways that improve heterologous protein expression.
  • IRES Internal Ribosome Binding Site
  • the combination of the STAR elements and these other elements results in a system for obtaining a cell which expresses two or more proteins that (1) predictable produces a high proportion of recombinant cell lines with high yields of heterologous proteins, (2) exhibits balanced and proportional expression of two or more polypeptide monomers which are constituents of a multimeric protein, and (8) creates recombinant cell lines with stable productivity characteristics.
  • the invention provides in one embodiment, a cell comprising two protein expression units each encoding at least one protein of interest, wherein one of said protein expression units comprises at least one Stabilizing Anti-Repressor (STAR) sequence chosen from the group consisting of: (a) SEQ ID: 7 in Figure 6 ; (b) a sequence derived from SEQ ID: 7 in Figure 6 by deletion, modification and/or insertion of one or more bases and (c) a functional fragment of SEQ ID: 7 in Figure 6 ; and wherein the other protein expression unit comprises at least one Stabilizing Anti-Repressor (STAR) sequence chosen from the group consisting of (a) SEQ ID: 1-65 in Figure 6 ; (b) a sequence derived from SEQ ID: 1-65 in Figure 6 by deletion, modification and/or insertion of one or more bases; and (c) a functional fragment of SEQ ID: 1-65 in Figure 6 .
  • STAR Stabilizing Anti-Repressor
  • cell/"host cell and “cell line”/”host cell line” are respectively typically defined as a eukaryotic cell and homogeneous population thereof that are maintained in cell culture by methods known in the art, and that have the ability to express heterologous proteins.
  • RNA products it refers to the process of transcription.
  • protein products it refers to the processes of transcription, translation and optionally post-translational modifications.
  • secreted proteins it refers to the processes of transcription, translation, and optionally post-translational modification (e.g. glycosylation, disfulfide bond formation, etc.); followed by secretion.
  • multimeric proteins it includes assembly of the multimeric structure from the polypeptide monomers.
  • the corresponding verbs of the noun "expression" have an analogous meaning as said noun.
  • a protein is herein defined as being either (i) a product obtained by the processes of transcription and translation and possibly but not necessarily said product is part of a multimeric protein (for example a subunit) and/or (ii) a product obtained by the processes of transcription, translation and post-translational modification.
  • the term "multimer” or "multimeric protein” is typically defined as a protein that comprises two or more, possibly non-identical, polypeptide chains ("monomers"). The different monomers in a multimeric protein can be present in stoichiometrically equal or unequal numbers. In either case, the proportion of the monomers is usually fixed by the functional structure of the multimeric protein.
  • protein expression unit is herein defined as a unit capable of providing protein expression and typically comprises a functional promoter, an open reading frame encoding a protein of interest and a functional terminator, all in operable configuration.
  • a functional promoter is a promoter that is capable of initiating transcription in a particular cell. Suitable promotors for obtaining expression in eukaryotic cells are the CMV-promoter, a mammalian EF1-alpha promoter, a mammalian ubiquitin promoter, or a SV40 promoter.
  • a functional terminator is a terminator that is capable of providing transcription termination.
  • a suitable terminator is an SV40 terminator.
  • an open reading frame encoding a protein of interest is typically defined as a fragment of DNA which codes for a specific RNA product or products or a specific protein or proteins, and which is optionally capable of becoming integrated into the genome of a host cell. It includes DNA elements required for proper transcription and translation of the coding region(s) of the transgene.
  • Said DNA encoding said protein of interest/transgene can either be a DNA encoding a product obtained by the processes of transcription and translation (and possibly but not necessarily said product is part of a multimeric protein, for example a subunit) or a product obtained by the processes of transcription, translation and post-translational modification.
  • recombinant cell/host cell and “recombinant cell line/host cell line” are respectively typically defined as a host cell and homogeneous populations thereof into which a transgene has been introduced for the purpose of producing a heterologous protein or proteins.
  • a STAR (STabilizing Anti-Repressor) sequence (or STAR element; the terms will be used interchangeably herein) is a naturally occurring DNA element that we have isolated from eukaryotic genomes on the basis of their ability to block transgene repression.
  • the STAR elements are recovered from the human genome.
  • a STAR sequence comprises the capacity to influence transcription of genes in cis and/or provide a stabilizing and/or an enhancing effect. It has been demonstrated that when STAR elements flank transgenes, the transgene expression level of randomly selected recombinant cell lines can be increased to levels approaching the maximum potential expression of the transgene's promoter. Moreover, the expression level of the transgene is stable over many cell generations, and does not manifest stochastic silencing.
  • STAR sequences confer a degree of position-independent expression on transgenes that is not possible with conventional transgenic systems.
  • the position independence means that transgenes that are integrated in genomic locations that would result in transgene silencing are, with the protection of STAR elements, maintained in a transcriptionally active state.
  • STAR-sequences can be identified (as disclosed for example in example 1 of EP 01202581.3 ) using a method of detecting, and optionally selecting, a DNA sequence with a gene transcription-modulating quality, comprising providing a transcription system with a variety of fragment-comprising vectors, said vectors comprising i) an element with a gene-transcription repressing quality, and ii) a promoter directing transcription of a reporter gene, the method further comprising performing a selection step in said transcription system in order to identify said DNA sequence with said gene transcription modulating quality.
  • said fragments are located between i) said element with a gene-transcription repressing quality, and ii) said promoter directing transcription of said reporter gene.
  • RNA polymerase initiates the transcription process after binding to a specific sequence, called the promoter, that signals where RNA synthesis should begin.
  • a modulating quality can enhance transcription from said promoter in cis, in a given cell type and/or a given promoter.
  • the same DNA sequence can comprise an enhancing quality in one type of cell or with one type of promoter, whereas it can comprise another or no gene transcription modulating quality in another cell or with another type of promoter.
  • Transcription can be influenced through a direct effect of the regulatory element (or the protein(s) binding to it) on the transcription of a particular promoter. Transcription can however, also be influenced by an indirect effect, for instance because the regulatory element affects the function of one or more other regulatory elements.
  • a gene transcription modulating quality can also comprise a stable gene transcription quality.
  • stable is meant that the observed transcription level is not significantly changed over at least 30 cell divisions.
  • a stable quality is useful in situations wherein expression characteristics should be predictable over many cell divisions. Typical examples are cell lines transfected with foreign genes. Other examples are transgenic animals and plants and gene therapies. Very often, introduced expression cassettes function differently after increasing numbers of cell divisions or plant or animal generations.
  • a stable quality comprises a capacity to maintain gene transcription in subsequent generations of a transgenic plant or animal.
  • said quality comprises the quality to maintain inducibility of expression in subsequent generations of a transgenic plant or animal. Frequently, expression levels drop dramatically with increasing numbers of cell divisions.
  • said gene transcription modulating quality comprises a stable gene transcription quality. Strikingly, fragments comprising a DNA sequence with said stable gene transcription quality can be detected and optionally selected with the method for identification of a DNA sequence with a gene transcription modulating quality, in spite of the fact that said method does not necessarily measure long term stability of transcription.
  • said gene transcription modulating quality comprises a stable gene transcription enhancing quality.
  • an identified DNA sequence with gene transcription modulating quality also provides a method for increasing the number of cells expressing a more than a certain level of a gene product of a gene of interest upon providing said gene of interest to the genome of said cells, comprising providing said cell with a DNA sequence comprising a gene transcription modulating quality together with said gene of interest.
  • the chances of detecting a fragment with a gene transcription-modulating quality vary with the source from which the fragments are derived. Typically, there is no prior knowledge of the presence or absence of fragments with said quality. In those situations many fragments will not comprise a DNA sequence with a gene transcription-modulating quality. In these situations a formal selection step for DNA sequences with said quality is introduced. This is done by selection vectors comprising said sequence on the basis of a feature of a product of said reporter gene, that can be selected for or against. For instance, said gene product may induce fluorescence or a color deposit (e.g. green fluorescent protein and derivatives, luciferase, or alkaline phosphatase) or confer antibiotic resistance or induce apoptosis and cell death.
  • a color deposit e.g. green fluorescent protein and derivatives, luciferase, or alkaline phosphatase
  • a method for the identification of a DNA sequence with a gene transcription modulating quality is particularly suited for detecting and optionally selecting a DNA sequence comprising a gene transcription-enhancing quality. It has been observed that at least some of the selected DNA sequences, when incorporated into an expression vector comprising a gene of interest, can dramatically increase gene transcription of said gene of interest in a host cell even when the vector does not comprise an element with a gene-transcription repressing quality. This gene transcription enhancing quality is very useful in cell lines transfected with foreign genes or in transgenic animals and plants.
  • Said transcription system can be a cell free in vitro transcription system. With the current expertise in automation such cell free systems can be accurate and quick.
  • said transcription system preferably comprises host cells. Using host cells warrants that fragments are detected and optionally selected with activity in cells.
  • An element with a gene transcription repressing quality will repress transcription from a promoter in the transcription system used. Said repression does not have to lead to undetectable expression levels. Important is that the difference in expression levels in the absence or presence of repression is detectable and optionally selectable.
  • said gene-transcription repression in said vectors results in gene-transcription repressing chromatin.
  • DNA sequences can be detected, and optionally selected that are capable of at least in part counteracting the formation of gene-transcription repressing chromatin.
  • a DNA sequence capable of at least in part counteracting the formation of gene-transcription repressing chromatin comprises a stable gene transcription quality.
  • the DNA sequence involved in gene-transcription repression is a DNA sequence that is recognized by a protein complex and wherein said transcription system comprises said complex.
  • said complex comprises a heterochromatin-binding protein comprising HP1, a Polycomb-group (Pc-G) protein, a histone deacetylase activity or MeCP2 (methyl-CpG-binding protein).
  • Pc-G Polycomb-group
  • MeCP2 methyl-CpG-binding protein
  • Many organisms comprise one or more of these proteins. These proteins frequently exhibit activity in other species as well.
  • Said complex can thus also comprise proteins from two or more species.
  • the mentioned set of known chromatin-associated protein complexes are able to convey long-range repression over many base pairs.
  • the complexes are also involved in stably transferring the repressed status of genes to daughter cells upon cell division. Sequences selected in this way are able to convey long-range anti-repression over many base pairs (van der Vlag et al., 2000).
  • the vector used can be any vector that is suitable for cloning DNA and that can be used in a transcription system.
  • the vector is an episomally replicating vector. In this way, effects due to different sites of integration of the vector are avoided. DNA elements flanking the vector at the site of integration can have effects on the level of transcription of the promoter and thereby mimic effects of fragments comprising DNA sequences with a gene transcription modulating quality.
  • said vector comprises a replication origin from the Epstein-Barr virus (EBV), OriP, and a nuclear antigen (EBNA-1).
  • EBV Epstein-Barr virus
  • EBNA-1 nuclear antigen
  • DNA sequences with gene transcription modulating quality can be obtained from different sources, for example from a plant or vertebrate, or derivatives thereof, or a synthetic DNA sequence or one constructed by means of genetic engineering.
  • said DNA sequence comprises a sequence as depicted in Table 3 and/or Figure 6 and/or a functional equivalent and/or a functional fragment thereof.
  • sequence identifiers can be extracted from a family of DNA sequences sharing a certain common feature. Such sequence identifiers can subsequently be used to identify sequences that share one or more identifiers. Sequences sharing such one or more identifiers are likely to be members of the same family of sequences, i.e are likely to share the common feature of the family.
  • STAR sequences or STAR elements a large number of sequences comprising STAR activity (so-called STAR sequences or STAR elements) were used to obtain sequence identifiers (patterns) which are characteristic for sequences comprising STAR activity. These patterns can be used to determine whether a test sequence is likely to contain STAR activity.
  • a method for detecting the presence of a STAR sequence within a nucleic acid sequence of about 50-5000 base pairs comprising determining the frequency of occurrence in said sequence of at least one sequence pattern and determining that said frequency of occurrence is representative of the frequency of occurrence of said at least one sequence pattern in at least one sequence comprising a STAR sequence.
  • any method is suited for determining whether a sequence pattern is representative of a STAR sequence. Many different methods are available in the art.
  • the step of determining that said occurrence is representative of the frequency of occurrence of said at least one sequence pattern in at least one sequence comprising a STAR sequence comprises, determining that the frequency of occurrence of said at least one sequence pattern significantly differs between said at least one STAR sequence and at least one control sequence. In principle any significant difference is discriminative for the presence of a STAR sequence. However, in a particularly preferred embodiment the frequency of occurrence of said at least one sequence pattern is significantly higher in said at least one sequence comprising a STAR sequence compared to said at least one control sequence.
  • sequences comprising a STAR sequence have been identified herein. It is possible to use these sequences to test how efficient a pattern is in discriminating between a control sequence and a sequence comprising a STAR sequence. Using so-called discriminant analysis it is possible to determine on the basis of any set of STAR sequences in a species, the most optimal discriminative sequence patters or combination thereof. Thus, preferably, at least one of said patterns is selected on the basis of optimal discrimination between said at least one sequence comprising a STAR sequence and a control sequence.
  • the frequency of occurrence of a sequence pattern in a test nucleic acid is compared with the frequency of occurrence in a sequence known to contain a STAR sequence.
  • a pattern is considered representative for a sequence comprising a STAR sequence if the frequencies of occurrence are similar. Even more preferably, another criterion is used.
  • the frequency of occurrence of a pattern in a sequence comprising a STAR sequence is compared to the frequency of occurrence of said pattern in a control sequence. By comparing the two frequencies it is possible to determine for each pattern thus analysed, whether the frequency in the sequence comprising the STAR sequence is significantly different from the frequency in the control sequence.
  • a sequence pattern is considered to be representative of a sequence comprising a STAR sequence, if the frequency of occurrence of the pattern in at least one sequence comprising a STAR sequence is significantly different from the frequency of occurrence of the same pattern in a control sequence.
  • said frequency of occurrence is representative of the frequency of occurrence of said at least one sequence pattern in at least 2 sequences comprising a STAR sequence, more preferably in at least 5 sequences comprising a STAR sequence.
  • said frequency of occurrence is representative of the frequency of occurrence of said at least one sequence pattern in at least 20 sequences comprising a STAR sequence.
  • said frequency of occurrence is representative of the frequency of occurrence of said at least one sequence pattern in at least 50 sequences comprising a STAR
  • the patterns that are indicative for a sequence comprising a STAR sequence are also dependent on the type of control nucleic acid used.
  • the type of control sequence used is preferably selected on the basis of the sequence in which the presence of a STAR sequence is to be detected.
  • said control sequence comprises a random sequence comprising a similar AT/CG content as said at least one sequence comprising a STAR sequence.
  • the control sequence is derived from the same species as said sequence comprising said STAR sequence. For instance, if a test sequence is scrutinized for the presence of a STAR sequence, active in a plant cell, then preferably the control sequence is also derived from a plant cell.
  • control nucleic acid is preferably also derived from a human genome.
  • control sequence comprises between 50% and 150% of the bases of said at least one sequence comprising a STAR sequence.
  • control sequence comprises between 90% and 110% of the bases of said at least one sequence comprising a STAR sequence. More preferably, between 95% and 105%.
  • a pattern can comprise any number of bases larger than two.
  • at least one sequence pattern comprises at least 5, more preferably at least 6 bases. Even more preferably, at least one sequence pattern comprises at least 8 bases.
  • said at least one sequence pattern comprises a pattern listed in table 4 and/or table 5.
  • a pattern may consist of a consecutive list of bases. However, the pattern may also comprise bases that are interrupted one or more times by a number of bases that are not or only partly discriminative. A partly discriminative base is for instance indicated as a purse.
  • the presence of STAR activity is verified using a functional assay.
  • a sequence comprises STAR activity.
  • STAR activity is confirmed if the sequence is capable of performing at least one of the following functions: (i) at least in part inhibiting the effect of sequence comprising a gene transcription repressing element of the invention, (ii) at least in part blocking chromatin-associated repression, (iii) at least in part blocking activity of an enhancer, (iv) conferring upon an operably linked nucleic acid encoding a transcription unit compared to the same nucleic acid alone. (iv-a) a higher predictability of transcription, (iv-b) a higher transcription, and/or (iv-c) a higher stability of transcription over time.
  • sequences comprising STAR activity identified herein open up a wide variety of possibilities to generate and identify sequences comprising the same activity in kind not necessarily in amount. For instance, it is well within the reach of a skilled person to alter the sequences identified herein and test the altered sequence for STAR activity. Such altered sequences are therefore also included herein and can be used in method for obtaining a cell which expresses two or more proteins or in a method for identifying a cell wherein expression of two or more proteins is in a predetermined ratio. Alteration can include deletion, insertion and mutation of one or more bases in the sequences.
  • Sequences comprising STAR activity were identified in stretches of 400 bases. However, it is expected that not all of these 400 bases are required to retain STAR activity. Methods to delimit the sequences that confer a certain property to a fragment of between 400 and 5000 bases are well known. The minimal sequence length of a fragment comprising STAR activity is estimated to be about 50 bases.
  • Table 4 and table 5 list patterns of 6 bases that have been found to be over represented in nucleic acid molecules comprising STAR activity. This over representation is considered to be representative for a STAR sequence.
  • the tables were generated for a family of 65 STAR sequences. Similar tables can be generated starting from a different set of STAR sequences, or from a smaller or larger set of STAR sequences.
  • a pattern is representative for a STAR sequence if it is over represented in said STAR sequence compared to a sequence not comprising a STAR element. This can be a random sequence. However, to exclude a non-relevant bias, the sequence comprising a STAR sequence is preferably compared to a genome or a significant part thereof.
  • a genome of a vertebrate or plant more preferably a human genome.
  • a significant part of a genome is for instance a chromosome.
  • the sequence comprising a STAR sequence and said control sequence are derived from nucleic acid of the same species.
  • said frequency of occurrence is representative of the frequency of occurrence of said at least one sequence pattern in at least 2 sequences comprising a STAR sequence, more preferably in at least 5 sequences comprising a STAR sequence. More preferably in at least 10 sequences comprising a STAR sequence.
  • said frequency of occurrence is representative of the frequency of occurrence of said at least one sequence pattern in at least 20 sequences comprising a STAR sequence.
  • said frequency of occurrence is representative of the frequency of occurrence of said at least one sequence pattern in at least 50 sequences comprising a STAR.
  • said sequences comprising a STAR sequence comprise at least one of the sequences depicted in figure 6 .
  • STAR activity is feature shared by the sequences listed in figure 6 . However, this does not mean that they must all share the same identifier sequence. It is very well possible that different identifiers exist. Identifiers may confer this common feature onto a fragment containing it, though this is not necessarily so.
  • At least one of said sequence patterns for detecting a STAR sequence comprises a sequence pattern GGACCC, CCCTGC, AAGCCC, CCCCCA and/or AGCACC.
  • at least one of said sequence patterns for detecting a STAR sequence comprises a sequence pattern CCCN ⁇ 16 ⁇ AGC, GGCN ⁇ 9 ⁇ GAC, CACN ⁇ 13 ⁇ AGG, and/or CTGN ⁇ 4 ⁇ GCC.
  • a list of STAR sequences can also be used to determine one or more consensus sequences therein.
  • a consensus sequence for a STAR element is therefore also provided herein. This consensus sequence can of course be used to identify candidate STAR elements in a test sequence.
  • sequences comprising a STAR element can be used by means of sequence homology to identify sequences comprising a STAR element in other species belonging to vertebrate.
  • a mammalian STAR sequence is used to screen for STAR sequences in other mammalian species.
  • STAR sequences obtainable by a method as described herein are thus provided. Further provided is a collection of STAR sequences.
  • said STAR sequence is a vertebrate or plant STAR sequence.
  • said STAR sequence is a mammalian STAR sequence or an angiosperm (monocot, such as rice or dicot, such as Arabidopsis ) . More preferably, said STAR sequence is a primate and/or human STAR sequence.
  • a list of sequences comprising STAR activity can be used to determine whether a test sequence comprises a STAR element.
  • a method for determining whether a nucleic acid sequence of about 50-5000 base pairs comprises a STAR sequence said method comprising, generating a first table of sequence patterns comprising the frequency of occurrence of said patterns in a collection of STAR sequences of the invention, generating a second table of said patterns comprising the frequency of occurrence of said patterns in at least one reference sequence, selecting at least one pattern of which said frequency of occurrence differs between the two tables, determining, within said nucleic acid sequence of about 50-5000 base pairs, the frequency of occurrence of at least one of said selected patterns, and determining whether the occurrence in said test nucleic acid is representative of the occurrence of said selected pattern in said collection of STAR sequences.
  • said determining comprises determining whether the frequency of occurrence in said test nucleic acid is representative of the frequency occurrence of said selected pattern in said collection of STAR sequences.
  • said method further comprises determining whether said candidate STAR comprises a gene transcription modulating quality using a method described herein.
  • said collection of STARs comprises sequence as depicted in figure 6 .
  • a STAR sequence can exert its activity in a directional way, i.e. more to one side of the fragment containing it than to the other. Moreover, STAR activity can be amplified in amount by multiplying the number of STAR elements. The latter suggests that a STAR element may comprise one or more elements comprising STAR activity.
  • Another way of identifying a sequence capable of conferring STAR activity on a fragment containing it comprises selecting from a vertebrate or plant sequence, a sequence comprising STAR activity and identifying whether sequences flanking the selected sequence are conserved in another species. Such conserved flanking sequences are likely to be functional sequences.
  • Such a method for identifying a sequence comprising a STAR element comprising selecting a sequence of about 50 to 5000 base pairs from a vertebrate or plant species comprising a STAR element and identifying whether sequences flanking said selected sequence in said species are conserved in at least one other species.
  • a method for detecting the presence of a STAR sequence within a nucleic acid sequence of about 50-5000 base pairs comprising identifying a sequence comprising a STAR sequence in a part of a chromosome of a cell of a species and detecting significant homology between said sequence and a sequence of a chromosome of a different species. The STAR in said different species is thus identified.
  • said species comprises a plant or vertebrate species, preferably a mammalian species.
  • the term quality in relation to a sequence refers to an activity of said sequence.
  • the term "DNA sequence” as used herein does, unless otherwise specified, not refer to a listing of specific ordering of bases but rather to a physical piece of DNA.
  • a transcription quality with reference to a DNA sequence refers to an effect that said DNA sequence has on transcription of a gene of interest.
  • “Quality” as used herein refers to detectable properties or attributes of a nucleic acid or protein in a transcription system.
  • the present invention provides, amongst others, a cell which expresses two or more proteins, a method for expressing two or more proteins of interest and a protein expression unit.
  • said STAR sequence is a vertebrate STAR sequence or a plant STAR sequence.
  • said vertebrate STAR sequence is a human STAR sequence.
  • a STAR sequence from a species from which a gene of interest is expressed For example, when one would like to express two or more proteins and one of the proteins is a human protein, one preferably includes a human STAR sequence for the expression of said human protein.
  • the STAR elements flanking an expression unit are the basis of the stable expression of the monomer transgenes over many cell generations.
  • STAR elements can protect individual transgenes from silencing.
  • that capability is extended to more than one expression unit introduced (preferentially) independently in a recombinant host cell.
  • Expression units that are not flanked by STAR elements can undergo significant silencing after only 5-10 cultures passages, during which time silencing of the STAR protected units is negligible.
  • the present invention uses STAR sequences for the production of two or more proteins and thereby the invention provides (1) an increased predictability in the creation of recombinant cell lines that efficiently produce the heterologous multimeric proteins of interest, (2) an increased yield of the heterologous multimeric proteins, (3) stable expression of the heterologous multimeric proteins, even during prolonged cultivation in the absence of selection agent and (4) the invention also provides favorable transgene expression characteristics without amplification of the transgene.
  • the increased yield of heterologous proteins provided by the invention may be obtained at low transgene copy numbers, without selective co-amplification using, for example, the DHFR/methotrexate system.
  • the broad applicability of the method of the invention include its utility in a wide range of host cell lines. This is for example useful/desirable when a particular multimeric protein is preferably expressed by a particular host cell line (e.g. expression of antibodies from lymphocyte-derived host cell lines).
  • the selection of cells which express said two or more proteins may for examples be obtained by performing a SDS-PAGE analysis, a Western blot analysis for an ELISA, which are all techniques which are known by a person skilled in the art and therefore need no further elaboration.
  • the identification of cells that express said two or more proteins in said predetermined ratio can also be performed by these techniques.
  • STAR sequence in at least two of said protein expression units, again, provide the desired predictability, yield, stability and stoichiometrically balanced availability of the two or more proteins.
  • polypeptides of a multimeric protein are produced according to a method of the invention it is desirable to provide the required monomers/subunits in a ratio that is relevant for the formation of said multimeric protein.
  • said monomers/subunits are produced in a biological relevant balanced ratio.
  • a multimeric protein consists of two subunits A and 1 subunit B it is desired to produce two subunits A for every subunit of B that is produced.
  • a predetermined ratio is herein defined as the natural occurring ratio (stoichiometry) of the differed subunits/monomers/polypeptides which comprise a multimeric protein.
  • a cell according to the invention expresses two proteins.
  • two proteins which together provide a therapeutically advantageous effect.
  • the predetermined ratio of the two expressed proteins is 1:1. This is for example useful in the production of multimeric proteins in which the monomers are in a 1:1 ratio.
  • Typical examples are antibodies that comprise two heavy chains and two light chains.
  • the invention provides a cell, wherein said two or more protein expression units further encode at least two different selection markers, and wherein the cell is selected by a method which comprises a two-step selection marker screening on said cell, wherein said cell is selected in a first step on the presence of a first selection marker and in a second step on the presence of a second selection marker.
  • a two-stage antibiotic selection is used which regime results in a high proportion of isolates that express for example, transgenes 1 and 2 at high levels; the first stage of selection eliminates cells that do not contain the expression unit or units, and the second stage of selection eliminates colonies that do not transcribe both bicistronic mRNAs at high levels.
  • This regime is one of the aspects for the increased frequency of multimer-expressing recombinant cell lines achieved by the invention compared to conventional methods. As described herein, it results in an increase in the frequency of expressor lines by more than ten-fold.
  • the invention provides a cell wherein at least one of said protein expression units comprises a monocistronic gene comprising an open reading frame encoding a protein of interest and wherein said monocistronic gene is under control of a functional promoter.
  • the invention provides a cell according to the invention, wherein at least one of said protein expression units comprises a bicistronic gene comprising an open reading frame encoding a protein of interest, a protein translation initiation site with a reduced translation efficiency, a selection marker and wherein said bicistronic gene is under control of a functional promoter.
  • the invention provides a cell according to the invention, wherein at least one of said protein expression units comprises a bicistronic gene comprising an open reading frame encoding a protein of interest, a protein translation initiation site with a reduced translation efficiency, a selection marker and wherein said bicistronic gene is under control of a functional promoter, which protein expression unit further comprises a monocistronic gene comprising an open reading frame encoding a second selection marker and wherein said monocistronic gene is under control of a functional promoter.
  • bicistronic gene is typically defined as a gene capable of providing a RNA molecule that encodes two proteins/polypeptides.
  • RNA molecule that encodes one protein/polypeptide
  • selection marker or selectable marker is typically used to refer to a gene and/or protein whose presence can be detected directly or indirectly in a cell, for example a gene and/or a protein that inactivates a selection agent and protects the host cell from the agent's lethal or growth-inhibitory effects (e.g. an antibiotic resistance gene and/or protein).
  • selection marker induces fluorescence or a color deposit (e.g. green fluorescent protein and derivatives, luciferase, or alkaline phosphatase).
  • selection agent is typically defined as a chemical compound that is able to kill or retard the growth of host cells (e.g. an antibiotic).
  • selection is typically defined as the process of using a selection marker/selectable marker and a selection agent to identify host cells with specific genetic properties (e.g. that the host cell contains a transgene integrated into its genome).
  • nouns "clone” and “isolate” typically refer to a recombinant host cell line that has been identified and isolated by means of selection.
  • the improvements provided by a method according to the invention have three integrated aspects.
  • (2) Existing systems do not provide stoichiometrically balanced and proportional amounts of the subunits of multimeric proteins; the present invention ensures that the expression levels of the subunits will be balanced and proportional.
  • (3) Existing systems do not provide a means of protecting the transgenes that encode the protein subunits from transgene silencing.
  • FIG 1 provides a, non-limiting, schematic representation of one of the embodiments of this part of the invention.
  • FIG 1A and FIG 1B show two separate protein expression units. This is the configuration of the DNA elements of the expression units in the plasmid as well as after integration into the genome.
  • Expression unit one is shown in FIG 1A . It contains an open reading frame for a transgene (a reporter gene or subunit 1 of a multimeric (TG S1, transgene subunit 1)). This is upstream of the attenuated EMCV IRES, and of the open reading frame encoding the zeocin resistance selectable marker protein (zeo). This bicistronic transgene is transcribed at high levels from the CMV promoter.
  • a transgene a reporter gene or subunit 1 of a multimeric (TG S1, transgene subunit 1
  • zeo zeocin resistance selectable marker protein
  • neomycin resistance selectable marker (neo; this confers resistance to the antibiotic G418 as well), transcribed as a monocistronic mRNA from the SV40 promoter.
  • neo this confers resistance to the antibiotic G418 as well
  • a monocistronic mRNA from the SV40 promoter These two genes are flanked by STAR elements.
  • FIG 1B a similar expression unit is depicted. It consists of a second transgene (a second reporter gene or the open reading frame for subunit 2 of a heterodimeric protein (TG S2)) upstream of the attenuated EMCV IRES and the blasticidin selectable marker open reading frame (bsd).
  • This bicistronic transgene is transcribed at high levels from the CMV promoter.
  • the neo selectable marker transcribed as a monocistronic mRNA from the SV40 promoter.
  • the two genes in the second expression unit are flanked by STAR elements
  • the one antibiotic that is particularly advantageous is zeocin, because the zeocin-resistance protein (zeocin-R) acts by binding the drug and rendering it harmless. Therefore it is easy to titrate the amount of drug that kills cells with low levels of zeocin-R expression, while allowing the high-expressors to survive. All other antibiotic-resistance proteins in common use are enzymes, and thus act catalytically (not 1:1 with the drug). When a two-step selection is performed it is therefore advantageous to use an antibiotic resistance protein with this 1:1 binding mode of action. Hence, the antibiotic zeocin is a preferred selection marker.
  • the zeocin antibiotic is in a two-step selection method combined with puromycin-R or blasticidin-R in the second bicistronic gene, and neomycin-R or hygromycin-R in the monocistronic gene.
  • the CMV promoter is considered the strongest available, so it is preferably chosen for the bicistronic-gene in order to obtain the highest possible product yield.
  • suitable promoters are e.g. mammalian promoters for EFI-alpha or ubiquitin.
  • the good expression and stability of the SV40 promoter makes it well suited for expression of the monocistronic gene; enough selection marker protein (for example the antibiotic resistance protein neomycin-R in the example cited herein) is made to confer high expression of said selection marker.
  • said SV40 promoter is preferentially used as a promoter driving the expression of the selection marker.
  • the invention provides a cell wherein at least one of said protein expression units comprises at least two STAR sequences.
  • the invention provides a cell wherein said protein expression unit comprising at least two STAR sequences is arranged such that said protein expression unit is flanked on either side by at least one STAR sequence.
  • the said at least two STAR sequences are essentially identical.
  • Essentially identical STAR sequences are defined herein as STAR sequences which arp identical in their important domains, but which may vary within their less important domains (the domains that confer the transcription stabilizing or enhancing quality), for example a pointmutation, deletion or insertion at a less important position within the STAR sequence.
  • Preferentially said essentially identical STAR sequences provide equal amounts of transcription stabilizing or enhancing activity.
  • STAR sequences to flank at least one protein expression unit is one of the aspects of the balanced and proportional levels of expression of two or more proteins and more specifically for the expression of the monomers of multimeric proteins.
  • the STAR sequences create chromatin domains of definite and stable transcriptional potential.
  • promoters that drive transcription of each bicistronic mRNA will function at definite, stable levels.
  • a recombinant host cell line created by the method of the invention is readily identified in which these levels result in appropriate proportions of each monomer of the multimeric protein of interest being expressed at high yields.
  • the protein expression unit contains only the bicistronic gene flanked by STAR elements.
  • the advantages of omitting the monocistronic antibiotic resistance gene are twofold. First, selection of high-expressing recombinant host cells requires the use of only two antibiotics. Second, it prevents repression of the bicistronic and/or monocistronic genes by the phenomena of promoter suppression and transcriptional interference. These phenomena are common problems in conventional transgenic systems in which two or more transcription units are located near each other. Repression by an upstream (5') unit of a downstream (3') unit is termed transcriptional interference, and repression by a downstream unit of an upstream unit is termed promoter suppression (Villemure et al., 2001).
  • Transcriptional interference can result in suppression of adjacent transgenes in all possible arrangements (tandem, divergent, and convergent) (Eszterhas et al., 2002). These phenomena can reduce the efficiency of selection of the IRES-dependent and/or monocistronic antibiotic resistance genes, and reduce the yield of the transgene. Therefore the embodiment of the invention comprising only a bicistronic gene flanked by STAR elements provides an alternative configuration of the components.
  • the method according to the invention uses a STAR sequence wherein said STAR sequence is depicted in Table 3 and/or figure 6 and/or a functional equivalent and/or a functional fragment thereof.
  • STAR sequences wherein said STAR sequence is depicted in Table 3 and/or figure 6 and/or a functional equivalent and/or a functional fragment thereof.
  • STAR elements that have strong predictability characteristics, in order to have high numbers of efficiently-expressing recombinant cell lines.
  • the STAR elements employed have moderate to strong anti-repressor activity, in order to be able to modulate the levels of recombinant protein production to match the requirements of the product (e.g. balanced and proportional expression of polypeptide monomers).
  • the selected STAR elements also confer significant increases on the stability of expression of the transgenes.
  • Some STAR elements also display promoter and host cell-type specificity. These characteristics are exploited to create novel transgenic systems to optimize the production of heterologous proteins that require a specific host cell (for example, to achieve a high yield or a pharmaceutically advantageous glycosylation pattern) or a specific mode of expression (for example, the use of an inducible promoter or a constitutive promoter; the use of a promoter with moderate strength or high strength, etc.). Therefore the use of different STAR elements results in different embodiments of the invention that pertain to these types of applications.
  • a functional equivalent and/or a functional fragment of a sequence depicted in Table 3 and/or figure 6 is defined herein as follows.
  • a functional equivalent of a sequence as depicted in Table 3 and/or figure 6 is a sequence derived with the information given in Table 3 and/or figure 6 .
  • a sequence that can be derived from a sequence in Table 3 and/or figure 6 by deleting, modifying and/or inserting bases in or from a sequence listed in Table 3 and/or figure 6 wherein said derived sequence comprises the same activity in kind, not necessarily in amount, of a sequence as depicted in Table 3 and/or figure 6 .
  • a functional equivalent is further a sequence comprising a part from two or more sequences depicted in Table 3 and/or figure 6 .
  • a fictional equivalent can also be a synthetic DNA sequence which is a sequence that is not derived directly or indirectly from a sequence present in an organism. For instance a sequence comprising a drosophila scs or scs' sequence is not a synthetic sequence, even when the scs or scs' sequence was artificially generated.
  • Functional sequences of STAR elements can be delineated by various methods known in the art. In one embodiment deletions and/or substitutions are made in STAR sequences. DNA that is modified in such a way is for example tested for activity by using a single modified nucleic acid or by generating a collection of test nucleic acids comprising said modified nucleic acid. Elucidation of functional sequences within STAR sequences enables the elucidation of consensus sequences for elements with a gene transcription modulating and/or a gene transcription repressing quality.
  • a functional fragment of a STAR sequence as depicted in Table 3 and/or figure 6 can for example be obtained by deletions from the 5' end or the 3' end or from the inside of said sequences or any combination thereof wherein said derived sequence comprises the same activity in kind, not necessarily in amount.
  • Yet another preferred feature of a method according to the invention is the introduction of a (weak) Internal Ribosome Binding Site (IRES) as an example of a protein translation initiation site with a reduced translation efficiency, between the open reading frame of the protein of interest and the selection marker open reading frame.
  • IRS Internal Ribosome Binding Site
  • this component of the present invention comprises a marked improvement in transgenic systems for the expression of two or more proteins.
  • IRES Internal ribosome binding site
  • IRES permits two or more proteins to be produced from a single RNA molecule (the first protein is translated by ribosomes that bind the RNA at the cap structure of its 5' terminus, (Martinez-Salas, 1999)). Translation of proteins from IRES elements is less efficient than cap-dependent translation: the amount of protein from IRES-dependent open reading frames (ORFs) ranges from less than 20% to 50% of the amount from the first ORF (Mizuguchi et al., 2000). This renders IRES elements undesirable for production of all subunits of a multimeric protein from one messenger RNA (mRNA), since it is not possible to achieve balanced and proportional expression of two or more protein monomers from a bicistronic or multicistronic mRNA.
  • mRNA messenger RNA
  • IRES-dependent translation provides an advantage that is exploited by the current invention. Furthermore, mutation of IRES elements can attenuate their activity, and lower the expression from the IRES-dependent ORFs to below 10% of the first ORF (Lopez de Quinto & Martinez-Salas, 1998, Rees et al., 1996).
  • the advantage exploited by the invention is as follows: when the IRES-dependent ORF encodes a selectable marker protein, its low relative level of translation means that high absolute levels of transcription must occur in order for the recombinant host cell to be selected. Therefore, selected recombinant host cell isolates will by necessity express high amounts of the transgene mRNA. Since the recombinant protein is translated from the cap-dependent ORF, it can be produced in abundance resulting in high product yields.
  • the invention provides a per a cell which expresses two or more proteins , wherein each of said protein expression units resides on a separate DNA-carrier.
  • the present invention preferentially makes use of a separate transcription unit for each protein and/or monomer of a multimeric protein.
  • the monomer ORF is produced by efficient cap-dependent translation.
  • This feature of the invention contributes that recombinant host cells are isolated which have high yields of each monomer, at levels that are balanced and proportionate to the stoichiometry of the multimeric protein.
  • the increased predictability at which such recombinant host cells are isolated results in an improvement in the efficiency of screening for such isolates by a factor of ten or more.
  • said DNA-carrier is a vector (or plasmid; the terms are used interchangeable herein).
  • said vector is a viral vector and in a more preferred, embodiment said viral vector is an adenoviral vector or a retroviral vector. It is clear to person skilled in the art that other viral vectors can also be used in a method according to the invention.
  • Conventional expression systems are DNA molecules in the form of a recombinant plasmid or a recombinant viral genome.
  • the plasmid or the viral genome is introduced into (mammalian host) cells and integrated into their genomes by methods known in the art.
  • the present invention also uses these types of DNA molecules to deliver its improved transgene expression system.
  • a preferred embodiment of the invention is the use of plasmid DNA for delivery of the expression system.
  • a plasmid contains a number of components: conventional components, known in the art, are an origin of replication and a selectable marker for propagation of the plasmid in bacterial cells; a selectable marker that functions in eukaryotic cells to identify and isolate host cells that carry an integrated transgene expression system; the protein of interest, whose high-level transcription is brought about by a promoter that is functional in eukaryotic cells (e.g. the human cytomegalovirus major immediate early promoter/enhancer, pCMV (Boshart et al., 1985)); and viral transcriptional terminators for the transgene of interest and the selectable marker (e.g. the SV40 polyadenylation site (Kaufman & Sharp, 1982)).
  • a promoter that is functional in eukaryotic cells
  • pCMV cytomegalovirus major immediate early promoter/enhancer
  • viral transcriptional terminators for the transgene of interest and the selectable marker e.g. the SV40
  • the vector used can be any vector that is suitable for cloning DNA and that can be used in a transcription system.
  • the vector is an episomally replicating vector. In this way, effects due to different sites of integration of the vector are avoided. DNA elements flanking the vector at the site of integration can have effects on the level of transcription of the promoter and thereby mimic effects of fragments comprising DNA sequences with a gene transcription modulating quality.
  • said vector comprises a replication origin from the Epstein-Barr virus (EBV), OriP, and a nuclear antigen (EBNA-1).
  • EBV Epstein-Barr virus
  • EBNA-1 nuclear antigen
  • the invention provides a a cell which expresses two or more proteins or a method for expressing two or more proteins in a cell comprising providing two or more protein expression units wherein one of the said protein expression units or said protein(s) of interest encodes an immunoglobulin heavy chain and/or wherein another of the said protein expression units or said protein(s) of interest encodes an immunoglobulin light chain.
  • a multimeric protein, an antibody is obtained. It is clear to a person skilled in the art that it is possible to provide a cell which expresses an immunoglobulin heavy chain from one protein expression unit and an immunoglobulin light chain from another protein expression unit with a third protein expression unit encoding a secretory component or a joining chain. In this way the production of for example sIgA and pentameric IgM is provided.
  • the used host cell secretes the produced multimer. In this way the product is easily isolated from the medium surrounding said host cell.
  • the invention results in the production of a functional multimer.
  • the functionality of the produced multimer is determined with standard procedures. For example, a produced multi subunit enzyme is tested in a corresponding enzymatic assay or binding to an antigen, for example in an ELISA, is used to test the functionality of a produced antibody.
  • the selection of a final suitable host cell expressing a multimer involves multiple steps amongst which are the selection for a cell that expresses all the desired subunits of a multimer, followed by a functional analysis of said multimer.
  • a multimeric protein With regard to a multimeric protein high expression levels of the subunits is desired as well as the formation of a functional multimeric protein of said subunits.
  • the use of a STAR sequence for the production of the subunits of a multimeric protein results in high amount of cells that express the subunits, as compared to control vectors without a STAR sequence.
  • the amount of functional multimeric protein is relatively higher when compared to the control.
  • each expression unit comprises at least two STAR sequences which sequences are arranged such that said expression unit is flanked on either side by at least one STAR sequence.
  • a functional promoter is a human cytomegalovirus (CMV promotor, a simian virus (SV40) promoter, a human ubiquitin C promoter or a human elongation factor alpha (EFI- ⁇ ) promoter.
  • CMV promotor a human cytomegalovirus
  • SV40 simian virus
  • EFI- ⁇ human elongation factor alpha
  • a STAR sequence can confer copy number-dependence on a transgene expression unit, making transgene expression independent of other transgene copies in tandem arrays, and independent of gene-silencing influences at the site of integration.
  • the invention also provides a method for obtaining a cell which expresses two or more proteins or a method for identifying a cell wherein expression of two or more proteins is in a predetermined ratio in which multiple copies of a protein expression unit encoding a protein of interest is integrated into the genome of said cell (i.e. in which cell, an amplification of the gene of interest is present).
  • the protein expression units are introduced simultaneously into said (host) cell or collection of cells by methods known in the art.
  • Recombinant host cells are selected by treatment with an appropriate antibiotic, for example G418, using methods known in the art.
  • an appropriate antibiotic for example G418, using methods known in the art.
  • another antibiotic or a combinations of antibiotics for example a combination of zeocin and blasticidin, is/are applied, and antibiotic-resistant colonies are identified and isolated. These are tested for the level of expression of transgenes.
  • bicistronic gene comprising an open reading frame encoding a protein of interest, a protein translation initiation site with a reduced translation efficiency, a selection marker and wherein said bicistronic gene is under control of a functional promoter
  • said protein expression unit further comprises a monocistronic gene comprising an open reading frame encoding a second selection marker and wherein said monocistronic gene is under control of a functional promoter.
  • said protein expression unit comprises at least two STAR sequences which are preferentially arranged such that said protein expression unit is flanked on either side by at least one STAR sequence. Examples of such a protein expression unit are provided within the experimental part of this patent application (for example Figures 1 and 5 ).
  • the protein expression unit according to the invention comprises STAR sequences, wherein said STAR sequences are essentially identical.
  • a protein expression unit according to the invention wherein said protein translation initiation site with a reduced translation efficiency comprises an Internal Ribosome Entry Site (IRES). More preferably a modified, e.g. weaker, IRES is used.
  • IRES Internal Ribosome Entry Site
  • a protein expression unit according to the invention wherein said protein expression unit is a vector.
  • said DNA-carrier is a vector (or plasmid; the terms are used interchangeably herein).
  • said vector is a viral vector and in a more preferred embodiment said viral vector is an adenoviral vector or a retroviral vector. It is clear to person skilled in the art that other viral vectors can also be used in a method according to the invention.
  • a protein expression unit according to the invention wherein said protein of interest is an immunoglobulin heavy chain.
  • a protein expression unit according to the invention wherein said protein of interest is an immunoglobulin light chain.
  • the invention includes a cell provided with a protein expression unit comprising a STAR.
  • the invention also includes a (host) cell comprising two protein expression units according to the invention.
  • a (host) cell is then for example used for large-scale production processes.
  • the invention also includes a cell obtainable according to anyone of the methods as described herein.
  • the invention furthermore includes a protein obtainable from said cell (for example, via the process of protein purification).
  • said protein is a multimeric protein and even more preferably said multimeric protein is an antibody.
  • Such an antibody can be used in pharmaceutical and/or diagnostic applications.
  • Various other embodiments apply to the present invention, including: other selectable marker genes; other IRES elements or means of attenuating IRES activity; other elements affecting transcription including promoters, enhancers, introns, terminators, and polyadenylation sites; other orders and/or orientations of the monocistronic and bicistronic genes; other anti-repressor elements or parts, derivations, and/or analogues thereof; other vector systems for delivery of the inventive DNA molecules into eukaryotic host cells; and applications of the inventive method to other transgenic systems.
  • Example 1 STAR elements and two-step selection improve the predictability of transgene expression
  • One object of this invention is to improve transgene expression for heterologous protein production by using a two-step antibiotic selection procedure.
  • the two-step procedure increases the predictability of finding recombinant host cell lines that express the transgene to high levels, thus increasing the yield of the heterologous protein.
  • the pSDH-SIB/Z and pSDH-GIB/Z families of plasmids were constructed as follows:
  • the zeocin selectable marker was recovered by polymerase chain reaction amplification (PCR) from plasmid pEM7/zeo (Invitrogen V500-20) using primers E99 and E100 (all PCR primers and mutagenic oligonucleotide sequences are listed in Table 1), and cloned directionally into the Xba I and Not I sites of multiple cloning site (MCS) B of pIRES (Clontech 6028-1) to create pIRES-zeo.
  • MCS multiple cloning site
  • the blasticidin selectable marker was recovered by PCR from plasmid pCMV/bsd (Invitrogen V510-20) using primers E84 and E85, and cloned directionally into the Xba I and Not I sites MCS-B of pIRES to create pIRES-bsd.
  • the SEAP (secreted alkaline phosphatase) reporter gene was recovered by PCR from plasmid pSEAP2-basic (Clontech 6049-1) using primers F11 and E87, and cloned directionally into MCS-A of pIRES-zeo and pIRES-bsd to create plasmids pIRES-SEAP-zeo and pIRES-SEAP-bsd.
  • the GFP reporter gene was recovered from plasmid phr-GFP-1 (Stratagene 240059) by restriction digestion with Nhe I and Eco RI , and ligated directionally into MCS-A of pIRES-zeo and pIRES-bsd to create plasmids pIRES-GFP-zeo and pIRES-GFP-bsd.
  • a linker was inserted at the non-methylated Cla I site of each of these plasmids (downstream of the neomycin resistance marker) to introduce an Age I site using oligonucleotides F34 and F35.
  • the pSDH-Tet vector was constructed by PCR of the luciferase open reading frame from plasmid pREP4-HSF-Luc (van der Vlag et al., 2000) using primers C67 and C68, and insertion of the Sac II/ Bam HI fragment into Sac II/ Bam HI-digested pUHD10-3 (Gossen & Bujard, 1992).
  • the luciferase expression unit was re-amplified with primers C65 and C66, and re-inserted into pUHD10-3 in order to flank it with multiple cloning sites (MCSI and MCSII).
  • An AscI site was then introduced into MCSI by digestion with EcoRI and insertion of a linker (comprised of annealed oligonucleotides D93 and D94).
  • the CMV promoter was amplified from plasmid pCMV-Bsd with primers D90 and D91, and used to replace the Tet-Off promoter in pSDH-Tet by Sal I lSac II digestion and ligation to create vector pSDH-CMV.
  • vector pSDH-CMV was digested with SacII and Bam HI and made blunt; the SEAP open reading frame was isolated from pSEAP-basic by Eco RI/ Sal I digestion, made blunt and ligated into pSDH-CMV to create vector pSDH-CS.
  • the puromycin resistance gene under control of the SV40 promoter was isolated from plasmid pBabe-Puro (Morgenstern & Land, 1990) by PCR, using primers C81 and C82.
  • pSDH-CSP plasmids containing STAR elements were modified as follows: for receiving SEAP-IRES-zeo/bsd cassettes, an Age I site was introduced at the Bgl II site by insertion of a linker, using oligonucleotides F32 and F33; for receiving GFP-IRES-zeo/bsd cassettes, an Age I site was introduced at the Bsu 36I site by insertion of a linker, using oligonucleotides F44 and F45.
  • the SEAP-IRES-zeo/bsd cassettes were inserted into the pSDH-CSP-STAR18 plasmid by replacement of the Bsu 3611 Age I fragment with the corresponding fragments from the pIRES-SEAP-zeo/bsd plasmids.
  • the GFP-IRES-zeo/bsd cassettes were inserted into pSDH-CSP-STAR plasmids by replacement of the Bgl II/ Age I fragment with the corresponding fragments from the pIRES-GFP-zeo/bsd plasmids.
  • the resulting plasmid families, pSDH-SIB/Z and pSDH-GIB/Z, are shown in FIG 3 .
  • the Chinese Hamster Ovary cell line CHO-K1 (ATCC CCL-61) was cultured in HAMS-F12 medium + 10% Fetal Calf Serum containing 2 mM glutamine, 100 U/ml penicillin, and 100 micrograms/ml streptomcyin at 37 C/5% CO 2 .
  • Cells were transfected with the pSDH-SIZ plasmids using SuperFect (QIAGEN) as described by the manufacturer. Briefly, cells were seeded to culture vessels and grown overnight to 70-90% confluence. SuperFect reagent was combined with plasmid DNA at a ratio of 6 microliters per microgram (e.g.
  • SEAP Secreted Alkaline Phosphatase
  • SEAP activity (Berger et al., 1988, Henthorn et al., 1988, Kain, 1997, Yang et al., 1997) in the culture media of the clones was determined as described by the manufacturer (Clontech Great EscAPe kit #K2041). Briefly, an aliquot of medium was heat inactivated at 65 C, then combined with assay buffer and CSPD chemiluminescent substrate and incubated at room temperature for 10 minutes. The rate of substrate conversion was then determined in a luminometer (Turner 20/20TD). Cell density was determined by counting trypsinized cells in a Coulter ACT10 cell counter.
  • Transfection of the pSDH-SIZ-STAR18 expression vector consistently results in ⁇ 10-fold more colonies than transfection of the empty pSDH-SIZ vector, presumably due to the increased proportion of primary transfectants that are able to bring the neomycin resistance gene to expression.
  • the outcome of a typical experiment is shown in Table 2, in which transfection of the empty vector yielded ⁇ 100 G418-resistant colonies, and transfection of the STAR18 vector yielded ⁇ 1000 colonies.
  • the expression of the SEAP reporter transgene was compared between the empty pSDH-SIZ vector (hence, without a STAR sequence) and the STAR18 vector ( FIG 4 ).
  • the populations of G418-resistant isolates were divided into two sets. The first set was cultured with G418 only (one-step selection). For this set, the inclusion of STAR18 to protect the transgene from silencing resulted in higher yield of reporter protein: the maximal level of expression among the 20 clones analyzed was 2-3-fold higher than the maximal expression level of clones without the STAR element.
  • the inclusion of STAR18 also led increased predictability: more than 25% of the STAR18 clones had expression levels greater than or equal to the maximum expression level observed in the STARless clones. In this population of STAR18 clones, 70% had expression above the background level, while only 50% of the STARless clones had expression above the background level.
  • STAR18 was even better when used in a two-step selection.
  • the second set of G418-resistant isolates was treated with zeocin. Clones that survived the two-step selection regime were assayed for expression of the SEAP reporter transgene. In this case too, the STAR18 element increased the yield compared to the STARless clones by approximately three-fold.
  • the predictability was also increased by inclusion of STAR18: ⁇ 80% of the population had expression levels greater than the highest-expressing STARless clone.
  • the one-step selection is compared with the two-step selection, it can be seen that the latter is superior in terms of both yield and predictability.
  • two-step selection no clones appear with background levels of expression. This is due to the requirement imposed on clones that survive zeocin selection that they have high levels of transcription of the bicistronic SEAP-zeocin gene.
  • Table 2 the elimination of low-producing clones by the second antibiotic selection step increases the predictability of finding high-producing clones; when STAR18 is included in the expression unit, this increased predictability is improved from three-fold to thirty-fold.
  • Example 2 Simultaneous expression of two proteins is improved by two-step selection and STAR elements
  • a second object of this invention is to improve the expression of heterologous multimeric proteins such as antibodies.
  • This example demonstrates that the combination of STAR elements and two-step antibiotic selection improves the predictability of establishing recombinant host cell lines that express balanced and proportional amounts of two heterologous polypeptides at high yields.
  • This method of the invention is applicable in practice to multimeric proteins such as antibodies. It is demonstrated in this example using two reporter proteins, secreted alkaline phosphatase (SEAP) and green fluorescent protein (GFP).
  • SEAP secreted alkaline phosphatase
  • GFP green fluorescent protein
  • Example 1 The pSDH-SIB/Z and pSDH-GIB/Z families of plasmids described in Example 1 are used. Clowning of STAR elements x and y, transfection and culture of host cells, and SEAP assay are described in Example 1. The assay for GFP is performed according to the manufacture's instructions.
  • Results show an increased number of clones wherein the two reporter proteins are both expressed. Moreover, expression was balanced in many of such clones.
  • Example 1 The expression system tested and validated in Example 1 has been modified to facilitate its application to any polypeptide that is preferably co-expressed with another polypeptide or polypeptides in a host cell, for example the heavy and light chains of recombinant antibodies. It is designed for easy and rapid construction of the expression units. This improved system is described in this example.
  • Plasmid pd2EGFP (Clontech 6010-1) was modified by insertion of a linker at the Bsi WI site to yield pd2EGFP-link.
  • the linker (made by annealing oligonucleotides F25 and F26) introduces sites for the PacI, BgIII, and Eco RV restriction endonucleases. This creates the multiple cloning site MCSII for insertion of STAR elements.
  • primers F23 and F24 were used to amplify a region of 0.37 kb from pd2EGFP, which was inserted into the Bgi II site of pIRES (Clontech 6028-1) to yield pIRES-stuf.
  • This introduces sites for the Asc I and Swa I restriction endonucleases at MCSI, and acts as a "stuffer fragment" to avoid potential interference between STAR elements and adjacent promoters.
  • pIRES-stuf was digested with Bgl II and Fsp I to liberate a DNA fragment composed of the stuffer fragment, the CMV promoter, the IRES element (flanked by multiple cloning sites MCS A and MCS B), and the SV40 polyadenylation signal. This fragment was ligated with the vector backbone of pd2EGFP-link produced by digestion with Bam HI and Stu I, to yield pd2IRES-link.
  • the open reading frames of the zeocin-, neomycin, or puromycin-resistance genes were inserted into the Bam HI/ Not I sites of MCS B in pd2IRES-link as follows: the zeocin-resistance ORF was amplified by PCR with primers F18 and E100 from plasmid pEM7/zeo, digested with Bam HI and Not I, and ligated with Bam HI/ Not I-digested pd2IRES-link to yield pd2IRES-link-zeo.
  • the neomycin-resistance ORF was amplified by PCR with primers F19 and F20 from pIRES, digested with Bam HI and Not I, and ligated with Bam HI/ Not I-digested pd2IRES-link to yield pd2IRES-link-neo.
  • the puromycin-resistance ORF was amplified by PCR with primers F21 and F22 from plasmid pBabe-Puro (Morgenstern & Land, 1990), digested with Bam HI and Not I, and ligated with Bam HI/ Not I-digested pd2IRES-link to yield pd2IRES-link-puro.
  • the GFP reporter ORF was introduced into pd2IRES-link-puro by amplification of phr-GFP-1 with primers F16 and F17, and insertion of the Eco RI-digested GFP cassette into the Eco RI site in MCS A of the pd2IRES-link-puro plasmid, to yield plasmid PP1 ( FIG 5A ). Correct orientation was verified by restriction mapping.
  • the SEAP reporter ORF was introduced into pd2IRES-link-zeo and pd2IRES-link-neo by PCR amplification of pSEAP2-basic with primers F14 and F15, and insertion of the Eco RI-digested SEAP cassette into the Eco RI sites in MCS A of the plasmids pd2IRES-link-zeo (to yield plasmid PP2, FIG 5B ) and pd2IRES-link-neo (to yield plasmid PP3, FIG 5C ). Correct orientation was verified by restriction mapping.
  • Plasmids PP1, PP2 and PP3 contain a bicistronic gene for expression of a reporter protein and and antibiotic resistance marker.
  • a monocistronic resistance marker was introduced as follows: pIRES-stuf was digested with Cla I, made blunt with Klenow enzyme, and digested further with Bgl II . This liberated a DNA fragment composed of the stuffer fragment, the CMV promoter, the IRES element (flanked by multiple cloning sites MCS A and MCS B), the SV40 polyadenylation signal, and the neomycin resistance marker under control of the SV40 promoter.
  • This fragment was ligated with the vector backbone of pd2EGFP-link produced by digestion with Bam HI and Stu I, to yield pd2IRES-link-neo. Then as described above the GFP and puro cassettes were introduced to yield PP4 ( FIG 5D ), and the SEAP and zeo cassettes were introduced to yield PP5 ( FIG 5E ).
  • Example 4 Predictability and yield are improved by application of STAR elements in expression systems
  • STAR elements function to block the effect of transcriptional repression influences on transgene expression units. These repression influences can be due to heterochromatin ("position effects", (Boivin & Dura, 1998)) or to adjacent copies of the transgene ("repeat-induced gene silencing", (Garrick et al., 1998)).
  • position effects (Boivin & Dura, 1998)
  • repeat-induced gene silencing (Garrick et al., 1998).
  • Two of the benefits of STAR elements for protein production are increased predictability of finding high-expressing primary recombinant host cells, and increased yield during production cycles. These benefits are illustrated in this example.
  • the pSDH-Tet vector was constructed by polymerase chain reaction amplification (PCR) of the luciferase open reading frame from plasmid pREP4-HSF-Luc (van der Vlag et al., 2000) using primers C67 and C68 (all PCR primers and mutagenic oligonucleotides are listed in Table 1), and insertion of the Sac II/ Bam HI fragment into Sac II/ Bam HI-digested pUHD10-3 (Gossen & Bujard, 1992).
  • PCR polymerase chain reaction amplification
  • the luciferase expression unit was re-amplified with primers C65 and C66, and re-inserted into pUHD10-3 in order to flank it with two multiple cloning sites (MCSI and MCSII).
  • An AscI site was then introduced into MCSI by digestion with EcoRI and insertion of a linker (comprised of annealed oligonucleotides D93 and D94).
  • the CMV promoter was amplified from plasmid pCMV-Bsd (Invitrogen K510-01) with primers D90 and D91, and used to replace the Tet-Off promoter in pSDH-Tet by Sal I/ Sac II digestion and ligation to create vector pSDH-CMV.
  • the luciferase open reading frame in this vector was replaced by SEAP (Secreted Alkaline Phosphatase) as follows: vector pSDH-CMV was digested with Sac II and Bam HI and made blunt; the SEAP open reading frame was isolated from pSEAP-basic (Clontech 6037-1) by Eco RI lSal I digestion, made blunt and ligated into pSDH-CMV to create vector pSDH-CS.
  • the puromycin resistance gene under control of the SV40 promoter was isolated from plasmid pBabe-Puro (Morgenstern & Land, 1990) by PCR, using primers C81 and C82.
  • STAR elements were inserted into MCSI and MCSII in two steps, by digestion of the STAR element and the pSDH-CSP vector with an appropriate restriction enzyme, followed by ligation.
  • the orientation of STAR elements in recombinant pSDH vectors was determined by restriction mapping. The identity and orientation of the inserts were verified by DNA sequence analysis. Sequencing was performed by the dideoxy method (Sanger et al., 1977) using a Beckman CEQ2000 automated DNA sequencer, according to the manufacturer's instructions. Briefly, DNA was purified from E. coli using QIAprep Spin Miniprep and Plasmid Midi Kits (QIAGEN 27106 and 12145, respectively). Cycle sequencing was carried out using custom oligonucleotides C85, E25, and E42 (Table 1), in the presence of dye terminators (CEQ Dye Terminator Cycle Sequencing Kit, Beckman 608000).
  • the Chinese Hamster Ovary cell line CHO-K1 (ATCC CCL-61) was cultured in HAMS-F12 medium + 10% Fetal Calf Serum containing 2 mM glutamine, 100 U/ml penicillin, and 100 micrograms/ml streptomcyin at 37° C/5% CO 2 .
  • Cells were transfected with the pSDH-CSP vector, and its derivatives containing STAR6 or STAR49 in MCSI and MCSII, using SuperFect (QIAGEN) as described by the manufacturer. Briefly, cells were seeded to culture vessels and grown overnight to 70-90% confluence.
  • SuperFect reagent was combined with plasmid DNA (linearized in this example by digestion with PvuI) at a ratio of 6 microliters per microgram (e.g. for a 10 cm Petri dish, 20 micrograms DNA and 120 microliters SuperFect) and added to the cells. After overnight incubation the transfection mixture was replaced with fresh medium, and the transfected cells were incubated further. After overnight cultivation, 5 micrograms/ml puromycin was added. Puromycin selection was complete in 2 weeks, after which time individual puromycin resistant CHO/pSDH-CSP clones were isolated at random and cultured further.
  • SEAP activity (Berger et al., 1988, Henthorn et al., 1988, Kain, 1997, Yang et al., 1997) in the culture medium of CHO/pSDH-CSP clones was determined as described by the manufacturer (Clontech Great EscAPe kit #K2041). Briefly, an aliquot of medium was heat inactivated at 65°C, then combined with assay buffer and CSPD chemiluminescent substrate and incubated at room temperature for 10 minutes. The rate of substrate conversion was then determined in a luminometer (Turner 20/20TD). Cell density was determined by counting trypsinized cells in a Coulter ACT10 cell counter.
  • the human osteosarcoma U-2 OS cell line (ATCC #HTB-96) was cultured in Dulbecco's Modified Eagle Medium + 10% Fetal Calf Serum containing glutamine, penicillin, and streptomycin (supra) at 37°C/5% CO2. Cells were co-transfected with the pSDH-CMV vector, and its derivatives containing STAR6 or STAR8 in MCSI and MCSII, (along with plasmid pBabe-Puro) using SuperFect (supra). Puromycin selection was complete in 2 weeks, after which time individual puromycin resistant U-2 OS/pSDH-CMV clones were isolated at random and cultured further.
  • Luciferase activity was assayed in resuspended cells according to the instructions of the assay kit manufacturer (Roche 1669893), using a luminometer (Turner 20/20TD). Total cellular protein concentration was determined by the bicinchoninic acid method according to the manufacturer's instructions (Sigma B-9643), and used to normalize the luciferase data.
  • clones with STAR elements in the expression units were isolated that express 2-3 fold higher SEAP activity than clones whose expression units do not include STAR elements.
  • the number of STAR-containing clones that express SEAP activity at or above the maximal activity of the STAR-less clones is quite high: 25% to 40% of the STAR clone populations exceed the highest SEAP expression of the pSDH-CSP clones.
  • the recombinant U-2 OS clones with STAR elements flanking the expression units had higher yields than the STAR-less clones: the highest expression observed from STAR8 clones was 2-3 fold higher than the expression from STAR-less clones.
  • STAR6 clones had maximal expression levels 5 fold higher than the STAR-less clones.
  • the STAR elements conferred greater predictability as well: for both STAR elements, 15 to 20% of the clones displayed luciferase expression at levels comparable to or greater than the STAR-less clone with the highest expression level.
  • STAR elements increase the yield of heterologous proteins (luciferase and SEAP). All three of the STAR elements introduced in this example provide elevated yields. The increased predictability conferred by the STAR elements is manifested by the large proportion of the clones with yields equal to or greater than the highest yields displayed by the STAR-less clones.
  • Example 5 STAR elements improve the stability of transgene expression
  • the U-2 OS cell line was transfected with the plasmid pSDH-Tet-STAR6 and cultivated as described in Example 4. Individual puromycin-resistant clones were isolated and cultivated further in the absence of doxycycline. At weekly intervals the cells were transferred to fresh culture vessels at a dilution of 1:20. Luciferase activity was measured at periodic intervals as described in Example 4. After 15 weeks the cultures were divided into two replicates; one replicate continued to receive puromycin, while the other replicate received no antibiotic for the remainder of the experiment (25 weeks total).
  • Table 7 presents the data on luciferase expression by an expression unit flanked with STAR6 during prolonged growth with or without antibiotic.
  • the expression of the reporter transgene, luciferase remains stable in the U-2 OS host cells for the duration of the experiment. After the cultures were divided into two treatments (plus antibiotic and without antibiotic) the expression of luciferase was essentially stable in the absence of antibiotic selection.
  • STAR elements are isolated from the genetic screen as described herein.
  • the screen uses libraries constructed with human genomic DNA that was size-fractionated to approximately 0.5 - 2 kilobases (supra).
  • the STAR elements range from 500 to 2361 base pairs (Table 6). It is likely that, for many of the STAR elements that have been isolated, STAR activity is conferred by a smaller DNA fragment than the initially isolated clone. It is useful to determine these minimum fragment sizes that are essential for STAR activity, for two reasons. First, smaller functional STAR elements would be advantageous in the design of compact expression vectors, since smaller vectors transfect host cells with higher efficiency. Second, determining minimum essential STAR sequences permits the modification of those sequences for enhanced functionality. Two STAR elements have been fine-mapped to determine their minimal essential sequences.
  • STAR10 (1167 base pairs) and STAR27 (1520 base pairs) have been fine-mapped. They have been amplified by PCR to yield sub-fragments of approximately equal length ( FIG 10 legend). For initial testing, these have been cloned into the pSelect vector at the Bam HI site, and transfected into U-2 OS/Tet-Off/LexA-HP1 cells. The construction of the host strains has been described (van der Vlag et al., 2000). Briefly, they are based on the U-2 OS human osteosarcoma cell line (American Type Culture Collection HTB-96).
  • U-2 OS is stably transfected with the pTet-Off plasmid (Clontech K1620-A), encoding a protein chimera consisting of the Tet-repressor DNA binding domain and the VP16 transactivation domain.
  • the cell line is subsequently stably transfected with fusion protein genes containing the LexA DNA binding domain, and the coding regions of either HP1 or HPC2 (two Drosophila Polycomb group proteins that repress gene expression when tethered to DNA).
  • the LexA-repressor genes are under control of the Tet-Off transcriptional regulatory system (Gossen and Bujard, 1992). After selection for hygromycin resistance, LexA-HP1 was induced by lowering the doxycycline concentration. Transfected cells were then incubated with zeocin to test the ability of the STAR fragments to protect the SV40-Zeo expression unit from repression due to LexA-HP1 binding.
  • STAR27 confers moderate growth in zeocin to transfected cells in this experiment ( FIG 10 ).
  • One of the sub-fragments of this STAR, 27B ( ⁇ 500 base pairs), permits weak growth of the host cells in zeocin-containing medium. This suggests that the anti-repression activity of this STAR is partially localized on sub-fragment 27B, but full activity requires sequences from 27A and/or 27C (each ⁇ 500 base pairs) as well.
  • Example 7 STAR elements function in diverse strains of cultured mammalian cells
  • host cell line for (heterologous) protein expression is a critical parameter for the quality, yield, and unit cost of the protein. Considerations such as post-translational modifications, secretory pathway capacity, and cell line immortality dictate the appropriate cell line for a particular biopharmaceutical production system. For this reason, the advantages provided by STAR elements in terms of yield, predictability, and stability should be obtainable in diverse cell lines. This was tested by comparing the function of STAR6 in the human U-2 OS cell line in which it was originally cloned, and the CHO cell line which is widely applied in biotechnology.
  • Example 4 The experiments of Example 4 are referred to.
  • the expression of the SEAP reporter gene in CHO cells is presented in FIG 8 ; the expression of the luciferase reporter gene in U-2 OS cells is presented in FIG 9 .
  • the STAR6 element is functional in both cell lines: reporter gene expression was more predictable in both of them, and clones of each cell line displayed higher yields, when the reporter gene was shielded from position effects by STAR6.
  • These two cell lines are derived from different species (human and hamster) and different tissue types (bone and ovary), reflecting the broad range of host cells in which this STAR element can be utilized in improving heterologous protein expression.
  • Example 8 STAR elements function in the context of various transcriptional promoters
  • Transgene transcription is achieved by placing the transgene open reading frame under control of an exogenous promoter.
  • the choice of promoter is influenced by the nature of the (heterologous) protein and the production system. In most cases, strong constitutive promoters are preferred because of the high yields they can provide. Some viral promoters have these properties; the promoter/enhancer of the cytomegalovirus immediate early gene (“CMV promoter”) is generally regarded as the strongest promoter in common biotechnological use (Boshart et al., 1985, Doll et al., 1996, Foecking & Hofstetter, 1986).
  • CMV promoter cytomegalovirus immediate early gene
  • the simian virus SV40 promoter is also moderately strong (Boshart et al., 1985, Foecking & Hofstetter, 1986) and is frequently used for ectopic expression in mammalian cell vectors.
  • the Tet-Off promoter is inducible: the promoter is repressed in the presence of tetracycline or related antibiotics (doxycycline is commonly used) in cell-lines which express the tTA plasmid (Clontech K1620-A), and removal of the antibiotic results in transcriptional induction (Deuschle et al., 1995, Gossen & Bujard, 1992, Izumi & Gilbert, 1999, Umana et al., 1999).
  • pSDH-SV40 is, amongst others, derived from pSelect-SV40-zeo.
  • the selection vector for STAR elements, pSelect-SV40-zeo is constructed as follows: the pREP4 vector (Invitrogen V004-50) is used as the plasmid backbone.
  • Epstein Barr oriP origin of replication and EBNA-1 nuclear antigen for high-copy episomal replication in primate cell lines; the hygromycin resistance gene with the thymidine kinase promoter and polyadenylation site, for selection in mammalian cells; and the ampicillin resistance gene and colE1 origin of replication for maintenance in Escherichia coli.
  • the vector contains four consecutive LexA operator sites between Xba I and Nhe I restriction sites (Bunker and guitarist, 1994). Embedded between the LexA operators and the Nhe I site is a polylinker consisting of the following restriction sites: Hin dIII- Asc I- Bam HI- Asc I- Hin dIII.
  • the zeocin resistance gene with the SV40 promoter and polyadenylation site derived from pSV40/Zeo (Invitrogen V502-20); this is the selectable marker for the STAR screen.
  • pSDH-SV40 was constructed by PCR amplification of the SV40 promoter (primers D41 and D42) from plasmid pSelect-SV40-Zeo, followed by digestion of the PCR product with Sac II and Sal I .
  • the pSDH-CMV vector was digested with Sac II and Sal I to remove the CMV promoter, and the vector and SV40 fragment were ligated together to create pSDH-SV40.
  • STAR6 was cloned into MCSI and MCSII as described in Example 4.
  • the plasmids pSDH-Tet, pSDH-Tet-STAR6, pSDH-Tet-STAR7, pSDH-SV40 and pSDH-SV40-STAR6 were co-transfected with pBabe-Puro into U-2 OS using SuperFect as described by the manufacturer. Cell cultivation, puromycin selection, and luciferase assays were carried out as described in Example 4.
  • FIGS 9 , 11 , and 12 compare the expression of the luciferase reporter gene from 3 different promoters: two strong and constitutive viral promoters (CMV and SV40), and the inducible Tet-Off promoter. All three promoters were tested in the context of the STAR6 element in U-2 OS cells. The results demonstrate that the yield and predictability from all 3 promoters are increased by STAR6. As described in Examples 4 and 7, STAR6 is beneficial in the context of the CMV promoter ( FIG 9 ).
  • STAR6 In the context of the Tet-Off promoter under inducing (low doxycycline) concentrations, STAR6 also improves the yield and predictability of transgene expression ( FIG 12 ): the highest-expressing STAR6 clone has a 20-fold higher yield than the best pSDH-Tet clone, and 9 STAR6 clones (35% of the population) have yields higher than the best STAR-less clone. It is concluded that this STAR element is versatile in its transgene-protecting properties, since it functions in the context of various biotechnologically useful promoters of transcription.
  • Example 9 STAR element function can be directional
  • nucleic acid sequences can be symmetrical (e.g. palindromic), longer naturally-occurring sequences are typically asymmetrical.
  • information content of nucleic acid sequences is directional, and the sequences themselves can be described with respect to their 5' and 3' ends.
  • the directionality of nucleic acid sequence information affects the arrangement in which recombinant DNA molecules are assembled using standard cloning techniques known in the art (Sambrook et al., 1989).
  • STAR elements are long, asymmetrical DNA sequences, and have a directionality based on the orientation in which they were originally cloned in the pSelect vector.
  • the STAR66 element was cloned into pSDH-Tet as described in Example 4.
  • U-2 OS cells were co-transfected with plasmids pSDH-Tet-STAR66-native and pSDH-Tet-STAR66-opposite, and cultivated as described in Example 4. Individual clones were isolated and cultivated; the level of luciferase expression was determined as described (supra).
  • FIG 14 The results of the comparison of STAR66 activity in the native orientation and the opposite orientation are shown in FIG 14 .
  • the yield of only one clone is reasonably high (60 luciferase units).
  • the yield of the highest-expressing clone when STAR66 is in the native orientation is considerably higher (100 luciferase units), and the predictability is much higher as well: 7 clones of the native-orientation population (30%) express luciferase above the level of the highest-expressing clone from the opposite-orientation population, and 15 of the clones in the native-orientation population (60%) express luciferase above 10 relative luciferase units.
  • Example 10 Transgene expression in the context of STAR elements is copy number-dependent
  • Transgene expression units for (heterologous) protein expression are generally integrated into the genome of the host cell to ensure stable retention during cell division. Integration can result in one or multiple copies of the expression unit being inserted into the genome; multiple copies may or may not be present as tandem arrays.
  • the increased yield demonstrated for transgenes protected by STAR elements suggests that STAR elements are able to permit the transgene expression units to function independently of influences on transcription associated with the site of integration in the genome (independence from position effects (Boivin & Dura, 1998). It suggests further that the STAR elements permit each expression unit to function independently of neighboring copies of the expression unit when they are integrated as a tandem array (independence from repeat-induced gene silencing (Garrick et al., 1998)). Copy number-dependence is determined from the relationship between transgene expression levels and copy number, as described in the example below.
  • U-2 OS cells were co-transfected with pSDH-Tet-STAR10 and cultivated under puromycin selection as described (supra). Eight individual clones were isolated and cultivated further. Then cells were harvested, and one portion was assayed for luciferase activity as described (supra). The remaining cells were lysed and the genomic DNA purified using the DNeasy Tissue Kit (QIAGEN 69504) as described by the manufacturer. DNA samples were quantitated by UV spectrophotometry. Three micrograms of each genomic DNA sample were digested with Pvu II and Xho I overnight as described by the manufacturer (New England Biolabs), and resolved by agarose gel electrophoresis.
  • DNA fragments were transferred to a nylon membrane as described (Sambrook et al., 1989), and hybridized with a radioactively labelled probe to the luciferase gene (isolated from Bam HI/ Sac II-digested pSDH-Tet). The blot was washed as described (Sambrook et al., 1989) and exposed to a phosphorimager screen (Personal F/X, BioRad). The resulting autoradiogram ( FIG 15 ) was analyzed by densitometry to determine the relative strength of the luciferase DNA bands, which represents the transgene copy number.
  • the enzyme activities and copy numbers (DNA band intensities) of luciferase in the clones from the pSDH-Tet-STAR10 clone population is shown in FIG 16 .
  • Example 11 STAR elements function as enhancer blockers but not enhancers
  • Enhancers are characteristically able to affect promoters even when they are located far away (many kilobase pairs) from the promoter.
  • Negative influences that act by heterochromatin formation e.g. Polycomb group proteins
  • the biochemical basis for enhancer function and for heterochromatin formation is fundamentally similar, since they both involve binding of proteins to DNA. Therefore it is important to determine whether STAR elements are able to block positive influences as well as negative influences, in other words, to shield transgenes from genomic enhancers in the vicinity of the site of integration.
  • the ability to shield transgenes from enhancer activity ensures stable and predictable performance of transgenes in biotechnological applications. This example examines the performance of STAR elements in an enhancer-blocking assay.
  • STAR activity Another feature of STAR activity that is important to their function is the increased yield they confer on transgenes (Example 4).
  • STARs are isolated on the basis of their ability to maintain high levels of zeocin expression when heterochromatin-forming proteins are bound adjacent to the candidate STAR elements. High expression is predicted to occur because STARs are anticipated to block the spread of heterochromatin into the zeocin expression unit.
  • a second scenario is that the DNA fragments in zeocin-resistant clones contain enhancers. Enhancers have been demonstrated to have the ability to overcome the repressive effects of Polycomb-group proteins such as those used in the method of the STAR screen (Zink & Paro, 1995). Enhancers isolated by this phenomenon would be considered false positives, since enhancers do not have the properties claimed here for STARs. In order to demonstrate that STAR elements are not enhancers, they have been tested in an enhancer assay.
  • the enhancer-blocking assay and the enhancer assay are methodologically and conceptually similar.
  • the assays are shown schematically in FIG 17 .
  • the ability of STAR elements to block enhancers is performed using the E47/E-box enhancer system.
  • the E47 protein is able to activate transcription by promoters when it is bound to an E-box DNA sequence located in the vicinity of those promoters (Quong et al., 2002).
  • E47 is normally involved in regulation of B and T lymphocyte differentiation (Quong et al., 2002), but it is able to function in diverse cell types when expressed ectopically (Petersson et al., 2002).
  • the E-box is a palindromic DNA sequence, CANNTG (Knofler et al., 2002).
  • an E-box is placed upstream of a luciferase reporter gene (including a minimal promoter) in an expression vector.
  • a cloning site for STAR elements is placed between the E-box and the promoter.
  • the E47 protein is encoded on a second plasmid.
  • the assay is performed by transfecting both the E47 plasmid and the luciferase expression vector into cells; the E47 protein is expressed and binds to the E-box, and the E47/E-box complex is able to act as an enhancer.
  • the E47/E-box complex enhances luciferase expression ( FIG 17A , situation 1).
  • STAR elements When STAR elements are inserted between the E-box and the promoter, their ability to block the enhancer is demonstrated by reduced expression of luciferase activity ( FIG 17A , situation 2); if STARs cannot block enhancers, luciferase expression is activated ( FIG 17A , situation 3).
  • STAR elements to act as enhancers utilizes the same luciferase expression vector. In the absence of E47, the E-box itself does not affect transcription. Instead, enhancer behaviour by STAR elements will result in activation of luciferase transcription.
  • the assay is performed by transfecting the luciferase expression vector without the E47 plasmid. When the expression vector does not contain STAR elements, luciferase expression is low ( FIG 17B , situation 1). If STAR elements do not have enhancer properties, luciferase expression is low when a STAR element is present in the vector ( FIG 17B , situation 2). If STAR elements do have enhancer properties, luciferase expression will be activated in the STAR-containing vectors ( FIG 17B , situation 3).
  • the luciferase expression vector was constructed by inserting the E-box and a human alkaline phosphatase minimal promoter from plasmid mu-E5+E2x6-cat(x) (Ruezinsky et al., 1991) upstream of the luciferase gene in plasmid pGL3-basic (Promega E1751), to create pGL3-E-box-luciferase (gift of W. Romanow).
  • the E47 expression plasmid contains the E47 open reading frame under control of a beta-actin promoter in the pHBAPr-1-neo plasmid; E47 in constitutively expressed from this plasmid (gift of W. Romanow).
  • STAR elements 1, 2, 3, 6, 10, 11, 18, and 27 have been cloned into the luciferase expression vector.
  • Clones containing the Drosophila scs element and the chicken beta-globin HS4-6x core ("HS4") element have been included as positive controls (they are known to block enhancers, and to have no intrinsic enhancer properties (Chung et al., 1993, Kellum & Schedl, 1992)), and the empty luciferase expression vector has been included as a negative control. All assays were performed using the U-2 OS cell line. In the enhancer-blocking assay, the E47 plasmid was co-transfected with the luciferase expression vectors (empty vector, or containing STAR or positive-control elements).
  • the E47 plasmid was co-transfected with STARless luciferase expression vector as a positive control for enhancer activity; all other samples received a mock plasmid during co-transfection.
  • the transiently transfected cells were assayed for luciferase activity 48 hours after plasmid transfection (supra).
  • the luciferase activity expressed from a plasmid containing no E-box or STAR/control elements was subtracted, and the luciferase activities were normalized to protein content as described (supra).
  • FIG 18 shows the results of the enhancer-blocking assay.
  • the E47/E-box enhancer complex activates expression of luciferase ("vector"); this enhanced level of expression has been normalized to 100. Enhancer activity is blocked by all STAR elements tested. Enhancer activity is also blocked by the HS4 and scs elements, as expected (Bell et al., 2001, Gerasimova & Corces, 2001).
  • FIG 19 shows the results of the enhancer assay.
  • the level of luciferase expression due to enhancement by the E47/E-box complex is set at 100 ("E47").
  • E47 the level of luciferase expression due to enhancement by the E47/E-box complex
  • none of the STAR elements bring about significant activation of luciferase expression.
  • the scs and HS4 elements also do not bring about activation of the reporter gene. Therefore it is concluded that at least the tested STAR elements do not possess enhancer properties.
  • Example 12 STAR elements are conserved between mouse and human
  • STAR6 is between the SLC8A1 and HAAO genes in both the human and mouse genomes.
  • a cloned human STAR has a paralog within the human genome, and its ortholog has been identified in the mouse genome.
  • STAR3a is a fragment of the 15q11.2 region of human chromosome 15. This region is 96.9% identical (paralogous) with a DNA fragment at 5q33.3 on human chromosome 5, which is near the IL12B interleukin gene.
  • These human DNAs share approximately 80% identity with a fragment of the 11B2 region on mouse chromosome 11.
  • the 11B2 fragment is also near the (mouse) IL12B interleukin gene.
  • STAR3a and the mouse 11B2 fragment can be strictly defined as paralogs.
  • one of the human STARs with a conserved sequence in mouse, STAR18 has been analyzed in greater detail.
  • the sequence conservation in the mouse genome detected with the original STAR18 clone extends leftward on human chromosome 2 for about 500 base pairs ( FIG 20 ; left and right relate to the standard description of the arms of chromosome 2).
  • the region of sequence conservation defines a "naturally occurring" STAR element in human that is more extensive in length than the original clone.
  • the region of mouse/human sequence conservation around STAR 18 was recovered from human BAC clone RP11-387A1 by PCR amplification, in three fragments: the entire region (primers E93 and E94), the leftward half (primers E93 and E92), and the rightward half (primers E57 and E94).
  • the corresponding fragments from the homologous mouse region were recovered from BAC clone RP23-400H17 in the same fashion (primers E95 and E98, E95 and E96, ann E97 and E98, respectively). All fragments were cloned into the pSelect vector and transfected into a U-2 OS/Tet-Off/LexA-HP1 cell line (supra).
  • the LexA-HP1 protein was induced by lowering the doxycycline concentration, and the ability of the transfected cells to withstand the antibiotic zeocin (a measure of STAR activity) was assessed by monitoring cell growth.
  • the original STAR18 clone was isolated from Sau 3AI digested human DNA ligated into the pSelect vector on the basis of its ability to prevent silencing of a zeocin resistance gene. Alignment of the human STAR18 clone (497 base pairs) with the mouse genome revealed high sequence similarity (72%) between the orthologous human and mouse STAR18 regions. It also uncovered high similarity (73%) in the region extending for 488 base pairs immediately leftwards of the Sau3AI site that defines the left end of the cloned region ( FIG 22 ). Outside these regions the sequence similarity between human and mouse DNA drops below 60%.
  • both the human and the mouse STAR18 elements confer survival on zeocin to host cells expressing the lexA-HP1 repressor protein.
  • the original 497 base pair STAR18 clone and its mouse ortholog both confer the ability to grow ( FIG 20 , a and d).
  • the adjacent 488 base pair regions of high similarity from both genomes also confer the ability to grow, and in fact their growth phenotype is more vigorous than that of the original STAR18 clone ( FIG 20, b and e ).
  • FIG 20, c and f the entire region of sequence similarity
  • STAR elements are isolated on the basis of their anti-repression phenotype with respect to transgene expression.
  • This anti-repression phenotype reflects underlying biochemical processes that regulate chromatin formation which are associated with the STAR elements. These processes are typically sequence-specific and result from protein binding or DNA structure. This suggests that STAR elements will share DNA sequence similarity. Identification of sequence similarity among STAR elements will provide sequence motifs that are characteristic of the elements that have already been identified by functional screens and tests. The sequence motifs will also be useful to recognize and claim new STAR elements whose functions conform to the claims of this patent. The functions include improved yield and stability of transgenes expressed in eukaryotic host cells.
  • sequence motifs that characterize STAR elements include: (1) provision of search motifs for prediction and identification of new STAR elements in genome databases, (2) provision of a rationale for modification of the elements, and (3) provision of information for functional analysis of STAR activity. Using bio-informatics, sequence similarities among STAR elements have been identified; the results are presented in this example.
  • Regulatory DNA elements typically function via interaction with sequence-specific DNA-binding proteins.
  • Bio-informatic analysis of DNA elements such as STAR elements whose regulatory properties have been identified, but whose interacting proteins are unknown, requires a statistical approach for identification of sequence motifs. This can be achieved by a method that detects short DNA sequence patterns that are over-represented in a set of regulatory DNA elements (e.g. the STAR elements) compared to a reference sequence (e.g. the complete human genome). The method determines the number of observed and expected occurrences of the patterns in each regulatory element. The number of expected occurrences is calculated from the number of observed occurrences of each pattern in the reference sequence.
  • the DNA sequence patterns can be oligonucleotides of a given length, e.g. six base pairs.
  • the actual frequency of each hexamer in the reference sequence is typically different than this due to biases in the content of G:C base pairs, etc. Therefore the frequency of each oligonucleotide in the reference sequence is determined empirically by counting, to create a "frequency table" for the patterns.
  • the pattern frequency table of the reference sequence is then used to calculate the expected frequency of occurrence of each pattern in the regulatory element set.
  • the expected frequencies are compared with the observed frequencies of occurrence of the patterns. Patterns that are "over-represented" in the set are identified; for example, if the hexamer ACGTGA is expected to occur 5 times in 20 kilobase pairs of sequence, but is observed to occur 15 times, then it is three-fold over-represented. Ten of the 15 occurrences of that hexameric sequence pattern would not be expected in the regulatory elements if the elements had the same hexamer composition as the entire genome. Once the over-represented patterns are identified, a statistical test is applied to determine whether their over-representation is significant, or may be due to chance.
  • a significance index, "sig" is calculated for each pattern.
  • the patterns that are significantly over-represented in the regulatory element set are used to develop a model for classification and prediction of regulatory element sequences.
  • Discriminant Analysis sets of known or classified items (e.g. STAR elements) are used to "train" a model to recognize those items on the basis of specific variables (e.g. sequence patterns such as hexamers).
  • the trained model is then used to predict whether other items should be classified as belonging to the set of known items (e.g. is a DNA sequence a STAR element).
  • the known items in the training set are STAR elements (positive training set).
  • Discriminant Analysis establishes criteria for discriminating positives from negatives based on a set of variables that distinguish the positives; in this example, the variables are the significantly over-represented patterns (e.g. hexamers).
  • Over-training is circumvented by applying a forward stepwise selection of variables (Huberty, 1994).
  • the goal of Stepwise Discriminant Analysis is to select the minimum number of variables that provides maximum discrimination between the positives and negatives.
  • the model is trained by evaluating variables one-by-one for their ability to properly classify the items in the positive and negative training sets. This is done until addition of new variables to the model does not significantly increase the model's predictive power (i.e. until the classification error rate is minimized). This optimized model is then used for testing, in order to predict whether "new" items are positives or negatives (Huberty, 1994).
  • the first step reduces a large set of sequence patterns (e.g. all 4096 hexamers) to a smaller set of significantly over-represented patterns (e.g. 100 hexamers); in the second step, Stepwise Discrimant Analysis reduces the set of over-represented patterns to the subset of those patterns that have maximal discriminative power (e.g. 5-10 hexamers). Therefore this approach provides simple and robust criteria for identifying regulatory DNA elements such as STAR elements.
  • DNA-binding proteins can be distinguished on the basis of the type of binding site they occupy. Some recognize contiguous sequences; for this type of protein, patterns that are oligonucleotides of length 6 base pairs (hexamers) are fruitful for bio-informatic analysis (van Helden et al., 1998). Other proteins bind to sequence dyads: contact is made between pairs of highly conserved trinucleotides separated by a non-conserved region of fixed width (van Helden et al., 2000).
  • BAC/PAC bacterial/P1
  • the BAC/PAC clones contain genomic DNA from regions of chromosome 1 (clones RP1154H19 and RP3328E19), from the HOX cluster of homeotic genes (clones RP1167F23, RP1170019, and RP11387A1), or from human chromosome 22 (Research Genetics 96010-22).
  • the DNAs were size-fractionated, and the 0.5 - 2 kb size fraction was ligated into Bam HI-digested pSelect vector, by standard techniques (Sambrook et al., 1989).
  • pSelect plasmids containing human genomic DNA that conferred resistance to zeocin at low doxycycline concentrations were isolated and propagated in Escherichia coli .
  • the screens that yielded the STAR elements of Table 6 have assayed approximately 1-2% of the human genome.
  • the human genomic DNA inserts in these 66 plasmids were sequenced by the dideoxy method (Sanger et al., 1977) using a Beckman CEQ2000 automated DNA sequencer, using the manufacturer's instructions. Briefly, DNA was purified from E. coli using QIAprep Spin Miniprep and Plasmid Midi Kits (QIAGEN 27106 and 12145, respectively). Cycle sequencing was carried out using custom oligonucleotides corresponding to the pSelect vector (primers D89 and D95, Table 1), in the presence of dye terminators (CEQ Dye Terminator Cycle Sequencing Kit, Beckman 608000).
  • Assembled STAR DNA sequences were located in the human genome (database builds August and December 2001) using BLAT (Basic Local Alignment Tool (Kent, 2002); http://genome.ucsc.edu/cgi-bin/hgGateway; Table 6).
  • the combined STAR sequences comprise 85.6 kilobase pairs, with an average length of 1.3 kilobase pairs.
  • Sequence motifs that distinguish STAR elements within human genomic DNA were identified by bio-informatic analysis using a two-step procedure, as follows (see FIG 21 for a schematic diagram).
  • the analysis has two input datasets: (1) the DNA sequences of the STAR elements (STAR1 - STAR65 were used; Table 6); and (2) the DNA sequence of the human genome (except for chromosome 1, which was not feasible to include due to its large size; for dyad analysis a random subset of human genomic DNA sequence ( ⁇ 27 Mb) was used).
  • the first step in the analysis uses RSA-Tools software (Regulatory Sequence Analysis Tools; http://www.ucmb.ulb.ac.be/bioinformatics/rsa-tools/ ; references (van Helden et al., 1998, van Helden et al., 2000, van Helden et al., 2000)) to determine the following information: (1) the frequencies of all dyads and hexameric oligonucleotides in the human genome; (2) the frequencies of the oligonucleotides and dyads in the 65 STAR elements; and (3) the significance indices of those oligonucleotides and dyads that are over-represented in the STAR elements compared to the genome.
  • a control analysis was done with 65 sequences that were selected at random from the human genome (i.e. from 2689 x 10 ⁇ 3 kilobase pairs) that match the length of the STAR elements of Table 6.
  • the over-represented oligonucleotides and dyads were used to, train models for prediction of STAR elements by Linear Discriminant Analysis (Huberty, 1994).
  • a pre-selection of variables was performed by selecting the 50 patterns with the highest individual dicriminatory power from the over-represented oligos or dyads of the frequency analyses. These pre-selected variables were then used for model training in a Stepwise Linear Discriminant Analysis to select the most discriminant combination of variables (Huberty, 1994).
  • Variable selection was based on minimizing the classification error rate (percentage of false negative classifications).
  • the expected error rate was estimated by applying the same discriminant approach to the control set of random sequences (minimizing the percentage of false positive classifications).
  • the predictive models from the training phase of Discriminant Analysis were tested in two ways. First, the STAR elements and random sequences that were used to generate the model (the training sets) were classified. Second, sequences in a collection of 19 candidate STAR elements (recently cloned by zeocin selection as described above) were classified. These candidate STAR elements are listed in Table 9 (SEQ ID:67-84).
  • Pattern frequency analysis was performed with RSA-Tools on 65 STAR elements, using the human genome as the reference sequence.
  • the most significantly over-represented oligonucleotide, CCCCAC occurs 107 times among the 65 STAR elements, but is expected to occur only 49 times. It has a significance coefficient of 8.76; in other words, the probability that its over-representation is due to random chance is 1 / 10 ⁇ 8.76, i.e. less than one in 500 million.
  • Table 4 also presents the number of STAR elements in which each over-represented oligonucleotide is found.
  • oligo 1 the most significant oligonucleotide, oligo 1 (CCCCAC) occurs 107 times, but is found in only 51 STARs, i.e. on average it occurs as two copies per STAR.
  • the least abundant oligonucleotide, number 166 (AATCGG) occurs on average as a single copy per STAR (thirteen occurrences on eleven STARs); single-copy oligonucleotides occur frequently, especially for the lower-abundance oligos.
  • CAGCCC the most abundant oligonucleotide
  • CAGCCC the most abundant oligonucleotide
  • oligonucleotide The most widespread oligonucleotide is number 120 (CCCAGG), which occurs on 58 STARs (on average twice per STAR), and the least widespread oligonucleotide is number 114 (CGTCGC), which occurs on only 6 STARs (and on average only once per STAR).
  • Three hundred ninety-seven of the dyads have a significance coefficient greater than 1, and are therefore highly over-represented in the STAR elements.
  • oligonucleotides and dyads found to be over-represented in STAR elements by pattern frequency analysis were tested for their discriminative power by Linear Discriminant Analysis.
  • Discriminant models were trained by step-wise selection of the best combination among the 50 most discriminant oligonucleotide (Table 4) or dyad (Table 5) patterns. The models achieved optimal error rates after incorporation of 4 (dyad) or 5 variables.
  • the discriminative variables from oligo analysis are numbers 11, 30, 94, 122, and 160 (Table 4); those from dyad analysis are numbers 73, 194, 419, and 497 (Table 5).
  • the discriminant models were then used to classify the 65 STAR elements in the training set and their associated random sequences.
  • the model using oligonucleotide variables classifies 46 of the 65 STAR elements as STAR elements (true positives); the dyad model classifies 49 of the STAR elements as true positives.
  • the models classify 59 of the 65 STAR elements as STAR elements (91%; FIG 22 ).
  • the false positive rates random sequences classified as STARs) were 7 for the dyad model, 8 for the oligonucleotide model, and 13 for the combined predictions of the two models (20%).
  • the STAR elements of Table 6 that were not classified as STARs by LDA are STARs 7, 22, 35, 44, 46, and 65. These elements display stabilizing anti-repressor activity in functional assays, so the fact that they are not classified as STARs by LDA suggests that they represent another class (or classes) of STAR elements.
  • the models were then used to classify the 19 candidate STAR elements in the testing set listed in Table 9.
  • the dyad model classifies 12 of these candidate STARs as STAR elements, and the oligonucleotide model classifies 14 as STARs.
  • the combined number of the candidates that are classified as STAR elements is 15 (79%). This is a lower rate of classification than obtained with the training set of 65 STARs; this is expected for two reasons.
  • the discriminant models were trained with the 65 STARs of Table 6, and discriminative variables based on this training set may be less well represented in the testing set.
  • the candidate STAR sequences in the testing set have not yet been fully characterized in terms of in vivo function, and may include elements with only weak anti-repression properties.
  • the STAR sequences contain a number of dyad and hexameric oligonucleotide patterns that are significantly over-represented in comparison with the human genome as a whole. These patterns may represent binding sites for proteins that confer STAR activity; in any case they form a set of sequence motifs that can be used to recognize STAR element sequences.
  • Transgene silencing occurs in transgenic plants at both the transcriptional and post-transcriptional levels (Meyer, 2000, Vance & Vaucheret, 2001). In either case, the desired result of transgene expression can be compromised by silencing; the low expression and instability of the transgene results in poor expression of desirable traits (e.g. pest resistance) or low yields of recombinant proteins. It also results in poor predictability: the proportion of transgenic plants that express the transgene at biotechnologically useful levels is low, which necessitates laborious and expensive screening of transformed individuals for those with beneficial expression characteristics.
  • This example describes the isolation of STAR elements from the genome of the dicot plant Arabidopsis thaliana for use in preventing transcriptional transgene silencing in transgenic plants.
  • Arabidopsis was chosen for this example because it is a well-studied model organism: it has a compact genome, it is amenable to genetic and recombinant DNA manipulations, and its genome has been sequenced (Bevan et al., 2001, Initiative, 2000, Meinke et al., 1998).
  • Genomic DNA was isolated from Arabidopsis thaliana ecotype Columbia as described (Stam et al., 1998) and partially digested with Mbo I. The digested DNA was size-fractionated to 0.5 - 2 kilbase pairs by agarose gel electrophoresis and purification from the gel (QIAquick Gel Extraction Kit, QIAGEN 28706), followed by ligation into the pSelect vector (supra). Transfection into the U-2 OS/Tet-Off/LexA-HP1 cell line and selection for zeocin resistance at low doxycycline concentration was performed as described (supra). Plasmids were isolated from zeocin resistant colonies and re-transfected into the U-2 OS/Tet-Off/LexA-HP1 cell line.
  • STAR activity was tested further by measuring mRNA levels for the hygromycin- and zeocin-resistance genes in recombinant host cells by reverse transcription PCR (RT-PCR).
  • RT-PCR reverse transcription PCR
  • Cells of the U-2 OS/Tet-Off/lexA-HP1 cell line were transfected with pSelect plasmids containing Arabidopsis STAR elements, the Drosophila scs element, or containing no insert (supra). These were cultivated on hygromycin for 2 weeks at high doxycycline concentration, then the doxycycline concentration was lowered to 0.1 ng/ml to induce the lexA-HP1 repressor protein.
  • First-strand cDNA synthesis was carried out using the RevertAid First Strand cDNA Synthesis kit (MBI Fermentas 1622) using oligo(dT)18 primer as described by the manufacturer.
  • An aliquot of the cDNA was used as the template in a PCR reaction using primers D58 and D80 (for the zeocin marker), and D70 and D71 (for the hygromycin marker), and Taq DNA polymerase (Promega M2661). The reaction conditions were 15-20 cycles of 94°C for 1 minute, 54°C for 1minute, and 72°C for 90 seconds.
  • RNA and PCR product DNA were resolved by agarose gel electrophoresis, and the zeocin and hygromycin bands were detected by Southern blotting as described (Sambrook et al., 1989), using PCR products produced as above with purified pSelect plasmid as template.
  • the ratio of the zeocin and hygromycin signals corresponds to the normalized expression level of the zeocin gene.
  • the library of Arabidopsis genomic DNA in the pSelect vector comprised 69,000 primary clones in E. coli, 80% of which carried inserts.
  • the average insert size was approximately 1000 base pairs; the library therefore represents approximately 40% of the Arabidopsis genome.
  • the strength of the cloned Arabidopsis STAR elements was tested by assessing their ability to prevent transcriptional repression of the zeocin-resistance gene, using an RT-PCR assay. As a control for RNA input among the samples, the transcript levels of the hygromycin-resistance gene for each STAR transfection were assessed too. This analysis has been performed for 12 of the Arabidopsis STAR elements. The results ( FIG 23 ) demonstrate that the Arabidopsis STAR elements are superior to the Drosophila scs element (positive control) and the empty vector ("SV40"; negative control) in their ability to protect the zeocin-resistance gene from transcriptional repression.
  • STAR-A28 and STAR-A30 enable 2-fold higher levels of zeocin-resistance gene expression than the scs element (normalized to the internal control of hygromycin-resistance gene mRNA) when the lexA-HP1 repressor is expressed.
  • Example 15 STAR-shielded genes that reside on multiple vectors are expressed simultaneously in CHO cells
  • STAR elements function to block the effect of transcriptional repression influences on transgene expression units.
  • One of the benefits of STAR elements for heterologous protein production is the increased predictability of finding high-expressing primary recombinant host cells. This feature allows for the simultaneous expression of different genes that reside on multiple, distinct vectors.
  • GFP and RED two different STAR7-shielded genes, GFP and RED, which are located on two different vectors. When these two vectors are transfected simultaneously to Chinese hamster ovary (CHO) cells, both are expressed, whereas the corresponding, but unprotected GFP and RED genes, show hardly such simultaneous expression.
  • the STAR7 element is tested in the ppGIZ-STAR7 and ppRIP-STAR7 vectors ( FIG 24 ).
  • the construction of the pPlug&Play (ppGIZ and ppRIP) vectors is described below.
  • Plasmid pGFP (Clontech 6010-1) is modified by insertion of a linker at the Bsi WI site to yield pGFP-link.
  • the linker (made by annealing oligonucleotides 5'GTACGGATATCAGATCTTTAATTAAG3' and 5'GTACCTTAATTAAAGATCTGATATCC3') introduces sites for the Pac I, Bgl II, and Eco RV restriction endonucleases.
  • pIRES-stuf is digested with Bgl II and Fsp I to liberate a DNA fragment composed of the stuffer fragment, the CMV promoter, the IRES element (flanked by multiple cloning sites MCS A and MCS B), and the SV40 polyadenylation signal.
  • This fragment is ligated with the vector backbone of pGFP-link produced by digestion with Bam HI and Stu I, to yield pIRES-link.
  • the open reading frames of the zeocin-resistance gene is inserted into the Bam HI/ Not I sites of MCS B in pIRES-link as follows: the zeocin-resistance ORF is amplified by PCR with primers 5'GATCGGATCCTTCGAAATGGCCAAGTTGACCAGTGC3' and 5'AGGCGCGGCCGCAATTCTCAGTCCTGCTCCTC3' from plasmid pEM7/zeo, digested with Bam HI and Not I, and ligated with Bam HI/ Not I-digested pIRES-link to yield pIRES-link-zeo.
  • the GFP reporter ORF is introduced into pIRES-link-zeo by amplification of phr-GFP-1 with primers 5'GATCGAATTCTCGCGAATGGTGAGCAAGCAGATCCTGAAG3' and 5'AGGCGAATTCACCGGTGTTTAAACTTACACCCACTCGTGCAGGCTGCCC AGG3', and insertion of the Eco RI-digested GFP cassette into the Eco RI site in MCS A of the pIRES-link-zeo plasmid.
  • the puromycin-resistance ORF is amplified by PCR with primers 5'GATCGGATCCTTCGAAATGACCGAGTACAAGCCCACG3' and 5'AGGCGCGGCCGCTCAGGCACCGGGCTTGCGGGTC3' from plasmid pBabe-Puro (Morgenstern & Land, 1990), digested with Bam HI and Not I, and ligated with Bam HI/ Not I-digested pIRES-link to yield pIRES-link-puro.
  • the RED gene is amplified by PCR with primers 5'GATCTCTAGATCGCGAATGGCCTCCTCCGAGAACGTCATC3' and 5'AGGCACGCGTTCGCGACTACAGGAACAGGTGGTGGCG3' from plasmid pDsRed2 (Clontech 6943-1), digested with Xba I and Mlu I and ligated to Nhe I- Mlu I digested pIRES-link-puro to yield ppRIP (for ppRED-IRES-puro).
  • 5' STAR7 is cloned into the Sal I site and 3'STAR7 is cloned into the Pac I site.
  • the Chinese Hamster Ovary cell line CHO-K1 (ATCC CCL-61) is cultured in HAMS-F12 medium + 10% Fetal Calf Serum containing 2 mM glutamine, 100 U/ml penicillin, and 100 micrograms/ml streptomycin at 37° C/5% CO 2 .
  • Cells are transfected with the plasmids using Lipofectamine 2000 (Invitrogen) as described by the manufacturer. Briefly, cells are seeded to culture vessels and grown overnight to 70-90% confluence. Lipofectamine reagent is combined with plasmid DNA at a ratio of 7.5 microliters per 3 microgram (e.g.
  • One tested construct consists of a monocistronic gene with the GFP gene, an IRES and the Zeocin resistance gene under control of the CMV promoter, but either with or without STAR7 element to flank the entire construct ( FIG 24 ).
  • the other construct consists of a monocistronic gene with the RED gene, an IRES and the puromycin resistance gene under control of the CMV promoter, but either with or without STAR7 element to flank the entire construct ( FIG 24 ).
  • the constructs are transfected to CHO-K1 cells. Stable colonies that are resistant for both zeocin and puromycin are expanded before the GFP and RED signals are determined on a XL-MCL Beckman Coulter flowcytometer. The percentage of cells in one colony that are double positive for both GFP and RED signals is taken as measure for simultaneous expression of both proteins and this is plotted in FIG 24 .
  • FIG 24 shows that simultaneous expression in independent zeocin and puromycin resistant CHO colonies of GFP and a RED reporter genes that are flanked by a STAR element results in a higher number of cells that express both GFP and RED proteins, as compared to the control vectors without STAR7 element.
  • the STAR7 element therefore conveys a higher degree of predictability of transgene expression in CHO cells.
  • In the STAR-less colonies at most 9 out of 20 colonies contain double GFP/RED positive cells. The percentage of double positive cells ranges between 10 and 40%. The remaining 11 out of 20 colonies have less than 10% GFP/RED positive cells.
  • the percentage GFP/RED double positive cells ranges between 25 and 75%. In 15 out of these 19 double positive colonies the percentage GFP/RED double positive cells is higher than 40%. This result shows that it is more likely that simultaneous expression of two genes is achieved when these genes are flanked with STAR elements.
  • Example 16 Expression of a functional antibody from two separate plasmids is easier obtained when STAR elements flank the genes encoding the heavy and light chains.
  • STAR elements Due to the ability of STAR elements to convey higher predictability to protein expression two genes can be expressed simultaneously from distinct vectors. This is shown in example 15 for two reporter genes, GFP and RED. Now the simultaneous expression of a light and a heavy antibody chain is tested. In example 16, STAR7-shielded light and heavy antibody cDNAs that reside on distinct vectors are simultaneously transfected to Chinese hamster ovary cells. This results in the production of functional antibody, indicating that both heavy and light chains are expressed simultaneously. In contrast, the simultaneous transfection of unprotected light and heavy antibody cDNAs shows hardly expression of functional antibody.
  • the tested constructs are the same as described in Example 15, except that the GFP gene is replaced by the gene encoding the light chain of the RING1 antibody (Hamer et al., 2002) and the RED gene is replaced by the gene encoding the heavy chain of the RING1 antibody.
  • the light chain is amplified from the RING1 hybridoma (Hamer et al., 2002) by RT-PCR using the primers 5'CAAGAATTCAATGGATTTTCAAGTGCAG3' and 5'CAAGCGG CCGCTTTGTCTCTAACACTCATTCC3'.
  • the PCR product is cloned into pcDNA3 after restriction digestion with Eco RI and Not I and sequenced to detect potential frame shifts in the sequence.
  • the cDNA is excised with Eco RI and Not I, blunted and cloned in ppGIZ plasmid.
  • the heavy chain is amplified from the RING1 hybridoma (Hamer et al., 2002) by RT-PCR using the primers 5'ACAGAATTCTTACCATGGATTTTGGGCTG3' and 5'ACAGCGGCCGCTCATTTACCAGGAGAGTGGG3'.
  • the PCR product is cloned into pcDNA3 after restriction digestion with Eco RI and Not I and sequenced to detect potential frame shifts in the sequence.
  • the cDNA is excised with Eco RI and Not I, blunted and cloned in ppRIP plasmid.
  • CHO colonies are simultaneously transfected with the RING1 Light Chain (LC) and RING1 Heavy Chain (HC) cDNAs that reside on two distinct vectors.
  • the Light Chain is coupled to the zeocin resistance gene through an IRES
  • the Heavy Chain is coupled to the puromycin resistance gene through an IRES.
  • FIG 25 shows that simultaneous transfection to CHO cells of the heavy and light chain encoding cDNAs results in the establishment of independent zeocin and puromycin resistant colonies.
  • the constructs are flanked by the STAR7 element this results in a higher production of functional RING1 antibody, as compared to the control vectors without STAR7 element.
  • the STAR7 element therefore conveys a higher degree of predictability of antibody expression in CHO cells.
  • Oligonucleotides used for polymerase chain reactions or DNA mutagenesis Number Sequence C65 AACAAGCTTGATATCAGATCTGCTAGCTTGGTCGAGCTGATACTTCCC C66 AAACTCGAGCGGCCGCGAATTCGTCGACTTTACCACTCCCTATCAGTGATAGAG C67 AAACCGCGGCATGGAAGACGCCAAAAACATAAAGAAAGG C68 TATGGATCCTAGAATTACACGGCGATCTTTCC C81 AAACCATGGCCGAGTACAAGCCCACGGTGCGCC C82 AAATCTAGATCAGGCACCGGGCTTGCGGGTCATGC C85 CATTTCCCCGAAAAGTGCCACC D30 TCACTGCTAGCGAGTGGTAAACTC D41 GAAGTCGACGAGGCAGGCAGAAGTATGC D42 GAGCCGCGGTTTAGTTCCTCACCTTGTCG D51 TCTGGAAGCTTTGCTGAAGAAAC D58 CCAAGTTGACCAGTGCC D70 TACAAGCCAACCACGGCCT D71 C
  • STAR elements and two-step selection increase the predictability of transgene expression without STAR with STAR fold improvement (carry out first antibiotic selection)
  • Low producers 19 17 (carry out second antibiotic selection, killing low producers) Survivors to characterize 5 30-fold 3 150 1 Colonies per microgram plasmid DNA.
  • 2 Manifesting the three-fold improvement due to the presence of STARs in the percent of high producers in the original population of colonies resistant to the first antibiotic.
  • 3 Manffesting the arithmetic product of the fold improvement in the number of colonies and the increased percentage of high producers due to the presence of STARs. Table 3.
  • Dyad patterns over-represented in STAR elements The patterns are ranked according to significance coefficient. These were determined using RSA-Tools with the random sequence from the human genome as reference. Patterns that comprise the most discriminant variables in Linear Discriminant Analysis are indicated with an asterisk.
  • STAR elements including genomic location and length STAR Location 1 Length 2 1 2q31.1 750 2 7p 15.2 916 33 15q11.2 and 10q22.2 2132 4 1p31.1 and 14q24.1 1625 54 20q13.32 1571 6 2p21 1173 7 1q34 2101 8 9q32 1839 94 10p15.3 1936 10 Xp11.3 1167 11 2p25.1 13777.
  • STAR elements convey stability over time on transgene expression 1 Cell Divisions 2 Luciferase Expression 3 STAR6 plus puromycin 42 18,000 60 23,000 84 20,000 108 16,000 STAR6 without puromycin 4 84 12,000 108 15,000 144 12,000 1 Plasmid pSDH-Tet-STAR6 was transfected into U-2 OS cells, and clones were isolated and cultivated in doxycycline-free medium. Cells were transferred to fresh culture vessels weekly at a dilution of 1:20. 2 The number of cell divisions is based on the estimation that in one week the culture reaches cell confluence, which represents ⁇ 6 cell divisions. 3 Luciferase was assayed as described in Example 4.
  • Candidate STAR elements tested by Linear Discriminant Analysis Candidate STAR Location 1 Length T2 F 20q13.33 ⁇ 2800 T2 R 6q14.1 ⁇ 2800 T3 F 15q12 ⁇ 2900 T3 R 7q31.2 ⁇ 2900 T5 F 9q34.13 ND 2 T5 R 9q34.13 ND T7 22q12.3 ⁇ 1200 T9 F 21q22.2 ⁇ 1600 T9 R 22q11.22 ⁇ 1600 T10 F 7q22.2 ⁇ 1300 T10 R 6q14.1 ⁇ 1300 T11 F 17q23.3 ⁇ 2000 T11 R 16q23.1 ⁇ 2000 T12 4p15.1 ⁇ 2100 T13 F 20p13 ⁇ 1700 T13 R 1p13.3 ⁇ 1700 T14 R 11q25 ⁇ 1500 T17 2q31.3 ND T18 2q31.1 ND 1 Chromosomal location is determined by BLAT search of DNA sequence data from the STAR elements against the human genome database.
  • Arabidopsis STAR elements of the invention including chromosome location and length STAR Chromosome Length, kb A1 I 1.2 A2 I 0.9 A3 I 0.9 A4 I 0.8 A5 I 1.3 A6 I 1.4 A7 II 1.2 A8 II 0.8 A9 II 0.9 A10 II 1.7 A11 II 1.9 A12 II 1.4 A13 II 1.2 A14 II 2.1 A15 II 1.4 A16 II 0.7 A17 II 1.5 A18 III 1.5 A19 III 0.7 A20 III 2.0 A21 IV 1.8 A22 IV 0.8 A23 IV 0.6 A24 IV 0.5 A25 , V 0.9 A26 V 1.9 A27 V 1.1 A28 V 1.6 A29 V 0.9 A30 V 2.0 A31 V 2.0 A32 V 1.3 A33 V 0.9 A34 I 0.9 A35 II 1.1
  • the drawings show representative versions of the DNA molecules of the invention. These portions of DNA, referred to as (a) protein expression unit(s), is/are created and manipulated in vectors such as recombinant plasmid molecules and/or recombinant viral genomes.
  • the protein expression units are integrated into host cell genomes as part of the method of the invention, and the schematic drawings represent the configuration of the DNA elements in the expression units in both the vector molecules and the host cell genome.
  • FIG. Schematic diagram of the invention.
  • FIG 1A shows the first expression unit. It is flanked by STAR elements, and comprises a bicistronic gene containing (from 5' to 3') a transgene (encoding for example a reporter gene or one subunit of a multimeric protein; TG S1, "transgene subunit 1"), an IRES, and a selectable marker (zeo, conferring zeocin resistance) under control of the CMV promoter.
  • a monocistronic selectable marker (neo, conferring G418 resistance) under control of the SV40 promoter is included. Both genes have the SV40 transcriptional terminator at their 3' ends (t).
  • FIG 1B shows the second expression unit. It is flanked by STAR elements, and contains a bicistronic gene containing (from 5' to 3') a transgene (encoding for example a different reporter gene or another subunit of a multimeric protein; TG S2), an IRES, and a selectable marker (bsd, conferring blasticidin resistance) under control of the CMV promoter.
  • a monocistronic selectable marker (neo, conferring G418 resistance) under control of the SV40 promoter is included. Both genes have the SV40 transcriptional terminator at their 3' ends.
  • FIG. 1 The pSDH-CSP plasmid.
  • the Secreted Alkaline Phosphatase (SEAP) reporter gene is under control of the CMV promoter, and the puromycin resistance selectable marker (puro) is under control of the SV40 promoter. Flanking these two genes are multiple cloning sites into which STAR elements can be cloned.
  • the plasmid also has an origin of replication (ori) and ampicillin resistance gene (amp R ) for propagation in Escherichia coli.
  • FIG 3. The pSDH-SIB/Z and pSDH-GIB/Z families of plasmids.
  • plasmids are derived from the pSDH-CSP plasmid ( FIG 2 ), by replacement of the monocistronic SEAP and puro genes with a bicistronic gene under control of the CMV promoter and a monocistronic neomycin resistance selectable marker gene (neo) under control of the SV40 promoter.
  • Panel A pSDH-SIB/Z in which the bicistronic gene encodes secreted alkaline phosphatase (SEAP) in the 5' position and blasticidin (bsd) or zeocin (zeo) resistance selectable markers in the 3' position, relative to the internal ribosome binding site (IRES).
  • SEAP secreted alkaline phosphatase
  • bsd blasticidin
  • zeocin resistance selectable markers in the 3' position, relative to the internal ribosome binding site (IRES).
  • Panel B pSDH-GIB/Z in which the bicistronic gene encodes green fluorescent protein. (GFP) in the 5' position and blasticidin (bsd) or zeocin (zeo) resistance selectable markers in the 3' position, relative to the internal ribosome binding site (IRES).
  • GFP green fluorescent protein
  • bsd blasticidin
  • zeocin zeo resistance selectable markers
  • FIG 4. Comparison of the consequences of one-step and two-step antibiotic selection on the predictability of transgene expression.
  • Recombinant CHO cell isolates containing plasmid pSDH-SIZ or plasmid pSDH-SIZ-STAR18 were selected on G418 (panel A) or sequentially on G418 and zeocin (panel B) and assayed for SEAP activity.
  • FIG. The PP (Plug and Play) family of plasmids.
  • plasmids contain a bicistronic expression unit (containing an internal ribosome binding site, IRES) between multiple cloning sites (MCS) for insertion of STAR elements.
  • IRES internal ribosome binding site
  • MCS multiple cloning sites
  • Panel A the bicistronic gene encodes green fluorescent protein (GFP) and the puromycin resistance marker (puro).
  • Panel B the bicistronic gene encodes secreted alkaline phosphatase (SEAP) and the zeocin resistance marker (zeo).
  • SEAP secreted alkaline phosphatase
  • zeo zeocin resistance marker
  • Panel C the bicistronic gene encodes SEAP and the neocin resistance marker (neo).
  • Panel D the bicistronic gene encodes GFP and puro, and an adjacent monocistronic gene encodes neo.
  • Panel E the bicistronic gene encodes SEAP and zeo, and an adjacent monocistronic gene encodes neo.
  • Bicistronic genes are under control of the CMV promoter (pCMV) and the monocistronic gene is under control of the SV40 promoter (pSV40).
  • a stuffer fragment of 0.37 kb (St) separates MCSI from pCMV.
  • Both the bicistronic and monocistronic genes have the SV40 polyadenylation site at their 3' ends.
  • FIG. STAR sequences
  • FIG 7. The pSDH-CSP plasmid used for testing STAR activity.
  • the Secreted Alkaline Phosphatase (SEAP) reporter gene is under control of the CMV promoter, and the puromycin resistance selectable marker (puro) is under control of the SV40 promoter. Flanking these two genes are multiple cloning sites into which STAR elements can be cloned.
  • the plasmid also has an origin of replication (ori) and ampicillin resistance gene (ampR) for propagation in Escherichia coli.
  • FIG 8. STAR6 and STAR,49 improve predictability and yield of transgene expression.
  • SEAP from the CMV promoter by CHO cells transfected with pSDH-CSP, pSDH-CSP-STAR6, or pSDH-CSP-STAR49 was determined.
  • the STAR-containing constructs confer greater predictability and elevated yield relative to the pSDH-CSP construct alone.
  • luciferase from the CMV promoter by U-2 OS cells transfected with pSDH-CMV, pSDH-CMV-STAR6, or pSDH-CMV-STAR8 was determined.
  • the STAR-containing constructs confer greater predictability and elevated yield relative to the pSDH-C1VIV construct alone.
  • FIG 10. Minimal essential sequences of STAR10 and STAR27.
  • STAR10 was amplified with primers E23 and E12 to yield fragment 10A, E13 and E14 to yield fragment 10B, and E15 and E16 to yield fragment 10C.
  • STAR27 was amplifies with primers E17 and E18 to yield fragment 27A, E19 and E20 to yield fragment 27B, and E21 and E22 to yield fragment 27C. These sub-fragments were cloned into the pSelect vector. After transfection into U-2 OSlTet-OfflLexA-HP1 cells, the growth of the cultures in the presence of zeocin was monitored. Growth rates varied from vigorous (+++) to poor (+/-), while some cultures failed to survive zeocin treatment (-) due to absence of STAR activity in the DNA fragment tested.
  • FIG 11. STAR element function in the context of the SV40 promoter.
  • pSDH-SV40 and pSDH-SV40-STAR6 were transfected into the human osteosarcoma U-2 OS cell line, and expression of luciferase was assayed with or without protection from gene silencing by STAR6 in puromycin-resistant clones.
  • FIG 12. STAR element function in the context of the Tet-Off promoter.
  • pSDH-Tet and pSDH-Tet-STAR6 were transfected into the human osteosarcoma U-2 OS cell line, and expression of luciferase was assayed with or without protection from gene silencing by STAR6 in puromycin-resistant clones.
  • FIG 14. Directionality of STAR66 function.
  • the STAR66 element was cloned into pSDH-Tet in either the native (STAR66 native) or the opposite orientation (STAR66 opposite), and transfected into U-2 OS cells. Luciferase activity was assayed in puromycin resistant clones.
  • FIG. Copy number-dependence of STAR function.
  • FIG. Copy number-dependence of STAR function.
  • the copy number of pSDH-Tet-STAR10 expression units in each clone was determined by phosphorimagery, and compared with the activity of the luciferase reporter enzyme expressed by each clone.
  • FIG. Enhancer-blocking and enhancer assays.
  • the luciferase expression vectors used for testing STARs for enhancer-blocking and enhancer activity are shown schematically.
  • the E-box binding site for the E47 enhancer protein is upstream of a cloning site for STAR elements. Downstream of the STAR cloning site is the luciferase gene under control of a human alkaline phosphatase minimal promoter (mp).
  • mp human alkaline phosphatase minimal promoter
  • the histograms indicate the expected outcomes for the three possible experimental situations (see text).
  • Panel A Enhancer-blocking assay.
  • Panel B Enhancer assay.
  • FIG. Enhancer-blocking assay.
  • Luciferase expression from a minimal promoter is activated by the E47/E-box enhancer in the empty vector (vector). Insertion of enhancer-blockers (scs, HS4) or STAR elements (STAR elements 1, 2, 3, 6, 10, 11, 18, and 27) block luciferase activation by the E47/E-box enhancer.
  • enhancer-blockers scs, HS4
  • STAR elements STAR elements 1, 2, 3, 6, 10, 11, 18, and 27
  • FIG. Enhancer assay.
  • Luciferase expression from a minimal promoter is activated by the E47/E-box enhancer in the empty vector (E47). Insertion of the scs and HS4 elements or various STAR elements (STARs 1, 2, 3, 6, 10, 11, 18, and 27) do not activate transcription of the reporter gene.
  • FIG 20 STAR18 sequence conservation between mouse and human.
  • the region of the human genome containing 497 base pair STAR18 is shown (black boxes); the element occurs between the HOXD8 and HOXD4 homeobox genes on human chromosome 2. It is aligned with a region in mouse chromosome 2 that shares 72% sequence identity. The region of human chromosome 2 immediately to the left of STAR18 is also highly conserved with mouse chromosome 2 (73% identity; gray boxes); beyond these region, the identity drops below 60%. The ability of these regions from human and mouse, either separately or in combination, to confer growth on zeocin is indicated: -, no growth; +, moderate growth; ++, vigorous growth; +++, rapid growth.
  • FIG 21 is a diagrammatic representation of FIG.
  • FIG 22 Results of discriminant analysis on classification of the training set of 65 STAR elements.
  • STAR elements that are correctly classified as STARs by Stepwise Linear Discriminant Analysis are shown in a Venn diagram.
  • the variables for LDA were selected from frequency analysis results for hexameric oligonucleotides ("oligos") and for dyads.
  • the diagram indicates the concordance of the two sets of variables in correctly classifying STARs.
  • FIG 23 RT-PCR assay of Arabidopsis STAR strength
  • U-2 OS/Tet-OffllexA-HP1 cells were transfected with candidate Arabidopsis STAR elements and cultivated at low doxycycline concentrations.
  • Total RNA was isolated and subjected to RT-PCR; the bands corresponding to the zeocin and hygromycin resistance mRNAs were detected by Southern blotting and quantified with a phosphorimager.
  • the ratio of the zeocin to hygromycin signals is shown for transfectants containing zeocin expression units flanked by 12 different Arabidopsis STAR elements, the Drosophila scs element, or no flanking element.
  • FIG. 24 STAR elements allow efficient and simultaneous expression of two genes from two distinct vectors.
  • the ppGIZ, ppGIZ-STAR7, ppRIP and ppRIP-STAR7 vectors used for testing simultaneous expression of respectively GFP and RED are shown.
  • the expression unit comprises (from 5' to 3') genes encoding the GFP or RED proteins, an IRES, and a selectable marker (zeo, conferring zeocin resistance or respectively puro, puromycin resistance gene) under control of the CMV promoter.
  • the expression unit has the SV40 transcriptional terminator at its 3' end (t).
  • the cassettes with the GFP and RED expression units are either flanked by STAR7 elements (STAR7-shielded) or not (Control).
  • the two control constructs or the two STAR7-shielded vectors are simultaneously transfected to CHO-K1 cells. Stable colonies that are resistant to both zeocin and puromycin are expanded and the GFP and RED signals are determined on a XL-MCL Beckman Coulter flowcytometer. The percentage of cells in one colony that are double positive for both GFP and RED signals is taken as measure for simultaneous expression of both proteins and this is plotted in FIG 24 .
  • FIG. 25 STAR elements improve expression of a functional antibody in CHO cells.
  • the different vectors containing the Light and Heavy Chain of the RING 1 antibody are shown in FIG 25 .
  • the constructs are simultaneously transfected to CHO cells. Stable colonies that are resistant to both zeocin and puromycin are expanded. The cell culture medium of these colonies is tested for the detection of functional RING1 antibody in an ELISA with RING 1 protein as antigen. The values are dividing by the number of cells in the colony. The highest value detected in the STAR-less control is arbitrarily set at 100%.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Virology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
EP03733632A 2002-06-14 2003-06-13 A method for the stimultaneaous production of multiple proteins; vectors and cells for use therein Expired - Lifetime EP1513937B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP03733632A EP1513937B1 (en) 2002-06-14 2003-06-13 A method for the stimultaneaous production of multiple proteins; vectors and cells for use therein

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP02077350 2002-06-14
EP02077350 2002-06-14
PCT/NL2003/000432 WO2003106684A2 (en) 2002-06-14 2003-06-13 A method for simultaneous production of multiple proteins; vectors and cells for use therein
EP03733632A EP1513937B1 (en) 2002-06-14 2003-06-13 A method for the stimultaneaous production of multiple proteins; vectors and cells for use therein

Publications (2)

Publication Number Publication Date
EP1513937A2 EP1513937A2 (en) 2005-03-16
EP1513937B1 true EP1513937B1 (en) 2011-03-02

Family

ID=29724494

Family Applications (1)

Application Number Title Priority Date Filing Date
EP03733632A Expired - Lifetime EP1513937B1 (en) 2002-06-14 2003-06-13 A method for the stimultaneaous production of multiple proteins; vectors and cells for use therein

Country Status (11)

Country Link
US (3) US7364878B2 (enExample)
EP (1) EP1513937B1 (enExample)
JP (3) JP4647309B2 (enExample)
AT (1) ATE500331T1 (enExample)
AU (1) AU2003238719B2 (enExample)
CA (3) CA2489475C (enExample)
DE (1) DE60336228D1 (enExample)
DK (1) DK1513937T3 (enExample)
ES (1) ES2362273T3 (enExample)
NZ (1) NZ537073A (enExample)
WO (1) WO2003106684A2 (enExample)

Families Citing this family (37)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5654442A (en) * 1989-11-14 1997-08-05 The Perkin-Elmer Corporation 4,7-dichlorofluorescein dyes as molecular probes
ATE421589T1 (de) * 2000-03-17 2009-02-15 Anticancer Inc Optisches abbildungssystem zur darstellung der genexpression des gesamten körpers und anwendungen
EP1806407B1 (en) 2001-07-04 2010-05-05 Chromagenics B.V. DNA sequences having anti-repressor activity
DK1513937T3 (da) 2002-06-14 2011-05-16 Chromagenics Bv Fremgangsmåde til den samtidige produktion af multiple proteiner; vektorer og celler til anvendelse derved
EP1513936A2 (en) * 2002-06-14 2005-03-16 Chromagenics B.V. Use of repression blocking sequences in methods for enhancing gene expression
EP2314629B2 (en) 2002-07-18 2022-11-16 Merus N.V. Recombinant production of mixtures of antibodies
USRE47770E1 (en) 2002-07-18 2019-12-17 Merus N.V. Recombinant production of mixtures of antibodies
CA2510179C (en) * 2002-12-18 2013-04-23 Chromagenics B.V. A method for improving protein production
ATE354645T1 (de) 2002-12-20 2007-03-15 Chromagenics Bv Mittel und methoden zur produktion eines proteins durch chromatin-öffner, die chromatin zugänglicher für transkriptionsfaktoren machen können
US20100069614A1 (en) 2008-06-27 2010-03-18 Merus B.V. Antibody producing non-human mammals
WO2004106375A1 (en) 2003-05-30 2004-12-09 Merus Biopharmaceuticals B.V. I.O. Fab library for the preparation of anti vegf and anti rabies virus fabs
AU2005205412B2 (en) 2004-01-20 2011-08-11 Merus N.V. Mixtures of binding proteins
WO2006005718A2 (en) * 2004-07-08 2006-01-19 Chromagenics B.V. Novel sequence for improving expression of nucleic acid
US8999667B2 (en) 2004-11-08 2015-04-07 Chromagenics B.V. Selection of host cells expressing protein at high levels
US20100136616A1 (en) * 2004-11-08 2010-06-03 Chromagenics B.V. Selection of Host Cells Expressing Protein at High Levels
US8039230B2 (en) 2004-11-08 2011-10-18 Chromagenics B.V. Selection of host cells expressing protein at high levels
PL1809750T3 (pl) * 2004-11-08 2012-08-31 Chromagenics Bv Selekcja komórki gospodarza eksprymującej białko na wysokich poziomach
US20060195935A1 (en) 2004-11-08 2006-08-31 Chromagenics B.V. Selection of host cells expressing protein at high levels
CN101090968B (zh) 2004-11-08 2011-10-26 科罗迈吉尼科斯公司 高水平表达蛋白质的宿主细胞的选择
US20070042397A1 (en) * 2005-03-03 2007-02-22 International Business Machines Corporation Techniques for linking non-coding and gene-coding deoxyribonucleic acid sequences and applications thereof
CA2637271C (en) * 2006-02-21 2014-12-09 Chromagenics B.V. Selection of host cells expressing protein at high levels
US20080293086A1 (en) * 2006-09-18 2008-11-27 Cobalt Technologies, Inc. A Delaware Corporation Real time monitoring of microbial enzymatic pathways
JP2010504507A (ja) * 2006-09-20 2010-02-12 インスティチュート・パスツール・コリア 細胞におけるターゲットタンパク質候補の発現を検出および/または定量する方法、ならびに小分子モデュレーターのターゲットタンパク質を同定する方法
US20090081715A1 (en) * 2007-09-07 2009-03-26 Cobalt Technologies, Inc., A Delaware Corporation Engineered Light-Emitting Reporter Genes
CL2009000879A1 (es) 2008-04-09 2010-05-07 Talfryn S A Metodo para fabricar un producto en un biorreactor que comprende cultivar microorganismos que son adaptados o mutagenizados para que exhiban por lo menos un 150% de tolerancia al producto; sistema para fabricar un producto; biorreactor.
EP2443239B1 (en) 2009-06-15 2015-11-25 Cellagenics B.V. Novel stringent selectable markers
CN102482690A (zh) 2009-06-26 2012-05-30 钴技术有限公司 生物产物生产的集成系统和方法
US9790517B2 (en) 2010-06-15 2017-10-17 Cellagenics B.V. Intergenic elements for enhancing gene expression
US9650630B2 (en) 2010-09-01 2017-05-16 Cellagenics B.V. Nucleic acid fragments from a ribosomal protein promoter for enhancing gene expression
WO2012040793A1 (en) * 2010-10-01 2012-04-05 Csl Limited Method of cloning nucleic acid
US8945876B2 (en) 2011-11-23 2015-02-03 University Of Hawaii Auto-processing domains for polypeptide expression
DK2838918T3 (da) 2012-04-20 2019-08-12 Merus Nv Fremgangsmåder og midler til fremstilling af heterodimere ig-lignende molekyler
WO2015053523A1 (ko) * 2013-10-07 2015-04-16 한화케미칼 주식회사 항체 발현용 바이시스트로닉 발현벡터 및 이를 이용한 항체의 생산 방법
EP4569107A1 (en) * 2022-08-09 2025-06-18 GEG Tech Transient expression system for rna, for gene editing
US20260041746A1 (en) * 2022-08-09 2026-02-12 Geg Tech Transient expression system for rna, for vaccination
WO2024033444A1 (en) * 2022-08-09 2024-02-15 Geg Tech Transient expression system for rna, for cosmetic uses
EP4569105A1 (en) * 2022-08-09 2025-06-18 GEG Tech Transient expression system for rna

Family Cites Families (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE4228458A1 (de) * 1992-08-27 1994-06-01 Beiersdorf Ag Multicistronische Expressionseinheiten und deren Verwendung
US5610053A (en) * 1993-04-07 1997-03-11 The United States Of America As Represented By The Department Of Health And Human Services DNA sequence which acts as a chromatin insulator element to protect expressed genes from cis-acting regulatory sequences in mammalian cells
US5972605A (en) 1994-07-07 1999-10-26 Geron Corporation Assays for regulators of mammalian telomerase expression
US5773695A (en) * 1996-01-26 1998-06-30 North Carolina State University Plant nuclear scaffold attachment region and method for increasing gene expression in transgenic cells
US5888809A (en) 1997-05-01 1999-03-30 Icos Corporation Hamster EF-1α transcriptional regulatory DNA
US6149212A (en) * 1997-07-02 2000-11-21 Eagle Inventors, Llc Adjustable door stop
CN100365127C (zh) 1998-07-21 2008-01-30 密理博公司 具有遍在染色质开放表达元件(ucoe)的聚核苷酸
DK1104490T3 (da) * 1998-08-14 2008-01-02 Chromagenics Bv Fremgangsmåde til påvisning af en DNA-sekvens, DNA-sekvens, fremgangsmåde til fremstilling af en DNA-konstruktion samt anvendelse deraf
US6800457B2 (en) * 1998-09-22 2004-10-05 Bristol-Myers Squibb Company Expression vectors containing hot spot for increased recombinant protein expression in transfected cells
US6521419B1 (en) * 1998-09-22 2003-02-18 Kanakaraju Koduri Expression vectors containing hot spot for increased recombinant protein expression in transfected cells
AU1128400A (en) 1998-10-22 2000-05-08 Medical College Of Georgia Institute, Inc. Long terminal repeat, enhancer, and insulator sequences for use in recombinant vectors
US20030166042A1 (en) * 2000-02-11 2003-09-04 Millennium Pharmaceuticals, Inc. Novel seven-transmembrane proteins/G-protein coupled receptors
US6586205B1 (en) * 2000-02-11 2003-07-01 Millennium Pharmaceuticals, Inc. 43239 a novel GPCR-like molecule and uses thereof
AU9006701A (en) 2000-09-20 2002-04-02 Cobra Therapeutics Ltd Polynucleotide
EP1806407B1 (en) * 2001-07-04 2010-05-05 Chromagenics B.V. DNA sequences having anti-repressor activity
EP1273666A1 (en) 2001-07-04 2003-01-08 Chromagenics B.V. Method of selecting a DNA sequence with transcription modulating activity using a vector comprising an element with a gene transcription repressing activity
EP1513936A2 (en) * 2002-06-14 2005-03-16 Chromagenics B.V. Use of repression blocking sequences in methods for enhancing gene expression
DK1513937T3 (da) 2002-06-14 2011-05-16 Chromagenics Bv Fremgangsmåde til den samtidige produktion af multiple proteiner; vektorer og celler til anvendelse derved
CA2510179C (en) 2002-12-18 2013-04-23 Chromagenics B.V. A method for improving protein production
ATE354645T1 (de) 2002-12-20 2007-03-15 Chromagenics Bv Mittel und methoden zur produktion eines proteins durch chromatin-öffner, die chromatin zugänglicher für transkriptionsfaktoren machen können
US7384878B2 (en) * 2004-05-20 2008-06-10 International Business Machines Corporation Method for applying a layer to a hydrophobic surface

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
None *

Also Published As

Publication number Publication date
US7901908B2 (en) 2011-03-08
US20050191723A1 (en) 2005-09-01
WO2003106684A3 (en) 2004-04-08
ES2362273T3 (es) 2011-06-30
US7960143B2 (en) 2011-06-14
JP5095693B2 (ja) 2012-12-12
CA2723500A1 (en) 2003-12-24
JP5095690B2 (ja) 2012-12-12
US20080227199A1 (en) 2008-09-18
US7364878B2 (en) 2008-04-29
JP2010004886A (ja) 2010-01-14
CA2722998A1 (en) 2003-12-24
CA2722998C (en) 2014-12-02
US20080227151A1 (en) 2008-09-18
NZ537073A (en) 2006-08-31
WO2003106684A2 (en) 2003-12-24
AU2003238719A1 (en) 2003-12-31
CA2489475C (en) 2011-03-29
JP2010011859A (ja) 2010-01-21
CA2723500C (en) 2014-10-28
ATE500331T1 (de) 2011-03-15
DE60336228D1 (de) 2011-04-14
EP1513937A2 (en) 2005-03-16
JP2005529610A (ja) 2005-10-06
JP4647309B2 (ja) 2011-03-09
AU2003238719B2 (en) 2008-02-21
DK1513937T3 (da) 2011-05-16
CA2489475A1 (en) 2003-12-24

Similar Documents

Publication Publication Date Title
US7960143B2 (en) Method for simultaneous production of multiple proteins; vectors and cells for use therein
US7794977B2 (en) Means and methods for regulating gene expression
AU2002314629B2 (en) Method of selecting DNA sequence with transcription modulating activity using a vector comprising an element with a gene transcription repressing activity
EP1572994B1 (en) Means and methods for producing a protein through chromatin openers that are capable of rendering chromatin more accessible to transcription factors
CA2812821C (en) Dna sequences comprising gene transcription regulatory qualities and methods for detecting and using such dna sequences
AU2011218621B2 (en) A method for simultaneous production of multiple proteins; vectors and cells for use therein
AU2008202251B2 (en) A method for simultaneous production of multiple proteins; vectors and cells for use therein
Class et al. Patent application title: Method for simultaneous production of multiple proteins; vectors and cells for use therein Inventors: Arie Pieter Otte (Amersfoort, NL) Arie Pieter Otte (Amersfoort, NL) Arthur Leo Kruckeberg (Shoreline, WA, US) Richard George Antonius Bernardus Sewalt (Arnhem, NL) Assignees: Crucell Holland BV
HK1076837A (en) Dna sequences having anti-repressor activity

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20041202

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK

REG Reference to a national code

Ref country code: HK

Ref legal event code: DE

Ref document number: 1070096

Country of ref document: HK

17Q First examination report despatched

Effective date: 20071018

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

GRAS Grant fee paid

Free format text: ORIGINAL CODE: EPIDOSNIGR3

GRAA (expected) grant

Free format text: ORIGINAL CODE: 0009210

REG Reference to a national code

Ref country code: HK

Ref legal event code: WD

Ref document number: 1070096

Country of ref document: HK

AK Designated contracting states

Kind code of ref document: B1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK

REG Reference to a national code

Ref country code: GB

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: CH

Ref legal event code: EP

REG Reference to a national code

Ref country code: IE

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: CH

Ref legal event code: NV

Representative=s name: BOVARD AG

REF Corresponds to:

Ref document number: 60336228

Country of ref document: DE

Date of ref document: 20110414

Kind code of ref document: P

REG Reference to a national code

Ref country code: DE

Ref legal event code: R096

Ref document number: 60336228

Country of ref document: DE

Effective date: 20110414

REG Reference to a national code

Ref country code: NL

Ref legal event code: T3

REG Reference to a national code

Ref country code: DK

Ref legal event code: T3

REG Reference to a national code

Ref country code: SE

Ref legal event code: TRGR

REG Reference to a national code

Ref country code: ES

Ref legal event code: FG2A

Ref document number: 2362273

Country of ref document: ES

Kind code of ref document: T3

Effective date: 20110630

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: GR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20110603

LTIE Lt: invalidation of european patent or patent extension

Effective date: 20110302

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: SI

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20110302

Ref country code: FI

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20110302

Ref country code: BG

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20110602

Ref country code: CY

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20110302

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: PT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20110704

Ref country code: EE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20110302

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: RO

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20110302

Ref country code: CZ

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20110302

Ref country code: SK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20110302

PLBE No opposition filed within time limit

Free format text: ORIGINAL CODE: 0009261

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: NO OPPOSITION FILED WITHIN TIME LIMIT

26N No opposition filed

Effective date: 20111205

REG Reference to a national code

Ref country code: DE

Ref legal event code: R097

Ref document number: 60336228

Country of ref document: DE

Effective date: 20111205

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: MC

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20110630

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: LU

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20110613

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: TR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20110302

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: HU

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20110302

REG Reference to a national code

Ref country code: FR

Ref legal event code: PLFP

Year of fee payment: 14

REG Reference to a national code

Ref country code: FR

Ref legal event code: PLFP

Year of fee payment: 15

REG Reference to a national code

Ref country code: FR

Ref legal event code: PLFP

Year of fee payment: 16

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: FR

Payment date: 20210513

Year of fee payment: 19

Ref country code: DE

Payment date: 20210518

Year of fee payment: 19

Ref country code: IT

Payment date: 20210511

Year of fee payment: 19

Ref country code: NL

Payment date: 20210615

Year of fee payment: 19

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: SE

Payment date: 20210610

Year of fee payment: 19

Ref country code: IE

Payment date: 20210610

Year of fee payment: 19

Ref country code: AT

Payment date: 20210525

Year of fee payment: 19

Ref country code: BE

Payment date: 20210518

Year of fee payment: 19

Ref country code: DK

Payment date: 20210610

Year of fee payment: 19

Ref country code: CH

Payment date: 20210616

Year of fee payment: 19

Ref country code: GB

Payment date: 20210520

Year of fee payment: 19

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: ES

Payment date: 20210707

Year of fee payment: 19

REG Reference to a national code

Ref country code: DE

Ref legal event code: R119

Ref document number: 60336228

Country of ref document: DE

REG Reference to a national code

Ref country code: DK

Ref legal event code: EBP

Effective date: 20220630

REG Reference to a national code

Ref country code: CH

Ref legal event code: PL

Ref country code: SE

Ref legal event code: EUG

REG Reference to a national code

Ref country code: NL

Ref legal event code: MM

Effective date: 20220701

REG Reference to a national code

Ref country code: AT

Ref legal event code: MM01

Ref document number: 500331

Country of ref document: AT

Kind code of ref document: T

Effective date: 20220613

REG Reference to a national code

Ref country code: BE

Ref legal event code: MM

Effective date: 20220630

GBPC Gb: european patent ceased through non-payment of renewal fee

Effective date: 20220613

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: NL

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20220701

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: SE

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20220614

Ref country code: LI

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20220630

Ref country code: IE

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20220613

Ref country code: FR

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20220630

Ref country code: CH

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20220630

Ref country code: AT

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20220613

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: GB

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20220613

Ref country code: DE

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20230103

Ref country code: BE

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20220630

REG Reference to a national code

Ref country code: ES

Ref legal event code: FD2A

Effective date: 20230728

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: IT

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20220613

Ref country code: DK

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20220630

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: ES

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20220614