EP1373524B1 - Fragmente der intron a von citomegalovirus - Google Patents

Fragmente der intron a von citomegalovirus Download PDF

Info

Publication number
EP1373524B1
EP1373524B1 EP01979785A EP01979785A EP1373524B1 EP 1373524 B1 EP1373524 B1 EP 1373524B1 EP 01979785 A EP01979785 A EP 01979785A EP 01979785 A EP01979785 A EP 01979785A EP 1373524 B1 EP1373524 B1 EP 1373524B1
Authority
EP
European Patent Office
Prior art keywords
sequence
intron
nucleotides
fragment
hcmv
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
EP01979785A
Other languages
English (en)
French (fr)
Other versions
EP1373524A2 (de
Inventor
Kent Thudium
Mark Selby
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novartis Vaccines and Diagnostics Inc
Original Assignee
Chiron Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Chiron Corp filed Critical Chiron Corp
Publication of EP1373524A2 publication Critical patent/EP1373524A2/de
Application granted granted Critical
Publication of EP1373524B1 publication Critical patent/EP1373524B1/de
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67—General methods for enhancing the expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16611—Simplexvirus, e.g. human herpesvirus 1, 2
    • C12N2710/16622—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/42—Vector systems having a special element relevant for transcription being an intron or intervening sequence for splicing and/or stability of RNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/60—Vector systems having a special element relevant for transcription from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00—Vectors comprising a special translation-regulating system
    • C12N2840/44—Vectors comprising a special translation-regulating system being a specific part of the splice mechanism, e.g. donor, acceptor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00—Vectors comprising a special translation-regulating system
    • C12N2840/44—Vectors comprising a special translation-regulating system being a specific part of the splice mechanism, e.g. donor, acceptor
    • C12N2840/445—Vectors comprising a special translation-regulating system being a specific part of the splice mechanism, e.g. donor, acceptor for trans-splicing, e.g. polypyrimidine tract, branch point splicing

Definitions

  • the present invention relates generally to recombinant gene expression systems. More particularly, the invention relates to novel cytomegalovirus (CMV) Intron A fragments for use in expression constructs for expressing gene products, and methods of using the same.
  • CMV cytomegalovirus
  • Proteins are conveniently produced in a variety of procaryotic and eucaryotic recombinant expression systems.
  • Eschericia coli -derived plasmid DNA vectors are widely used to express proteins both in vitro and in vivo. In vitro, such vectors are used for purposes ranging from e.g., preliminary evaluation of the nature of protein expression to large-scale manufacture of recombinant proteins.
  • DNA vectors are used, for example, for gene therapy and nucleic acid vaccination.
  • effective vectors are those that express high levels of protein due to the use of efficient promoters and other control elements.
  • Other factors that may contribute to efficient transfection of cells include: (1) uptake of plasmid by cells; (2) escape of plasmid from endocytic vesicles after endocytosis; (3) translocation of the plasmid from the cytoplasm into the nucleus; and (4) transcription of the plasmid in the nucleus.
  • a major barrier to efficient transfection is translocation of the plasmid into the nucleus, particularly in cells that do not undergo mitosis (e.g., myocytes).
  • One parameter that may affect this step is the size of the plasmid, as the nuclear pore complex involved in uptake of macromolecules into the nucleus has a finite size.
  • the latter point is particularly important for preparation of certain recombinant viral vectors that have a limited capacity to package plasmids, such as alphavirus and adeno-associated vectors.
  • hCMV human cytomegalovirus
  • IE1 immediate-early immediate-early
  • the hCMV IE1 enhancer/promoter is one of the strongest enhancer/promoters known and is active in a broad range of cell types.
  • the hCMV IE 1 enhancer/promoter region ( Figure 2) includes a tissue-specific modulator, multiple potential binding sites for several different transcription factors, and a complex enhancer.
  • the transcribed region of the gene contains four exons and three introns. The largest of the introns, termed "Intron A,” is found within the 5'-untranslated region of the gene. See, e.g., Chapman et al., Nuc. Acids Res. (1991) 19:3979-3986 for the sequence and structure of this region in hCMV strain Towne, and Akrigg et al., Virus Res. (1985) 2:107-121, for a description of the corresponding region in hCMV strain AD169.
  • the Intron A region of the hCMV IE1 enhancer/promoter has been shown to contain elements that enhance expression of heterologous proteins in mammalian cells. See, e.g., Chapman et al., Nuc. Acids Res. (1991) 19: 3979-3986.
  • Introns are non-coding regions present in most pre-mRNA transcripts produced in the mammalian cell nucleus. Intron sequences can profoundly enhance gene expression when included in heterologous expression vectors. See, e.g., Buchman et al., Molec. Cell. Biol. (1988) 8 :4395-4405; Chapman et al., Nuc. Acids Res. (1991) 19 :3979-3986. Recent studies have demonstrated a connection between pre-mRNA splicing and export from the nucleus of mature mRNAs to the cytoplasm. Cullen, B.R., Proc. Natl. Acad. Sci. USA (2000) 97 :4-6; and Luo et al., Proc.
  • the present invention provides CMV Intron A fragments for use in expression constructs.
  • the fragments retain the ability to enhance expression levels when present in such expression constructs.
  • the use of Intron A fragments is desirable, especially when used in recombinant viral vectors with size constraints for packaging plasmids, such as alphavirus and adeno-associated vectors.
  • the present invention provides a highly efficient expression system for the production of recombinant proteins in therapeutically useful quantities, both in vitro and in vivo.
  • the subject invention is directed to an hCMV Intron A fragment, wherein the fragment lacks a full-length Intron A sequence and comprises: (a) a sequence of nucleotides having at least about 75% sequence identity to the contiguous sequence of nucleotides found at positions 1-25, inclusive, of Figure 1A, and (b) a sequence of nucleotides having at least about 75% sequence identity to the contiguous sequence of nucleotides found at positions 775-820, inclusive, of Figure 1A.
  • the expression construct achieves expression levels greater than those levels achieved by a corresponding construct that completely lacks an Intron A sequence.
  • the expression levels achieved are at least two-fold, or at least ten-fold, or at least fifty-fold greater than those levels achieved by a corresponding construct that completely lacks an Intron A sequence.
  • the invention is directed to an Intron A fragment that comprises: (a) a sequence of nucleotides having at least about 75% sequence identity to the contiguous sequence of nucleotides found at positions 1-51, inclusive, of Figure 1A, and (b) a sequence of nucleotides having at least about 75% sequence identity to the contiguous sequence of nucleotides found at positions 741-820, inclusive, of Figure 1A, wherein when the fragment is present in an expression construct, the expression construct achieves expression levels greater than those levels achieved by a corresponding construct that completely lacks an Intron A sequence. In certain embodiments, the expression levels achieved are at least two-fold, or at least ten-fold, or at least fifty-fold greater than those levels achieved by a corresponding construct that completely lacks an Intron A sequence.
  • the Intron A fragment comprises the sequence of nucleotides 1-51, inclusive, of Figure 1A, linked to nucleotides 741-820, inclusive, of Figure 1A.
  • the Intron A fragment comprises the Intron A nucleotide sequence depicted in Figure 1C, or a nucleotide sequence with at least about 75% sequence identity thereto.
  • the Intron A fragment consists of the Intron nucleotide sequence depicted in Figure 1C.
  • the invention is directed to an hCMV Intron A fragment, wherein the fragment lacks a full-length Intron A sequence and comprises: (a) a sequence of nucleotides having at least about 75% sequence identity to the contiguous sequence of nucleotides found at positions 1-25, inclusive, of Figure 1 A, and (h) a sequence of nucleotides having at least about 75% sequence identity to the contiguous sequence of nucleotides found at positions 775-820, inclusive, of Figure 1 A. wherein when the fragment is present in an expression construct, the expression construct achieves expression levels equal to, or greater than, those levels achieved by an expression construct that includes a corresponding intact, full-length Intron A sequence.
  • the invention is directed to an hCMV Intron A fragment, wherein the fragment lacks a full-length Intron A sequence and comprises: (a) a sequence of nucleotides having at least about 75% sequence identity to the contiguous sequence of nucleotides found at positions 1-51, inclusive, of Figure 1A, and (b) a sequence of nucleotides having at least about 75% sequence identity to the contiguous sequence of nucleotides found at positions 741-820, inclusive, of Figure 1A, wherein when the fragment is present in an expression construct, the expression construct achieves expression levels equal to, or greater than, those levels achieved by an expression construct that includes a corresponding intact, full-length Intron A sequence.
  • the invention is directed to recombinant expression constructs comprising (a) a coding sequence; and (b) control elements that are operably linked to the coding sequence, wherein the control elements comprise the Intron A fragment described herein, whereby the coding sequence can be transcribed and translated in a host cell.
  • the control elements further comprise a promoter selected from the group consisting of an SV40 early promoter, a CMV promoter, a mouse mammary tumor virus LTR promoter, an adenovirus major late promoter, an RSV promoter, a SR ⁇ promoter, and a herpes simplex virus promoter.
  • control elements may comprise the hCMV immediate-early (IE1) enhancer/promoter region found at nucleotide positions 460 to 1264 of Figure 2, and Exon 2 of the 5'-UTR comprising the sequence of nucleotides depicted at positions 821-834, inclusive, of Figure 1A.
  • IE1 immediate-early
  • Host cells comprising the expression constructs and methods of producing a recombinant polypeptide are also provided.
  • the invention is directed to a polynucleotide comprising the sequence depicted in Figure 5B.
  • Intron A fragment is meant a fragment derived from an Intron A sequence of a CMV immediate-early enhancer/promoter region, which does not include the entire Intron A sequence.
  • a representative hCMV enhancer/promoter region is shown in Figure 2.
  • the intact Intron A sequence is represented by the lowercase nucleotides spanning positions 1265-2088 of Figure 2 and nucleotides 1-820 of Figure 1A.
  • the Intron A fragment of the present invention comprises a deletion from the full-length sequence, which deletion may be internal or occur at the 5'- and/or 3'-ends of the Intron A region, so long as the region still functions to permit authentic splicing in the nucleus of primary transcripts that include the Intron A fragment.
  • an "Intron A fragment” includes the minimum number of bases or elements necessary to achieve expression levels over those achieved in corresponding constructs that completely lack an Intron A sequence. More preferably, expression levels achieved by constructs that include the Intron A fragment of the invention are at least two-fold over those levels achieved without the presence of the Intron A region, preferably at least ten-fold greater, most preferably at least twenty- to fifty-fold greater, or more, than those levels achieved without the Intron A region. Preferably, expression levels are at least equal to, or greater than, for example at least two-fold greater than, those levels achieved when the intact, full-length Intron A sequence is present in a corresponding expression construct. Such comparisons are typically made by making expression constructs that include all elements of the test construct, but either completely lack the Intron A sequence, or include the full-length Intron A sequence (see the Examples herein).
  • an "Intron A fragment" of the present invention will generally include at least the 5' splice junction sequence (nucleotides 1-7 as shown in Figure 1A), usually at least up to the first 25 5'-nucleotides of the Intron A region (nucleotides 1-25 of Figure 1A), more preferably at least up to the first 30 nucleotides of the Intron A region (nucleotides 1-30 of Figure 1A), even more preferably at least up to the first 40 nucleotides of the Intron A region (nucleotides 1-40 of Figure 1A), more preferably at least up to the first 51 nucleotides of the Intron A region (nucleotides 1-51 of Figure 1A), and even up to the first 75 or more nucleotides of the Intron A region, and any integer between these values, or even more of the 5'-region of Intron A.
  • an "Intron A fragment” will optionally include at least the 3' splice junction sequence (nucleotides 815-820 of Figure 1A).
  • the Intron A fragment will include at least up to the 25 3'-nucleotides of the Intron A sequence shown in Figure 1A (nucleotides 796-820 of Figure 1A), preferably up to the 50 3'-nucleotides of the sequence shown in Figure 1A (nucleotides 771-820 of Figure 1A), more generally up to the 70 3'-nucleotides (nucleotides 751-820 of Figure 1A), preferably at least up to the 80 3'-nucleotides (nucleotides 741-820 of Figure 1A), or even more of the 3'-region, such as the 100-150 3'-nucleotides, and any integer between these values, or more of the 3'-region of Intron A
  • an Intron A fragment according to the present invention may include a variety of internal deletions, such as about 10 to about 750 or more nucleotides of the Intron A sequence, preferably about 25 to about 700 or more nucleotides, more preferably about 50 to about 700 nucleotides, and most preferably about 500 to about 680-690 or more nucleotides, or any integer between the above ranges, so long as an expression construct including the Intron A fragment either enhances expression relative to a corresponding construct completely lacking an Intron A sequence, or provides equivalent or enhanced expression relative to a corresponding construct which includes the entire Intron A sequence, as described above.
  • the retained 5'- and 3'-regions of the Intron A fragment of the present invention may be directly linked to one another, e.g., as shown in Figure 1A, or the 5'-and 3'-regions of the Intron A fragment may be linked together via a linker sequence.
  • the linker sequence may comprise from 1 up to about 400 or more nucleotides, or any integer between these values, and may comprise regions for particular transcript factors, such as NF1 binding sites, tissue-specific enhancer sequences, such as muscle-specific enhancers, and the like.
  • One representative Intron A fragment sequence comprises the sequence of nucleotides at positions 1-51 linked to nucleotides 741-820, of Figure 1A, thus comprising an internal deletion of nucleotides 52-740, as shown in Figure 1A. Also included in this construct is Exon 2 of the 5' UTR of the hCMV enhancer/promoter region, nucleotides 821-834 of Figure 1A.
  • an "Intron A fragment” as used herein, encompasses sequences with identity to an Intron A fragment isolated from any of the various hCMV strains, such as for example hCMV strain Towne and hCMV strain AD169, as well as polynucleotides that are substantially homologous to the reference molecule (as defined below) and which still function as described above.
  • the fragment shown in Figure 1C includes nucleotide substitutions at the branch points and in the polypyrimidine tract to conform these sequences to consensus sequences, as shown in Figures 1B and 1 C.
  • the branch points retain termination codons, i.e., TAA, TAG or TGA.
  • portions of the molecule outside of the splice donor and splice acceptor regions are more amenable to change.
  • the nucleotides found in these regions are preferably at least 80% homologous to the sequence of nucleotides present in the native sequence shown in Figure 1A, but may be less homologous as long as the Intron A fragment retains function, as defined above.
  • the polypyrimidine tract region is preferably one where substantially all of the bases are Ts or Cs.
  • polypeptide and protein refer to a polymer of amino acid residues and are not limited to a minimum length of the product. Thus, peptides, oligopeptides, dimers, multimers, and the like, are included within the definition. Both full-length proteins and fragments thereof are encompassed by the definition.
  • the terms also include postexpression modifications of the polypeptide, for example, glycosylation, acetylation, phosphorylation and the like.
  • the polypeptide expressed by the coding sequence may be one useful in a vaccine, therapeutic or diagnostic and may be derived from any of several known viruses, bacteria, parasites and fungi, as well as any of the various tumor antigens.
  • the expressed polypeptide may be a therapeutic hormone, a transcription or translation mediator, an enzyme, an intermediate in a metabolic pathway, an immunomodulator, and the like.
  • a "polypeptide” refers to a protein which includes modifications, such as deletions, additions and substitutions (generally conservative in nature), to the native sequence, so long as the protein maintains the desired activity. These modifications may be deliberate, as through site-directed mutagenesis, or may be serendipitous, such as through mutations of hosts which produce the proteins or errors due to PCR amplification.
  • a "coding sequence” or a sequence which "encodes" a selected polypeptide is a nucleic acid molecule which is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vitro or in vivo when placed under the control of appropriate regulatory sequences.
  • the boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus.
  • a coding sequence can include, but is not limited to, cDNA from viral, procaryotic or eucaryotic mRNA, genomic DNA sequences from viral (e.g. DNA viruses and retroviruses) or procaryotic DNA, and synthetic DNA sequences.
  • a transcription termination sequence may be located 3' to the coding sequence.
  • a "nucleic acid" molecule can include both double- and single-stranded sequences and refers to, but is not limited to, cDNA from viral, procaryotic or eucaryotic mRNA, genomic DNA sequences from viral (e.g. DNA viruses and retroviruses) or procaryotic DNA, and especially synthetic DNA sequences. The term also captures sequences that include any of the known base analogs of DNA and RNA.
  • “Operably linked” refers to an arrangement of elements wherein the components so described are configured so as to perform their desired function.
  • a given promoter operably linked to a coding sequence is capable of effecting the expression of the coding sequence when the proper transcription factors, etc., are present.
  • the promoter need not be contiguous with the coding sequence, so long as it functions to direct the expression thereof.
  • intervening untranslated yet transcribed sequences can be present between the promoter sequence and the coding sequence as can transcribed introns, and the promoter sequence can still be considered “operably linked" to the coding sequence.
  • Recombinant as used herein to describe a nucleic acid molecule means a polynucleotide of genomic, cDNA, viral, semisynthetic, or synthetic origin which, by virtue of its origin or manipulation is not associated with all or a portion of the polynucleotide with which it is associated in nature.
  • the term "recombinant” as used with respect to a protein or polypeptide means a polypeptide produced by expression of a recombinant polynucleotide.
  • the gene of interest is cloned and then expressed in transformed organisms, as described further below. The host organism expresses the foreign gene to produce the protein under expression conditions.
  • control element refers to a polynucleotide sequence which aids in the expression of a coding sequence to which it is linked.
  • the term includes promoters, transcription termination sequences, upstream regulatory domains, polyadenylation signals, untranslated regions, including 5'-UTRs (such as Exon 2 of the hCMV enhancer/promoter region 5'-UTR) and 3'-UTRs and when appropriate, leader sequences and enhancers, which collectively provide for the transcription and translation of a coding sequence in a host cell.
  • a “promoter” as used herein is a DNA regulatory region capable of binding RNA polymerase in a host cell and initiating transcription of a downstream (3' direction) coding sequence operably linked thereto.
  • a promoter sequence includes the minimum number of bases or elements necessary to initiate transcription of a gene of interest at levels detectable above background.
  • Within the promoter sequence is a transcription initiation site, as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.
  • Eucaryotic promoters will often, but not always, contain "TATAA” boxes and "CAAT” boxes.
  • a control sequence "directs the transcription" of a coding sequence in a cell when RNA polymerase will bind the promoter sequence and transcribe the coding sequence into mRNA, which is then translated into the polypeptide encoded by the coding sequence.
  • a "host cell” is a cell which has been transformed, or is capable of transformation, by an exogenous DNA sequence
  • a "heterologous" region of a DNA construct is an identifiable segment of DNA within or attached to another DNA molecule that is not found in association with the other molecule in nature.
  • a sequence encoding a human protein other than the immediate-early 72,000 molecular weight protein of hCMV is considered a heterologous sequence when linked to an hCMV IE1 enhancer/promoter.
  • a sequence encoding the immediate-early 72,000 molecular weight protein of hCMV will be considered heterologous when linked to an hCMV promoter with which it is not normally associated.
  • heterologous coding sequence is a construct where the coding sequence itself is not found in nature (e.g., synthetic sequences having codons different from the native gene). Allelic variation or naturally occurring mutational events do not give rise to a heterologous region of DNA, as used herein.
  • selectable marker is meant a gene which confers a phenotype on a cell expressing the marker, such that the cell can be identified under appropriate conditions.
  • a selectable marker allows selection of transected cells based on their ability to thrive in the presence or absence of a chemical or other agent that inhibits an essential cell function. Suitable markers, therefore, include genes coding for proteins which confer drug resistance or sensitivity thereto, impart color to, or change the antigenic characteristics of those cells transfected with a nucleic acid element containing the selectable marker when the cells are grown in an appropriate selective medium.
  • selectable markers include: cytotoxic markers and drug resistance markers, whereby cells are selected by their ability to grow on media containing one or more of the cytotoxins or drugs; auxotrophic markers by which cells are selected by their ability to grow on defined media with or without particular nutrients or supplements, such as thymidine and hypoxanthine; metabolic markers by which cells are selected for, e.g., their ability to grow on defined media containing the appropriate sugar as the sole carbon source, or markers which confer the ability of cells to form colored colonies on chromogenic substrates or cause cells to fluoresce. Representative selectable markers are described in more detail below.
  • “Expression cassette” or “expression construct” refers to an assembly which is capable of directing the expression of the sequence(s) or gene(s) of interest.
  • the expression cassette includes control elements, as described above, such as a promoter or promoter/enhancer (such as the hCMV IE1 enhancer/promoter) which is operably linked to (so as to direct transcription of) the sequence(s) or gene(s) of interest, and often includes a polyadenylation sequence as well.
  • An expression cassette will also include an Intron A fragment as defined above and, optionally, Exon 2 of the hCMV IE1 enhancer/promoter region.
  • the expression cassette described herein may be contained within a plasmid construct.
  • the plasmid construct may also include, one or more selectable markers, a signal which allows the plasmid construct to exist as single-stranded DNA (e.g., a M13 origin of replication), at least one multiple cloning site, and a "mammalian" origin of replication (e.g., a SV40 or adenovirus origin of replication).
  • a signal which allows the plasmid construct to exist as single-stranded DNA e.g., a M13 origin of replication
  • at least one multiple cloning site e.g., a SV40 or adenovirus origin of replication
  • Transformation refers to the insertion of an exogenous polynucleotide into a host cell, irrespective of the method used for insertion: for example, transformation by direct uptake, transfection, infection, and the like. For particular methods of transfection, see further below.
  • the exogenous polynucleotide may be maintained as a nonintegrated vector, for example, an episome, or alternatively, may be integrated into the host genome.
  • isolated is meant, when referring to a polypeptide, that the indicated molecule is separate and discrete from the whole organism with which the molecule is found in nature or is present in the substantial absence of other biological macromolecules of the same type.
  • isolated with respect to a polynucleotide is a nucleic acid molecule devoid, in whole or part, of sequences normally associated with it in nature; or a sequence, as it exists in nature, but having heterologous sequences in association therewith; or a molecule disassociated from the chromosome.
  • “Homology” refers to the percent identity between two polynucleotide or two polypeptide moieties.
  • Two DNA, or two polypeptide sequences are "substantially homologous" to each other when the sequences exhibit at least about 50% , preferably at least about 75%, more preferably at least about 80%-85% (80, 81, 82, 83, 84, 85%), preferably at least about 90%, and most preferably at least about 95%-98% (95, 96, 97, 98%), or more, or any integer within the range of 50% to 100%, sequence identity over a defined length of the molecules.
  • substantially homologous also refers to sequences showing complete identity to the specified DNA or polypeptide sequence.
  • identity refers to an exact nucleotide-to-nucleotide or amino acid-to-amino acid correspondence of two polynucleotides or polypeptide sequences, respectively. Percent identity can be determined by a direct comparison of the sequence information between two molecules by aligning the sequences, counting the exact number of matches between the two aligned sequences, dividing by the length of the shorter sequence, and multiplying the result by 100. Readily available computer programs can be used to aid in the analysis, such as ALIGN, Dayhoff, M.O. in Atlas of Protein Sequence and Structure M.O. Dayhoff ed., 5 Suppl.
  • nucleotide sequence identity is available in the Wisconsin Sequence Analysis Package, Version 8 (available from Genetics Computer Group, Madison, WI) for example, the BESTFIT, FASTA and GAP programs, which also rely on the Smith and Waterman algorithm. These programs are readily utilized with the default parameters recommended by the manufacturer and described in the Wisconsin Sequence Analysis Package referred to above. For example, percent identity of a particular nucleotide sequence to a reference sequence can be determined using the homology algorithm of Smith and Waterman with a default scoring table and a gap penalty of six nucleotide positions.
  • Another method of establishing percent identity in the context of the present invention is to use the MPSRCH package of programs copyrighted by the University of Edinburgh, developed by John F. Collins and Shane S. Sturrok, and distributed by IntelliGenetics, Inc. (Mountain View, CA). From this suite of packages the Smith-Waterman algorithm can be employed where default parameters are used for the scoring table (for example, gap open penalty of 12, gap extension penalty of one, and a gap of six). From the data generated the "Match" value reflects "sequence identity.”
  • Other suitable programs for calculating the percent identity or similarity between sequences are generally known in the art, for example, another alignment program is BLAST, used with default parameters.
  • homology can be determined by hybridization of polynucleotides under conditions which form stable duplexes between homologous regions, followed by digestion with single-stranded-specific nuclease(s), and size determination of the digested fragments.
  • DNA sequences that are substantially homologous can be identified in a Southern hybridization experiment under, for example, stringent conditions, as defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art. See, e.g., Sambrook et al., supra; DNA Cloning, supra; Nucleic Acid Hybridization, supra.
  • the present invention is based on the discovery of novel hCMV Intron A fragments which are able to enhance expression of a downstream (3') sequence relative to expression levels achieved in the absence of an Intron A sequence, or at least provide for equivalent expression levels as those obtained using the intact, full-length Intron A sequence.
  • the hCMV IE1 enhancer/promoter from which the Intron A sequence is derived is one of the strongest enhancer/promoters known and is active in a broad range of cell types. See, e.g., Chapman et al., Nuc. Acids Res. (1991) 19 :3979-3986; and U.S. Patent No. 5,688,688.
  • the use of active fragments from this region effectively reduces the overall plasmid size for expression of a particular coding sequence. This is particularly desirable when large coding sequences, and/or viral vectors with limited ability to package large genes, are used. Moreover, the decrease in overall size of the constructs effectively enhances efficiency of expression.
  • the Intron A fragments of the present invention surprisingly retain the ability to result in expression of protein at high levels in vitro and in vivo and, in some cases, provide for higher expression than vectors using the entire hCMV 1E1 Intron A sequence. As shown in the examples, these high levels of expression have provided for immune responses that are comparable to, or even better than, that induced by the parent vector.
  • the Intron A fragments for use herein will retain at least up to the initial 7 nucleotides of the Intron A region, preferably at least up to the initial 25 nucleotides of the Intron A region (see, Figure 1A for a representative Intron A sequence).
  • the Intron A fragment of the present invention will retain at least up to the first 30 nucleotides of the Intron A region (nucleotides 1-30 of Figure 1A), generally at least up to the first 40 nucleotides of the Intron A region (nucleotides 1-40 of Figure 1A), more preferably at least up to the first 51 nucleotides of the Intron A region (nucleotides 1-51 of Figure 1A), and even up to the first 75 or more nucleotides of the Intron A region.
  • the 5'-region may include 25, 26, 27, 28, 29, 30...50, 51, 52, 53, 54, 55...70, 71, 72, 73, 74, 75...85, 86, 87 or more of the 5'-nucleotides, and so on. It is evident that any number of nucleotides specified above, as well as nucleotides falling within the specified numbers, are intended to be encompassed herein, so long as an expression construct containing the Intron A fragment functions as defined above.
  • the Intron A fragment will optionally also include a sufficient amount of the 3'-region of Intron A to function as described herein.
  • the Intron A fragment will include at least the 3' splice junction sequence (nucleotides 815-820 of Figure 1A), preferably, at least up to the 25 3'-nucleotides of the Intron A sequence shown in Figure 1A (nucleotides 796-820 of Figure 1A), preferably up to the 50 3'-nucleotides of the sequence shown in Figure 1A (nucleotides 771-820 of Figure 1A), more generally up to the 70 3'-nucleotides (nucleotides 751-820 of Figure 1A), preferably at least up to the 80 3'-nucleotides (nucleotides 741-820 of Figure 1A), or even more of the 3'-region, such as the 100-150 3'-nucleotides, and any integer between these values, or more of the 3'
  • the 3'-portion of the Intron A fragment may include 50, 51, 52, 53, 54, 55...70,71,72, 73, 74, 75...85, 86, 87...90, 92, 93, 94, 95, 96....110, 111, 112, and so on, or more of the 3'-nucleotides of the Intron A region. It is evident that any number of nucleotides specified above, as well as nucleotides falling within the specified numbers, are intended to be encompassed herein.
  • the 5'- and 3'-retained regions of the Intron A fragment of the present invention may be directly linked to one another, e.g., there may be an internal deletion of the Intron A sequence.
  • This deletion may comprise, for example, 10-750 or more base pairs of the intact Intron A region, preferably about 300-700 base pairs, and most preferably about 500-700 base pairs.
  • one preferable fragment includes a large internal deletion of about 688 base pairs.
  • This fragment therefore includes the sequence of nucleotides at positions 1-51 directly linked to nucleotides 741-S34, of Figure 1A, thus comprising an internal deletion of nucleotides 52-740 of Intron A, as shown in Figure 1A.
  • Nucleotides 821-834 of Figure 1A represent Exon 2 of the 5'-UTR.
  • Figure 3 shows various Intron A fragment constructs with Intron A deletions ranging from 55 to 661 base pairs.
  • the 5'- and 3'-regions of the Intron A fragment may be linked together via a linker sequence.
  • the linker sequence may comprise from 1 up to about 400 or more nucleotides, preferably from 10-100 nucleotides, or any integer between these values, and may comprise regions for enhancers, particular transcript factors, such as NF1 binding sites, and the like.
  • the Intron A fragment of the present invention can be isolated from a CMV genomic library. as well as from plasmids containing the Intron A region, using an appropriate prffobe and cloned for future use.
  • the sequence can be produced syntlietically, using known methods of polynucleotide synthesis (see, e.g. Edge, M.D., Nature (1981) 292 :756; Nambair, et al. Science (1984) 223 :1299; Jay, Ernest, J. Biol. Chem. (1984) 259 :6311), based on the known Intron A sequence. See, e.g., Chapman et al., Nuc. Acids Res.
  • One particularly convenient method for obtaining the Intron A fragment of the present invention is to isolate Intron A (either alone, or in association with the rest of the hCMV enhancer/promoter region) from any of the various plasmids known to contain the same, using techniques well known in the art, as well as described in the examples herein.
  • hCMV Intron A can be obtained from plasmid pCMV6, as described in Chapman et al., Nuc. Acids Res. (1991) 19 :3979-3986 and U.S. Patent No. 5,688,688.
  • the Intron A sequence can be manipulated to obtain deletion mutants thereof, such as by excising portions of the Intron A sequence using restriction enzymes.
  • Site specific DNA cleavage is performed by treatment with a suitable restriction enzyme (or enzymes), under conditions which are generally understood in the art, and the particulars of which are specified by the manufacturer of these commercially available enzymes. See, e.g., New England Biolabs, Product Catalog.
  • restriction endonucleases with various specificities have been isolated from a wide range of prokaryotes and are well known in the art. See, e.g., Sambrook et al., supra. The choice of an appropriate restriction endonuclease depends on the particular sequence targeted. One of skill in the art will readily recognize the proper restriction enzyme to use for a desired sequence.
  • size separation of the cleaved fragments may be performed by polyacrylamide gel or agarose gel electrophoresis, using standard techniques. A general description of size separations is found in, e.g., Sambrook et al., supra.
  • the Intron A sequence can then be ligated to other control sequences such as an appropriate promoter (if the Intron A is isolated without the remaining hCMV IE1 enhancer/promoter region), and the desired coding sequence, using known techniques.
  • the sequence of the Intron A fragment can be optimized for use in particular expression systems using techniques well known in the art. Additionally, portions of the sequence of the fragment may be changed, e.g., by deleting or substituting possible branch points, as well as other regions of the molecule. These regions of a representative Intron A are shown in Figure 1A.
  • One particular optimized sequence of the Intron A fragment is shown in Figure 1C. As explained in the examples, this fragment was obtained by first deleting most of the 3'-sequence of the Intron A region and then substituting, by means of a synthetic oligonucleotide, the last 80 nucleotides of the Intron A region with an optimized sequence, and including Exon 2 of the 5'-UTR region.
  • the optimized sequence was based on published branch point and polypyrimidine track consensus sequences.
  • mutagenized sequences can be obtained by techniques well known in the art, such as site-directed mutagenesis and polymerase chain reaction (PCR) techniques where appropriate. See, e.g., Sambrook, supra.
  • the fragment can be used to direct the transcription of a desired protein in a wide variety of cell types.
  • Cis-acting control elements can be conveniently associated with the Intron A fragment in order to optimize expression of the coding sequence associated therewith. If proteins produced in the system are either naturally secreted or engineered to be, the transformed cells may produce the protein product for protracted time periods, further increasing yields.
  • the system allows for the production of a desired protein in an authentic configuration, with authentic post-translation modifications, in a relatively pure form and in economically useful amounts.
  • the Intron A fragments of the present invention will find use in expression constructs to express a wide variety of substances, including peptides which act as antibiotics and antiviral agents, e.g., immunogenic peptides for use in vaccines and diagnostics; recombinant antibodies; antineoplastics; immunomodulators, such as any of the various cytokines including interleukin-1, interleukin-2, interleukin-3, interleukin-4, and gamma-interferon; peptide hormones such as insulin, proinsulin, growth hormone, GHRH, LHRH, EGF, somatostatin, SNX-111, BNP, insulinotropin, ANP, FSH, LH, PSH and hCG, gonadal steroid hormones (androgens, estrogens and progesterone), thyroid-stimulating hormone, inhibin, cholecystokinin, ACTH, CRF, dynorphins, endorphins, endothel
  • proteins for use in vaccines and diagnostics may be of viral, bacterial, fungal or parasitic origin, including but not limited to, those encoded by human and animal viruses and can correspond to either structural or non-structural proteins.
  • the present system will find use for recombinantly producing a wide variety of proteins from the herpesvirus family, including proteins derived from herpes simplex virus (HSV) types 1 and 2, such as HSV-1 and HSV-2 glycoproteins gB, gD and gH; proteins derived from varicella zoster virus (VZV), Epstein-Barr virus (EBV) and cytomegalovirus (CMV) including CMV gB and gH; and proteins derived from other human herpesviruses such as HHV6 and HHV7.
  • HSV herpes simplex virus
  • VZV varicella zoster virus
  • EBV Epstein-Barr virus
  • CMV cytomegalovirus
  • Polynucleotide sequences encoding proteins from the hepatitis family of viruses can also be conveniently used in the techniques described herein.
  • HCV hepatitis A virus
  • HCV hepatitis B virus
  • HCV hepatitis C virus
  • HDV delta hepatitis virus
  • HEV hepatitis E virus
  • HGV hepatitis G virus
  • the viral genomic sequence of HCV is known, as are methods for obtaining the sequence. See, e.g., International Publication Nos. WO 89/04669; WO 90/11089; and WO 90/14436.
  • the HCV genome encodes several viral proteins, including E1 (also known as E) and E2 (also known as E2/NSI).
  • E1 also known as E
  • E2 also known as E2/NSI
  • the sequences encoding each of these proteins, as well as antigenic fragments thereof, will find use in the present system.
  • the coding sequence for the ⁇ -antigen from HDV is known (see, e.g., U.S. Patent No. 5,378,814) and this sequence can also be conveniently used in the present system.
  • antigens derived from HBV such as the core antigen, the surface antigen, sAg, as well as the presurface sequences, preS1 and preS2 (formerly called preS), as well as combinations of the above, such as sAg/preS1, sAg/preS2, sAg/preS1/preS2, and preS1/preS2, will find use herein. See, e.g., "HBV Vaccines - from the laboratory to license:a case study" in Mackett, M. and Williamson, J.D., Human Vaccines and Vaccination, pp. 159-176, for a discussion of HBV structure; Beames et al., J.
  • Polynucleotide sequences encoding proteins derived from other viruses will also find use in the expression systems, such as without limitation, proteins from members of the families Picomaviridae (e.g., polioviruses, etc.); Caliciviridae; Togaviridae (e.g., rubella virus, dengue virus, etc.); Flaviviridae; Coronaviridae; Reoviridae; Birnaviridae; Rhabodoviridae (e.g., rabies virus, etc.); Filoviridae; Paramyxoviridae (e.g., mumps virus, measles virus, respiratory syncytial virus, etc.); Orthomyxoviridae (e.g., influenza virus types A, B and C, etc.); Bunyaviridae; Arenaviridae; Retroviradae (e.g., HTLV-I; HTLV-II; HIV-1 (also known as HTLV-III, LAV,
  • the invention may be used in expression constructs to express genes encoding the gp 120 envelope protein from any of the above HIV isolates.
  • the gp120 sequences for a multitude of HN-1 and HIV-2 isolates, including members of the various genetic subtypes of HIV, are known and reported (see, e.g., Myers et al., Los Alamos Database, Los Alamos National Laboratory, Los Alamos, New Mexico (1992); Myers et al., Human Retroviruses and Aids, 1990, Los Alamos, New Mexico: Los Alamos National Laboratory; and Modrow et al., J. Virol.
  • the invention is equally applicable to other immunogenic proteins derived from any of the various HIV isolates, including any of the various envelope proteins such as gp160 and gp41, gag antigens such as p24gag and p55gag, as well as proteins derived from the pol region.
  • the present invention will also find use in expression constructs for the expression of influenza virus proteins. Specifically, the envelope glycoproteins HA and NA of influenza A are of particular interest for generating an immune response.
  • the fragments described herein provide a means for producing proteins useful for treating a variety of malignant cancers.
  • the system of the present invention can be used to produce a variety of tumor antigens which in turn may be used to mount both humoral and cell-mediated immune responses to particular proteins specific to the cancer in question, such as an activated oncogene, a fetal antigen, or an activation marker.
  • tumor antigens include any of the various MAGEs (melanoma associated antigen E), including MAGE 1, 2, 3, 4, etc. (Boon, T.
  • MART 1 melanoma antigen recognized by T cells
  • mutant ras mutant ras
  • mutant p53 mutant p97 melanoma antigen
  • CEA carcinoembryonic antigen
  • the subject invention can be used to produce a variety of proteins useful for the prevention, treatment and/or diagnosis of a wide variety of diseases.
  • Polynucleotide sequences coding for the above-described molecules can be obtained using recombinant methods, such as by screening cDNA and genomic libraries from cells expressing the gene, or by deriving the gene from a vector known to include the same. Furthermore, the desired gene can be isolated directly from cells and tissues containing the same, using standard techniques, such as phenol extraction and PCR of cDNA or genomic DNA. See, e.g., Sambrook et al., supra, for a description of techniques used to obtain and isolate DNA. The gene of interest can also be produced synthetically, rather than cloned. The nucleotide sequence can be designed with the appropriate codons for the particular amino acid sequence desired.
  • the complete sequence may be assembled from overlapping oligonucleotides prepared by standard methods and assembled into a complete coding sequence. See, e.g., Edge, Nature (1981) 292 :756; Nambair et al., Science (1984) 223 : 1299; Jay et al., J. Biol. Chem. (1984) 259 :6311.
  • Markers and amplifiers can also be employed in the subject expression systems.
  • markers are known which are useful in selecting for transformed cell lines and generally comprise a gene whose expression confers a selectable phenotype on transformed cells when the cells are grown in an appropriate selective medium.
  • markers for mammalian cell lines include, for example, the bacterial xanthine-guanine phosporibosyl transferase gene, which can be selected for in medium containing mycophenolic acid and xanthine (Mulligan et al. (1981) Proc. Natl. Acad. Sci.
  • aminoglycoside phosphotransferase gene (specifying a protein that inactivates the antibacterial action of neomycin/kanamycin derivatives), which can be selected for using medium containing neomycin derivatives such as G418 which are normally toxic to mammalian cells (Colbere-Garapin et al. (1981) J. Mol. Biol. 150 :1-14).
  • Useful markers for other expression systems are well known to those of skill in the art. These and other selectable markers can be obtained from commercially available plasmids, using techniques well known in the art. See, e.g., Sambrook et al., supra.
  • Expression can also be amplified by placing an amplifiable gene, such as the mouse dihydrofolate reductase (dhfr) gene adjacent to the coding sequence. Cells can then be selected for methotrexate resistance in dhfr-deficient cells. See, e.g. Urlaub et al. (1980) Proc. Natl. Acad. Sci. USA 77 :4216-4220; Ringold et al. (1981) J. Mol. and Appl. Genet. 1 :165-175. Constructs which include both markers and amplifiers will also find use in the subject expression vectors, such as any of the various EMCV-DHFR/Neo constructs described in, e.g., U.S. Patent No. 6,096,505.
  • dhfr mouse dihydrofolate reductase
  • Transcription termination and polyadenylation sequences may also be present, located 3' to the translation stop codon for the coding sequence.
  • transcription terminator/polyadenylation signals include, but are not limited to, those derived from SV40, as described in Sambrook et al., supra, as well as a bovine growth hormone terminator sequence.
  • the promoter may be the homologous hCMV IE1 promoter normally associated with the intact, full-length Intron A sequence from which the fragment is derived, a heterologous CMV IE1 promoter (e.g., from a different CMV strain), or even a non-CMV IE1 promoter.
  • the choice of promoter will depend on the cell type used for expression and is readily determined by one of skill in the art.
  • promoters for mammalian cell expression include the SV40 early promoter, a CMV promoter as described above, the mouse mammary tumor virus LTR promoter, the adenovirus major late promoter (Ad MLP), the RSV promoter, the SR ⁇ promoter, the herpes simplex virus promoter, tissue-specific promoters, among others.
  • One particular promoter used in the constructs described herein is a promoter derived from the hCMV IE1 enhancer/promoter region depicted in Figure 2, such as approximately nucleotide positions 460 to 1264 of Figure 2, or functional portions of this region.
  • Nonviral promoters such as a promoter derived from the murine metallothioncin gene, will also find use for mammalian expression.
  • Insect cell expression systems typically Baculovirus systems, will generally include a polyhedrin promoter.
  • Promoters for use in bacterial systems include promoter sequences derived from sugar metabolizing enzymes, such as galactose, lactose (lac) (Chang et al., Nature (1977) 198: 1056), and maltose, promoter sequences derived from biosynthetic enzymes such as tryptophan (trp) (Goeddel et al., Nuc. Acids Res.
  • hybrid promoters such as tac, a hybrid trp-lac promoter (Amann et al., Gene (1953) 25: 167; de Boer et al., Proc. Natl. Acad Sci . (1983) 80: 21).
  • Promoters useful in yeast expression systems include, for example, promoters from sequences encoding enzymes in the metabolic pathway such as alcohol dehydrogenase (ADH) (EPO Publication No.
  • enolase glucokinase, glucose-6-phosphate isomerase, glyceraldehyde-3-phosphate-dehydrogenase (GAP or GAPDH), hexokinase, phosphofructokinase, 3-phosphoglycerate mutase, and pyruvate kinase (PyK) (EPO Publication No. 329,203) promoters.
  • GAP or GAPDH glyceraldehyde-3-phosphate-dehydrogenase
  • hexokinase phosphofructokinase
  • 3-phosphoglycerate mutase 3-phosphoglycerate mutase
  • PyK pyruvate kinase
  • Other promoters for use in such systems include a promoter derived from the yeast PHO5 gene, encoding acid phosphatase (Myanohara et al., Proc. Natl. Acad.
  • hybrid promoters include the ADH regulatory sequence linked to the GAP transcription activation region (U.S. Patent Nos. 4,876,197 and 4,880,734), as well as promoters which consist of the regulatory sequences of either the ADH2, GAL4, GAL10, or PHO5 genes, combined with the transcriptional activation region of a glycolytic enzyme gene such as GAP or PyK (EPO Publication No. 164,556).
  • promoters can be obtained from commercially available plasmids, using techniques well known in the art. See, e.g., Sambrook et al., supra.
  • An expression vector is constructed so that the particular coding sequence is located in the vector with the Intron A fragment and the appropriate regulatory sequences, the positioning and orientation of the coding sequence with respect to the control sequences being such that the coding sequence is transcribed under the "control" of the control sequences (i.e., RNA polymerase which binds to the DNA molecule at the promoter transcribes the coding sequence).
  • control i.e., RNA polymerase which binds to the DNA molecule at the promoter transcribes the coding sequence.
  • Modification of the sequences encoding the molecule of interest may be desirable to achieve this end. For example, in some cases it may be necessary to modify the sequence so that it can be attached to the promoter and other control sequences in the appropriate orientation; i.e., to maintain the reading frame.
  • the promoter sequence and other regulatory sequences may be ligated to the coding sequence prior to insertion into a vector.
  • the coding sequence can be cloned directly into an expression vector
  • Mutants or analogs of the polypeptide of interest may be prepared by the deletion of a portion of the sequence encoding the polypeptide of interest, by insertion of a sequence, and/or by substitution of one or more nucleotides within the sequence.
  • Techniques for modifying nucleotide sequences, such as site-directed mutagenesis, and the like, are well known to those skilled in the art. See, e.g., Sambrook et al., supra; Kunkel, T.A. (1985) Proc. Natl. Acad. Sci. USA (1985) 82 :448; Geisselsoder et al.
  • nucleic acid molecules comprising nucleotide sequences of interest can be stably integrated into a host cell genome or maintained on a stable episomal element in a suitable host cell using various gene delivery techniques well known in the art. See, e.g., U.S. Patent No. 5,399,346.
  • insect cell expression systems such as baculovirus systems
  • baculovirus systems are known to those of skill in the art and described in, e.g., Summers and Smith, Texas Agricultural Experiment Station Bulletin No. 1555 (1987).
  • Materials and methods for baculovirus/insect cell expression systems are commercially available in kit form from, inter alia, Invitrogen, San Diego CA ("MaxBac" kit).
  • bacterial and mammalian cell expression systems are well known in the art and described in, e.g., Sambrook et al., supra.
  • Yeast expression systems are also known in the art and described in, e.g., Yeast Genetic Engineering (Barr et al., eds., 1989) Butterworths, London.
  • mammalian cell lines are known in the art and include immortalized cell lines available from the American Type Culture Collection (ATCC), such as, but not limited to, Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS), human embryonic kidney cells, human hepatocellular carcinoma cells (e.g., Hep G2), Madin-Darby bovine kidney (“MDBK”) cells, as well as others.
  • ATCC American Type Culture Collection
  • CHO Chinese hamster ovary
  • HeLa cells HeLa cells
  • BHK baby hamster kidney
  • COS monkey kidney cells
  • human embryonic kidney cells e.g., Hep G2
  • MDBK Madin-Darby bovine kidney
  • bacterial hosts such as E. coli, Bacillus subtilis, and Streptococcus spp., will find use with the present expression constructs.
  • Yeast hosts useful in the present invention include inter alia, Saccharomyces cerevisiae, Candida albicans, Candida maltosa, Hansenula polymorpha, Kluyveromyces fragilis, Kluyveromyces lactis, Pichia guillerimondii, Pichia pastoris, Schizosaccharomyces pombe and Yarrowia lipolytica.
  • Insect cells for use with baculovirus expression vectors include, inter alia, Aedes aegypti, Autographa californica, Bombyx mori, Drosophila melanogaster, Spodoptera frugiperda, and Trichoplusia ni.
  • a wide variety of methods can be used to deliver the expression constructs to cells. Such methods include DEAE dextran-mediated transfection, calcium phosphate precipitation, polylysine- or polyornithine-mediated transfection, or precipitation using other insoluble inorganic salts, such as strontium phosphate, aluminum silicates including bentonite and kaolin, chromic oxide, magnesium silicate, talc, and the like.
  • Other useful methods of transfection include electroporation, sonoporation, protoplast fusion, liposomes, peptoid delivery, or microinjection. See, e.g., Sambrook et al., supra, for a discussion of techniques for transforming cells of interest.
  • the expression constructs can be packaged in liposomes prior to delivery to the cells.
  • Lipid encapsulation is generally accomplished using liposomes which are able to stably bind or entrap and retain nucleic acid.
  • the ratio of condensed DNA to lipid preparation can vary but will generally be around 1:1 (mg DNA:micromoles lipid), or more of lipid.
  • liposomes as carriers for delivery of nucleic acids, see, Hug and Sleight, Biochim. Biophys. Acta. (1991) 1097 :1-17; Straubinger et al., in Methods of Enzymology (1983), Vol. 101, pp. 512-527.
  • Liposomal preparations for use with the present invention include cationic (positively charged), anionic (negatively charged) and neutral preparations, with cationic liposomes particularly preferred.
  • Cationic liposomes are readily available.
  • N[1-2,3-dioleyloxy)propyl]-N,N,N-triethylanunonium (DOTMA) liposomes are available under the trademark Lipofectin, from GIBCO BRL, Grand Island, NY. (See, also, Felgner et al., Proc. Natl. Acad. Sci. USA (1987) 84 :7413-7416).
  • lipids include transfectace (DDAB/DOPE) and DOTAP/DOPE (Boerhinger).
  • DDAB/DOPE transfectace
  • DOTAP/DOPE DOTAP/DOPE
  • Other cationic liposomes can be prepared from readily available materials using techniques well known in the art. See, e.g., Szoka et al., Proc. Natl. Acad. Sci. USA (1978) 75 :4194-4198; PCT Publication No. WO 90/11092 for a description of the synthesis of DOTAP (1,2-bis(oleoyloxy)-3-(trimethylammonio)propane) liposomes.
  • the various liposome-nucleic acid complexes are prepared using methods known in the art.
  • the DNA can also be delivered in cochleate lipid compositions similar to those described by Papahadjopoulos et al., Biochem. Biophys. Acta. (1975) 394: 483-491. See, also, U.S. Patent Nos. 4,663,161 and 4,871,488.
  • the molecules are produced by growing host cells transformed by an expression vector described above under conditions whereby the protein is expressed.
  • the expressed protein is then isolated from the host cells and purified. If the expression system secretes the protein into growth media, the product can be purified directly from the media. If it is not secreted, it can be isolated from cell lysates.
  • the selection of the appropriate growth conditions and recovery methods are within the skill of the art.
  • the product may be isolated and purified by any number of techniques, well known in the art, including: chromatography, e.g., HPLC, affinity chromatography, ion exchange chromatography, size-exclusion, etc.; electrophoresis; density gradient centrifugation; solvent extraction, or the like.
  • the expression constructs of the present invention may also be used for nucleic acid immunization and gene therapy, using standard gene delivery protocols. Methods for gene delivery are known in the art. See, e.g., U.S. Patent Nos. 5,399,346, 5,580,859, 5,589,466. Genes can be delivered either directly to the vertebrate subject or, alternatively, delivered ex vivo, to cells derived from the subject and the cells reimplanted in the subject.
  • retroviral systems have been developed for gene transfer into mammalian cells.
  • retroviruses provide a convenient platform for gene delivery systems.
  • a selected gene can be inserted into a vector and packaged in retroviral particles using techniques known in the art.
  • the recombinant virus can then be isolated and delivered to cells of the subject either in vivo or ex vivo.
  • retroviral systems have been described (U.S. Patent No. 5,219,740; Miller and Rosman, BioTechniques (1989) 7 :980-990; Miller, A.D., Human Gene Therapy (1990) 1 :5-14; Scarpa et al., Virology (1991) 180:849-852; Burns et al., Proc. Natl.
  • retroviral gene delivery vehicles of the present invention may be readily constructed from a wide variety of retroviruses, including for example, B, C, and D type retroviruses as well as spumaviruses and lentiviruses such as FIV, HIV, HIV-1, HIV-2 and SIV (see RNA Tumor Viruses, Second Edition, Cold Spring Harbor Laboratory, 1985).
  • retroviruses may be readily obtained from depositories or collections such as the American Type Culture Collection ("ATCC”; 10801 University Boulevard., Manassas, VA 20110-2209), or isolated from known sources using commonly available techniques.
  • adenovirus vectors have also been described. Unlike retroviruses which integrate into the host genome, adenoviruses persist extrachromosomally thus minimizing the risks associated with insertional mutagenesis (Haj-Ahmad and Graham, J. Virol. (1986) 57 :267-274; Bett et al., J. Virol. (1993) 67 :5911-5921; Mittereder et al., Human Gene Therapy (1994) 5 :717-729; Seth et al., J. Virol. (1994) 68:933-940; Barr et al., Gene Therapy (1994) 1 :51-58; Berkner, K.L. BioTechniques (1988) 6 :616-629; and Rich et al., Human Gene Therapy (1993) 4 :461-476).
  • AAV vectors can be readily constructed using techniques well known in the art. See, e.g., U.S. Patent Nos. 5,173,414 and 5,139,941; International Publication Nos. WO 92/01070 (published 23 January 1992) and WO 93/03769 (published 4 March 1993); Lebkowski et al., Molec. Cell. Biol. (1988) 8 :3988-3996; Vincent et al., Vaccines 90 (1990) (Cold Spring Harbor Laboratory Press); Carter, B.J. Current Opinion in Biotechnology (1992) 3 :533-539; Muzyczka, N.
  • Molecular conjugate vectors such as the adenovirus chimeric vectors described in Michael et al., J. Biol. Chem. (1993) 268 :6866-6869 and Wagner et al., Proc. Natl. Acad. Sci. USA (1992) 89 :6099-6103, can also be used for gene delivery.
  • Alphavirus genus such as but not limited to vectors derived from the Sindbis, Semliki Forest viruses and VEE, will also find use as viral vectors for delivering the gene of interest.
  • Sindbis Sindbis
  • Semliki Forest viruses and VEE will also find use as viral vectors for delivering the gene of interest.
  • Sinbus-virus derived vectors useful for the practice of the instant methods, see, Dubensky et al., J. Virol. (1996) 70 :508-519; and International Publication Nos. WO 95/07995 and WO 96/17072.
  • the expression constructs of the present invention can also be delivered without a viral vector.
  • the construct can be delivered directly, or packaged in liposomes prior to delivery to the subject or to cells derived therefrom, as described above.
  • the expression constructs may also be encapsulated, adsorbed to, or associated with, particulate carriers.
  • particulate carriers present multiple copies of a selected molecule to the immune system and promote trapping and retention of molecules in local lymph nodes.
  • the particles can be phagocytosed by macrophages and can enhance antigen presentation through cytokine release.
  • particulate carriers include those derived from polymethyl methacrylate polymers, as well as microparticles derived from poly(lactides) and poly(lactide-co-glycolides), known as PLG. See, e.g., Jeffery et al., Pharm. Res. (1993) 10 :362-368; and McGee et al., J. Microencap. (1996).
  • particulate systems and polymers can be used for the in vivo or ex vivo delivery of the expression constructs.
  • polymers such as polylysine, polyarginine, polyomithine, spermine, spermidine, as well as conjugates of these molecules, are useful for transferring a nucleic acid of interest.
  • DEAE dextran-mediated transfection, calcium phosphate precipitation or precipitation using other insoluble inorganic salts, such as strontium phosphate, aluminum silicates including bentonite and kaolin, chromic oxide, magnesium silicate, talc, and the like will find use with the present system. See, e.g., Felgner, P.L., Advanced Drug Delivery Reviews (1990) 5 :163-187, for a review of delivery systems useful for gene transfer.
  • biolistic delivery systems employing particulate carriers such as gold and tungsten, are especially useful for delivering the expression constructs of the present invention.
  • the particles are coated with the construct to be delivered and accelerated to high velocity, generally under a reduced atmosphere, using a gun powder discharge from a "gene gun.”
  • a gun powder discharge from a "gene gun” For a description of such techniques, and apparatuses useful therefore, see, e.g., U.S. Patent Nos. 4,945,050; 5,036,006; 5,100,792; 5,179,022; 5,371,015; and 5,478,744.
  • a series of 13 expression constructs were made which deleted from between 54 and 688 nucleotides from within the core region of Intron A, bounded by the splice donor and branch point sites.
  • the expression constructs were linked to the firefly (Photinus pyralis) luciferase gene or to a codon-optimized HIV p55gag gene (Zur Megede et al., J. Virol. (2000) 74:2628-2635.)
  • the initial deletion of Intron A was prepared by means of substituting a 778 base pair Nsi I - Sal I fragment from plasmid pCMVkmLuc (International Publication No. WO 98/06437) with a synthetic oligonucleotide (Figure 1B) that restored the last 80 nucleotides of Intron A (with optimized branch point and polypyrimidine tract sequences as shown in Figure 1B), together with Exon 2 of the 5'-UTR (nucleotides 821-834 of Figure 1A).
  • the resulting construct contained a 688 bp deletion from Intron A and is shown in Figure 1A.
  • the resulting expression plasmid, pCON3 contains the hCMV enhancer/promoter region with a 130 bp Intron A fragment.
  • the final sequence of the intron in pCON3 is shown in Figure 1C.
  • Intron A deletion constructs were made by progressive deletion within plasmid pCMVII (U.S. Patent No. 6,096,505) in either the 5' ⁇ 3' direction from the unique Nsi I site toward the unique Hpa I site, or in the 3' ⁇ 5' direction from the Hpa I site toward the Nsi I site (see, Figure 3 and Table 1). Following the restriction enzyme digests, the plasmids were treated with T4 DNA polymerase and excess dNTPs. Resulting blunt-ended vector fragments were gel-purified and self-ligated. As shown in Figure 3, these constructs included deletions within the intron ranging from 54 to 663 base pairs in length.
  • the Nde I -Sal I fragment from the truncation plasmids was substituted into plasmid pCMVkmLuc digested with Nde I and Sal I .
  • selected ones were digested with Sal I -Xba I to generate recipient vector fragments for the insertion of the codon-optimized HIV p55gag gene obtained by digestion of plasmid pCMVkm 2 .GAGmod.SF2 (Zur Megede et al., J. Virol. (2000) 74:2628-2635).
  • 293 (ATTC Accession No. CRL-1573) and RD (ATTC Accession No. CCL-136) cells were grown in DMEM medium supplemented with fetal calf serum (10% v/v). Fourteen hours prior to transfection, 2 ⁇ 10 5 cells/well were seeded into 6 well plates. Transient transfection was done using 2 ⁇ g of the vector DNA described above, per well using 12 ⁇ g of Fugene 6 (Roche Molecular Biochemicals, Indianapolis, IN) per supplier instructions in 6 replicate wells per construct. Forty-eight hours post-transfection, cell lysates were analyzed for reporter gene expression. HIV p55gag expression was evaluated by means of a p24 antigen ELISA (Coulter, Miami, FL). Geometric mean titers across each plate (construct) were calculated.
  • FIG. 5A shows the wild-type rabbit ⁇ -globin gene sequence used.
  • Figure 6 shows the wild-type sequences for the splice donor, branch point and polyY tract of R ⁇ G-IVSI are suboptimal relative to the consensus sequences for these elements. Therefore, the construct containing R ⁇ G-IVSI was modified such that these sequence elements were optimized.
  • Figure 5B shows the optimized rabbit ⁇ -globin gene sequence used, termed R ⁇ G-OPTI. Analysis of this construct showed approximately 4 times higher p55gag expression as compared to the parent vector in vitro ( Figure 6).
  • RNA transcript analysis 293 cells were transiently transfected and then lysed using RNAstat 60 (Tel-Test B, Inc., Friendswood, TX) to yield total cell RNA. Extracted RNA was digested with RQ1-Dnase (Promega Corp, Madison, WI) and subjected to RT-PCR using the GeneAmp RNA PCR kit (Roche Molecular Biochemicals, Indianapolis, IN). PCR spanning the region of the intron was done using an upstream primer in exon 1 of the 5' UTR [primer "KBT-162"; seq.
  • CGCTGTTTTGACCTCCATA (SEQ ID NO:7)] and a downstream primer from the luciferase reporter gene [primer "KBT-163"; seq. GTTGAGCAATTCACGTTCAT (SEQ ID NO:8)]; a control PCR of actin transcripts was also performed for each RNA preparation. All of the mutants spliced efficiently, within the sensitivity of the assay, as no products of lengths predicted for unspliced messages were detected.
  • mice in groups of 6 animals were immunized once bilaterally in the tibialis anterior muscle with 5 ⁇ g of naked vector DNA per injection site (prepared endotoxin-free [Qiagen, Inc., Valencia, CA] and formulated in normal saline).
  • Three- and six-week post-immunization bleeds were analyzed by ELISA for anti-HIV p55gag antibody as described in Zur Megede et al., J. Virol. (2000) 74:2628-2635.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Processing And Handling Of Plastics And Other Materials For Molding In General (AREA)
  • Separation, Recovery Or Treatment Of Waste Materials Containing Plastics (AREA)
  • Perforating, Stamping-Out Or Severing By Means Other Than Cutting (AREA)
  • Package Closures (AREA)

Claims (20)

  1. Menschliches Cytomegalovirus (hCMV)-Intron A-Fragment, wobei diesem Fragment eine vollständige Intron A-Sequenz fehlt und es umfasst: (a) eine Nucleotidsequenz mit mindestens etwa 75% Sequenzidentität zur zusammenhängenden Sequenz der ersten 25 5'-Nucleotide einer hCMV-Intron A-Sequenz, und (b) eine Nucleotidsequenz, die mindestens etwa 75% Sequenzidentität mit den letzten 25 3'-Nucleotiden einer hCMV-Intron A-Sequenz hat, wobei, wenn dieses Fragment in einem Expressionskonstrukt vorhanden ist, das Expressionskonstrukt Expressionsspiegel erreicht, die größer sind als die Expressionsspiegel, welche durch ein entsprechendes Konstrukt erreicht werden, dem die Intron A-Sequenz vollständig fehlt.
  2. Intron A-Fragment nach Anspruch 1, wobei (a) die ersten 25 5'-Nucleotide einer hCMV-Intron A-Sequenz die Nucleotide 1265-1289 von SEQ ID NO: 4 sind, und (b) die letzten 25 3'-Nucleotide einer hCMV-Intron A-Sequenz die Nucleotide 2064-2088 von SEQ ID NO: 4 sind.
  3. Intron A-Fragment nach Anspruch 1, wobei (a) die ersten 25 5'-Nucleotide einer hCMV-Intron A-Sequenz die Nucleotide 1-25 der SEQ ID NO: 1 sind, und (b) die letzten 25 3'-Nucleotide einer hCMV-Intron A-Sequenz die Nucleotide 800-824 der SEQ ID NO: 1 sind.
  4. Intron A-Fragment nach einem der vorangegangen Ansprüche, wobei dieses Fragment umfasst: (a) eine Nucleotidsequenz, die mindestens etwa 75% Sequenzidentität zu der zusammenhängenden Sequenz der ersten 51 5'-Nucleotide einer hCMV-Intron A-Sequenz hat, und (b) eine Nucleotidsequenz mit mindestens etwa 75% Sequenzidentität zu der zusammenhängenden Sequenz der letzten 80 3'-Nucleotide einer hCMV-Intron A-Sequenz.
  5. Intron A-Fragment nach Anspruch 4, wobei (a) die ersten 51 5'-Nucleotide einer hCMV-Intron A-Sequenz die Nucleotide 1265-1315 von SEQ ID NO: 4 sind, und (b) die letzten 80 3'-Nucleotide einer hCMV-Intron A-Sequenz die Nucleotide 2009-2088 von SEQ ID NO: 4 sind.
  6. Intron A-Fragment nach Anspruch 4, wobei (a) die ersten 51 5'-Nucleotide einer hCMV-Intron A-Sequenz die Nucleotide 1-51 von SEQ ID NO: 1 sind, und (b) die letzten 80 3'-Nucleotide einer hCMV-Intron A-Sequenz die Nucleotide 745-824 von SEQ ID NO: 1 sind.
  7. Intron A-Fragment nach einem der vorangegangen Ansprüche, wobei, wenn dieses Fragment in einem Expressionskonstrukt enthalten ist, das Expressionskonstrukt Expressiönsspiegel erreicht, die mindestens 2-fach höher sind als jene Spiegel, die erreicht werden durch ein entsprechendes Konstrukt, welchem die Intron A-Sequenz vollständig fehlt.
  8. Intron A-Fragment nach einem der vorangegangen Ansprüche, wobei, wenn dieses Fragment in einem Expressionskonstrukt enthalten ist, das Expressionskonstrukt Expressionsspiegel erreicht, die mindestens 10-fach höher sind als jene Spiegel, die erreicht werden durch ein entsprechendes Konstrukt, welchem die Intron A-Sequenz vollständig fehlt.
  9. Intron A-Fragment nach einem der vorangegangen Ansprüche, wobei, wenn dieses Fragment in einem Expressionskonstrukt enthalten ist, das Expressionskonstrukt Expressionsspiegel erreicht, die mindestens 50-fach höher sind als jene Spiegel, die erreicht werden durch ein entsprechendes Konstrukt, welchem die Intron A-Sequenz vollständig fehlt.
  10. Intron A-Fragment nach einem der vorangegangen Ansprüche, wobei dieses Fragment aus einer Intron A-Nucleotidsequenz besteht wie dargestellt in SEQ ID NO: 3 oder einer Nucleotidsequenz, die mindestens etwa 75% Sequenzidentität dazu hat.
  11. Intron A-Fragment nach Anspruch 10, wobei dieses Fragment aus einer Intron A-Nucleotidsequenz wie dargestellt in SEQ ID NO: 3 besteht.
  12. Menschliches Cytomegalovirus (hCMV)-Intron A-Fragment, wobei diesem Fragment die vollständige Intron A-Sequenz fehlt und es umfasst: (a) eine Nucleotidsequenz mit mindestens etwa 75% Sequenzidentität zu der zusammenhängenden Sequenz der ersten 25 5'-Nucleotide einer hCMV-Intron A-Sequenz, und (b) eine Nucleotidsequenz, die mindestens etwa 75% Sequenzidentität zu den letzten 25 3'-Nucleotiden einer hCMV-Intron A-Sequenz hat, wobei, wenn dieses Fragment in einem Expressionskonstrukt enthalten ist, das Expressionskonstrukt Expressionsspiegel erreicht, welche gleich wie oder größer sind als jene Spiegel, die durch ein Expressionskonstrukt erreicht werden, welches die entsprechende intakte vollständige Intron A-Sequenz enthält.
  13. Intron A-Fragment nach Anspruch 12, wobei dieses Fragment umfasst (a) eine Nucleotidsequenz, die mindestens etwa 75% Sequenzidentität zur zusammenhängenden Sequenz der ersten 51 5'-Nucleotide einer hCMV-Intron A-Sequenz hat, und (b) eine Nucleotidsequenz, die mindestens etwa 75% Sequenzidentität mit den letzten 80 3'-Nucleotiden einer hCMV-Intron A-Sequenz hat.
  14. Rekombinantes Expressionskonstrukt, das geeignet ist zur Lenkung der Transkription einer ausgewählten codierenden Sequenz, wobei das Expressionskonstrukt umfasst: (a) eine codierende Sequenz; (b) Kontrollelemente, die funktionell verknüpft sind mit dieser codierenden Sequenz, wobei die Kontrollelemente das Intron A-Fragment nach einem der Ansprüche 1-13 umfassen, wobei die codierende Sequenz in einer Wirtszelle transkribiert und translatiert werden kann.
  15. Rekombinantes Expressionskonstrukt nach Anspruch 14, wobei die Kontrollelemente darüber hinaus einen Promotor umfassen, ausgewählt aus der Gruppe bestehend aus einem SV40-frühen-Promotor, einem CMV-Promotor, einem Mäuse-Mamma-Tumor-Virus-LTR-Promotor, einem Adenovirus-starken späten Promotor, einem RSV-Promotor, einem SRα-Promotor und einem Herpes-Simplex- Virus-Promotor.
  16. Rekombinantes Expressionskonstrukt nach Anspruch 14 oder 15, wobei die Kontrollelemente darüber hinaus die hCMV-sehr frühe (IE1) Enhancer/Promotor-Region entsprechend den Nucleotidpositionen 460 bis 1264 der SEQ ID NO: 4 umfassen und wobei die Kontrollelemente darüber hinaus Exon 2 der 5'-UTR umfassen, das die Sequenz der Nucleotide an Positionen 2089-2096 von SEQ ID NO: 4 umfasst.
  17. Wirtszelle, umfassend das rekombinante Expressionskonstrukt nach einem der Ansprüche 14-16.
  18. Verfahren zur Herstellung eines rekombinanten Polypeptids, umfassend: (a) Bereitstellen einer Population von Wirtszellen nach Anspruch 17, und (b) Züchten dieser Population von Zellen unter Bedingungen, bei denen die codierende Sequenz des rekombinanten Expressionskonstrukts exprimiert wird, wodurch das rekombinante Polypeptid hergestellt wird.
  19. Verfahren zur Herstellung eines rekombinanten Polypeptids, umfassend: (a) Einbringen des Expressionskonstrukts nach einem der Ansprüche 14-17 in eine Wirtszelle; und (b) Auslösen der Expression der codierenden Sequenz des Expressionskonstrukts zur Herstellung des rekombinanten Polypeptids.
  20. Polynucleotid, umfassend die Sequenz wie dargestellt in SEQ ID NO: 6.
EP01979785A 2000-10-13 2001-10-12 Fragmente der intron a von citomegalovirus Expired - Lifetime EP1373524B1 (de)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US24050200P 2000-10-13 2000-10-13
US240502P 2000-10-13
PCT/US2001/032050 WO2002031137A2 (en) 2000-10-13 2001-10-12 Cytomegalovirus intron a fragments

Publications (2)

Publication Number Publication Date
EP1373524A2 EP1373524A2 (de) 2004-01-02
EP1373524B1 true EP1373524B1 (de) 2006-04-12

Family

ID=22906778

Family Applications (1)

Application Number Title Priority Date Filing Date
EP01979785A Expired - Lifetime EP1373524B1 (de) 2000-10-13 2001-10-12 Fragmente der intron a von citomegalovirus

Country Status (11)

Country Link
US (2) US6893840B2 (de)
EP (1) EP1373524B1 (de)
JP (1) JP4445703B2 (de)
CN (1) CN1247785C (de)
AT (1) ATE323166T1 (de)
AU (1) AU2002211710A1 (de)
CA (1) CA2425852C (de)
DE (1) DE60118798T2 (de)
ES (1) ES2261489T3 (de)
WO (1) WO2002031137A2 (de)
ZA (1) ZA200302667B (de)

Families Citing this family (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB0027088D0 (en) * 2000-11-06 2000-12-20 Glaxo Group Ltd DNA expression vectors
JP3630414B2 (ja) 2002-05-21 2005-03-16 インターナショナル・ビジネス・マシーンズ・コーポレーション 塩基配列のクラスタ生成システム、塩基配列のクラスタ生成方法、該クラスタ生成方法を実行するためのプログラム、および該プログラムを記憶したコンピュータ可読な記録媒体、および塩基配列情報提供システム
ATE505538T1 (de) * 2003-06-09 2011-04-15 Corixa Corp Dna-vektoren
MXPA06003978A (es) * 2003-10-10 2006-06-27 Powderject Vaccines Inc Constructos de acidos nucleicos.
EA010059B1 (ru) * 2003-10-14 2008-06-30 Байоджен Айдек Ма Инк. Flp-опосредованная рекомбинация
GB0507997D0 (en) * 2005-02-01 2005-05-25 Powderject Vaccines Inc Nucleic acid constructs
JP2008536506A (ja) * 2005-04-22 2008-09-11 ロンザ・バイオロジクス・ピーエルシー ｍＣＭＶプロモーターおよびｈＣＭＶ主要最初期遺伝子を含む哺乳類発現ベクター
US20120129770A1 (en) * 2009-06-22 2012-05-24 Rajyashri Karur Ramakrishna Novel polynucleotide molecules for enhanced gene expression
EP2474611A4 (de) * 2009-09-04 2013-06-12 Nat Inst Biomedical Innovation Verstärker für einen promoter und verwendung davon
US20120100573A1 (en) * 2010-10-21 2012-04-26 Thudium Kent B Cytomegalovirus intron a fragments
US11060083B2 (en) 2013-07-19 2021-07-13 Larix Bioscience Llc Methods and compositions for producing double allele knock outs
JP6482546B2 (ja) 2013-07-19 2019-03-13 ラリクス・バイオサイエンス・リミテッド・ライアビリティ・カンパニーＬａｒｉｘ Ｂｉｏｓｃｉｅｎｃｅ， Ｌｌｃ 二重対立遺伝子ノックアウトを生成するための方法および組成物
CA3205555A1 (en) * 2014-04-25 2015-10-29 Genethon Treatment of hyperbilirubinemia
US11617788B2 (en) 2018-07-09 2023-04-04 Arizona Board Of Regents On Behalf Of The University Of Arizona Viral promoters and compositions and methods of use thereof
KR20210080071A (ko) * 2019-12-20 2021-06-30 (주)셀트리온 목적 단백질의 고발현을 위한 인트론을 포함하는 발현 카세트 및 이의 이용
KR20220119703A (ko) 2019-12-24 2022-08-30 아스클레피오스 바이오파마슈티컬, 인크. 조절 핵산 서열
GB202005732D0 (en) 2020-04-20 2020-06-03 Synpromics Ltd Regulatory nucleic acid sequences
EP4176063A2 (de) 2020-07-06 2023-05-10 Helmholtz Zentrum München Deutsches Forschungszentrum für Gesundheit und Umwelt GmbH Intron-codierte extranukleare transkripte zur proteinübersetzung, rna-codierung und mehrzeitpunktabfrage von nichtcodierender oder proteincodierender rna-regulierung
CN114958914B (zh) * 2022-06-06 2023-09-26 新乡医学院 一种人类及哺乳动物细胞附着体表达载体、构建方法和应用

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5939018A (en) * 1984-10-10 1999-08-17 Kawasaki Steel Corporation Martensitic stainless steels for seamless steel pipe
CA1341423C (en) * 1984-10-31 2003-03-04 Paul A. Luciw Recombinant proteins of viruses associated with lymphadenopathy syndrome and/or acquired immune deficiency syndrome
US5620896A (en) 1992-03-23 1997-04-15 University Of Massachusetts Medical Center DNA vaccines against rotavirus infections
US5739018A (en) 1996-08-07 1998-04-14 The Regents Of The University Of California Packaging cell lines for pseudotyped retroviral vectors
US6025338A (en) 1996-10-17 2000-02-15 University Of Florida Nucleic acid vaccines against rickettsial diseases and methods of use
WO2000041679A1 (en) * 1999-01-13 2000-07-20 Johns Hopkins University School Of Medicine Genetic immunization with co-delivery of nucleic acid and cytokines
CA2378539A1 (en) 1999-07-06 2001-01-11 Merck & Co., Inc. Adenovirus carrying gag gene hiv vaccine

Also Published As

Publication number Publication date
DE60118798T2 (de) 2007-04-12
WO2002031137A2 (en) 2002-04-18
JP4445703B2 (ja) 2010-04-07
ZA200302667B (en) 2004-07-05
US20050079488A1 (en) 2005-04-14
JP2004511229A (ja) 2004-04-15
US6893840B2 (en) 2005-05-17
CA2425852A1 (en) 2002-04-18
AU2002211710A1 (en) 2002-04-22
WO2002031137A3 (en) 2002-10-31
CN1247785C (zh) 2006-03-29
ES2261489T3 (es) 2006-11-16
CN1469930A (zh) 2004-01-21
ATE323166T1 (de) 2006-04-15
US20050191727A1 (en) 2005-09-01
CA2425852C (en) 2009-09-29
EP1373524A2 (de) 2004-01-02
DE60118798D1 (de) 2006-05-24
US7846687B2 (en) 2010-12-07

Similar Documents

Publication Publication Date Title
US7846687B2 (en) Cytomegalovirus Intron A fragments
US6475798B2 (en) P element derived vector and methods for its use
US6096505A (en) Noncloning technique for expressing a gene of interest
KR101454842B1 (ko) 개선된 알파바이러스 레플리콘 및 헬퍼 구축물
US20080160048A1 (en) Nucleic Acid Constructs
JP2002503461A (ja) 遺伝子ワクチンベクター工学
JP2007325597A (ja) 組換えアルファウイルスベクター
Macdonald Development of new cell lines for animal cell biotechnology
KR20040010635A (ko) 신규 발현 벡터 및 이의 용도
US20120100573A1 (en) Cytomegalovirus intron a fragments
US6291246B1 (en) DNA virus vectors and methods for their preparation
Dickson Molecular and cell biology of human gene therapeutics
ES2312170T3 (es) Vector episomal y usos del mismo.
US6436693B1 (en) Method for helper virus-free packaging of a gene vector DNA
KR100548187B1 (ko) 헬퍼바이러스 없이 유전자 벡터dna를 패키징하는 방법
Pavlakis Gene expression using DNA viral vectors
Bernard Production of Proteins by Transient Expression
JP2023546202A (ja) Ｈｅｋ２９３細胞株を製造するための方法、ｅｂ－ｖｌｐを製造するための方法、およびｅｂ－ｖｌｐを含む組成物
JPH08168382A (ja) ウイルス不含タンパクを生産する為の不死化リンパ球

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20030930

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

RIN1 Information on inventor provided before grant (corrected)

Inventor name: SELBY, MARK

Inventor name: THUDIUM, KENT

Inventor name: ULMER, JEFFREY

17Q First examination report despatched

Effective date: 20050422

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

GRAS Grant fee paid

Free format text: ORIGINAL CODE: EPIDOSNIGR3

GRAA (expected) grant

Free format text: ORIGINAL CODE: 0009210

RIN1 Information on inventor provided before grant (corrected)

Inventor name: THUDIUM, KENT

Inventor name: SELBY, MARK

AK Designated contracting states

Kind code of ref document: B1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: IT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT;WARNING: LAPSES OF ITALIAN PATENTS WITH EFFECTIVE DATE BEFORE 2007 MAY HAVE OCCURRED AT ANY TIME BEFORE 2007. THE CORRECT EFFECTIVE DATE MAY BE DIFFERENT FROM THE ONE RECORDED.

Effective date: 20060412

REG Reference to a national code

Ref country code: GB

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: CH

Ref legal event code: EP

REF Corresponds to:

Ref document number: 60118798

Country of ref document: DE

Date of ref document: 20060524

Kind code of ref document: P

REG Reference to a national code

Ref country code: IE

Ref legal event code: FG4D

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: SE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20060712

Ref country code: DK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20060712

REG Reference to a national code

Ref country code: CH

Ref legal event code: NV

Representative=s name: PATENTANWAELTE SCHAAD, BALASS, MENZL & PARTNER AG

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: PT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20060912

ET Fr: translation filed
REG Reference to a national code

Ref country code: ES

Ref legal event code: FG2A

Ref document number: 2261489

Country of ref document: ES

Kind code of ref document: T3

RAP2 Party data changed (patent owner data changed or rights of a patent transferred)

Owner name: NOVARTIS VACCINES AND DIAGNOSTICS, INC.

PLBE No opposition filed within time limit

Free format text: ORIGINAL CODE: 0009261

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: NO OPPOSITION FILED WITHIN TIME LIMIT

26N No opposition filed

Effective date: 20070115

NLT2 Nl: modifications (of names), taken from the european patent patent bulletin

Owner name: NOVARTIS VACCINES AND DIAGNOSTICS, INC.

Effective date: 20070124

BECN Be: change of holder's name

Owner name: NOVARTIS VACCINES & DIAGNOSTICS INC.

Effective date: 20060412

REG Reference to a national code

Ref country code: CH

Ref legal event code: PFA

Owner name: NOVARTIS VACCINES & DIAGNOSTICS, INC.

Free format text: CHIRON CORPORATION#4560 HORTON STREET#EMERYVILLE, CALIFORNIA 94608-2916 (US) -TRANSFER TO- NOVARTIS VACCINES & DIAGNOSTICS, INC.#4560 HORTON STREET#EMERYVILLE, CA 94608-2916 (US)

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: GR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20060713

NLT1 Nl: modifications of names registered in virtue of documents presented to the patent office pursuant to art. 16 a, paragraph 1

Owner name: NOVARTIS VACCINES AND DIAGNOSTICS, INC.

REG Reference to a national code

Ref country code: FR

Ref legal event code: CD

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: TR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20060412

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: CY

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20060412

REG Reference to a national code

Ref country code: FR

Ref legal event code: PLFP

Year of fee payment: 16

REG Reference to a national code

Ref country code: FR

Ref legal event code: PLFP

Year of fee payment: 17

REG Reference to a national code

Ref country code: FR

Ref legal event code: PLFP

Year of fee payment: 18

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: GB

Payment date: 20200930

Year of fee payment: 20

Ref country code: LU

Payment date: 20200924

Year of fee payment: 20

Ref country code: MC

Payment date: 20200928

Year of fee payment: 20

Ref country code: FR

Payment date: 20200924

Year of fee payment: 20

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: BE

Payment date: 20200924

Year of fee payment: 20

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: NL

Payment date: 20201015

Year of fee payment: 20

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: FI

Payment date: 20201009

Year of fee payment: 20

Ref country code: IE

Payment date: 20201009

Year of fee payment: 20

Ref country code: AT

Payment date: 20200925

Year of fee payment: 20

Ref country code: DE

Payment date: 20200929

Year of fee payment: 20

Ref country code: IT

Payment date: 20200928

Year of fee payment: 20

Ref country code: ES

Payment date: 20201105

Year of fee payment: 20

Ref country code: CH

Payment date: 20201015

Year of fee payment: 20

REG Reference to a national code

Ref country code: DE

Ref legal event code: R071

Ref document number: 60118798

Country of ref document: DE

REG Reference to a national code

Ref country code: CH

Ref legal event code: PL

REG Reference to a national code

Ref country code: BE

Ref legal event code: MK

Effective date: 20211012

REG Reference to a national code

Ref country code: GB

Ref legal event code: PE20

Expiry date: 20211011

REG Reference to a national code

Ref country code: FI

Ref legal event code: MAE

REG Reference to a national code

Ref country code: IE

Ref legal event code: MK9A

REG Reference to a national code

Ref country code: AT

Ref legal event code: MK07

Ref document number: 323166

Country of ref document: AT

Kind code of ref document: T

Effective date: 20211012

REG Reference to a national code

Ref country code: NL

Ref legal event code: MK

Effective date: 20211011

REG Reference to a national code

Ref country code: ES

Ref legal event code: FD2A

Effective date: 20220126

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: GB

Free format text: LAPSE BECAUSE OF EXPIRATION OF PROTECTION

Effective date: 20211011

Ref country code: IE

Free format text: LAPSE BECAUSE OF EXPIRATION OF PROTECTION

Effective date: 20211012

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: ES

Free format text: LAPSE BECAUSE OF EXPIRATION OF PROTECTION

Effective date: 20211013