EP1232278A1 - MICROBIAL 9$g(a)-HYDROXYLATION OF STEROIDS - Google Patents

MICROBIAL 9$g(a)-HYDROXYLATION OF STEROIDS

Info

Publication number
EP1232278A1
EP1232278A1 EP00977417A EP00977417A EP1232278A1 EP 1232278 A1 EP1232278 A1 EP 1232278A1 EP 00977417 A EP00977417 A EP 00977417A EP 00977417 A EP00977417 A EP 00977417A EP 1232278 A1 EP1232278 A1 EP 1232278A1
Authority
EP
European Patent Office
Prior art keywords
gene
steroid
dione
androstene
kstd2
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
EP00977417A
Other languages
German (de)
French (fr)
Inventor
Robert Van Der Geize
Gerda Hessels
Lubbert Dijkhuizen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Organon NV
Original Assignee
Akzo Nobel NV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Akzo Nobel NV filed Critical Akzo Nobel NV
Priority to EP00977417A priority Critical patent/EP1232278A1/en
Publication of EP1232278A1 publication Critical patent/EP1232278A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/001Oxidoreductases (1.) acting on the CH-CH group of donors (1.3)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • C12N1/205Bacterial isolates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P33/00Preparation of steroids
    • C12P33/06Hydroxylating
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12RINDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00Microorganisms ; Processes using microorganisms
    • C12R2001/01Bacteria or Actinomycetales ; using bacteria or Actinomycetales

Definitions

  • the invention relates to a method to prepare genetically modified micro-organisms having inhibited capacity for nucleus degradation of steroids, the use of such micr- organism in steroid accumulation as well as such modified micro-organisms.
  • the enzyme 3-ketosteroid ⁇ '-dehydrogenase [4-ene-3-oxosteroid:(acceptor)-l- ene-oxidoreductase, EC 1.3.99.4] is involved in cleavage of ring B of the steroid nucleus by introducing a double bond at the C1-C2 position. More particularly, the enzyme is involved in the conversion of 4-androstene-3,17-dione in 1,4-androstadiene- 3,17-dione and of 9 ⁇ -hydroxy-4-androstene-3,17-dione in 9 ⁇ -hydroxy-l,4- androstadiene-3,17-dione (see Figure 1).
  • KSTD 3-ketosteroid ⁇ '-dehydrogenase
  • the enzyme has been identified in several bacteria: Arthrobacter simplex (Penasse and Peyre, 1968 Rhodococcus. Crit Rev Biotech 14:29-73), Pseudomonas (Levy and Talalay, 1959 J Biol Chem 234:2009- 20013; 1959 J Biol Chem 234:2014-2021 ), Nocardia restrictus (Sih and Bennet, 1962 Biochem Biophys Acta 56:587-592), Nocardia corallina (Itagaki et al., 1990 Biochim Biophys Acta 1038:60-67), Nocardia opaca (Drobnic et al, 1993 Biochim Biophys Res Comm 190:509-515), Mycobacterium fortuitum (Wovcha et al, 1979 Biochim Biophys Acta 574:471-479) and Rhodococcus erythropolis IMET7030 (Kaufinann et al, 1992 J Steroid Biochem Mo lee Biol 43:297-301).
  • KSTD of N. opaca has been characterized as a flavoprotein (Lestrovaja et al, 1978 Z Allg Mikrobiol 18:189-196). Only the KSTD encoding genes (kstD: 3-ketosteroid ⁇ 1 Dehydrogenase) of A. simplex, Comamonas testosteroni and Rhodococcus rhodochrous have been fully characterized (Plesiat et al, 1991 J Bacteriol 173:7219-7227; Molnar et al, 1995 Mol Microbiol 15:895-905; Morii et al, 1998 J. Biochem 124:1026-1032).
  • Rhodococcus species are able to degrade natural phytosterols, which are inexpensive starting materials for the production of bioactive steroids (Kieslich K., 1986 Drug Res 36: 888-892).
  • Rhodococcus and Mycobacterium strains treated with mutagens and/or incubated with enzyme inhibitors convert sterols into 4-androstene-3,17-dione and l,4-androstadiene-3,17-dione (Martin, 1977 Adv Appl Microbiol 22:29-58).
  • KSTD activity is essential for steroid nucleus degradation and kstO gene inactivation is needed to accumulate steroid intermediates.
  • the nucleotide sequence of the kstO gene of R. erythropolis has been provided.
  • KSTD protein is encoded by nucleotides 820-2329 of SEQ ID ⁇ O:l.
  • Inactivation of genes is a powerful tool for analysis of gene function and for introduction of metabolic blocks.
  • Gene disruption with a non-replicative vector carrying a selective marker is the commonly used method for gene inactivation.
  • Construction of strains with desirable properties via metabolic pathway engineering approaches may require the stepwise inactivation or replacement of several genes. This is only possible when a suitable strategy for introduction of unmarked gene deletions or gene replacements, allowing infinite rounds of metabolic engineering without being dependent on multiple markers, is available.
  • a stepwise inactivation of genes preferably dehydrogenase genes, involved in steroid degradation.
  • the invention applies for an inactivation of genes involved in the accumulation of 9 ⁇ -hydroxy-4-androstene-3,17- dione by growing of micro-organisms on 4-androstene-3,17-dione.
  • at least the gene kstDl is inactivated.
  • the second enzyme is a dehydrogenase, more preferably a KSTD isoenzyme.
  • a method of site-directed mutagenesis can be used. A method for introduction of unmarked gene deletions is to be preferred for the stepwise inactivation of KSTD genes. The resulting genetically modified strains would be free of heterologous DNA.
  • At least the gene _fcstD2 is inactivated. Most preferably, at least both the genes kstDl and _fcytD2 are inactivated.
  • Another aspect of the present invention is the nucleotide sequence of the kstD2 gene of R. erythropolis. KSTD2 protein is encoded by nucleotides 1-1678 of SEQ ID NO:5. No methods for introduction of unmarked gene deletions in the genus Rhodococcus have been reported.
  • Bacteriol 179:180-186 Corynebacterium (Schafer et al, 1994 Gene 145:69-73) and Mycobacterium (Marklund et al, 1995 J Bacteriol 177:6100-6105; Norman et al, 1995 Mol Microbiol 16:755-760; Sander et al, 1995 Mol Microbiol 16:991-1000; Pelicic et al, 1996 Mol Microbiol 20:919-125; K ipfer et al, 1997 Plasmid 37:129-140).
  • Counter-selectable markers may be used to screen for the rare second recombination event resulting in gene deletion or gene replacement.
  • both sacB and rpsL proved to be useful reporter genes (Hosted and Baltz, 1997 J Bacteriol 179:180-186; Schafer et al, 1994 J Bacteriol 172:1663-1666; Sander et al, 1995 Mol Microbiol 16:991-1000; Pelicic et al, 1996 Mol Microbiol 20:919-925; Jager et al, 1992 J Bacteriol 174:5462-5465), but other suitable markers can be used as well.
  • the B. subtilis levansucrase encoded by the sacB gene, catalyzes hydrolysis of sugars and synthesis of levans (high-molecular weight fructose polymers).
  • Expression of sacB in Rhodococcus is lethal in the presence of sucrose.
  • the biochemical basis for toxicity of levansucrase action on sucrose is still unknown.
  • Conditional lethality (i.e. presence or absence of sucrose) of the sacB gene therefore can be used as a counter-selectable marker. Counter-selection in this context means that expression of the marker is lethal, instead of giving rise to resistance as is the case for selectable markers (e.g. resistance markers).
  • Counter-selection is needed to select for those mutants that have undergone a second recombination event, thereby losing the sacB marker and introducing the desired mutatioa
  • the advantage of this system is that during selection solely potentially good mutants will survive the selection. Compared to a system in which only one selection marker is used, counter-selection avoids a time consuming screening process for loss of the resistance marker that would be necessary in an one-selection-marker system.
  • unmarked mutation allows the repetitive introduction of mutations in the same strain.
  • Foreign DNA vector DNA
  • Newly introduced vector DNA for the introduction of a second mutation, therefore cannot integrate at the site of the previous mutation (by homologous recombination between vector DNA's). Integration will definitely happen if vector DNA is still present in the chromosome and will give rise to a large number of false-positive integrants.
  • the system enables the use of a sole antibiotic gene for the introduction of an infinite number of mutations.
  • Unmarked mutation also allows easy use in the industry because of the absence of heterogeneous DNA allowing easy disposal of fermentation broth.
  • Gene inactivation by gene deletion enables the construction of stable, non-reverting mutants. Especially small genes ( ⁇ 500 bp) are inactivated more easily by gene deletion compared to gene disruption by a single recombination integration. Gene deletion mutagenesis can also be apphed to inactivate a cluster of several genes from the genome. The gene deletion mutagenesis strategy can be applied also for gene- replacement (e.g. changing wild type into mutant gene).
  • Rhodococcus erythropolis The preferred strain for mutagenesis of the catabolic steroid dehydrogenases genes is Rhodococcus erythropolis.
  • these species belong to the genus Rhodococcus but also related species such as Nocardia, Mycobacterium and Arthrobacter can be used.
  • Rhodococcus Gene inactivation in Rhodococcus is hampered by the occurrence of illegitimate recombination events resulting in random genomic integration of the mutagenic vector (Desomer et al, 1991 Mol Microbiol 5:2115-2124; Barnes et al, 1997 J Bacteriol 179:6145-6153), a phenomenon we encountered when attempting to disrupt the kstDl gene in R. erythropolis SQL Illegitimate recombination is also a well-known phenomenon in some slow-growing species of Mycobacterium (McFadden, 1996 Mol Microbiol 121:205-211).
  • the introduction of a second gene inactivation event can be performed using the same methods as is illustrated in the Examples for kstD2.
  • the same methods may be used again, or, alternatively, UV irradiation or chemical means such as nitroguanidine or diepoxyethaan may be used. Methods to introduce gene mutations in that way are well known in the art.
  • micro-organisms possessing multiple gene inactivation' s can be used to accumulate steroid intermediates.
  • the accumulated product is 9 ⁇ -hydroxy-4-androstene-3,17-dione.
  • the starting material may depend on the enzyme genes which are inactivated. Suitable starting materials are e.g. phytosterols or 4-androstene-3,17-dione. The preferred starting material is 4- androstene-3 , 17-dione.
  • An advantage of the present method is that high conversion yields from the starting steroid into the accumulated product can be obtained.
  • the yields may exceed 80%, preferably more than 90% and often reach a value of almost 100%.
  • Still another aspect of the invention resides in genetically modified micro-organisms with multiple inactivated genes which are involved in steroid degradation. Especially these genes are dehydrogenases.
  • Preferably at least the gene kstDl or kstD2 is inactivated.
  • Preferred are micro-organisms belonging to the genus Rhodococcus. Most preferred is the strain Rhodococcus erythropolis RG1-UV29.
  • Rhodococcus erythropolis RG1-UV29 and Rhodococcus erythropolis RGl have been deposited at the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ), Mascheroder Weg lb, D-38124 Braunschweig, Germany under the accession numbers DSM 13157 and DSM 13156, respectively. These deposits have been made under the terms of the Budapest Treaty.
  • FIG. 1 Schematic representation of steroid nucleus degradation in R. erythropolis SQL
  • the positions of the 3-ketosteroid ⁇ 1 -dehydrogenase (KSTD) isoenzymes are indicated with KSTD 1 and KSTD3
  • FIG. 2 Schematic representation of the mutagenic vector pSDH422 with the counter-selectable marker sacB used for construction of Rhodococcus erythropolis strain RGl with an 1062 bp unmarked kstDl gene deletion.
  • ORF2 and ORF3 are the flanking genes of kstDl in R. erythropolis SQl.
  • Inserted window Southern analysis, using kstDl as a probe, of R. erythropolis chromosomal DNA digested with BamYR of wild type (lane 1), strain SDH422-3 (lane 2), SDH422-4 (lane 3) and two individual kstDl deletion mutants (lanes 4 and 5).
  • a degenerated kstD oligonucleotide probe [5' ttcgg(c/g)gg(c/g)ac(c/g)tc(c/g)gc(c/g)tac tc(c/g)gg(c/g)gc(c/g)tc(c/g)atctgg] (SEQ ID NO:2) was developed from an alignment of the N-terminal parts of known KSTD protein sequences of A. simplex, C. testosteroni and N. opaca. Total D ⁇ A of R. erythropolis SQl digested with Bgl ⁇ l was sized by sucrose gradient centrifugation. Southern analysis at 68 °C (stringent washes with
  • KstDl deletion strain A mutagenic vector was constructed that contains a R. erythropolis SQl chromosomal DNA fragment with a kstDl deletion. A 1062 bp Bsml fragment of pSDH200, encoding a large internal part of KSTD1, was deleted to construct pSDH200)BsmI. For construction of the mutagenic vector a 2724 bp Smal/EcoRl fragment of pSDH200)BsmI harbouring the remaining 468 bp of kstDl and its flanking regions was cloned into the SmaVEcoBI site of pKl ⁇ mobsacB (pSDH422, see Figure 2).
  • the vector pSDH422 encoding kanamycin resistance to select for integration of the mutagenic vector into the chromosome and harbouring the sacB gene of B. subtilis for counter- selection, was introduced into E.coli SI 7-1 and mobilized to R. erythropolis SQl by conjugation as follows. Cells of the R. erythropolis SQl recipient strain were spread on LBP agar supplemented with 30 ⁇ g-ml "1 nalidixic acid and grown for 5 days. The mutagenic vector pSDH422 was first introduced in E.coli SI 7-1 by transformation.
  • Transformants (approx. 1000 per plate) grown overnight on selective media (kanamycin 25 ⁇ g ml "1 ) were incubated at room temperature for another 24 h.
  • Colonies of both Rhodococcus and E.coli strains were resuspended in a final volume of 1.5 ml of LBP (1% bacto-pepton (Difco), 0.5% yeast extract (BBL) and 1% NaCl). Aliquots of 750 ⁇ l of each strain were mixed and gently pelleted by centrifugation. The pellet was resuspended in 1 ml LBP and cells were spread on non-selective LBP agar in 250 ⁇ l aliquots.
  • LBP bacto-pepton
  • BBL yeast extract
  • kanamycin resistant (kan r ) Rhodococcus transconjugants were sucrose sensitive (suc s ); no growth occurred after replica plating on LBPS (1% bacto-pepton, 0.5% yeast extract, 1% NaCl, 10% sucrose) agar supplemented with 200 ⁇ g-ml "1 kanamycin.
  • Late exponential phase R. erythropolis RGl cells (2-10 8 CFUs-ml "1 ) grown in 10 mM glucose mineral medium (K 2 HPO 4 4.65 g-1 "1 , NaH 2 PO 4 H 2 O 1.5 g-1 "1 , NH_tCl 3 g l “1 , MgSO 4 -7H 2 O 1 g-1 "1 , Vishniac trace elements, pH 7.2) were sonicated for a short period of time to obtain single cells. Diluted (10 4 ) samples were spread on glucose mineral agar medium and irradiated for 15-20 sec with an UV lamp (Philips TAW 15W) at a distance of 27 cm, on average resulting in 95% killing of cells.
  • Example 4 Microbiological 9 ⁇ -hydroxylation of 4-androstene-3,17dione with UV-mutant Rhodococcus erythropolis UV-29.
  • Rhodococcus erythropolis SQl UV-29 is a UV-mutant which is capable of conversion of 4-androstene-3,17-dione (AD) into 9 -hydroxy-4-androstene-3,17-dione (9 ⁇ OH-AD) with concentration of 10 to 20 g/1. This conversion was performed using the following method:
  • a 10 liter fermentor with 6 liter in situ sterilized fermentation broth (1.5% yeast extract, 1.5% glucose, 0.01% antifoaming agent polypropylene glycol; pH 7.5) was inoculated with preculture (1%) and incubated at 28°C for 16 hours under sparging with sterile air and the culture was agitated to induce submerged growth.
  • a gene library of R. erythropolis RGl was introduced into competent R. erythropolis strain RG1-UV29 by electrotransformation. Colonies obtained were replica plated onto mineral agar medium containing 4-androstene-3,17-dione (0.5 g/1) as sole carbon and energy source. Complementation of the strain RG1-UV29 phenotype was scored after three days of incubation at 30 °C. Colonies growing on 4-androstene-3,17-dione mineral agar medium were cultivated in LBP medium for isolation of plasmid DNA, that was subsequently re- introduced into strain RG1-UV29 to check for genuine complementation.
  • Plasmid pKSDIOl isolated from a transformant that showed restored growth on 4-androstene-3,17-dione mineral medium, was introduced into E. coli DH5 ⁇ for further analysis. An insert of approximately 6.5 kb rhodococcal DNA was identified in pKSDIOl and subjected to restriction mapping analysis, subcloning and subsequent complementation experiments. A 3.6 kb EcoRI DNA fragment of pKSDIOl was still able to restore the strain RG1-UV29 phenotype and thus was subcloned in pBluescript(II) KS (pKSD105) for nucleotide sequencing.
  • Nucleotide sequence analysis revealed the presence of a large open reading frame (ORF) of 1,698 nt, encoding a putative protein of 565 amino acids with a calculated molecular weight of 60.2 kDa.
  • This ORF was designated kstDl (SEQ ID NO :5)( which is identical to the previously described kstDl - see Example 3).
  • the deduced amino acid sequence of kstD2 showed high similarity to known 3-ketosteroid ⁇ '-dehydrogenases (KSTD) indicating that kstD2 encodes a second KSTD enzyme in R. erythropolis RGl .
  • KSTD 3-ketosteroid ⁇ '-dehydrogenases
  • R. erythropolis strain RG7 is a mutant strain, obtained from wild type R. erythropolis strain SQl, containing a single kstD2 gene deletion.
  • R. erythropolis strain RG8 is constructed by the successive deletion of two genes encoding 3-ketosteroid ⁇ 1 - dehydrogenase activity, i.e. kstDl and kstD2, from wild type R. erythropolis strain SQl.
  • Strain RG8 was obtained by deletion of the kstD2 gene from the genome of the kstDl deletion mutant R. erythropolis strain RGl.
  • the method used for kstD2 gene deletion was analogous to the method described for kstDl gene deletion in example 2, except for the fact that a different mutagenic vector was used (pKSD201 versus pSDH422).
  • the mutagenic vector pKSD201 was constructed as follows. A 1,093 bp internal DNA fragment of the kstD2 gene was deleted by Mlul digestion and subsequent self-ligation of pKSD105, resulting in construction of pKSD200. A 2.4 kb EcoRI fragment of pKSD200 harboring the mutated kstD2 gene was ligated into EcoRI digested pK18mobsacB, thereby constructing pKSD201. Plasmid pKSD201 was introduced into E. coli SI 7-1 and mobilized by conjugation to R. erythropolis strain SQl (to construct strain RG7), or strain RGl (to construct strain RG8).
  • Transconjugants resulting from targeted integration of pKSD201 into the genome appeared after 3 days of growth at 30 °C. Deletion of kstD2 was achieved by growth of one selected transconjugant (suc s kan r ) overnight under non-selective conditions (i.e. LBP medium) and subsequent plating on selective LBPS agar medium.
  • Rhodococcus erythropolis RG8 is a kstDl and kstD2 double deletion mutant which is capable of conversion of 4-androstene-3,17-dione (AD) into 9 ⁇ -hydroxy-4-androstene- 3,17-dione (9 ⁇ OH- AD) with a concentration of 10 g/1.
  • a 10 liter fermentor with 6 liter in situ sterilized fermentation broth (1.5% yeast extract, 1.5% glucose, 0.01% antifoaming agent polypropylene glycol; pH 7.5) was inoculated with preculture (1%) and incubated at 28°C for 16 hours under sparging with sterile air and the culture was agitated to induce submerged growth.
  • the microorganism identified under I. above was accompanied by
  • This International Depositary Authority accepts the microorganism identified under 1 above, which was received by it on 1999 - 11 - 25 (Date of the original deposit)'.
  • microorganism idenufied under I above was received by this International Depositary Authority on (date of original deposit) and a request to conven the original deposit to a deposit under the Budapest Treatv was received by it on (date of receipt of request for conversion)
  • the microorganism identified under I above was accompanied by
  • microorganism identified under I above was received by this International Depositary Authority on (date of original deposit) and a request to convert the original deposit to a deposit under the Budapest Treaty was received by it on (date of receipt of request for conversion)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Virology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

A method is described to construct genetically modified strains of steroid degrading micro-organisms wherein multiple genes involved in steroid nucleus degradation are inactivated, such as steroid dehydrogenase genes. Examples for such genes are kstD1 and kstD2: strains with multiple inactivated steroid degrading enzyme genes can be used in the accumulation of steroid intermediates with a high yield. A preferred accumulation product is 9α-hydroxy-4-androstene-3,17-dione.

Description

Microbial 9α-hydroxylation of steroids
The invention relates to a method to prepare genetically modified micro-organisms having inhibited capacity for nucleus degradation of steroids, the use of such micr- organism in steroid accumulation as well as such modified micro-organisms.
The ability to degrade phytosterols is widespread in nocardioform actinomycetes and requires a set of enzymes degrading the side-chain and the steroid nucleus structure.
The enzyme 3-ketosteroid Δ'-dehydrogenase (KSTD) [4-ene-3-oxosteroid:(acceptor)-l- ene-oxidoreductase, EC 1.3.99.4] is involved in cleavage of ring B of the steroid nucleus by introducing a double bond at the C1-C2 position. More particularly, the enzyme is involved in the conversion of 4-androstene-3,17-dione in 1,4-androstadiene- 3,17-dione and of 9α-hydroxy-4-androstene-3,17-dione in 9α-hydroxy-l,4- androstadiene-3,17-dione (see Figure 1). The enzyme has been identified in several bacteria: Arthrobacter simplex (Penasse and Peyre, 1968 Rhodococcus. Crit Rev Biotech 14:29-73), Pseudomonas (Levy and Talalay, 1959 J Biol Chem 234:2009- 20013; 1959 J Biol Chem 234:2014-2021 ), Nocardia restrictus (Sih and Bennet, 1962 Biochem Biophys Acta 56:587-592), Nocardia corallina (Itagaki et al., 1990 Biochim Biophys Acta 1038:60-67), Nocardia opaca (Drobnic et al, 1993 Biochim Biophys Res Comm 190:509-515), Mycobacterium fortuitum (Wovcha et al, 1979 Biochim Biophys Acta 574:471-479) and Rhodococcus erythropolis IMET7030 (Kaufinann et al, 1992 J Steroid Biochem Mo lee Biol 43:297-301). KSTD of N. opaca has been characterized as a flavoprotein (Lestrovaja et al, 1978 Z Allg Mikrobiol 18:189-196). Only the KSTD encoding genes (kstD: 3-ketosteroid Δ1 Dehydrogenase) of A. simplex, Comamonas testosteroni and Rhodococcus rhodochrous have been fully characterized (Plesiat et al, 1991 J Bacteriol 173:7219-7227; Molnar et al, 1995 Mol Microbiol 15:895-905; Morii et al, 1998 J. Biochem 124:1026-1032).
The exclusive inhibition of the steroid 1 ,2-dehydrogenase causes accumulation of 9 - hydroxy-4-androstene-3,17-dione, an excellent starting material for corticoid synthesis (Kieslich K., 1985 J Basic Microbiol 25:461-474). 9α-Hydroxyandrogens are of industrial importance as anti-androgens, anti-estrogens and antifertility. The 9α-hydroxy group is easily dehydrated to the 9(1 l)-dehydro system and offers a starting structure for the production of 9α-halogen corticoids. Rhodococcus species are well-known for their large catabolic potential (Warhurst and Fewson, 1994 Rhodococcus. Crit Rev Biotech 14:29-73; Bell et al, 1998 J Appl Microbiol 85:195-210). Several Rhodococcus species are able to degrade natural phytosterols, which are inexpensive starting materials for the production of bioactive steroids (Kieslich K., 1986 Drug Res 36: 888-892). Rhodococcus and Mycobacterium strains treated with mutagens and/or incubated with enzyme inhibitors convert sterols into 4-androstene-3,17-dione and l,4-androstadiene-3,17-dione (Martin, 1977 Adv Appl Microbiol 22:29-58).
Although cloning of kstD and expression of an inactive KSTD protein o R. erythropolis IMET7030 in Escherichia coli have been described (Wagner et al, 1992 J Basic Microbiol 32:65-71; 1992 J Basic Microbiol 32:269-277) and a nucleotide sequence of N. opaca (Drobnic et al, 1993 Biochem Biophys Res Comm 190:509-515) (synonym R. erythropolis IMET7030) is available (DDBJ/EMBL/GenBank U59422), no molecular characterization of this gene has been reported. KSTD activity is essential for steroid nucleus degradation and kstO gene inactivation is needed to accumulate steroid intermediates. According to one aspect of the present invention the nucleotide sequence of the kstO gene of R. erythropolis has been provided. KSTD protein is encoded by nucleotides 820-2329 of SEQ ID ΝO:l.
Inactivation of genes is a powerful tool for analysis of gene function and for introduction of metabolic blocks. Gene disruption with a non-replicative vector carrying a selective marker is the commonly used method for gene inactivation. Construction of strains with desirable properties via metabolic pathway engineering approaches, however, may require the stepwise inactivation or replacement of several genes. This is only possible when a suitable strategy for introduction of unmarked gene deletions or gene replacements, allowing infinite rounds of metabolic engineering without being dependent on multiple markers, is available. According to another aspect of the present invention there is provided a stepwise inactivation of genes, preferably dehydrogenase genes, involved in steroid degradation. In particular the invention applies for an inactivation of genes involved in the accumulation of 9α-hydroxy-4-androstene-3,17- dione by growing of micro-organisms on 4-androstene-3,17-dione. Preferably, at least the gene kstDl is inactivated.
It was unexpectedly found that disruption of the kstDl gene encoding 3-ketosteroid Δ - dehydrogenase in R. erythropolis SQ1 did not result in inactivation of steroid nucleus degradation. The remaining activity appeared to be based on the presence of a second enzyme. It has now been found that inactivation of more than one gene is required to obtain a strain completely blocked in steroid nucleus degradation. Preferably the second enzyme is a dehydrogenase, more preferably a KSTD isoenzyme. In order to make it possible to disrupt or delete several genes, preferably a method of site-directed mutagenesis can be used. A method for introduction of unmarked gene deletions is to be preferred for the stepwise inactivation of KSTD genes. The resulting genetically modified strains would be free of heterologous DNA.
According to another preferred embodiment of this invention, at least the gene _fcstD2 is inactivated. Most preferably, at least both the genes kstDl and _fcytD2 are inactivated. Another aspect of the present invention is the nucleotide sequence of the kstD2 gene of R. erythropolis. KSTD2 protein is encoded by nucleotides 1-1678 of SEQ ID NO:5. No methods for introduction of unmarked gene deletions in the genus Rhodococcus have been reported. Gene deletion or gene replacement methods, however, have been described for some other members of the actinomycetales, namely Streptomyces (Hillemann et al, 1991 Nucleic Acid Res 19:727-731; Hosted and Baltz, 1997 J. Bacteriol 179:180-186), Corynebacterium (Schafer et al, 1994 Gene 145:69-73) and Mycobacterium (Marklund et al, 1995 J Bacteriol 177:6100-6105; Norman et al, 1995 Mol Microbiol 16:755-760; Sander et al, 1995 Mol Microbiol 16:991-1000; Pelicic et al, 1996 Mol Microbiol 20:919-125; K ipfer et al, 1997 Plasmid 37:129-140). Counter-selectable markers may be used to screen for the rare second recombination event resulting in gene deletion or gene replacement. In this respect, both sacB and rpsL proved to be useful reporter genes (Hosted and Baltz, 1997 J Bacteriol 179:180-186; Schafer et al, 1994 J Bacteriol 172:1663-1666; Sander et al, 1995 Mol Microbiol 16:991-1000; Pelicic et al, 1996 Mol Microbiol 20:919-925; Jager et al, 1992 J Bacteriol 174:5462-5465), but other suitable markers can be used as well. The use of rpsL in Rhodococcus has not been reported, but sacB (encoding the Bacillus subtilis levansucrase) provides a potent positive selection marker in this genus (Jager et al, 1995 FEMS Microbiol Lett 126:1-6; Denis-Larose et al, 1998 Appl Environ Microbiol 64:4363-4367).
The B. subtilis levansucrase, encoded by the sacB gene, catalyzes hydrolysis of sugars and synthesis of levans (high-molecular weight fructose polymers). Expression of sacB in Rhodococcus is lethal in the presence of sucrose. The biochemical basis for toxicity of levansucrase action on sucrose is still unknown. Conditional lethality (i.e. presence or absence of sucrose) of the sacB gene therefore can be used as a counter-selectable marker. Counter-selection in this context means that expression of the marker is lethal, instead of giving rise to resistance as is the case for selectable markers (e.g. resistance markers). Counter-selection is needed to select for those mutants that have undergone a second recombination event, thereby losing the sacB marker and introducing the desired mutatioa The advantage of this system is that during selection solely potentially good mutants will survive the selection. Compared to a system in which only one selection marker is used, counter-selection avoids a time consuming screening process for loss of the resistance marker that would be necessary in an one-selection-marker system.
An advantage of unmarked mutation is that it allows the repetitive introduction of mutations in the same strain. Foreign DNA (vector DNA) is removed in the process of introducing the mutation. Newly introduced vector DNA, for the introduction of a second mutation, therefore cannot integrate at the site of the previous mutation (by homologous recombination between vector DNA's). Integration will definitely happen if vector DNA is still present in the chromosome and will give rise to a large number of false-positive integrants. The system enables the use of a sole antibiotic gene for the introduction of an infinite number of mutations. Unmarked mutation also allows easy use in the industry because of the absence of heterogeneous DNA allowing easy disposal of fermentation broth.
Gene inactivation by gene deletion enables the construction of stable, non-reverting mutants. Especially small genes (<500 bp) are inactivated more easily by gene deletion compared to gene disruption by a single recombination integration. Gene deletion mutagenesis can also be apphed to inactivate a cluster of several genes from the genome. The gene deletion mutagenesis strategy can be applied also for gene- replacement (e.g. changing wild type into mutant gene).
The preferred strain for mutagenesis of the catabolic steroid dehydrogenases genes is Rhodococcus erythropolis. However, unmarked gene deletion of kstDl and/or kstD2 in other species, genetically accessible by conjugation, is conceivable if the molecular organization is the same (or similar) as in R. erythropolis SQL Preferably these species belong to the genus Rhodococcus but also related species such as Nocardia, Mycobacterium and Arthrobacter can be used.
Gene inactivation in Rhodococcus is hampered by the occurrence of illegitimate recombination events resulting in random genomic integration of the mutagenic vector (Desomer et al, 1991 Mol Microbiol 5:2115-2124; Barnes et al, 1997 J Bacteriol 179:6145-6153), a phenomenon we encountered when attempting to disrupt the kstDl gene in R. erythropolis SQL Illegitimate recombination is also a well-known phenomenon in some slow-growing species of Mycobacterium (McFadden, 1996 Mol Microbiol 121:205-211). Coηjugative plasmid transfer from E.coli S17-1 to Rhodococcus has been shown to minimize random integration (Powell and Archer, 1998 Antinie van Leeuwenhoek 74:175-188). Conjugative mobilization of plasmids from E. coli strain SI 7-1 to many different strains of coryneform bacteria and to Rhodococcus fascians DSM20131 has been proven possible (Schafer et al, 1990 J. Bacteriol 172:1663-1666; Jager et al, 1995 FEMS Microbiol Lett 126:1-6). According to the present invention conjugative transfer of a mutagenic vector carrying the sacB gene as counter-selectable marker therefore was adopted for introduction of unmarked gene deletions in steroid catabolism in ?. erythropolis SQL
As a further embodiment of the present invention, the introduction of a second gene inactivation event can be performed using the same methods as is illustrated in the Examples for kstD2. For even further gene inactivation, the same methods may be used again, or, alternatively, UV irradiation or chemical means such as nitroguanidine or diepoxyethaan may be used. Methods to introduce gene mutations in that way are well known in the art.
Also, methods to construct vehicles to be used in the mutagenesis protocol are well known (Sambrook et al, Molecular Cloning: a Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, latest edition). Furthermore, techniques for site directed mutagenesis, ligation of additional sequences, PCR, sequencing of DNA and construction of suitable expression systems are all, by now, well known in the art. Portions or all of the DNA encoding the desired protein can be constructed synthetically using standard solid phase techniques, preferably to include restriction sites for ease of ligation.
Modifications and variations of the method for introducing disrupted gene mutations or unmarked gene deletion as well as transformation and conjugation will be obvious to those skilled in the art from the foregoing detailed description of the invention. Such modifications and variations are intended to come within the scope of present application.
According to another aspect of the present invention micro-organisms possessing multiple gene inactivation' s can be used to accumulate steroid intermediates. Preferably the accumulated product is 9α-hydroxy-4-androstene-3,17-dione. The starting material may depend on the enzyme genes which are inactivated. Suitable starting materials are e.g. phytosterols or 4-androstene-3,17-dione. The preferred starting material is 4- androstene-3 , 17-dione.
An advantage of the present method is that high conversion yields from the starting steroid into the accumulated product can be obtained. The yields may exceed 80%, preferably more than 90% and often reach a value of almost 100%. Still another aspect of the invention resides in genetically modified micro-organisms with multiple inactivated genes which are involved in steroid degradation. Especially these genes are dehydrogenases. Preferably at least the gene kstDl or kstD2 is inactivated. In particular preferred is the inactivation of both genes kstDl and _fcstD2. Preferred are micro-organisms belonging to the genus Rhodococcus. Most preferred is the strain Rhodococcus erythropolis RG1-UV29.
The micro-organism strains Rhodococcus erythropolis RG1-UV29 and Rhodococcus erythropolis RGl have been deposited at the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ), Mascheroder Weg lb, D-38124 Braunschweig, Germany under the accession numbers DSM 13157 and DSM 13156, respectively. These deposits have been made under the terms of the Budapest Treaty.
A person skilled in the art will understand how to use the methods and materials described and referred to in this document in order to construct micro-organisms lacking the ability to degrade the steroid nucleus. Multiple genes encoding for several other steroid nucleus degrading enzymes can similarly be inactivated.
The following examples are illustrative for the invention and should in no way be interpreted as limiting the scope of the invention.
Legends to the figures
Figure 1 Schematic representation of steroid nucleus degradation in R. erythropolis SQL The positions of the 3-ketosteroid Δ1 -dehydrogenase (KSTD) isoenzymes are indicated with KSTD 1 and KSTD3
Figure 2 Schematic representation of the mutagenic vector pSDH422 with the counter-selectable marker sacB used for construction of Rhodococcus erythropolis strain RGl with an 1062 bp unmarked kstDl gene deletion. ORF2 and ORF3 are the flanking genes of kstDl in R. erythropolis SQl.
Figure 3
Schematic overview of the molecular organization of -fcstDl in wild type R. erythropolis SQl and after integration of pSDH422 by a single cross-over event at the targeted locus downstream (strain SDH422-3) and upstream (strain SDH422-4) of AstDl, respectively.
Inserted window: Southern analysis, using kstDl as a probe, of R. erythropolis chromosomal DNA digested with BamYR of wild type (lane 1), strain SDH422-3 (lane 2), SDH422-4 (lane 3) and two individual kstDl deletion mutants (lanes 4 and 5).
Figure 4
Bioconversions in 6 liter culture of Rhodococcus erythropolis SQl UV-29 of 4- androstene-3,17-dione into 9α-hydroxy-4-androstene-3,17-dione. 10 g/1 AD (-O-) and 20 g/l AD (-Δ-, -*-, -X-)
Figure 5 Bioconversion in 6 liter culture of Rhodococcus erythropolis RG8 of 4-androstene-3,17- dione into 9α-hydroxy-4-androstene-3,17-dione. 10 g/1 AD (-Δ-, -X-)
Examples
Example 1 kstDl characterization.
A degenerated kstD oligonucleotide probe [5' ttcgg(c/g)gg(c/g)ac(c/g)tc(c/g)gc(c/g)tac tc(c/g)gg(c/g)gc(c/g)tc(c/g)atctgg] (SEQ ID NO:2) was developed from an alignment of the N-terminal parts of known KSTD protein sequences of A. simplex, C. testosteroni and N. opaca. Total DΝA of R. erythropolis SQl digested with Bglϊl was sized by sucrose gradient centrifugation. Southern analysis at 68 °C (stringent washes with
2xSSC for 2x15 min and O.lxSSC for 2x10 min) of fractions obtained yielded a 6 kb DΝA fragment hybridizing with digoxigenine-labelled kstD oligonucleotide probe. This fragment was ligated into the BglU site of the Rhodococcus-E. coli shuttle-vector pDA71 (Dabs et al., 1995 Development of improved Rhodococcus plasmid vectors and their use in cloning genes of potential commercial and medical importance, p.129-135.
In: Proceedings of the Ninth Symposium on the Actinomycetes, Moscow, Russia) and subcloned into BamHl digested pBluescript II KS (Stratagene) (pSDH200).
From restriction mapping analysis we concluded that only one EcoRV site was present on the 6 kb fragment, dividing it into equally sized fragments of approximately 3 kb. Southern analysis showed that an approximately 2.9 kb ΕcoRV fragment of pSDH200 contained sequences homologous to the kstD oligonucleotide. Nucleotide sequencing revealed an open reading frame of 1,533 nt (kstDl, see SΕQ ID NO:l) encoding KSTD1, as was demonstrated by heterologous expression in Escherichia. Further nucleotide sequencing revealed two ORFs of 1,533 nt (ORFl) and 627 nt (ORF2) encoding putative proteins of 510 aa and 208 aa, respectively.
Example 2
KstDl deletion strain. A mutagenic vector was constructed that contains a R. erythropolis SQl chromosomal DNA fragment with a kstDl deletion. A 1062 bp Bsml fragment of pSDH200, encoding a large internal part of KSTD1, was deleted to construct pSDH200)BsmI. For construction of the mutagenic vector a 2724 bp Smal/EcoRl fragment of pSDH200)BsmI harbouring the remaining 468 bp of kstDl and its flanking regions was cloned into the SmaVEcoBI site of pKlδmobsacB (pSDH422, see Figure 2). The vector pSDH422, encoding kanamycin resistance to select for integration of the mutagenic vector into the chromosome and harbouring the sacB gene of B. subtilis for counter- selection, was introduced into E.coli SI 7-1 and mobilized to R. erythropolis SQl by conjugation as follows. Cells of the R. erythropolis SQl recipient strain were spread on LBP agar supplemented with 30 μg-ml"1 nalidixic acid and grown for 5 days. The mutagenic vector pSDH422 was first introduced in E.coli SI 7-1 by transformation.
Transformants (approx. 1000 per plate) grown overnight on selective media (kanamycin 25 μg ml"1) were incubated at room temperature for another 24 h. Colonies of both Rhodococcus and E.coli strains were resuspended in a final volume of 1.5 ml of LBP (1% bacto-pepton (Difco), 0.5% yeast extract (BBL) and 1% NaCl). Aliquots of 750 μl of each strain were mixed and gently pelleted by centrifugation. The pellet was resuspended in 1 ml LBP and cells were spread on non-selective LBP agar in 250 μl aliquots. After growth overnight at 30°C the confluently grown material was resuspended in 2 ml LBP medium and 100 μl aliquots spread on LBP agar supplemented with kanamycin (200 μg-ml"1) and nalidixic acid (30 μg-ml' ). R. erythropolis SQl transconjugants appeared after 3 days. All resulting kanamycin resistant (kanr) Rhodococcus transconjugants were sucrose sensitive (sucs); no growth occurred after replica plating on LBPS (1% bacto-pepton, 0.5% yeast extract, 1% NaCl, 10% sucrose) agar supplemented with 200 μg-ml"1 kanamycin. Southern analysis (Fig. 3) of wild type (lane 1 : single band of approx. 4500 bp) and of two transconjugants, SDH422-3 (lane 2: two bands of approx. 2900 and 10100 bp) and SDH422-4 (lane 3: two bands of approx. 4000 and 9000 bp) revealed that both had retained one copy of pSDH422 integrated at the targeted locus by a single recombination event. Gene deletion of kstDl in the R. erythropolis SDH422-3 strain was achieved during growth overnight under non-selective conditions, made visible by subsequent plating on selective medium, i.e. LBPS agar
Gene deletion of the kstDl gene was achieved during growth overnight under non- selective conditions and subsequent plating on selective medium, i.e. LBPS agar. Colony PCR with kstDl primers (forward primer [5' gcgcatatgcaggactggaccagcgagtgc] (SEQ ID NO:3); reverse primer [5' gcgggatccgcgttacttcgccatgtcctg](SEQ ID NO:4)) on 9 suc7kans colonies resulted in 6 PCR products with fragment sizes of 468 bp comprising the deleted kstDl gene. Gene deletion was confirmed by Southern analysis at 60 °C (stringent washes with 2xSSC for 2x5 min and O.lxSSC for 2x5 min) using randomly digoxigenine-labelled kstDl gene as a probe. The 4.5 kb kstDl DNA fragment of wild type obtained after Bam l digestion of chromosomal DNA was reduced to 3.4 kb in the gene deletion mutants, indicating deletion of the expected 1062 bp kstDl DNA fragment. The resulting strain was denoted R. erythropolis RGl.
Example 3 Inactivation of steroid Δ ' -dehydrogenation by UV mutagenesis.
Late exponential phase R. erythropolis RGl cells (2-108 CFUs-ml"1) grown in 10 mM glucose mineral medium (K2HPO4 4.65 g-1"1, NaH2PO4 H2O 1.5 g-1"1, NH_tCl 3 g l"1, MgSO4-7H2O 1 g-1"1, Vishniac trace elements, pH 7.2) were sonicated for a short period of time to obtain single cells. Diluted (104) samples were spread on glucose mineral agar medium and irradiated for 15-20 sec with an UV lamp (Philips TAW 15W) at a distance of 27 cm, on average resulting in 95% killing of cells. After 4 days of incubation, colonies were replica plated on 4-androstene-3,17-dione (0.5 g-1"1, solubilized in DMSO (50 mg-ml"1)) mineral agar medium. Steroid growth deficient mutants scored after 3-4 days were selected for further characterization. To select for strains blocked in Δ - dehydrogenation the mutant population was screened for 4-androstene-3,17-dione growth deficient mutants able to grow on l,4-androstadiene-3,17-dione (0.25 g-1"1) mineral agar medium. It can be concluded that the gene was inactivated. The gene was called kstDl (see Figure 1).
Example 4 Microbiological 9α-hydroxylation of 4-androstene-3,17dione with UV-mutant Rhodococcus erythropolis UV-29.
Rhodococcus erythropolis SQl UV-29 is a UV-mutant which is capable of conversion of 4-androstene-3,17-dione (AD) into 9 -hydroxy-4-androstene-3,17-dione (9αOH-AD) with concentration of 10 to 20 g/1. This conversion was performed using the following method:
A 250 ml Erlenmeyer flask containing 75 ml sterile medium (1.5% yeast extract, 1.5% glucose; pH 7.0) was grown with Rhodococcus erythropolis SQl UV-29 on a rotary shaker (180 rpm) at 28 °C for 24 hours (preculture). A 10 liter fermentor with 6 liter in situ sterilized fermentation broth (1.5% yeast extract, 1.5% glucose, 0.01% antifoaming agent polypropylene glycol; pH 7.5) was inoculated with preculture (1%) and incubated at 28°C for 16 hours under sparging with sterile air and the culture was agitated to induce submerged growth. Then a suspension of 60 gram 4-androstene-3,17-dione in 300 ml polysorbate (0.1%) was introduced. Aerobic incubation with agitation at 28°C was then resumed for 24 hours. Samples of the culture were then extracted with methanol (70%) and filtrated over a dead-end 0.45 μm filter before the steroid composition was determined with HPLC. The same procedure was performed in triple with a two-times higher AD-concentration of 20 g/1, by adding 120 g instead of 60 g AD. As shown in figure 4 within 24 hours 10-20 g/1 of 4-androstene-3,17-dione is almost completely conversed into 9α-hydroxy-4-androstene-3,17-dione (approximately 93% of total 4-androstene-3,17-dione).
Example 5 kstD2 characterization.
A gene library of R. erythropolis RGl was introduced into competent R. erythropolis strain RG1-UV29 by electrotransformation. Colonies obtained were replica plated onto mineral agar medium containing 4-androstene-3,17-dione (0.5 g/1) as sole carbon and energy source. Complementation of the strain RG1-UV29 phenotype was scored after three days of incubation at 30 °C. Colonies growing on 4-androstene-3,17-dione mineral agar medium were cultivated in LBP medium for isolation of plasmid DNA, that was subsequently re- introduced into strain RG1-UV29 to check for genuine complementation. Plasmid pKSDIOl, isolated from a transformant that showed restored growth on 4-androstene-3,17-dione mineral medium, was introduced into E. coli DH5α for further analysis. An insert of approximately 6.5 kb rhodococcal DNA was identified in pKSDIOl and subjected to restriction mapping analysis, subcloning and subsequent complementation experiments. A 3.6 kb EcoRI DNA fragment of pKSDIOl was still able to restore the strain RG1-UV29 phenotype and thus was subcloned in pBluescript(II) KS (pKSD105) for nucleotide sequencing. Nucleotide sequence analysis revealed the presence of a large open reading frame (ORF) of 1,698 nt, encoding a putative protein of 565 amino acids with a calculated molecular weight of 60.2 kDa. This ORF was designated kstDl (SEQ ID NO :5)( which is identical to the previously described kstDl - see Example 3). The deduced amino acid sequence of kstD2 showed high similarity to known 3-ketosteroid Δ'-dehydrogenases (KSTD) indicating that kstD2 encodes a second KSTD enzyme in R. erythropolis RGl .
Example 6 kstD2 deletion strains.
R. erythropolis strain RG7 is a mutant strain, obtained from wild type R. erythropolis strain SQl, containing a single kstD2 gene deletion. R. erythropolis strain RG8 is constructed by the successive deletion of two genes encoding 3-ketosteroid Δ1- dehydrogenase activity, i.e. kstDl and kstD2, from wild type R. erythropolis strain SQl. Strain RG8 was obtained by deletion of the kstD2 gene from the genome of the kstDl deletion mutant R. erythropolis strain RGl. The method used for kstD2 gene deletion was analogous to the method described for kstDl gene deletion in example 2, except for the fact that a different mutagenic vector was used (pKSD201 versus pSDH422).
The mutagenic vector pKSD201 was constructed as follows. A 1,093 bp internal DNA fragment of the kstD2 gene was deleted by Mlul digestion and subsequent self-ligation of pKSD105, resulting in construction of pKSD200. A 2.4 kb EcoRI fragment of pKSD200 harboring the mutated kstD2 gene was ligated into EcoRI digested pK18mobsacB, thereby constructing pKSD201. Plasmid pKSD201 was introduced into E. coli SI 7-1 and mobilized by conjugation to R. erythropolis strain SQl (to construct strain RG7), or strain RGl (to construct strain RG8). Transconjugants (suc kanr), resulting from targeted integration of pKSD201 into the genome appeared after 3 days of growth at 30 °C. Deletion of kstD2 was achieved by growth of one selected transconjugant (sucs kanr) overnight under non-selective conditions (i.e. LBP medium) and subsequent plating on selective LBPS agar medium. Colony PCR performed on 15 suc7kans colonies with kstD2 primers (forward primer [5' gcgcatatggctaagaatcaggcaccc](SΕQ ID NO:6); reverse primer [5' gcgggatccctacttctctgctgcgtgatg](SEQ ID NO:7)) resulted in 4 PCR products with fragment sizes of 0.6 kb, comprising the remaining part of the kstD2 gene. Southern analysis using dig- labeled kstD2 gene as a probe on Asp! IS digested chromosomal DNA of wild type and these 4 obtained mutants confirmed deletion of kstD2: wild type AspllS DNA fragment of 2.4 kb was reduced to 1.3 kb in the mutant strains.
Example 7
Microbial 9α-hydroxylation of 4-androstene-3,17-dione with R. erythropolis strain RG8.
Rhodococcus erythropolis RG8 is a kstDl and kstD2 double deletion mutant which is capable of conversion of 4-androstene-3,17-dione (AD) into 9α-hydroxy-4-androstene- 3,17-dione (9αOH- AD) with a concentration of 10 g/1.
This conversion was performed using the following method:
A 250 ml Erlenmeyer flask containing 75 ml sterile medium (1.5% yeast extract, 1.5% glucose; pH 7.0) was grown with Rhodococcus erythropolis RG8 on a rotary shaker (180 rpm) at 28 °C for 24 hours (preculture). A 10 liter fermentor with 6 liter in situ sterilized fermentation broth (1.5% yeast extract, 1.5% glucose, 0.01% antifoaming agent polypropylene glycol; pH 7.5) was inoculated with preculture (1%) and incubated at 28°C for 16 hours under sparging with sterile air and the culture was agitated to induce submerged growth. Then a suspension of 60 gram 4-androstene-3,l 7-dione in 300 ml polysorbate (0.1%) was introduced. Aerobic incubation with agitation at 28°C was then resumed for 24 hours. Samples were taken during the process. These samples were extracted with methanol (70%) and filtrated over a dead-end 0.45μm filter before the steroid composition was determined with HPLC. This process was performed twice.
As shown in figure 5 within 15 hours 10 g/1 of 4-androstene-3,l 7-dione is almost completely converted into 9α-hydroxy-4-androstene-3,l 7-dione (approximately 92-96% of the total 4-androstene-3, 17-dione).
BUDAPEST TREATY ON THE INTERNATIONAL
RECOGNITION OF THE DEPOSIT OF MICROORGANISMS
FOR THE PURPOSES OF PATENT PROCEDURE
INTERNATIONAL FORM
Akzo Nobel N.V. Velperweg 76
NL-2824 BM Arnhem
VIABILITY STATEMENT issued pursuant to Rule 10 2 by the INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
I DEPOSITOR II IDENTIFICATION OF THE MICROORGANISM
Name Akzo Nobel N . V . Accession number given by the Velperweg 76 INTERNATIONAL DEPOSITARY AUTHORITY
Address DSM 13156
NL- 2824 BM Arnhem
Date of the deposit or the transfer'
1999- 11-25
III VIABILITY STATEMENT
The viability of the microorganism identified under II above was tested on 19 9 9 - 11 - 2 5 : On that date, the said microorganism was
(X)1 viable
( )' no longer viable
IV CONDITIONS UNDER WHICH THE VIABILITY TEST HAS BEEN PERFORMED'
V INTERNATIONAL DEPOSITARY AUTHORITY
Name DSMZ-DEUTSCHE SAMMLUNG VON Sιgnature(s) of person(s) having the power to represent the
MIKROORGANISMEN UND ZELL ULTUREN GmbH International Depositary Authority or of authorized officιal(s)
Address Mascheroder Weg lb D-381 Braunschweig
Date 1999 - 11 -29
1 Indicate the date of original deposit or. where a new deposit or a transfer has been made, the most recent relevant date (date of the new deposit or date of the transfer) In the cases referred to in Rule 10 (a) (n) and (in), refer to the most recent viability test 1 Mark with a cross the applicable box
4 Fill in if the information has been requested and if the results of the test were negative
Form DSMZ-BP 9 (sole page) 0196 BUDAPEST TREATY ON THE INTERNATIONAL
RECOGNmON OF THE DEPOSIT OF MICROORGANISMS
FOR THE PURPOSES OF PATENT PROCEDURE
INTERNATIONAL FORM
Akzo Nobel N.V. Velperweg 76
NL-2824 BM Arnhem
RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7 1 by the INTERNATIONAL DEPOSITARY AUTHORITY idenufied at the bottom of this page
I. IDENTIFICATION OF THE MICROORGANISM
Identification reference given by the DEPOSITOR Accession number given by the INTERNATIONAL DEPOSITARY AUTHORITY RGl
DSM 13156
II. SCIENTIFIC DESCRIPTION AND/OR PROPOSED TAXONOMIC DESIGNATION
The microorganism identified under I. above was accompanied by
(X ) a scientific description
(X ) a proposed taxonomic designation
(Marie with a cross where applicable)
III. RECEIPT AND ACCEPTANCE
This International Depositary Authority accepts the microorganism identified under 1 above, which was received by it on 1999 - 11 - 25 (Date of the original deposit)'.
IV. RECEIPT OF REQUEST FOR CONVERSION
The microorganism idenufied under I above was received by this International Depositary Authority on (date of original deposit) and a request to conven the original deposit to a deposit under the Budapest Treatv was received by it on (date of receipt of request for conversion)
V. INTERNATIONAL DEPOSITARY AUTHORITY
Name DSMZ-DEUTSCHE SAMMLUNG VON Sιgπamre(s) of peπon(s) having the power to represent the M1KROORGANISMEN UND ZELLKULTUREN GmbH International Depositary Authority or of authorized ofTιcιal(s)
Address Mascheroder Weg lb D-38124 Braunschweig
Date. 1999 - 11-29
1 Where Rule 64 (d) applies, such date is the date on which the status ot inicmauonaJ depositary authority was acquired BUDAPEST TREATY ON THE INTERNATIONAL
RECOGNITION OF THE DEPOSIT OF MICROORGANISMS
FOR THE PURPOSES OF PATENT PROCEDURE
INTERNATIONAL FORM
Akzo Nobel N.V. Velperweg 76
NL-2824 BM Arnhem
VIABILITY STATEMENT issued pursuant to Rule 10 2 by the INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
' Indicate the date of original deposit or, where a new deposit or a transfer has been made, the most recent relevant date (date of the new deposit or date of the transfer) ' In the cases referred to in Rule 10 2(a) (n) and (in), refer to the most recent viability test
' Mark with a cross the applicable box
4 Fill in if the information has been requested and if the results of the test were negative
Form DSMZ-BP 9 (sole page) 0196 BUDAPEST TREATY ON THE INTERNATIONAL
RECOGNITION OF THE DEPOSIT OF MICROORGANISMS
FOR THE PURPOSES OF PATENT PROCEDURE
INTERNATIONAL FORM
Akzo Nobel N.V. Velperweg 76
NL-2824 BM Arnhem
RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7 1 by the INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
I IDENTIFICATION OF THE MICROORGANISM
Identification reference given by the DEPOSITOR Accession number given by the INTERNATIONAL DEPOSITARY AUTHORITY RG1-UV29
DSM 13157
II SCIENTIFIC DESCRIPTION AND/OR PROPOSED TAXONOMIC DESIGNATION
The microorganism identified under I above was accompanied by
(X ) a scientific descπpuon
(X ) a proposed taxonomic designation
(Mark with a cross where applicable)
III RECEIPT AND ACCEPTANCE
This International Depositary Authority accepts the microorganism idenufied under I above, which was received by it on 19 99 - 11 - 25 (Date of the original deposit)'
IV RECEIPT OF REQUEST FOR CONVERSION
The microorganism identified under I above was received by this International Depositary Authority on (date of original deposit) and a request to convert the original deposit to a deposit under the Budapest Treaty was received by it on (date of receipt of request for conversion)
V INTERNATIONAL DEPOSITARY AUTHORITY
Name DSMZ-DEUTSCHE SAMMLUNG VON Sιgnature(s) of person(s) having the power to represent the MIKROORGANISMEN UND ZELLKULTUREN GmbH International Depositary Authority or of authorized offιcιal(s)
Address Mascheroder Weg lb
D-38124 Braunschweig £/. iΛxleX s)
Date 1999 - 11- 29
' Where Rule 64 (d) applies, such date is the date on which the status of international depositary authority was acquired

Claims

Claims
I . Method to construct a genetically modified strain of a steroid-degrading microorganism lacking the ability to degrade the steroid nucleus, the method comprising inactivation of multiple genes involved in steroid nucleus degradation. 2. Method according to claim 1 wherein the method comprises inactivation of multiple steroid dehydrogenase genes.
3. Method according to claim 2 wherein a first inactivated gene is kstDl or kstD2.
4. Method according to claim 3 wherein the first inactivated gene is disrupted or deleted. 5. Method according to claim 3 wherein the first gene is deleted by unmarked gene deletion.
6. Method according to claims 3-5 wherein any subsequent gene is inactivated by UV irradiation.
7. Method according to claims 3-6, wherein any subsequent gene is deleted by unmarked gene deletion.
8. Method according to claim 5, wherein the second gene is deleted by unmarked gene deletion.
9. Method according to claims 1-8 wherein the micro-organism is Rhodococcus, preferably R. erythopolis. 10. Micro-organism prepared according to claims 1-9.
I I. Micro-organism according to claim 10 wherein at least both kstDl and kstD2 are inactivated.
12. Genetically modified strain Rhodococcus erythropolis RG 1 -UV29.
13. Use of micro-organisms according to claims 10-12 in the preparation of 9α- hydroxy-4-androstene-3,l 7-dione by growing said micro-organisms on a culture medium comprising 4-androstene-3,l 7-dione.
14. Nucleotide sequence encoding KSTD protein encoded by nucleotides 820-2329 of SEQ ID NO: 1.
15. Nucleotide sequence encoding KSTD2 protein encoded by nucleotides 1-1678 of SEQ ID NO:5.
EP00977417A 1999-10-22 2000-10-17 MICROBIAL 9$g(a)-HYDROXYLATION OF STEROIDS Ceased EP1232278A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP00977417A EP1232278A1 (en) 1999-10-22 2000-10-17 MICROBIAL 9$g(a)-HYDROXYLATION OF STEROIDS

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
EP99203470 1999-10-22
EP99203470 1999-10-22
EP99204449 1999-12-22
EP99204449 1999-12-22
PCT/EP2000/010223 WO2001031050A1 (en) 1999-10-22 2000-10-17 MICROBIAL 9α-HYDROXYLATION OF STEROIDS
EP00977417A EP1232278A1 (en) 1999-10-22 2000-10-17 MICROBIAL 9$g(a)-HYDROXYLATION OF STEROIDS

Publications (1)

Publication Number Publication Date
EP1232278A1 true EP1232278A1 (en) 2002-08-21

Family

ID=26153382

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00977417A Ceased EP1232278A1 (en) 1999-10-22 2000-10-17 MICROBIAL 9$g(a)-HYDROXYLATION OF STEROIDS

Country Status (11)

Country Link
EP (1) EP1232278A1 (en)
CN (1) CN1224716C (en)
AR (1) AR026186A1 (en)
AU (1) AU775476B2 (en)
CA (1) CA2396879A1 (en)
CZ (1) CZ20021784A3 (en)
IL (1) IL149715A0 (en)
NO (1) NO20022449L (en)
NZ (1) NZ519039A (en)
RU (1) RU2268935C2 (en)
WO (1) WO2001031050A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015128534A1 (en) 2014-02-27 2015-09-03 Consejo Superior De Investigaciones Científicas Selective recombinant mutants of mycobacterium smegmatis mc2 155 and use thereof for producing 1,4-androstadiene-3,17-dione or 4-androstene-3,17-dione from natural sterols

Families Citing this family (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ATE465247T1 (en) 2002-02-21 2010-05-15 Organon Nv IDENTIFICATION OF 3-KETOSTEROID 9-ALFA-HYDROXYLASE GENES AND BLOCKED MICROORGANISMS IN 3-KETOSTEROID 9-ALFA-HYDROXYLASE ACTIVITY
CN1720329A (en) * 2002-12-03 2006-01-11 阿克佐诺贝尔公司 New expression system from rhodococcus
AT503486B1 (en) * 2006-04-11 2008-05-15 Iep Gmbh METHOD FOR THE ENANTIOSELECTIVE REDUCTION OF STEROIDS
RU2351645C1 (en) * 2007-07-20 2009-04-10 Наталия Евгеньевна Войшвилло STRAIN Rhodococcus erythropolis "ВКПМ" Ac-1740 FOR 9 ALPHA-HYDROXYSTEROIDS
WO2009024572A1 (en) * 2007-08-21 2009-02-26 N.V. Organon Method for the production of modified steroid degrading microorganisms and their use
BRPI1005827A2 (en) 2009-02-23 2016-03-08 Univ Groningen pharmaceutical composition and method for treating an individual suffering from a disease caused by a bacterium
CN103361394B (en) * 2013-08-07 2016-08-17 中国科学院上海高等研究院 Utilize the method that microorganism converts preparation 9 Alpha-hydroxies-androstenedione
CN103805577A (en) * 2013-08-14 2014-05-21 济南环亿生物科技有限公司 Method for efficiently producing hydroxysteroid dehydrogenase with testosterone comamonas
CN107586762A (en) * 2017-09-18 2018-01-16 天津科技大学 A kind of dehydrogenase mutant of 3 sterone Δ 1 and its application
CN107955827B (en) * 2017-12-15 2019-07-02 江南大学 A method for enzymatic conversion to produce 9α-hydroxyandrost-4-ene-3,17-dione
US11001871B2 (en) 2017-12-15 2021-05-11 Jiangnan University Method for producing 9alpha-hydroxy androstane-4-alkene-3,17-diketone by enzymatic conversion
GB2577037A (en) * 2018-08-09 2020-03-18 Cambrex Karlskoga Ab Genetically-modified bacteria and uses thereof
SG11202108529WA (en) * 2019-02-08 2021-09-29 Sanofi Sa Biotechnological optimization of microorganisms for the 1,2-dehydrogenation of steroids
CN110229838B (en) * 2019-05-28 2021-01-08 浙江理工大学 Method for obtaining hydroxylated compound by biotransformation of steroid compound
CN114621965B (en) * 2022-02-15 2023-10-03 复旦大学 A kind of 3-sterone-Δ1-dehydrogenase mutant and its application
CN120366249A (en) * 2025-04-23 2025-07-25 浙江工业大学 3-Sterone-delta 1-dehydrogenase mutant and application thereof in catalyzing dehydrogenation of steroid compounds

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
HU196627B (en) * 1986-11-18 1988-12-28 Gyogyszerkutato Intezet Microbiological process for producing y alpha-hydroxy-4-androstene-3,17-dione
RU2039824C1 (en) * 1993-06-22 1995-07-20 Институт биохимии и физиологии микроорганизмов РАН Method of manufacturing androst-1,4-diene-3,17-dione

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
KIESLICH (1985) J. Basic Microbiol. 25, 461-474. *
See also references of WO0131050A1 *
WOVCHA ET AL. (1979) Biochim. Biophys. Acta 574, 471-479. *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015128534A1 (en) 2014-02-27 2015-09-03 Consejo Superior De Investigaciones Científicas Selective recombinant mutants of mycobacterium smegmatis mc2 155 and use thereof for producing 1,4-androstadiene-3,17-dione or 4-androstene-3,17-dione from natural sterols

Also Published As

Publication number Publication date
IL149715A0 (en) 2002-11-10
CN1224716C (en) 2005-10-26
CN1413260A (en) 2003-04-23
NO20022449D0 (en) 2002-05-23
RU2002113373A (en) 2004-02-27
CA2396879A1 (en) 2001-05-03
AR026186A1 (en) 2003-01-29
NZ519039A (en) 2004-09-24
RU2268935C2 (en) 2006-01-27
AU775476B2 (en) 2004-08-05
WO2001031050A1 (en) 2001-05-03
CZ20021784A3 (en) 2002-08-14
NO20022449L (en) 2002-06-19
AU1514501A (en) 2001-05-08

Similar Documents

Publication Publication Date Title
AU775476B2 (en) Microbial 9alpha-hydroxylation of steroids
JP2012040016A (en) Thermophilic microorganism with inactivated lactate dehydrogenase (ldh) gene for ethanol production
EP1068294B1 (en) Microbial strains and processes for the manufacture of biomaterials
JP4801151B2 (en) Modified microorganism with inactivated lactate dehydrogenase gene
US7514236B2 (en) Identification of 3-ketosteroid 9-alfa-hydroxylase genes and microorganisms blocked in 3-ketosteroid 9-alfa-hydroxylase activity
CN113423827A (en) Biotechnological optimization of microorganisms for 1, 2-dehydrogenation of steroids
JP2011200133A (en) Method for producing genetically modified microorganism
EP0652958A1 (en) Cloning and expression of a lipase modulator gene from pseudomonas pseudoalcaligenes
JP5712495B2 (en) Microorganisms deleted or inactivated drug resistance genes
CA2083407C (en) Microorganisms for the stabilization of plasmids
JP5069926B2 (en) Genes involved in foaming of acetic acid bacteria, acetic acid bacteria bred by modifying the genes, and method of producing vinegar using the acetic acid bacteria
US20060172423A1 (en) New expression system from rhodococcus
EP1127943A2 (en) Means and methods for the expression of homologous and heterologous proteins in strains of Rhodococcus
US7214520B2 (en) Cloning, sequencing and expression of a comamonas cyclopentanone 1,2-monooxygenase-encoding gene in Escherichia coli
JP2960775B2 (en) Expression of DNA sequences from nocardioform microorganisms
US20090186390A1 (en) Method for the Production of Modified Steroid Degrading Microorganisms and their Use
JP2003088380A (en) Decomposition method of biphenyl or its derivative, and microorganism used for it
JP2011200132A (en) Microorganism deficient or inactive in nitrile hydratase gene
JP2006502692A (en) Method for overexpression of dehydrogenase
Jain et al. Specific deletion of a large segment of pRA500: a 3, 5‐xylenol degradative plasmid

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20020522

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

17Q First examination report despatched

Effective date: 20050310

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: N.V. ORGANON

APBN Date of receipt of notice of appeal recorded

Free format text: ORIGINAL CODE: EPIDOSNNOA2E

APBR Date of receipt of statement of grounds of appeal recorded

Free format text: ORIGINAL CODE: EPIDOSNNOA3E

APAF Appeal reference modified

Free format text: ORIGINAL CODE: EPIDOSCREFNE

APBT Appeal procedure closed

Free format text: ORIGINAL CODE: EPIDOSNNOA9E

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN REFUSED

18R Application refused

Effective date: 20071201

R18R Application refused (corrected)

Effective date: 20071202