Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
  • C12P21/00—Preparation of peptides or proteins
  • C12P21/02—Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
  • C07K14/43513—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from arachnidae
  • C07K14/43531—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from arachnidae from mites
• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
  • A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
  • A01N63/40—Viruses, e.g. bacteriophages
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
  • C12N15/86—Viral vectors
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
  • C12N2710/00011—Details
  • C12N2710/14011—Baculoviridae
  • C12N2710/14111—Nucleopolyhedrovirus, e.g. autographa californica nucleopolyhedrovirus
  • C12N2710/14141—Use of virus, viral particle or viral elements as a vector
  • C12N2710/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

• the present invention relates to improved Plutella xylostella baculoviruses for use as biological insecticides.
• the invention provides recombinant baculoviruses that have been genetically engineered to incorporate genes encoding insecticidal toxins.
• Baculoviruses are insect viruses which are useful as biological insecticides. Over 400 baculovirus isolates have been described.
• the Autographa califomica nuclear polyhedrosis virus (AcMNPV) the prototype virus of the family Baculoviridae, was originally isolated from Autographa califomica, a lepidopteran noctuid commonly known as the alfalfa looper. This virus infects 12 families and more than 30 species within the order of Lepidopteran insects (Granados et ⁇ /. , The Biology of Baculoviruses, 1, 99 (1986)). AcMNPV is not known to infect productively any species outside this order.
• the life cycle of baculoviruses includes two stages. Each stage of the life cycle is represented by a specific form of the virus: budded virions (BV) which are nonoccluded, and occlusion bodies (OB). 2
• BV budded virions
• OB occlusion bodies
• OB occlusion body
• PIB polyhedral inclusion body
• a polyhedrin protein having molecular weight of 29 kD is the major viral-encoded structural protein of the viral occlusions (U.S. Patent Number 4,745,051).
• the viral occlusions are an important part of the natural baculovirus life cycle, providing the means for horizontal (insect-to-insect) transmission among susceptible insect species.
• a susceptible insect usually in the larval stage
• the crystalline occlusions dissociate in the gut of susceptible insects to release the infectious viral particles.
• ODV occlusion-derived viruses
• virus particles enter the cell by endocytosis or fusion, and the viral DNA is uncoated at the nuclear pore or in the nucleus.
• Viral DNA replication is detected within six hours .
• secondary infection spreads to other insect tissues by the budding of the extracellular virus (BV) from the surface of the cell.
• the BV form of the virus is responsible for cell-to-cell spread of the virus within an individual infected insect, as well as for transmitting infection in cell culture.
• polyhedrin protein Late in the infection cycle (12 hours p.i.), polyhedrin protein can be detected in infected cells. It is not until 18-24 hours p.i. that the polyhedrin protein assembles in the nucleus of the infected cell and virus particles become embedded in the proteinaceous occlusions. Viral occlusions accumulate to large numbers over 4-5 days as cells lyse. These polyhedra have no active role in the spread of infection in the larva. BVs in the haemolymph multiply and spread, leading to the death of the larva. When infected larvae die, millions of polyhedra remain in the decomposing tissue, while the BVs are degraded. When other larvae are exposed to the polyhedra by ingestion of, e.g., contaminated plants or other food material, the cycle is repeated.
• the occluded form of the virus is responsible for the initial infection of the insect through the gut, as well as for the environmental stability of the virus.
• ODVs are essentially non-infectious when administered by injection, but are highly infectious when ingested orally.
• the non-occluded form of the virus i.e., BV
• BVs are highly infectious for cells in culture or internal insect tissues by injection, but are not infectious when ingested.
• a major impediment to the widespread use of insecticidal baculoviruses in agriculture is the time lag between initial infection of the insect and its death. This time lag can range from days to weeks. During this period, the insect continues to feed, causing further damage to the plant. To shorten this lag time, recombinant baculoviruses have been constructed that express an insect-controlling or modifying substance, such as a toxin, neuropeptide, hormone, or enzyme (Tomalski, M. D. et al , Nature, 352:82-85 (1991); Federici, In Vitro, 28:50A (1992); Martens et al. , App. & Envir.
• an insect-controlling or modifying substance such as a toxin, neuropeptide, hormone, or enzyme
• a second major impediment to the use of insecticidal baculoviruses is the limited host range of the viruses. While the limited host range of baculoviruses makes them safe to non-target organisms, it has also meant that they are unable to control the variety of lepidopteran pests present in the field. This is particularly true when the complex of lepidopteran insects that needs to be controlled comprises insects that are either non- permissive or semi-permissive for infection by the particular insecticidal baculovirus being used.
• An insect that is non-permissive for infection is one that cannot be productively infected at any dose; an insect that is semi-permissive for infection is one that can only be productively infected when exposed to an amount of the virus that is at least one, but more generally two or more, orders of magnitude greater than that required for productive infection in susceptible insects, i.e., permissive hosts.
• an insect that is semi-permissive for infection is one that can only be productively infected when exposed to an amount of the virus that is at least one, but more generally two or more, orders of magnitude greater than that required for productive infection in susceptible insects, i.e., permissive hosts.
• Prior to the present invention no baculovirus of the genus Nucleopolyhedrovirus had been identified for which the diamondback moth, Plutella xylostella, is a permissive host. This insect is an important pest in many vegetable crops and has developed resistance to both chemical and biological insecticides.
• the present invention provides recombinant Plutella xylostella baculoviruses (PxNPVs), which exhibit superior insecticidal activity against Plutella xylostella insects relative to other wild-type and recombinant baculoviruses.
• Recombinant PxNPVs according to the invention are PxNPVs containing one or more genetic alterations relative to wild-type PxNPV. Genetic alterations include without limitation introduction or deletion of one or more restriction sites; modification, deletion, or duplication of one or more viral-encoded genes; and introduction of one or more genes encoding heterologous proteins, i.e. , proteins that are non-virally encoded or are encoded by a different virus.
• recombinant PxNPVs have incorporated within their genomes a nucleic acid sequence encoding an insect-modifying substance, such as, e.g., an insecticidal toxin, peptide hormone, enzyme, or receptor, which is operably linked to a promoter capable of activating transcription in the target insect.
• an insect-modifying substance such as, e.g., an insecticidal toxin, peptide hormone, enzyme, or receptor, which is operably linked to a promoter capable of activating transcription in the target insect.
• the insect-modifying substance is an insecticidal toxin. It is believed that a recombinant baculovirus encoding an insecticidal toxin in the context of the PxNPV genomic background provides significantly improved insecticidal benefits.
• Non-limiting examples of insecticidal toxins include AalT, AaHITl, AaHrT2, LqhIT2, LqqITI, LqqIT2, BjITl, BJIT2, LqhP35, LqhcdT, SmpIT2, SmpCT2, SmpCT3, SmpMT, DK9.2, DKll, DK12, ⁇ -agatoxin, King Kong toxin, Pt6, NPS-326,
• the native secretion signal peptide i.e., the signal peptide associated with the toxin
• a heterologous signal peptide is employed to promote secretion of the toxin from infected insect cells.
• Non-limiting examples of useful heterologous signal peptides include those derived from the pBMHPC-12 signal sequence from Bombyx mori; the adipokinetic hormone signal sequence from Manduca sexta; the apolipophorin signal sequence from Manduca sexta; the chorion signal sequence from Bombyx mori; the cuticle signal sequence from Drosophila melanogaster; the esterase-6 signal sequence from Drosophila melanogaster; and the sex-specific signal sequence from Bombyx mori.
• the invention also encompasses direct ligation vectors, which are designed to facilitate the construction of recombinant PxNPV genomes by DNA fragment ligation 5 in vitro. Introduction of the DNA resulting from such a ligation into an appropriate host cell results in the production of recombinant PxNPVs.
• the invention provides expression cassettes encoding insecticidal toxins.
• the expression cassettes comprise a promoter sequence, preferably derived from a Drosophila melanogaster hsp70 promoter, which is operably linked to a nucleic acid sequence encoding a toxin.
• the expression cassettes of the invention may also be incorporated into plasmid vectors, which are designated modular expression vectors.
• the invention provides codon-optimised genes encoding insecticidal toxins, such as, e.g., those shown in Figures 10 and 11 below.
• Codon- optimised genes are those in which particular codons present in the native toxin-encoding sequence have been substituted with alternative codons that are more efficiently utilized by the insect cell protein-synthesizing machinery.
• the invention provides insecticidal compositions and formulations comprising at least one recombinant PxNPV as described above and an agriculturally acceptable carrier.
• the invention provides methods for killing insect pests and for reducing insect infestation, which comprise administering to a desired locus an insecticidal-effective amount of PxNPV-containing insecticidal compositions or formulations.
• Figure 1 is a schematic illustration of the procedures used to construct the pmd 205.1 , pmd 216.1 , and pmd 220.2 vectors for the production of recombinant PxNPVs deleted for the viral ecdysteroid glucosyl transferase (egt) gene.
• Figure 2 is a schematic illustration of the procedures used to construct the
• Figure 3 is a schematic illustration of the structure of pMEV modular expression vectors.
• Figure 4 is a schematic illustration of pMEV vectors containing different promoters.
• Figure 5 is a schematic illustration of the cloning of sequences into the modular expression vectors.
• Figure 6 is an illustration of the D. melanogaster hsp70 promoter module in pMEV5 and the amplification primers used to isolate the sequence.
• Figure 7 is an illustration of the D. melanogaster hsp70 promoter module in pMEV6 and the amplification primers used to isolate the sequence.
• Figure 8 is an illustration of a codon-optimized DNA sequence encoding
• AalT and the oligonucleotides and amplification primers that were used to synthesize the sequence were used to synthesize the sequence.
• Figure 9 is a schematic illustration of the structure of the pMEV/ADK modular expression vectors.
• Figure 10 is an illustration of a codon-optimized DNA sequence encoding the LqhIT2 toxin and the oligonucleotides and amplification primers that were used to synthesize the sequence.
• Figure 11 is an illustration of a codon-optimized DNA sequence encoding ⁇ -ACTX-HVl toxin and the oligonucleotides and amplification primers that were used to synthesize the sequence.
• PxNPVs isolated, purified recombinant Plutella xylostella baculoviruses
• PxNPV refers to an isolate of baculovirus of the genus Nucleopolyhedrovirus (NPV), the wild-type version of which was isolated from infected Plutella xylostella larvae and 7 which is genetically distinct from other known baculoviruses and exhibits higher infectivity for Plutella xylostella larvae relative to other baculoviruses.
• NPV Nucleopolyhedrovirus
• the genomic sequences of recombinant PxNPVs according to the present invention exhibit at least about 90% sequence identity, and preferably at least about 95% sequence identity, with the genomic sequence of PxNPV deposited as ATCC VR-2607.
• PxNPVs encompassed by the present invention may also be identified by:
• PxNPVs of the invention typically exhibit infectivity for Plutella xylostella larvae that is at least about two orders of magnitude greater than that exhibited by the V8 strain of AcMNPV deposted as ATCC VR-2465.
• PxNPVs of the invention excluding fragments resulting from genetic alterations, exhibit restriction fragments characteristic of PxNPV, i.e. , that are present in PxNPV digests and absent from the digests produced by other baculoviral DNAs.
• the present inventors have discovered that the recombinant PxNPVs of the present invention exhibit superior insecticidal activity on Plutella xylostella larvae relative to wild-type PxNPVs and/or recombinant NPVs derived from other species of baculoviruses.
• Recombinant PxNPVs according to the present invention are PxNPVs in which one or more genetic alterations have been introduced relative to wild-type PxNPV.
• Genetic alteration refers to any change in the sequence of the PxNPV genome including, without limitation, introduction of one or more restriction sites; deletion of one or more restriction sites; modification, deletion, or duplication of one or more viral-encoded genes; and introduction of one or more genes encoding heterologous proteins, i.e., non-virally encoded proteins or proteins encoded by a different virus.
• modified PxNPVs whose genomes contain restriction sites not present in wild-type PxNPV or, conversely, are lacking one or more restriction sites present in wild-type PxNPV are encompassed by the present invention.
• restriction site refers to a nucleic acid sequence that is a recognition site for a restriction endonuclease.
• a cloning site not present in wild-type PxNPV i.e., a sequence comprising at least one unique restriction site for incorporation 8 of a heterologous gene into the PxNPV genome.
• recombinant PxNPVs have incorporated within their genome at least one heterologous gene, including without limitation genes encoding an insect-modifying substance such as, e.g. , an insecticidal toxin, a hormone, an enzyme, or a receptor.
• recombinant PxNPVs contain a heterologous gene encoding an insecticidal toxin.
• Suitable insecticidal toxins include without limitation those listed in the Table below:
• the toxin-encoding sequence is operably linked to a promoter, i.e., a promoter sequence is placed upstream of the toxin-encoding sequence so that expression of the toxin is under the control of the promoter.
• the promoter may be a baculovirus-derived promoter, such as, e.g., DA26, 35K, 6.9K, and polyhedrin (polh) promoters (O'Reilly et al. , J. Gen. Virol. 71: 1029 (1990); Friesen et al. , J. Virol. 61:2264, 1987; Wilson et al. , J. Virol. 61:661-666, 1987; Hooft van Iddekinger et al.
• a host cell promoter may be used, such as, e.g. , an insect-derived hsp70 promoter or actin promoter. Any native or synthetic promoter active in promoting transcription in target insect cells may be used.
• the DNA sequence encoding the toxin may comprise the native upstream sequence encoding the signal peptide which, in its cell of origin, directs secretion of the toxin.
• the toxin-encoding sequence may be fused in-frame with an upstream DNA sequence encoding a heterologous signal sequence, i.e.
• a sequence derived from another source including without limitation sequences derived from thepBMHPC-12 signal sequence from Bombyx mori, the adipokinetic hormone signal sequence from Manduca sexta, the apolipophorin signal sequence from Manduca sexta, the chorion signal sequence from Bombyx mori, the cuticle signal sequence from Drosophila melanogaster, the esterase-6 signal sequence from Drosophila melanogaster, and the sex-specific signal sequence from Bombyx mori, all of which are disclosed in U.S. Patent No. 5,547,871.
• the recombinant PxNPVs of the invention have incorporated within their genome a gene encoding wild-type or mutant juvenile hormone esterase (JHE), expression of which can cause irreversible termination of the feeding stage and pupation and thus result in death of the target insect.
• JHE juvenile hormone esterase
• Recombinant PxNPVs may also be produced by genetically altering a wild- type or pre-existing recombinant PxNPV strain in a manner that results in the modification of one or more viral-encoded functions.
• one or more viral genes such as, e.g. , those encoding the viral polyhedrin protein, ecdysteroid glucosyl transferase (EGT), or plO protein may be modified, deleted, or duplicated.
• viral-encoded sequences derived from other baculoviruses may also be introduced, such as, e.g., the region from the V8 strain of AcMNPV which carries a determinant that results in a faster killing phenotype, as disclosed in U.S. Patent No. 5,662,897.
• Non-limiting examples of recombinant PxNPVs according to the invention include those having ATCC deposit numbers VR-2607,VR-2608, and VR-2609.
• the present invention provides methods and compositions for the construction of recombinant PxNPVs. Any method known in the art may be used to construct recombinant PxNPVs. For example, co-infection of an appropriate host cell with two strains of PxNPV may result in homologous recombination in vivo between related sequences, resulting in the formation of a recombinant PxNPV. Similarly, homologous recombination can occur in vivo in cells co-transfected with purified PxNPV viral genomic DNA and a second nucleic acid containing PxNPV sequences. Alternatively, recombinant PxNPVs may be produced by introducing into a cell isolated viral genomic DNA which had been previously modified in vitro. In one series of embodiments, recombinant PxNPVs are formed by the use of direct ligation vectors and modular expression vectors. These components, and methods for using them to form recombinant PxNPVs, are described below.
• Direct ligation virus vectors comprise purified PxNPV viral genomic DNAs which can be used to construct recombinant PxNPV genomes by DNA ligation in vitro. Direct ligation vectors direct the production of recombinant PxNPV virions when introduced into an appropriate host cell.
• PxNPV direct ligation vectors comprise PxNPV genomic DNA that has been modified to incorporate at least one cloning site not present in wild-type PxNPV.
• a cloning site comprises one or more restriction sites which are either absent from wild-type PxNPV genome or are not found within the nucleic acid encoding or regulating an essential PxNPV viral function.
• the direct ligation vectors of the invention are engineered to delete any such restriction sites which lie outside the cloning site, so that the cloning site comprises at least one unique restriction site.
• Digestion of a direct ligation vector using one or more restriction enzymes specified by the cloning site thus produces a DNA preparation into which a heterologous nucleic acid segment can be introduced, usually in a single ligation step, without disrupting an essential viral function.
• the resulting DNA preparation may be introduced into an appropriate host cell for propagation of recombinant PxNPV.
• Direct ligation vectors simplify the production of recombinant PxNPVs by obviating the dependence on in vivo recombination events to form recombinant viruses. See, e.g. , International Patent Application WO 94/28114.
• Cloning sites for use in PxNPV direct ligation vectors are designed by first selecting one or more restriction enzymes that either (i) do not digest PxNPV DNA at all or (ii) recognize a small number of sites that do not lie within the nucleic acid encoding or regulating an essential PxNPV viral function. The selection is performed by (i) searching the PxNPV DNA sequence computationally or (ii) subjecting PxNPV DNA to digestion with the enzyme(s) and detecting the presence or absence of digestion products. If the enzyme recognizes a small number of sites, these sites may be disrupted, using conventional techniques (such as, e.g. , restriction enzyme digestion followed by blunt-ending and re- ligation) to produce PxNPV DNA that lacks the sites but supports viral replication and infectivity.
• restriction enzymes that either (i) do not digest PxNPV DNA at all or (ii) recognize a small number of sites that do not lie within the nucleic acid encoding or regulating an essential PxNPV
• the cloning site is introduced into PxNPV DNA (whether wild-type or modified as described above to inactivate one or more restriction sites) by any appropriate means, including homologous recombination in vivo or ligation in vitro.
• the cloning site includes at least non-overlapping restriction sites to allow (i) directional cloning of an insert nucleic acid and/or (ii) independent insertion of multiple insert nucleic acids.
• direct ligation vectors from PxNPV include other modifications, including without limitation those that result in inactivation of a viral gene, such as, e.g. , that encoding polyhedrin, ecdysteroid glucosyl transferase (EGT) or plO protein.
• a viral gene such as, e.g. , that encoding polyhedrin, ecdysteroid glucosyl transferase (EGT) or plO protein.
• the cloning site is introduced in a location that results in such inactivation. 13
• Modular expression vectors for use in the present invention are plasmid vectors containing an expression cassette which can be excised from the modular expression vector and ligated into the PxNPV direct ligation vectors described above.
• the expression cassette comprises, in a 5' - to - 3' direction: a promoter sequence operably linked to a 5' untranslated region (UTR) which includes the transcription start site; a sequence containing one or more restriction sites to facilitate insertion of a heterologous gene (this sequence is designated an "insertion site"); and a 3' UTR sequence containing at least a site for 3' terminal mRNA processing and polyadenylation.
• the expression cassette is flanked on either end by appropriate restriction sites compatible with a PxNPV direct ligation vector.
• Suitable promoters for use in modular expression vectors include baculovirus promoters and host cell promoters.
• Suitable baculovirus promoters include, without limitation, DA26, 35K, 6.9K, and polyhedrin (polh) promoters.
• Suitable host cell promoters include without limitation hsp70 and actin promoters, preferably derived from an insect species. Sequences "derived from" a promoter sequence encompass modifications, including deletions, insertions, substitutions and duplications, of native promoter sequences. The only requirement is that the final promoter function effectively in a target insect cell to direct the expression of the heterologous gene to which it is operably linked.
• Expression cassettes may also include sequences encoding signal sequences, which direct the secretion of the heterologous protein.
• the signal sequences may be those associated with the heterologous protein or may be derived from a different protein. Suitable signal sequences include, without limitation, those derived from the pBMHPC-12 signal sequence from Bombyx mori; the adipokinetic hormone signal sequence from Manduca sexta; the apolipophorin signal sequence from Manduca sexta; the chorion signal sequence from Bombyx mori; the cuticle signal sequence from Drosophila melanogaster; the esterase-6 signal sequence from Drosophila melanogaster; and the sex-specific signal sequence from Bombyx mori.
• a nucleic acid sequence encoding the signal peptide is inserted between the 5-UTR and the start of the mature heterologous protein.
• the junction between the 3 ' terminus of the signal peptide-encoding sequence and the start of the mature heterologous protein is designed so that insertion of the heterologous sequence results in an 14 in-frame fusion protein between the signal peptide and the heterologous sequence.
• Sequences "derived from" a known signal sequence encompass modifications, including deletions, insertions, and substitutions, of amino acid residues within the signal sequence. The only requirement is that the resulting sequence function effectively in a target insect cell to direct the secretion from the insect cell of the heterologous sequence to which it is linked.
• Heterologous sequences for use in the present invention include, without limitation, those encoding insect-modifying substances, such as, e.g., insecticidal toxins, hormones, enzymes, and receptors.
• suitable insecticidal toxins include without limitation AalT, AaHITl, AaHIT2, LqhIT2, LqqITI, LqqIT2, BjITl, BJIT2, LqhP35, Lqh ⁇ lT, SmpIT2, SmpCT2, SmpCT3, SmpMT, DK9.2, DKll, DK12, ⁇ -agatoxin, King Kong toxin, Pt6, NPS-326, NPS-331, NPS-373, Tx4(6-1), TxP-1, ⁇ -atracotoxins, ⁇ -conotoxins, ⁇ -conotoxins, chlorotoxin and ⁇ -conotoxins.
• nucleic acid sequences encoding the insect-modifying substances and/or the signal peptides may correspond to the native nucleic acid sequences encoding these peptides.
• sequences may be altered to take into account the optimal codon usage for known genes in either the virus vector (or closely related strains) and/or in the insects that are the targets of the insecticidal viruses of the invention.
• Codon optimized sequences i.e., sequences in which the nucleic acid sequence encoding a particular amino acid has been modified without changing the amino acid encoded at that position, may be designed using methods well-known in the art, such as, for example, by comparing codon usage in known gene sequences in the virus and/or in the target insect and in the nucleic acid sequences encoding the signal peptides and insect-modifying substances of the invention.
• codon usage in the sequences encoding the signal peptides and insect-modifying substances reflects the codon usage of the virus vector or the target insect.
• Recombinant PxNPVs may be produced by either (i) co-transfecting PxNPV DNA and a heterologous sequence into an appropriate host cell, to allow for homologous recombination in vivo or (ii) ligation in vitro of a heterologous sequence into a direct ligation vector, followed by introduction of the construct into an appropriate host cell to 15 allow for viral propagation.
• Appropriate host cells are any cells that support baculovirus replication, including without limitation Sf9 cells, Sf21 cells, and High FiveTM cells (Invitrogen, Carlsbad CA).
• An isolated virus according to the invention is one which has been cloned through plaque purification in tissue culture, for example, or otherwise prepared from a single viral genotype.
• a modular expression vector is constructed to contain an expression cassette in which a suitable promoter sequence is operably linked to a sequence encoding a heterologous protein, i.e. , expression of the heterologous protein is placed under the control of the promoter.
• the expression cassette is excised from the modular expression vector and inserted into a PxNPV direct ligation vector by DNA ligation in vitro.
• the ligation mixture is then transfected into an appropriate host cell.
• Recombinant PxNPVs are recovered from the growth medium and characterized for LC 50 and LT 50 using any conventional method, including without limitation diet overlay assays, diet incorporation assays, and leaf dip assays.
• LC 50 is the concentration of virus at which 50% of infected larvae are dead within the duration of the test period.
• LT 50 is the time after infection when 50% of the infected larvae are dead when exposed to a specified dose of virus.
• PxNPVs according to the invention exhibit an LC 50 of about 1 x 10 5 OBs/ 16cm 2 or less on Plutella xylostella larvae when measured using the standard diet overlay assay as described in Example 6 below.
• Other baculovirus isolates typically exhibit higher LC 50 s on Plutella xylostella larvae, i.e. , they are less efficacious, relative to their infectivity for other insect species.
• the present invention provides insecticidal compositions and formulations that include one or more recombinant PxNPVs.
• the recombinant PxNPVs of the invention kill Plutella xylostella larvae more effectively than wild-type PxNPV or recombinant versions of other baculoviruses (see, e.g., Example 11 below).
• An insecticidal composition according to the invention includes at least one recombinant PxNPV.
• An insecticidal formulation comprises at least one recombinant PxNPV in an insecticidalry effective amount and an agriculturally suitable carrier.
• An insecticidally effective amount is an amount that causes a detectable reduction in the 16 infestation, as manifested in the number or amount of the insect pests in a given area or amount of a crop ; the damage caused by the insect pests ; or any other appropriate parameter of infestation.
• the formulations may be in the form of wettable powders, dispersible granular formulations, granules, suspensions, emulsions, solutions for aerosols, baits, and other conventional insecticide preparations.
• Suitable carriers are, without limitation, water, alcohol, hydrocarbons or other organic solvents, or a mineral, animal, or vegetable oil, or a powder such as talc, clay, silicate, or kieselguhr. Wetting agents, coating agents, UV protectants, dispersants, and sticking agents may also be included. A nutrient such as a sugar may be added to increase feeding behavior and/or attract insects. Flow agents such as, for example, clay-based flow agents, may be added to minimize caking of wettable powders or other dry preparations. The compositions may be formulated as coated particles or as microencapsulated material.
• formulations must be non-phytotoxic and not detrimental to the integrity of the recombinant PxNPV contained therein, nor should any components significantly deter insect feeding or any viral functions.
• Exemplary formulations are disclosed in EP published application 0697 170 Al ; PCT application WA 92/19102; and U.S. Patent No. 4,948,586.
• the insecticidal formulations of the invention may also include one or more chemical insecticides and/or one or more non-PxNPV biological control agents.
• Chemical insecticides include without limitation pyrethroids, pyrazolines, organophosphates, carbamates, formadines, and pyrroles, all of which are well-known in the art. Exemplary compounds are disclosed in PCT applications 96/03048, 96/01055, and 95/95741.
• Biological control agents include, e.g. , non-PxNPV baculoviruses (native or recombinant); Bacillus thuringiensis; Nosema polyvora; M.
• the present invention also provides methods for killing insect pests.
• the methods comprise contacting the insects with an insecticide-effective amount of the compositions or formulations of the invention.
• the invention also provides methods for reducing insect infestation of, e.g. , a crop, which comprise administering to a desired locus an insecticidally effective amount of the compositions or formulations of the invention.
• the insecticidal formulations are administered using conventional techniques, such as, e.g. , spraying or dusting crops. Typically, the formulations are administered at dosages of between about 2.4 X 10 8 and about 2.4 X 10 12 OBs/hectare (OBs are occlusion bodies). 17
• Effective dosages depend on, for example, the insect target, the recombinant PxNPV used, and the plant crop being treated.
• the dosages comprising an insecticidally effective amount can be determined by those of ordinary skill in the art using conventional methods.
• Example 1 Construction of Egt-Deleted ⁇ -Galactosidase-Containing Recombinant PxNPV The following experiments were performed to produce a recombinant
• PxNPV in which the viral ecdysteroid glucosyl transferase (egt) gene had been deleted and replaced with an E. coli ⁇ -galactosidase ( ⁇ -gal) marker gene.
• egt viral ecdysteroid glucosyl transferase
• ⁇ -gal E. coli ⁇ -galactosidase
• FIG. 1 illustrates the procedure used to construct a transfer vector for use in disrupting the egt gene in PxNPV by insertion of a ⁇ -galactosidase gene.
• a vector comprising the ⁇ -gal cassette, designated pmd 216.1, was constructed as follows.
• a Bam Hl-to-Xba I fragment containing the ⁇ -gal gene under control of the Drosophila melanogaster hsp 70 promoter was isolated from pAcDzl (Zuidema et al. , J. Gen. Virol. 71:2201 (1990)).
• the final transfer vector was constructed by performing a four-fragment ligation between (i) pBluescriptTM SK + digested with Bam HI and Pst I which had been dephosphorylated with calf intestinal phosphatase; (ii) the 0.975 kb Bgl H-to-Pvu II fragment of pmd 205.1 ; (iii) the 3.86 kb Sma I-to-Xba I ⁇ -gal fragment of pmd 216.1; and (iv) the 1.6 kb Xba I-to-Pst I fragment of pmd 205.1.
• the resulting transfer vector, designated pmd 220.2 contains an hsp 70-driven ⁇ -gal marker gene cloned into the site of the egt deletion.
• An egt-deleted ⁇ -gal marked PxNPV was constructed by homologous recombination between pmd 220.2 and PxNPV-3 DNA cotransfected into cultured Sf-9 cells. 1 ⁇ g of pmd 220.2 DNA and 250 ng of PxNPV-3 DNA were mixed with 25 ⁇ g of Lipofectin (Gibco BRL, Gaithersburg MD) in a final volume of 200 ⁇ l of TNM-FH (JRH Biosciences, Lenexa KS).
• TNM-FH complete media TNM-FH plus 10% fetal bovine serum and 1 % pluronic F68 (Gibco BRL, Gaithersburg, MD)
• the mixture was overlaid on 2.75 x 10 5 Sf-9 cells which had been plated in a well of a standard 6-well tissue culture plate. Cells were refed with fresh media at 24 hours and budded virus was harvested after an additional 96 hours. Recombinant viruses were occlusion body positive (occ+) and expressed the ⁇ -gal gene.
• Recombinants (occ+/blue plaques) were identified by three rounds of plaque purification in the presence of 100 ⁇ g/ml 5 bromo-4- chloro-3-indolyl- ⁇ -D-galactopyranoside (X-gal). The resulting virus was designated T96- 19.1.1.1.
• oligonucleotides were synthesized to form the Bsu-Sse linker, having the sequences: 5 '- CCTCAGGGCAGCTTAAGGCAGCGGACCGGCAGCCTGCAGG -3 ' (Oligo 32) and 5'- CCTGCAGGCTGCCGGTCCGCTGCCTTAAGCTGCCCTGAGG -3' (Oligo 33) 19
• these two oligomers encode several restriction endonuclease sites, including Bsu 361 and Sse 83871 sites, useful in the construction of recombinant viruses.
• Each was diluted to a concentration of 30 pmol/ ⁇ l into an annealing buffer containing 10 mM Tris-HCl (pH 7.5), 100 mM NaCI and 1 mM EDTA. The mixture was heated to 95°C for 10 minutes and then slowly cooled to room temperature over several hours.
• the annealed oligonucleotides were inserted into the pmd 205.1 transfer vector as follows.
• the pmd 205.1 vector was digested with Spe I, which cuts at a single site located just upstream of the egt deletion ( Figure 2) .
• the ends of the digested plasmid were filled in using the Klenow fragment of DNA polymerase I in the presence of all four nucleotides.
• 100 ng of the linearized plasmid were then ligated to 15 pmol of the double stranded linker with T4 DNA ligase in a total volume of 10 ⁇ l. After the ligation reaction was complete, the T4 ligase was heat inactivated and the mixture was treated with polynucleotide kinase.
• the 8.8 kb DNA band was purified by electrophoresis in a 1 % low melt preparative grade agarose gel (BioRad, Richmond VA).
• the gel slice containing the 8.8 kb linear DNA was melted at 65°C and an in-gel ligation using approximately 1/10 of the gel slice was used to recircularize the DNA, which was then used to transform E. coli DH5 ⁇ cells.
• the resulting plasmids were screened using polymerase chain reaction (PCR) to determine the orientation of the Bsu-Sse linker relative to the egt gene.
• Oligos 32 and 33 w ere s eparately paired w ith oligomer EGT 1 (5 ' - GCGGCCAATATATTGGCCGTGTTT-S'), which is specific for the region of the egt gene 5 ' to the deletion.
• the orientation of the Bsu-Sse linker in LAB 50.2 is indicated in Figure 2.
• An egt-deleted direct ligation PxNPV vector was constructed by homologous recombination between LAB 50.2 and T96-19.1.1.1 PxNPV viral DNA that had been co- transfected into cultured Sf9 cells as described in Example 1 , using 1 ⁇ g of LAB 50.2 and 250 ng of T96-19.1.1.1 viral DNA.
• recombinant viruses were occlusion body positive and did not express the ⁇ -gal gene.
• Recombinant (occ+ /white) viruses were identified by three rounds of plaque purification in the presence of 100 ⁇ g/ml X-gal. The resulting virus was named T97-8.1.1.1 (ATCC deposit no. VR-2608).
• vectors pMEVl , pMEV2, pMEV3 and pMEV4 for the expression of foreign genes under the control of baculoviral promoters are disclosed in International Patent Application US 94/06079. These vectors have the general structure shown in Figure 3. Each vector was derived from the pBluescript SK+ plasmid
• the promoter modules in vectors pMEVl through pMEV4 are derived from genes that are expressed at different stages in the virus life cycle.
• the DA26 gene promoter module in pMEVl and the 35K gene promoter module in pMEV4 are derived from genes that are expressed early in the virus life cycle; that is, before the onset of DNA synthesis.
• the 6.9K gene promoter module in pMEV2 is derived from a "late" structural gene, which is expressed after the onset of DNA synthesis, and the polyhedrin (polh) gene promoter module in pMEV3 is from a "very late" gene that encodes the major structural component of viral occlusion bodies.
• the polylinker module is designed to allow placement of a protein coding region immediately adjacent to the 5 ' UTR of the promoter module without the introduction of extraneous linker sequences.
• the polylinker contains an Esp3 I site which is positioned so that digestion of the vector with Esp3 I cuts between positions -4 and -5 in the top strand of the promoter module and at the junction between the promoter and polylinker modules in the bottom strand.
• Treatment of Esp31-digested DNA with DNA polymerase in the presence of the four standard 2 ' -deoxynucleoside triphosphates (dNTPs) creates a linearized vector that is blunted at the exact 3 ' terminus of the promoter 21 module.
• This segment can be joined to a 5' blunt-ended fragment whose sequence begins with the ATG initiation codon of the desired protein coding region.
• the 3' terminus of the fragment is constructed so that it contains a recognition site for one of the enzymes that cleave within the polylinker module (illustrated with BamH I in Figure 5) and both the protein coding fragment and vector are digested with this enzyme prior to ligation.
• a key feature of these vectors is the presence of recognition sites for restriction enzymes Sse8387 I and Bsu36 I at either end of the expression cassette. This allows for the excision of inserted sequences from the modular expression vector and their ligation into the direct ligation PxNPV vectors of the present invention (see, e.g. , Example
• pMEV5 and pMEV6 Two vectors, pMEV5 and pMEV6, were constructed to incorporate a D. melanogaster hsp70 (major heat shock) gene promoter.
• pMEV5 contains a 724 bp segment of the D. melanogaster hsp70 promoter/5' UTR (designated hsp70Bam in Figure 4) extending from position -493 to position +231 with respect to the transcription start site of the hsp70 gene.
• pMEV6 contains a 475 bp segment of the same promoter/5' UTR (designated hsp70Xba in Figure PD2), extending from position -244 to position +231.
• the promoter modules used to construct pMEV5 and pMEV6 were synthesized by PCR amplification using plasmid phcHSP70PL (Morris et al. , J. Virol. 66:7397 (1992)) as the template.
• the oligonucleotide primers for each reaction and the sequence of the amplified product are shown in Figures 6 and 7 (for pMEV5 and pMEV6, respectively) .
• Each of the primers has a bipartite structure.
• the 5 ' portion has no sequence homology with the phcHSP70PL template and is used to incorporate specific restriction sites into the termini of the final PCR product.
• each primer contains sequences homologous to the phcHSP70PL template and defines one of the boundaries of the hps70- specific sequences in each module. 22
• the (-) strand primer (HSP70Esp) was phosphorylated at its 5' terminus by incubating 200 pmol of primer for 30 min at 37° C in a 10 ml reaction containing 70 mM Tris-HCl (pH 7.5), 10 mM MgCl 2 , 5 mM DTT, 1 mM ATP and 10 units T4 polynucleotide kinase (New England Biolabs, Beverly MA).
• the PCR reactions were then performed in separate MicroAmp tubes (Perkin Elmer, Norwalk CT) according to the following procedure.
• each primer was combined with 0.25 - 1.0 ng of phcHSP70PL DNA in a 50 ⁇ l reaction containing 200 ⁇ M dNTPs, IX cloned Pfu polymerase buffer (Stratagene, La Jolla CA) and 5 units of cloned Pfu DNA polymerase (Stratagene, La Jolla CA).
• the samples were placed in a Perkin-Elmer Model 9600 thermal cycler (Perkin Elmer, Norwalk CT) and subjected to 2 cycles of 1 min at 94 °C (denaturation step), 1.5 min at 50 °C (annealing step) and 3 min at 72 °C (extension step) followed by 28 cycles of 1 min at 94°C, 1.5 min at 55°C and 3 min at 72°C. On the last cycle, the extension reaction was carried out for an additional 7 min and the reactions were brought to 4°C.
• the amplification products were extracted once with phenol: chloroform :isoamyl alcohol (25:24:1), adjusted to 0.3M sodium acetate, and precipitated with ethanol.
• the DNA was digested with Pst I (which cleaves at the Sse8387 I site) and the fragments containing the presumptive hsp70 promoter modules were purified by electrophoresis on a 1.2 % low melt preparative grade agarose gel (BioRad, Richmond, C A) .
• the base vector for constructing pMEV5 and pMEV6 was prepared by cleaving pMEVl with EcoR I and filling in the ends with the Klenow fragment of DNA polymerase I in the presence of all four dNTPs.
• the large (3.1 kb) fragment containing the pBluescript backbone and the 3 ' UTR and polylinker modules was purified on a low melt agarose gel and ligated individually with the purified hsp70 promoter modules to form pMEV5 and pMEV6.
• pMEV5/ADK-AaIT C.
• pMEV6/ADK-AaIT The pMEV5 and pMEV6 vectors described above were further engineered to incorporate the gene encoding AalT, an insect-specific toxin that is expressed in the venom of the North African scorpion Andoctuonus australis (Hector) (Zlotkin et al. , 23
• Patent 5,547,871 discloses a codon-optimized ADK-AalT gene sequence in which secretion of the AalT toxin is directed by a signal peptide from the Manduca sexta adipokinetic hormone (ADK) gene.
• ADK Manduca sexta adipokinetic hormone
• a fragment containing the ADK-AalT gene sequence was synthesized by PCR using pMEV3/ADK-AaIT as a template.
• the (+) strand primer, designated PD30 begins at the initiator ATG codon of the ADK signal peptide.
• the (-) strand primer, designated 69K3UT was chosen so that it primes DNA synthesis at a location downstream of the polylinker module; that is, within the 3 'UTR of pMEV3/ ADK- AalT.
• the sequences of the primers and the amplified DNA fragment are presented in Figure 8.
• the 5' terminus of the (+) strand primer, PD30 was phosphorylated as described above for HSP70Esp.
• the PCR reaction was also carried out as described above, except that the amplification was performed for 25 cycles of 1 min at 94°C, 1.5 min at 52°C, and 3 min at 72°C.
• the DNA was digested with BamH I, which cuts in the polylinker module, and the 274 bp 5 '-blunt/3 '-BamH I fragment containing the ADK- AalT coding region is inserted into pMEV5 and pMEV6.
• the structures of the resulting plasmids, pMEV5/ ADK- AalT and pMEV6/ ADK- AalT were confirmed by restriction enzyme analysis and partial DNA sequence determination.
• a DNA fragment containing the promoter module and linked ADK signal peptide was recovered from the corresponding pMEVx/ ADK- AalT vector by PCR.
• the (+)-strand primer for each reaction was a promoter specific oligonucleotide that primes DNA synthesis at the 5 ' end of the promoter module and incorporates restriction sites for Sst I, Sse8387 I and Stu I into the 5' end of the amplified fragment.
• the templates and (+) strand primers for each reaction are listed in the following table:
• the PCR reaction was carried out as described above for pMEV5-6, except that the amplification is performed for 25 cycles of 1 min at 94°C, 1.5 min at 52°C and 3 min at 72°C.
• the DNA synthesized from all of the templates except pMEV5/ ADK- AalT was digested with Pst I, which cuts at the Sse8387
• Xba I which cuts downstream of the ADK signal peptide, and the fragment containing the promoter module and signal peptide was inserted 25 between the Pst I (Sse8387 1) and Xba I sites in one of the existing pMEVx vectors, such as pMEVl.
• the hsp70Bam promoter module in pMEV5 contains an internal Xba I site
• the hsp70Bam/ADK module must be inserted into pMEVx framework in two pieces. Accordingly, one portion of the DNA synthesized from the pMEV5/ ADK- AalT template was digested with Pst I and Xho I and a second portion was digested with Xho I and Xba I.
• the Pst I/Xho I fragment representing the 5' segment of the hsp70Bam/ADK module was combined with the Xho I/Xba I fragment representing the 3' segment of the hsp70Bam/ADK module and ligated into a Pst I/Xba I vector fragment prepared from pMEVl.
• Each of the resulting pMEVx ADK vectors is identical in structure to the corresponding pMEVx vector, except for the insertion of the 57 bp ADK signal peptide between the promoter and polylinker modules.
• the straw itch mite toxin TxP-I is a paralytic neurotoxin isolated from the venom of the predatory straw itch mite, Py emotes tritici (Tomalski et al. , Toxicon 27:1151 (1989)).
• the tox34 gene encodes a precursor protein of 291 amino acids (Tomalski et al. , Nature 352:82 (1991)). To test the efficacy of the tox34 gene within the context of a recombinant
• Txp- 1 constructs three different Txp- 1 constructs were prepared which differed in the aminoterminal signal sequence that directs secretion of the toxin from cells.
• One construct retained the native tox34 aminoterminal sequence; one contained an ADK signal peptide in place of the aminoterminal 40 residues of the tox34 preprotein; and one contained the ADK signal peptide in place of the aminoterminal 26 residues of the tox34 preprotein.
• tox34 Three different segments of the tox34 gene corresponding to codons 1 - 291 (designated tox34), 27 - 291 (tox34L) and 40 - 291 (tox34S) were synthesized by PCR and 26 adapted for cloning into one or more of the modular expression vectors described above.
• the template for the amplification reactions was plasmid pHSP70tox34 (Lu et al., Biological Control 7:320 (1996)).
• the plus-strand primer for each amplification is shown in the following table:
• the (-) strand primer designated TOX34CT2 , 5 ' -
• the DNA was digested with Xma I and the 5' -blunt/3 '- Xma I tox34 coding region fragments (designated tox34, tox34L or tox34S) were purified and cloned into a MEVS vector prepared as described in Example 3, except that the polylinker was cleaved with Xma I (which cleaves at the Sma I site) rather than with BamH I.
• the desired product was isolated from this mixture by PCR, using 0.5 ⁇ l of the ligation reaction as a source of template and oligonucleotides LqhIT2 PCRF (phosphorylated at its 5' terminus) 28 and LqhIT2 PCRR as primers ( Figure 10). Amplification was carried out for 25 cycles of 1 min at 94°C, 1.5 min at 55°C and 3 min at 72°C, as described in Example 3.
• the DNA was digested with BamH I, which cuts in the linker segment adjacent to the termination codon, and the desired 190 bp 5 ' -blunt/3 ' -BamH I fragment was purified by gel electrophoresis and cloned into MEVS vectors pMEVl/ADK, pMEV2/ADK, pMEV5/ ADK and pMEV6/ ADK as outlined in Example 3 and Figure 5.
• the sequence of the LqhIT2 coding region in each vector was confirmed by DNA sequencing.
• ⁇ -ACTX-HVl The ⁇ -atracotoxins are a family of insecticidal peptide toxins isolated from
• oligonucleotides Based on the amino acid sequence of ⁇ -ACTX-HVl , two oligonucleotides were designed that represent the two strands of the ⁇ -ACTX-HVl coding region and a small amount of 3' flanking linker DNA. Codon usage within the ⁇ -ACTX-HVl coding region is designed to reflect overall codon usage in the AcMNPV genome (Ayres et al (1994)). The sequences of these oligonucleotides are shown in Figure 11. Due to the length of oligonucleotides ACTXHV1F and ACTXHV1R, there was a strong likelihood that each was significantly contaminated with incomplete synthesis products.
• a PCR strategy similar to that described above for LqhIT2 was used to synthesize an ⁇ - ACTX-HV1 coding region fragment suitable for cloning into MEVS vectors.
• 0.1 pmol of each oligonucleotide were combined and used as the template for PCR amplification of the desired full length ⁇ -ACTX-HVl product.
• the primers for the reaction were ACTXPCRF (phosphorylated at its 5' terminus as described above) and ACTXPCRR.
• the PCR reaction was performed as described above, except that amplification was carried out for 15 cycles of 1 min at 94°C, 1.5 min at 55°C and 3 min at 72°C.
• the DNA was cleaved with BamH I, which cuts in the linker segment adjacent to the termination codon, and the desired 118 bp 5 ' -blunt/3 ' -BamH I fragment was purified by gel electrophoresis and cloned into MEVS vectors 29 pMEVl/ADK, pMEV2/ADK, pMEV5/ADK and pMEV6/ADK.
• the sequence of the ⁇ - ACTX-HV1 coding region in each vector was confirmed by DNA sequencing.
• PxNPVs encoding insecticidal toxins.
• Viral DNA was prepared from occlusion bodies (O'Reilly etal. 1994). The purified DNA was digested with Bsu 361 and Sse 83871 using an approximately 5 units of enzyme/ ⁇ g DNA. Size exclusion chromatography or sucrose gradient purification was used to separate the viral genomic DNA from the excised fragment. The resulting linearized viral DNA was ethanol precipitated and resuspended in 10 mM Tris-HCl pH 8.0/ 1 mM
• EDTA at a concentration of 0.2 - 1 ⁇ g/ ⁇ l.
• Example 1 The culture was refed with fresh medium 24 hours after transfection. After an additional 72 hours, the culture supernatant was harvested, diluted, and used to re-infect
• the data indicate that the increased efficacy of recombinant PxNPVs is not limited to AalT-expressing constructs.
• the tox34 expressing PxNPVs exhibit as low an
• LT 50 and LC 50 as the AalT-expressing recombinant.
• LC 50 and LC 50 as the AalT-expressing recombinant.

Landscapes

• Life Sciences & Earth Sciences (AREA)
• Health & Medical Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Zoology (AREA)
• Organic Chemistry (AREA)
• Engineering & Computer Science (AREA)
• General Health & Medical Sciences (AREA)
• Genetics & Genomics (AREA)
• Wood Science & Technology (AREA)
• Biotechnology (AREA)
• Virology (AREA)
• Microbiology (AREA)
• Molecular Biology (AREA)
• Biochemistry (AREA)
• Insects & Arthropods (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Plant Pathology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Engineering & Computer Science (AREA)
• Biophysics (AREA)
• Tropical Medicine & Parasitology (AREA)
• Gastroenterology & Hepatology (AREA)
• Medicinal Chemistry (AREA)
• Agronomy & Crop Science (AREA)
• Pest Control & Pesticides (AREA)
• Dentistry (AREA)
• Environmental Sciences (AREA)
• Toxicology (AREA)
• Biomedical Technology (AREA)
• Physics & Mathematics (AREA)
• Chemical Kinetics & Catalysis (AREA)
• General Chemical & Material Sciences (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Agricultural Chemicals And Associated Chemicals (AREA)
• Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Applications Claiming Priority (3)

Publications (1)

Family

ID=22186700

Family Applications (1)

Country Status (16)

Families Citing this family (10)

Family Cites Families (4)

• 1999
  • 1999-05-07 PL PL99345242A patent/PL345242A1/xx unknown
  • 1999-05-07 CA CA002331853A patent/CA2331853A1/en not_active Abandoned
  • 1999-05-07 CN CN99807162A patent/CN1310767A/zh active Pending
  • 1999-05-07 NZ NZ507918A patent/NZ507918A/en unknown
  • 1999-05-07 SK SK1685-2000A patent/SK16852000A3/sk unknown
  • 1999-05-07 BR BR9910515-2A patent/BR9910515A/pt not_active IP Right Cessation
  • 1999-05-07 TR TR2000/03245T patent/TR200003245T2/xx unknown
  • 1999-05-07 EP EP99921724A patent/EP1076717A1/en not_active Withdrawn
  • 1999-05-07 IL IL13940199A patent/IL139401A0/xx unknown
  • 1999-05-07 AU AU38856/99A patent/AU753930B2/en not_active Ceased
  • 1999-05-07 JP JP2000548496A patent/JP2002514435A/ja active Pending
  • 1999-05-07 ID IDW20002404A patent/ID28101A/id unknown
  • 1999-05-07 WO PCT/US1999/009914 patent/WO1999058705A1/en not_active Application Discontinuation
  • 1999-05-07 KR KR1020007012790A patent/KR20010043627A/ko not_active Application Discontinuation
  • 1999-05-07 HU HU0101684A patent/HUP0101684A3/hu unknown
• 2000
  • 2000-11-03 ZA ZA200006301A patent/ZA200006301B/xx unknown

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events