EP0948599A1 - Protein kinases and uses thereof - Google Patents
Protein kinases and uses thereofInfo
- Publication number
- EP0948599A1 EP0948599A1 EP98936821A EP98936821A EP0948599A1 EP 0948599 A1 EP0948599 A1 EP 0948599A1 EP 98936821 A EP98936821 A EP 98936821A EP 98936821 A EP98936821 A EP 98936821A EP 0948599 A1 EP0948599 A1 EP 0948599A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- plant
- polynucleotide
- nucleic acid
- regulatory element
- asp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/04—Plant cells or tissues
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8237—Externally regulated expression systems
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/11—Protein-serine/threonine kinases (2.7.11)
- C12Y207/11017—Ca2+/Calmodulin-dependent protein kinase (2.7.11.17)
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Definitions
- This invention relates to nucleic acids encoding calcium dependent protein kinases, polypeptides produced from such nucleic acids and transgenic plants expressing such nucleic acids.
- HR hypersensitivity response
- the site in the plant where the potential phytopathogen invades undergoes localized cell death, and it is postulated that this localized plant cell death contains the invading microorganism or virus, thereby protecting the remainder of the plant.
- Other plant defense responses include the production of phytoalexins, the production of lytic enzymes capable of averting pathogen ingress and modifications to cell walls that strengthen it against physical and/or enzymatic attack.
- the HR of plants can include phytoalexin production as part of the response to invading microorganisms.
- tobacco Naturalicotiana tabacum
- sesquiterpenes in response to microbial invaders, e.g., Pseudomonas lachrymans .
- compositions can serve as elicitors of plant phytoalexin synthesis. These include one or more toxic ions, e.g., mercuric ions, other chemically defined compositions, metabolic inhibitors, cell wall glycans, certain glycoproteins, certain enzymes, fungal spores, chitosans, certain fatty acids, and certain oligosaccharides derived from plant cell walls. See, e.g., Sequeira, L. (1983) Annu . Rev. Microbiol . 37.51-79 and references cited therein.
- Elicitins are proteins produced by plant pathogens and potential plant pathogens. Elicitins can induce the HR in plants. Generally, but not necessarily, localized cell death is the result of the elicitin-induced response in the infected (or challenged) plant tissue. These responses mediate full or partial resistance to destructive infection by the invading, potentially plant pathogenic microorganism. Amino acid and nucleotide coding sequences for an elicitin of Phytophthora parasi tica have been published. Ka oun et al . (1993) Mol . Plant-Microbe Interactions 6:573-581.
- Plant pathogenic viruses including, but not limited to, Tobacco Mosaic Virus (TMV) , induce the HR in infected plants. Bacteria that infect plants also can induce HR and thereby disease resistance; representative bacteria eliciting HR include, e.g., Xanthomonas spp . and Pseudomonas syringae . Plant pathogenic fungi generally do not induce the HR response after attack on a host plant, e.g., Phytophthora parasi tica and Peronospora tabaci on tobacco hosts, but can induce the HR after attack on a non-host plant .
- TMV Tobacco Mosaic Virus
- Nucleic acids of the present invention are based on novel calcium dependent protein kinase (CDPK) genes and their corresponding proteins. Induction of expression of these novel CDPK genes is surprisingly rapid, i.e., mRNA transcription of such genes can be observed as soon as 30 minutes after elicitor-mediated induction of plant defense responses.
- CDPK calcium dependent protein kinase
- the novel genes disclosed herein are among those genes that are most rapidly induced in response to signals indicating an invading plant pathogen.
- An isolated polynucleotide is disclosed herein, that comprises the nucleotide sequence of SEQ ID NO:l and its complement, and an RNA analog of SEQ ID NO:l or its complement.
- a polynucleotide can also be a nucleic acid fragment of the above that is at least 20 nucleotides in length and that hybridizes under stringent conditions to genomic DNA encoding the polypeptide of Figure 3.
- the polynucleotide can comprise, for example, nucleotides 1 to 170, nucleotides 160 to 560, or nucleotides 550 to 920 of Figure 2.
- a nucleic acid construct as disclosed herein comprises a polynucleotide of the invention.
- a polynucleotide of the invention can be operably linked to one or more elements that regulate transcription of the polynucleotide, for example, a regulatory element induced in response to a plant pathogen such as a fungus (e.g., Phytophthora) , a bacterium (e.g., PseudojTionas) , or a virus (e.g., Tobacco Mosaic Virus) as described herein.
- a plant pathogen such as a fungus (e.g., Phytophthora)
- a bacterium e.g., PseudojTionas
- virus e.g., Tobacco Mosaic Virus
- transgenic plant cells, plant tissues, and plants that have been genetically engineered to contain and express a polynucleotide of the invention, for example, a coding sequence, or an antisense sequence.
- the construct can further comprises a regulatory element operably linked to the polynucleotide, e.g., an inducible regulatory element.
- the plant can be a dicotyledonous plant, e.g., a member of the Solanaceae family such as Nicotiana tabacum.
- the plant can also be a monocotyledonous plant, a gymnosperm, or a conifer.
- a transgenic plant contains a polynucleotide expressing a polypeptide having from about 250 to about 550 amino acids.
- the polypeptide comprises an amino acid sequence substantially identical to the amino acid sequence of Figure 3.
- a method of using a polynucleotide is disclosed herein. The method comprises the step of hybridizing the polynucleotide discussed above to DNA or RNA from a plant .
- the method can further comprise the steps of identifying a segment of the plant DNA or RNA that has about 70% or greater sequence identity to the polynucleotide, and the step of cloning at least a portion of the DNA or RNA segment.
- the cloned portion may further comprise DNA flanking the segment having 70% or greater sequence identity.
- the invention features a method of altering disease resistance in a plant.
- the method comprises the steps of introducing a polynucleotide of the invention into a plant cell; and producing a plant containing the polynucleotide from the plant cell .
- Expression of the polynucleotide alters disease resistance in the plant.
- the nucleic acid construct may further comprise an inducible regulatory element operably linked to the polynucleotide and expression may be induced by the regulatory element upon exposure of the plant to an elicitor or plant pathogen.
- the invention features an isolated polypeptide, having from about 250 to about 550 amino acids and comprising an amino acid sequence substantially identical to Figure 3.
- An inducible regulatory element is a DNA sequence effective for regulating the expression of a polynucleotide that is operably linked to that regulatory element.
- a CDPK gene product associated with a plant defense response e.g., a hypersensitive response
- a developmentally- regulated regulatory element e.g., a plant defense response
- regulatory elements that are sufficient to render gene expression inducible in response to disease- associated external signals or agents (e.g., pathogen- or elicitor- induced signals or agents as described herein) .
- regulatory elements flanking a novel CDPK gene and involved in rapid induction of transcription of such a novel gene are located 5' to the coding region of a gene, but are not so limited.
- tissue-specific is meant capable of preferentially increasing expression of a gene product (e.g., an mRNA molecule or polypeptide) in one tissue
- tissue e.g., xylem tissue
- tissue e.g., phloem
- cell-specific capable of preferentially increasing expression of a gene product (e.g., an mRNA molecule or polypeptide) in one cell (e.g., a parenchyma cell) as compared to another cell (e.g., an epidermal cell).
- a gene product e.g., an mRNA molecule or polypeptide
- a "pathogen” is an organism whose infection of, or association with, cells of viable plant tissue can result in a disease.
- An “elicitor” is any molecule that is capable of initiating a plant defense response. Examples of elicitors include, without limitation, one or more toxic ions, e.g., mercuric ions, other chemically defined compositions, metabolic inhibitors, cell wall glycans, certain glycoproteins, certain enzymes, fungal spores, chitosans, certain fatty acids, and certain oligosaccharides derived from plant cell walls, and elicitins (e.g., harpin, cryptogein, and parasiticein) .
- toxic ions e.g., mercuric ions
- other chemically defined compositions e.g., metabolic inhibitors, cell wall glycans, certain glycoproteins, certain enzymes, fungal spores, chitosans, certain fatty acids, and certain oligosaccharides
- operably linked is meant that two polynucleotides are connected in such a way as to permit the two polynucleotides to achieve a desired functional activity, for example, linking of an inducible regulatory sequence and a coding sequence to achieve gene expression when the appropriate inducer molecules are present .
- all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.
- the materials, methods, and examples are illustrative only and not intended to be limiting.
- Figure 1 is a representation of the nucleotide sequences of the primers FokinB and RecallV.
- Figure 2 is a representation of the DNA sequence (SEQ ID NO:l) of a partial cDNA clone isolated from a cell suspension culture derived from a tobacco cultivar KY14 explant, after growth in the presence of the elicitin parasiticein.
- Figure 3 is a representation of the deduced amino acid sequence of the DNA sequence of Figure 2, using the standard one letter amino acid code.
- Figure 4 is a schematic comparison of the amino acid sequence of Figure 3 to that of a soybean CDPK.
- the present invention relates to isolated polynucleotides (nucleic acids) that are induced in plant cells in response to invasion by a potential plant pathogen and/or treatment with an elicitor or elicitor- mimicking chemical signals.
- nucleic acids typically encode a calcium dependent protein kinase (CDPK) polypeptide or CDPK-related polypeptide.
- CDPK calcium dependent protein kinase
- Induction of the novel polynucleotides disclosed herein corresponds in time to that of plant defense response genes, whereas other CDPK genes appear to be induced less rapidly. Induction of gene expression for such novel genes is more rapid than that of genes involved in developmentally regulated processes in plants, e.g., developmentally regulated processes such as floral development .
- a polynucleotide of the present invention can be in the form of RNA or in the form of DNA, including cDNA, synthetic DNA or genomic DNA.
- the DNA can be double- stranded or single-stranded and, if single-stranded, can be either a coding strand or non-coding strand.
- An RNA analog of SEQ ID NO : 1 may be, for example, mRNA or a combination of ribo- and deoxyribonucleotides .
- a polynucleotide of the invention can encode a polypeptide including an amino acid sequence substantially similar or identical to that of Figure 3.
- a polynucleotide may be a variant of the nucleic acid shown in SEQ ID NO:l, e.g., can have a different nucleotide sequence that, due to the degeneracy of the genetic code, encodes the same amino acid sequence as the polypeptide of Figure 3.
- a polynucleotide of the invention can further include additional nucleic acid sequences.
- a nucleic acid fragment encoding a secretory or leader amino acid sequence can be fused in-frame to the amino terminal end of a polypeptide comprising the amino acid sequence of Figure 3.
- nucleic acid fragments are known in the art that encode amino acid sequences useful for fusing in-frame to the CDPK polypeptides disclosed herein. See, e.g., U.S. 5,629,193.
- a polynucleotide can further include one or more regulatory elements operably linked to a CDPK polynucleotide disclosed herein.
- the present invention also includes polynucleotides that selectively hybridize to a CDPK polynucleotide sequence disclosed herein. Hybridization may involve Southern analysis (Southern blotting) , a method by which the presence of DNA sequences in a target nucleic acid mixture are identified by hybridization to a labeled oligonucleotide or DNA fragment probe.
- Southern analysis typically involves electrophoretic separation of DNA digests on agarose gels, denaturation of the DNA after electrophoretic separation, and transfer of the DNA to nitrocellulose, nylon, or another suitable membrane support for analysis with a radiolabeled, biotinylated, or enzyme-labeled probe as described in sections 9.37- 9.52 of Sambrook et al . , (1989) Molecular Cloning, second edition, Cold Spring Harbor Laboratory, Plainview, NY.
- a polynucleotide can hybridize under moderate stringency conditions or under high stringency conditions to a polynucleotide disclosed herein. High stringency conditions are used to identify nucleic acids that have a high degree of homology or sequence identity to the probe.
- High stringency conditions can include the use of a denaturing agent such as formamide during hybridization, e.g., 50% formamide with 0.1% bovine serum albumin/O.1% Ficoll/0.1% polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl , and 75 mM sodium citrate at 42 °C.
- a denaturing agent such as formamide during hybridization, e.g., 50% formamide with 0.1% bovine serum albumin/O.1% Ficoll/0.1% polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl , and 75 mM sodium citrate at 42 °C.
- Another example is the use of 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 ⁇ g/ml) , 0.1% SDS, and 10% dextran sulfate at 42°C, with washes at 42°C in 0.2 x SSC and 0.1% SDS.
- low ionic strength and high temperature can be employed for washing, for example, 0.015 M NaCl/0.0015 M sodium citrate (0.1X SSC); 0.1% sodium lauryl sulfate (SDS) at 65°C.
- Moderate stringency conditions are hybridization conditions used to identify nucleic acids that have less homology or identity to the probe than do nucleic acids identified under high stringency conditions.
- Moderate stringency conditions can include the use of higher ionic strength and/or lower temperatures for washing of the hybridization membrane, compared to the ionic strength and temperatures used for high stringency hybridization.
- a wash solution comprising 0.060 M NaCl/0.0060 M sodium citrate (4X SSC) and 0.1% sodium lauryl sulfate (SDS) can be used at 50°C, with a last wash in IX SSC, at 65°C.
- a hybridization wash in IX SSC at 37 °C can be used.
- Hybridization can also be done by Northern analysis (Northern blotting) , a method used to identify RNAs that hybridize to a probe.
- the probe is labeled with a radioisotope such as 32 P, by biotinylation or with an enzyme .
- the RNA to be analyzed can be electrophoretically separated on an agarose or polyacrylamide gel, transferred to nitrocellulose, nylon, or other suitable membrane, and hybridized with the probe, using standard techniques well known in the art such as those described in sections 7.39-7.52 of Sambrook et al . , supra .
- a probe of at least about 20 nucleotides in length be used, preferably at least about 50 nucleotides, more preferably at least about 100 nucleotides. If a relatively short probe is to be used, the nucleotide sequence of the probe preferably avoids regions conserved among plant CDPK genes (protein kinase domains and calcium-binding domains) , to more readily distinguish the rapidly induced CDPK genes disclosed herein from more slowly induced CDPK genes, constitutive CDPK genes or low-level constitutive CDPK genes. Nevertheless, probes containing such conserved regions can be used, provided that there are sufficient non-conserved regions present in the probe that are more specific for the novel polynucleotides disclosed herein.
- CDPK genes protein kinase domains and calcium-binding domains
- a polynucleotide of the invention has at least about 70% sequence identity, preferably at least about 80% sequence identity, more preferably at least about 90% sequence identity to SEQ ID NO:l. Sequence identity can be determined, for example, by computer programs designed to perform single and multiple sequence alignments. Polynucleotides having at least about 70% nucleotide sequence identity to the polynucleotide of SEQ ID NO : 1 are included in the invention and can be identified by hybridization under conditions of moderate stringency. Polynucleotides having at least about 80% sequence identity, or at least about 90% sequence identity, or at least about 95% sequence identity to the polynucleotide of SEQ ID NO:l can be identified by high stringency hybridization.
- a polynucleotide of the invention can be obtained by chemical synthesis, isolation and cloning from plant genomic DNA, or other means known to the art, including the use of polymerase chain reaction (PCR) technology carried out using oligonucleotides corresponding to portions of SEQ ID NO:l.
- PCR refers to a procedure or technique in which target nucleic acid is amplified in a manner similar to that described in U.S. Patent No. 4,683,195, incorporated herein by reference, and subsequent modifications of the procedure described therein.
- sequence information from the ends of the region of interest or beyond are employed to design oligonucleotide primers that are identical or similar in sequence to opposite strands of the template to be amplified.
- PCR can be used to amplify specific RNA sequences, specific DNA sequences from total genomic DNA, and cDNA transcribed from total cellular RNA, bacteriophage or plasmid sequences, and the like.
- a cDNA library in an expression vector
- CDPK-specific antibody prepared using peptide sequence (s) from hydrophilic regions of the CDPK sequence of Figure 3 and technology known in the art .
- novel polynucleotides of the invention can be found in substantially all plants, including members of the Leguminaceae (e.g., soybean), members of the Solanaceae (e.g., N. tabacum) , members of the
- polynucleotides of the invention are selected from the Solanaceae family.
- a polynucleotide of the invention is identified and isolated from a plant based on nucleotide sequence homology and on the rapid induction of expression after elicitor or pathogen treatment. For example, DNA.DNA hybridization under conditions of moderate to high stringency with a polynucleotide probe disclosed herein allows the identification of corresponding genes from other plant species.
- target nucleic acid e.g., cDNA
- tissue shortly after induction of defense responses facilitates the isolation of the novel polynucleotides disclosed herein, because such polynucleotides typically are more rapidly induced than other CDPK genes .
- a nucleic acid construct comprises a polynucleotide as disclosed herein, and typically is linked to another, different polynucleotide.
- a full-length CDPK coding sequence can be operably fused in-frame to a nucleic acid fragment that encodes a leader sequence, secretory sequence or other additional amino acid sequences that may be usefully linked to a polypeptide or peptide fragment.
- a nucleic acid construct includes a polynucleotide of the invention operably linked to at least one suitable regulatory sequence in sense or antisense orientation.
- Regulatory sequences typically do not themselves code for a gene product. Instead, regulatory sequences affect the expression level of the coding sequence. Examples of regulatory sequences are known in the art and include, without limitation, minimal promoters and promoters of genes induced in response to elicitors. Native regulatory sequences of the polynucleotides disclosed herein can be readily isolated by those skilled in the art and used in constructs of the invention. Other examples of suitable regulatory sequences include enhancers or enhancer-like elements, introns, 3' non-coding regions such as poly A sequences and other regulatory sequences discussed herein. Molecular biology techniques for preparing such chimeric genes are known in the art.
- Polypeptides of the invention have from about 250 to about 550 amino acids, e.g., from about 300 amino acids to about 508 amino acids, or from about 308 amino acids to about 500 amino acids.
- a polypeptide of the invention typically contains protein kinase domains as well as calcium-binding site domains. Such domains include, for example, amino acids 2 to 7 , 42 to 49, 191 to 202, 227 to 238, 264 to 274, and 297 to 307 of Figure 3.
- the amino acid sequence of the polypeptide can include the deduced amino acid sequence of Fig. 3.
- a polypeptide of the invention includes an amino acid sequence substantially identical to that of Fig.
- polypeptide is expressed and produced in a manner or environment other than the manner or environment in which the polypeptide is naturally expressed and produced.
- a polypeptide is isolated when expressed and produced in bacteria or fungi.
- a polypeptide is isolated when a gene encoding it is operably linked to a chimeric regulatory element and expressed in a tissue or species where the polypeptide is not naturally expressed.
- a polypeptide is isolated when a gene encoding it is operably linked to a chimeric regulatory element and is expressed in a tissue where the polypeptide is naturally expressed, but at higher levels.
- a polypeptide of the invention can also be isolated by standard purification methods to obtain it in about 80% or greater purity, or about 90% or greater purity or about 95% or greater purity.
- a polypeptide of the invention is an analog or variant of a polypeptide including the deduced amino acid sequence of Fig. 3.
- Such analogs or variants include, for example, naturally occurring allelic variants, non-naturally occurring allelic variants, deletion variants, and insertion variants, that do not substantially alter the function of the polypeptide.
- a polypeptide of the invention may comprise the sequence shown in Fig. 3 as well as the flanking amino terminal and carboxy terminal sequences encoded by the same gene as that comprising the nucleotide sequence of SEQ ID NO:l.
- a chimeric polypeptide may be produced from a gene that links, in-frame, nucleotides from the 5' region of a first CDPK gene to nucleotides from the 3' region of a second CDPK gene, thereby forming a chimeric gene that encodes the chimeric polypeptide.
- a chimeric CDPK polypeptide is a polypeptide expressed by a polynucleotide encoding amino acids 1 to 156 from the amino terminal region of a soybean CDPK gene (Fig. 4) , followed by the amino acid sequence of Fig. 3, followed by amino acids 465 to 508 from the carboxy terminal region of the same soybean CDPK gene, all of which are fused in-frame.
- a transgenic plant of the invention contains a nucleic acid construct as described herein. Such a construct is introduced into a plant cell and at least one transgenic plant is obtained. Seeds produced by a transgenic plant can be grown and selfed (or outcrossed and selfed) to obtain plants homozygous for the construct. Seeds can be analyzed to identify those homozygotes having the desired expression of the construct. Transgenic plants may be entered into a breeding program, e.g., to increase seed, to introgress the novel construct into other lines or species, or for further selection of other desirable traits. Alternatively, transgenic plants may be obtained by vegetative propagation of a transformed plant cell, for those species amenable to such techniques.
- a transgenic plant also refers to progeny of an initial transgenic plant.
- Progeny includes descendants of a particular plant or plant line, e.g., seeds developed on an instant plant.
- Progeny of an instant plant also includes seeds formed on F l t F 2 , F 3 , and subsequent generation plants, or seeds formed on BC ⁇ BC 2 , BC 3 , and subsequent generation plants.
- a transgenic plant contains a construct that includes a polynucleotide of the invention operably linked in sense orientation to a suitable regulatory element, so that a sense mRNA is produced. If desired, a selectable marker gene can be incorporated into the construct in order to facilitate identification of transformed cells or tissues.
- Inhibition of the novel CDPK genes in plants is also useful.
- inhibition of CDPK gene expression shortly before harvest of a seed crop can permit plant pathogens to more readily invade plant vegetative tissues, thereby reducing the amount of plant biomass that interferes with mechanical harvesting of the seeds.
- Regulated inhibition of CDPK gene expression can be accomplished by operably linking, in antisense orientation, a polynucleotide of the invention to a suitable inducible regulatory sequence. See, e.g., U.S. Patent 5,453,566.
- cosuppression i.e, expression in the sense orientation of the entire or partial coding sequence of a novel CDPK gene can suppress corresponding endogenous CDPK genes.
- a nucleic acid construct includes a polynucleotide disclosed herein, operably linked to a minimal promoter.
- a minimal promoter contains the DNA sequence signals necessary for RNA polymerase binding and initiation of transcription.
- transcription directed by a minimal promoter is low and does not respond either positively or negatively to environmental or developmental signals in plant tissue.
- An exemplary minimal promoter suitable for use in plants is the truncated CaMV 35S promoter, which contains the region from -90 to +8 of the .35S transcription unit.
- Transcriptional regulatory sequences can be used to control gene expression in suspension cultures.
- the EAS4 promoter including the transcription initiation signals, the inducible transcription regulatory element and the transcription-enhancing element can be used to mediate the inducible expression of the disclosed coding sequence in transgenic plants or suspension cell cultures. See U.S. Application Serial No. 08/577,483.
- expression of the coding sequence of interest is induced by the application of an elicitor or other inducing signal.
- Transgenic techniques for use in the invention include, without limitation, Agro acterium-mediated transformation, electroporation and particle gun transformation.
- Illustrative examples of transformation techniques are described in U.S. Patent 5,204,253, (particle gun) and U.S. Patent 5,188,958 (Agrobacterium) . Transformation methods utilizing the Ti and Ri plasmids of Agrobacterium spp . typically use binary type vectors. Walkerpeach, C. et al . , in Plant Molecular Biology Manual, S. Gelvin and R. Schilperoort , eds . , Kluwer Dordrecht, Cl:l-19 (1994).
- an inducible transcription regulatory sequence can be coupled to a promoter sequence functional in plants, both of which are operably linked to a polynucleotide of the invention.
- a truncated (or minimal) promoter generally is used, for example, the truncated 35S promoter of Cauliflower Mosaic Virus (CaMV) .
- CeMV Cauliflower Mosaic Virus
- Truncated versions of other constitutive promoters can also be used, e.g., A . tumefaciens T-DNA genes such as nos , ocs, and mas, and plant virus genes such as the CaMV 19S gene.
- Monocots which have been successfully transformed and regenerated include wheat, corn, rye, rice and asparagus. See, e.g., U.S. Patent Nos. 5,484,956 and 5,550,318.
- Transgenic aspen tissue has been prepared and transgenic plants have been regenerated. Poplars have also been transformed.
- Technology is also available for the manipulation, transformation, and regeneration of Gymnosperm plants. See, e.g., U.S. Patent No. 5,122,466 and U.S. Patent No. 5,041,382.
- a method according to the invention includes the introduction of a nucleic acid construct into a plant cell and the production of a plant from such a transformed cell .
- Expression of the polynucleotide present in the construct alters the disease resistance phenotype of the plant, e.g., a novel disease resistance phenotype is conferred on the plant or an existing disease resistance phenotype is enhanced.
- Disease resistance phenotype involves the level and timing of host defensive responses in the transgenic plant. Assays to indicate that disease resistance has been altered typically include the application of a compound that ordinarily elicits a defensive response to a transgenic plant and, in parallel, the application of the same compound to a control plant .
- a control plant typically is from the same parental line as the one into which a new nucleic acid construct was introduced.
- Disease resistance is enhanced or conferred on a plant by expression of a polynucleotide of the invention when there is a higher level of resistance in the transgenic plant than the corresponding resistance in the control plant. Disease resistance can be measured with reference to a specific pathogen, e.g., a Phythophthora spp . .
- Disease resistance can also be measured with reference to several pathogens, to identify an enhanced systemic defense response.
- transgenic plants are to be induced for expression of a CDPK coding sequence operably linked to an elicitor-mediated regulatory element
- the elicitor typically must penetrate the cuticle of the plant to have an inductive effect .
- Plant tissue can be wounded to facilitate or allow the uptake of the elicitor into the plant tissue.
- inducing compositions including elicitors and other chemical signals, such as the combination of ethylene and methyl jasmonate, can be effectively used to induce expression.
- a method of using a polynucleotide of the invention comprises the step of hybridizing the polynucleotide to DNA or RNA from a plant. Hybridization can be carried out, for example, as described hereinabove .
- the method can further comprise the step of identifying a segment of the plant DNA or RNA that has a significant degree of sequence identity to the polynucleotide, e.g., 70% sequence identity, preferably 80% sequence identity, 90% sequence identity, or 95% sequence identity.
- the segment can be identified by electrophoretic separation of the plant DNA or RNA and the use of labeled polynucleotide probe, which results in a visible band at the position of the homologous segment.
- Segments can be generated, for example, by physical shearing or by restriction endonuclease digestion.
- a segment can be as short as 100 bp (nucleotides) in length, but typical segments are at least 1000 bp, and can be 10,000 bp or greater.
- Such a method can further comprise the step of cloning at least a portion of the DNA or RNA segment, including, but not limited to, DNA flanking the homologous segment.
- flanking DNA can include promoters, enhancers, transcriptional regulatory elements and poly A sequences.
- Flanking DNA can be either 5' to or 3' to the homologous segment and preferably includes 300, or 600, or 1,000 bp of DNA beyond the coding sequence, because regulatory elements generally are found within this span.
- Promoters and other elicitor or pathogen- responsive regulatory elements flanking the novel polynucleotides disclosed herein are particularly useful, because such elements confer very rapid induction of gene expression after treatment with pathogen or elicitor.
- Such regulatory elements can be operably linked to useful genes to allow rapid production of desirable compounds.
- such regulatory elements can be used to drive expression of genes encoding antibodies, blood clotting factors, antigenic peptides, viral replicases or coat proteins, and enzymes involved in secondary metabolite synthesis (such as isoprenoid biosynthesis) . See, e.g., U.S. Patent 5,612,487; U.S. Patent 5,484,719; and U.S. Application Ser. No. 08/577,483, filed December 22, 1995.
- a chimeric gene having an elicitor or pathogen-responsive element After introducing a chimeric gene having an elicitor or pathogen-responsive element into a plant, expression of the chimeric gene product can be induced with an appropriate pathogen or elicitor. Production of the desired gene product (or its enzymatic end product) rapidly ensues and the desired product can then be obtained.
- the elicitor parasiticein was prepared by expression of the Phytophthora parAl gene in E. coli cells and isolation of the gene product from the periplasmic space.
- Genomic DNA of Phytophthora Race O was isolated from mycelium essentially as described in Xu, J. , et al . Trends in Genetics 10:226-227 (1994). The DNA was sheared and used as a template for PCR amplification of the parAl gene, using primers designed according to the parAl sequence reported in Kamoun, S., et al . Mol . Plant- Microbe Interact. 6:573-581 (1993). The parAl PCR product was cloned into pBluescript (Stratagene, San Diego, CA) and the sequence of the product determined by double-stranded DNA sequencing using the dideoxy chain termination method.
- pBluescript Stratagene, San Diego, CA
- the parAl insert in pBluescript was amplified by PCR, using primers that created an N-terminal histidine tag and a protein kinase site at the 5' end of the gene.
- the PCR product was ligated into the expression vector pET28b (Novagen, Madison, WI) and, after confirming the DNA sequence of the parAl fusion, the pET28b construct was transformed into E. coli BL21.
- a BL21 culture containing the parAl fusion was grown at 37° C in the presence of kanamycin to an OD 600 of 0.3.
- IPTG ImM
- Periplasmic proteins were prepared by osmotic shock essentially as described in Ausubel, F., et al . in Current Protocols in Molecular Biology, John Wiley & Sons, New York (1989) .
- Cells (1.5 ml) were harvested by centrifugation, resuspended in 500 ⁇ l of 50 mM Tris-HCl, pH 8.0, 20% sucrose, 1 mM EDTA and incubated with shaking for 10 minutes at room temperature.
- the pellet was resuspended in 200 ⁇ l ice cold MgS0 4 (5 mM) and incubated with shaking for 10 minutes at 4° C. The mixture was centrifuged and the resulting supernatant (containing periplasmic proteins) was applied to a Ni ++ column.
- the parAl protein was purified from the column according to the manufacturer's directions. The protein concentration in the parAl extract was determined by the Bradford method. Nicotiana tabacum L. cv. KY14 cell suspension cultures were treated with parasiticein at a final concentration of 2 ⁇ g/ml during rapid growth phase to induce stress response genes. Parallel suspension cell cultures which were not treated with parasiticein served as controls. Cells were collected by gentle vacuum filtration 0, 30, 60 and 120 minutes after the addition of elicitor.
- RNA was isolated from treated and untreated tobacco cells and used as template for targeted differential display reverse transcriptase PCR (TDDRT- PCR) .
- First strand cDNA was generated using a cDNA cycle kit from Invitrogen (San Diego, CA) . The first strand cDNAs were then used as templates for PCR. The PCR reaction was carried out using typical conditions as described in PCR Protocols: A Guide to Methods and
- PCR primers were FokinB (GTTGACTCCCTACCCTCTT) and RecallV (GGTACTTAGGAAGTGTTACGGG) . See Figure 1. PCR products were separated by electrophoresis on a 1% (w/v) agarose gel and products of greater than about 800 base pairs (bp) from the 60 minute treated culture were purified by electroelution onto DE-81 paper (Whatman) . Ends of the purified PCR products were filled in with
- Klenow polymerase ligated to the EcoRV site of pBluescript, and transformed into E. coli TB1.
- Ampicillin resistant TB1 colonies were screened for the presence of a > . 800 bp DNA fragment inserted into pBluescript.
- the sequence of one such insert was determined by the dideoxynucleotide chain termination procedure of Sanger et al . (1977) Proc . Natl . Acad. Sci . USA 74 . : 8073-8077, with a Sequenase ® kit from United States Biochemical Corp., Cleveland, OH) or an automated fluorescence based system (Applied Biosystems, Foster
- the sequence of the insert in the vector was determined on both strands .
- the plasmid containing this insert was designated pCDPK-1.
- the nucleotide sequence of the insert in pCDPK-1 is shown in Figure 2 and the deduced amino acid sequence of the insert is shown in Figure 3.
- the deduced amino acid sequence was compared to amino acid sequences of plant genes in the GenBank, EMBL, and Swiss Prot databases . Homology was found to plant CDPK polypeptides, including polypeptides from Glycine max, Arabidopsis thaliana, Vigna radiata, Zea mays and Cucurbi ta pepo.
- FIG. 4 shows a comparison of the amino acid sequence of Fig. 3 and a soybean CDPK amino acid sequence (Genbank Accession No:M64987) .
- the amino acid sequence of the tobacco calcium binding sites were similar to the amino acid sequence of corresponding sites in the soybean CDPK. However, there were significant differences in other parts of the sequence. The comparison indicates that there is about 78% overall sequence identity between the soybean CDPK and CDPK-1.
- the BLASTN program was used to compare the pCDPK-1 nucleotide sequence to nucleic acid sequences on various databases. Based on the nucleotide sequence of other plant CDPK genes and the length of the polypeptides encoded thereby, the nucleic acid insert present in pCDPK-1 is estimated to lack about 560 bp of 5' CDPK-1 coding sequence and about 130 bp of 3' CDPK-1 coding sequence.
- Example 2 Isolation of a full-length cDNA clone To obtain a full-length clone, a RACE (Rapid Amplification of cDNA Ends) approach is used, with polyA ⁇ RNA prepared from tobacco cells after induction with elicitor being the template. PolyA+ RNA is prepared as described in Example 1.
- RACE Rapid Amplification of cDNA Ends
- a primer having the sequence GAC AAG GAC GGG AGT GGG TAT (Primer A, internal to CDPK-1) and a primer having the sequence GAC TCG AGT CGA CAT CGA TTT TTT TTT TTT TTT TT (dT 17 adapter-primer) are used to amplify the 3 ' end of the CDPK coding sequence .
- the reverse transcriptase reaction is carried out in 2 ⁇ l 10X RTC buffer, 10 units of RNasin (Promega Biotech), 0.5 ⁇ g of dT 17 adapter-primer and 10 Units of AMV reverse transcriptase (Life Sciences) in a total volume of 3.5 ⁇ l, as described in Frohman, M.
- PCR Protocols A Guide to Methods and Applications, supra, pp. 28-38.
- the PCR amplification reaction is carried out in 5 ⁇ l 10X PCR buffer, 5 ⁇ l DMSO, 5 ⁇ l 10X dNTPs (15 mM each) , 30 ⁇ l H 2 0, 1 ⁇ l adapter-primer (25 pmol , GAC TCG AGT CGA CAT CG) , 1 ⁇ l primer A and l-5 ⁇ l cDNA. Cycle times are as indicated in Frohman, supra .
- the 5' end of the CDPK coding sequence is cloned by carrying out reverse transcription as described above, using 10 pmole of primer B (AGG GGC TAC GTA GTA AGG ACT) instead of dT 17 adapter-primer.
- the cDNA product is extended using terminal transferase and dATP as described in Frohman, supra, and then amplified by PCR as described above with 10 pmole of dT 17 adapter-primer, 10 pmole of adapter-primer and 10 pmole of primer C (ATT CTC AGG CTT AAG GTC CCT) .
- PCR is carried out under standard conditions. Back et al . (1994) Arch . Biochem . Biophys . 315 : 523-532.
- the amplified 3' and 5' products are blunt- end cloned into pBluescript SK (Stratagene) and combined with the pCDPK-1 insert by routine molecular biology techniques to form a full-length cDNA of the tobacco CDPK coding sequence .
- the DNA sequence of the full-length cDNA is determined by a dideoxynucleotide chain termination procedure, as described in Example 1.
- the insert from pCDPK-1 was radiolabeled by the random priming method and hybridized to the gel -separated RNA as described in Sambrook, J. et al . , supra . No mRNA hybridizing to CDPK-1 was detected prior to elicitor treatment, whereas mRNA hybridizing to CDPK-1 was readily detected at 1/2, 1 and 2 hours after elicitor treatment. At 6 and 12 hours after elicitor treatment, no mRNA hybridizing to CDPK-1 could be detected, indicating that
- CDPK-1 gene expression had decreased to undetectable levels by about 6 hours.
- a CDPK gene is constructed from: a chemically synthesized DNA encoding amino acids 1 to 156 of the soybean CDPK of Figure 6, a chemically synthesized DNA encoding amino acids 465 to 508 of the soybean CDPK of Figure 6, and the CDPK insert of pCDPK-1.
- the three DNAs are ligated by routine molecular biology techniques to form a chimeric CDPK coding sequence having amino acids 1 to 156 of soybean CDPK at the amino terminal end, fused in-frame to amino acids 1 to 307 of tobacco CDPK (Fig.
- the chimeric coding sequence is inserted in sense orientation into an Agrobacterium binary vector containing a minimal 35S and EAS4 inducible regulatory element. Operable linkage of the regulatory element, promoter, and coding sequence is confirmed by determining the DNA sequence of the junction regions and by expression in transgenic plants.
- Transformed plant cell lines are produced using a modified Agrro ac erium tumefaciens transformation protocol.
- Nucleic acid constructs are prepared that contain the full-length CDPK cDNA of Example 3 or the chimeric CDPK coding sequence of Example 4.
- the recombinant constructs containing the sequences to be introduced into plants are transferred into A . tumefaciens strain GV3850 by triparental mating with E. coli TB1 (pRK2013) .
- N. tabacum leaves at a variety of stages of growth are cut into 1 cm 2 pieces, and dipped in a suspension of Agrobacterium cells (about 10 4 to 10 5 cells/ml) .
- Plant Tissue Culture Medium contains per liter: 4.31 g of Murashige and Skoog Basal Salts Mixture (Sigma Chemical Company, St.
- the biolistic technique for the introduction of DNA containing cell suicide genes under the regulatory control of the inducible transcriptional regulatory element is a useful alternative transformation technique because it does not entail the use of Agrobacterium cells or fungal cell wall digestive enzymes (as necessary for the generation of protoplasts for electroporation) , both of which can lead to induction of the coding sequences under the control of that regulatory element.
- Transgenic plants are regenerated essentially as described by Horsch et al . (1985) Science 227:1229-1231.
- Example 7 Elicitor- and Pathogen-inducible Expression of a Chimeric CDPK Gene in Transgenic Tobacco
- the activity of the CDPK constructs of Example 7 are measured in transgenic tobacco plants treated with either an elicitor or pathogen.
- transgenic tobacco plants expressing the GUS reporter gene under the control of the cauliflower mosaic virus (CaMV) 35S promoter are also produced.
- F x seeds from regenerated transgenic tobacco plants are germinated on medium containing 100 mg/L kanamycin.
- the resulting kanamycin-resistant plants are subsequently transferred into soil and grown in a greenhouse.
- Half of the plants are tested for the expression of the CDPK gene under inducing conditions, e.g., by intercellular application of elicitor or cellulase to the transgenic plants.
- Elicitor or cellulase is applied with a mechanical pipetter.
- remaining plants are mock-treated with a solution lacking cellulase or elicitor.
- Tobacco tissue is wounded with a scalpel in some experiments to facilitate exposure to the inducing compound .
- Tobacco leaf genomic DNA is isolated as described in Murray and Thompson (1980) Nucleic Acids Research 8 . : 4321-4325. After digestion of aliquots with desired restriction enzymes, the digested DNA samples are electrophoresed on 0.8% agarose gels and the size-separated DNAs are transferred to nylon membranes. DNA blots are hybridized with the 900 bp CDPK cDNA insert of Example 1 that is radiolabeled by the random primer method. Hybridization is performed at 60 °C in 0.25 M sodium phosphate buffer, pH 8.0 , 0.7% SDS, 1% bovine serum albumin, 1 mM EDTA.
- the blot is then washed twice at 45°C with 2X SSC, 0.1% SDS and twice with 0.2X SSC, 0.1% SDS (IX SSC is 0.15 M NaCl, 0.015 M sodium citrate, pH 7.0) .
- Relative hybridization intensities of the various bands on the membrane are estimated from autoradiograms using a video densitometer (MilliGen/Biosearch, Ann Arbor, MI) .
- Restriction endonuclease-digested genomic DNAs of various plant species are separated by agarose gel electrophoresis (0.8% agarose), and then transferred to a Hybond-N + membrane (Amersham Corp., Arlington Heights, IL) .
- Radiolabeled probe fragments comprising coding sequences of pCDPK-1 are hybridized to the digested genomic DNA essentially as described in Sambrook et al . (1989) , supra .
- Moderate stringency conditions are used (hybridization in 4X SSC, at 65°C with the last wash in IX SSC, at 65°C) .
- PCR is carried out using target genomic DNA as a template and primers derived from highly conserved regions of the pCDPK-1 coding sequence.
- the cDNA clone described in Example 1 is used as a hybridization probe for screening a N. tabacum cv. NK326 genomic library in the XEMBL3 vector (Clontech, Palo Alto, CA) .
- Genomic DNA clones having 70% or greater sequence identity to the tobacco CDPK of Example 1 are identified using routine subcloning protocols.
- the nucleotide sequences of the cloned nucleic acid inserts are determined using routine DNA sequencing protocols.
- One of the genomic DNA clones has a full-length coding sequence that comprises the tobacco CDPK coding sequence of Example 1.
- the clone also contains DNA contiguous with, and 5' to, the coding sequence of Example 1. Examination of the nucleotide sequence of the 5' flanking DNA in this clone reveals a putative ATG start codon as well as one or more putative regulatory elements upstream of the start codon and within about 1000 bp of the start codon.
- CORRESPONDENCE ADDRESS (A ADDRESSEE: Fish & Richardson P. C, P. . (B STREET: 60 South Sixth Street, Suite 3300 (C CITY: Minneapolis (D STATE: MN (E COUNTRY: USA (F ZIP: 55402
- TELECOMMUNICATION INFORMATION (A TELEPHONE: 612-335-5050 (B TELEFAX: 612-288-9696 (C TELEX :
- 100 105 110 lie Arg Lys Met Leu Glu Gin Asp Pro Lys Arg Arg Leu Thr Ala His
- Arg lie Glu Gly Thr Tyr Glu Asp Ser Thr Ala Val His Leu Val Met
- 385 390 395 400 lie Ala Ala Thr Val His Leu Asn Lys Leu Glu Arg Glu Glu Asn Leu
- 450 455 460 lie Asp Tyr Gly Glu Phe Ala Ala Met Met Arg Lys Gly Asn Gly Gly
- 465 470 475 480 lie Gly Arg Arg Thr Met Arg Lys Thr Leu Asn Leu Arg Asp Ala Leu
- 100 105 110 lie Arg Lys Met Leu Glu Gin Asp Pro Lys Arg Arg Leu Thr Ala His
- Val Asp Glu lie Arg Gin Ala Leu Glu Glu Phe Gly Val Pro Asp Thr
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Botany (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US88965597A | 1997-07-08 | 1997-07-08 | |
| US889655 | 1997-07-08 | ||
| PCT/US1998/014109 WO1999002655A1 (en) | 1997-07-08 | 1998-07-07 | Protein kinases and uses thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP0948599A1 true EP0948599A1 (en) | 1999-10-13 |
Family
ID=25395529
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP98936821A Withdrawn EP0948599A1 (en) | 1997-07-08 | 1998-07-07 | Protein kinases and uses thereof |
Country Status (17)
| Country | Link |
|---|---|
| EP (1) | EP0948599A1 (cs) |
| JP (1) | JP2001500390A (cs) |
| KR (1) | KR20000068498A (cs) |
| CN (1) | CN1234831A (cs) |
| AP (1) | AP9901469A0 (cs) |
| AU (1) | AU8568498A (cs) |
| BR (1) | BR9806183A (cs) |
| CA (1) | CA2265441A1 (cs) |
| CZ (1) | CZ69899A3 (cs) |
| EA (1) | EA199900184A1 (cs) |
| HU (1) | HUP0003564A2 (cs) |
| ID (1) | ID21034A (cs) |
| IL (1) | IL128570A0 (cs) |
| OA (1) | OA10990A (cs) |
| PL (1) | PL332087A1 (cs) |
| WO (1) | WO1999002655A1 (cs) |
| ZA (1) | ZA985999B (cs) |
Families Citing this family (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB9917642D0 (en) * | 1999-07-27 | 1999-09-29 | Zeneca Ltd | Improvements in or relating to organic compounds |
| US6476293B1 (en) | 1999-10-01 | 2002-11-05 | University Of Kentucky Research Foundation | Use of bacterial acetate kinase and their genes for protection of plants against different pathogens |
| US6515204B1 (en) | 1999-10-05 | 2003-02-04 | Her Majesty The Queen In Right Of Canada, As Represented By The Minister Of Agriculture And Agri-Food | Corn silk gene and regulatory region |
| AU2001257525A1 (en) * | 2000-05-05 | 2001-11-20 | The General Hospital Corporation | Calcium dependent protein kinase polypeptides as regulators of plant disease resistance |
| WO2002034925A1 (en) * | 2000-10-20 | 2002-05-02 | University Of Kentucky Research Foundation | Use of bacterial acetate kinase and their genes for protection of plants against different pathogens |
| KR100697311B1 (ko) | 2005-06-03 | 2007-03-20 | 한국생명공학연구원 | 스트레스 유도성 식물 유전자 |
| CN103305486B (zh) * | 2012-03-09 | 2014-11-12 | 中国农业科学院作物科学研究所 | 小麦TaCPK2蛋白在植物抗病育种中的应用 |
| US10743538B2 (en) | 2014-10-01 | 2020-08-18 | Plant Health Care, Inc. | Elicitor peptides having disrupted hypersensitive response box and use thereof |
| CN107002091A (zh) | 2014-10-01 | 2017-08-01 | 植物保健公司 | 过敏反应激发子肽及其用途 |
| BR112018069945A2 (pt) | 2016-04-06 | 2019-02-05 | Plant Health Care, Inc. | micróbios benéficos para distribuição de peptídeos ou proteínas efetoras e uso dos mesmos |
| PL3439682T3 (pl) | 2016-04-06 | 2025-12-01 | Plant Health Care, Inc. | Peptydy pochodzące od czynnika wywołującego odpowiedź nadwrażliwości i ich stosowanie |
-
1998
- 1998-07-07 ZA ZA985999A patent/ZA985999B/xx unknown
- 1998-07-07 CN CN98800943A patent/CN1234831A/zh active Pending
- 1998-07-07 CA CA002265441A patent/CA2265441A1/en not_active Abandoned
- 1998-07-07 WO PCT/US1998/014109 patent/WO1999002655A1/en not_active Ceased
- 1998-07-07 EP EP98936821A patent/EP0948599A1/en not_active Withdrawn
- 1998-07-07 CZ CZ99698A patent/CZ69899A3/cs unknown
- 1998-07-07 BR BR9806183-6A patent/BR9806183A/pt not_active IP Right Cessation
- 1998-07-07 EA EA199900184A patent/EA199900184A1/ru unknown
- 1998-07-07 AU AU85684/98A patent/AU8568498A/en not_active Abandoned
- 1998-07-07 IL IL12857098A patent/IL128570A0/xx unknown
- 1998-07-07 JP JP11508865A patent/JP2001500390A/ja not_active Ceased
- 1998-07-07 HU HU0003564A patent/HUP0003564A2/hu unknown
- 1998-07-07 AP APAP/P/1999/001469A patent/AP9901469A0/en unknown
- 1998-07-07 PL PL98332087A patent/PL332087A1/xx unknown
- 1998-07-07 KR KR1019997001912A patent/KR20000068498A/ko not_active Withdrawn
- 1998-07-07 ID IDW990064A patent/ID21034A/id unknown
-
1999
- 1999-03-05 OA OA9900051A patent/OA10990A/en unknown
Non-Patent Citations (1)
| Title |
|---|
| See references of WO9902655A1 * |
Also Published As
| Publication number | Publication date |
|---|---|
| HUP0003564A2 (hu) | 2001-02-28 |
| BR9806183A (pt) | 1999-11-16 |
| AU8568498A (en) | 1999-02-08 |
| WO1999002655A1 (en) | 1999-01-21 |
| KR20000068498A (ko) | 2000-11-25 |
| CN1234831A (zh) | 1999-11-10 |
| EA199900184A1 (ru) | 1999-10-28 |
| CZ69899A3 (cs) | 1999-08-11 |
| ZA985999B (en) | 1999-04-20 |
| WO1999002655A9 (en) | 1999-04-15 |
| IL128570A0 (en) | 2000-01-31 |
| ID21034A (id) | 1999-04-08 |
| OA10990A (en) | 2001-11-07 |
| PL332087A1 (en) | 1999-08-30 |
| JP2001500390A (ja) | 2001-01-16 |
| CA2265441A1 (en) | 1999-01-21 |
| AP9901469A0 (en) | 1999-03-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AP924A (en) | Transcription regulatory elements for gene expression in plant tissue. | |
| CN114990070A (zh) | 修饰nf-yc4启动子的转录抑制子结合位点以增加蛋白质含量和抗应力 | |
| CN113563442B (zh) | 抗旱相关蛋白IbSPB1及其编码基因与应用 | |
| CN109136260A (zh) | Wrky20蛋白质及其编码基因在调控植物抗逆性中的应用 | |
| CN110117322A (zh) | 从紫斑白三叶分离的myb类转录因子及其编码基因和应用 | |
| US6605764B1 (en) | Pathogen- or elicitor-inducible transcription regulatory element from the tobacco 5-EPI-aristolochene synthase gene and plants transformed therewith | |
| WO1999002655A1 (en) | Protein kinases and uses thereof | |
| AU2009234464B2 (en) | Heat resistant plants and plant tissues and methods and materials for making and using same | |
| US20050034196A1 (en) | Novel salicylic acid-binding protein encoding nucleic acid, SABP2, and methods of use thereof | |
| AU746787B2 (en) | Salicylic acid pathway genes and their use for the induction of resistance in plants | |
| CN106011098A (zh) | 一种棉花抗病相关蛋白GaGSTF2及其编码基因与应用 | |
| CN110294795A (zh) | 大豆蛋白质GmDISS2及其编码基因在调控植物耐逆性中的应用 | |
| AU744673B2 (en) | Gene associated with disease resistance in plants | |
| Cheng et al. | An Arabidopsis Chloroplast RNA-Binding Protein Gene Encodes Multiple mRNAs with Different 5 [prime] Ends | |
| US6608245B1 (en) | Tomato nucleic acid sequences that confer resistance to Verticillium and plants transformed therewith | |
| JP2000342262A (ja) | 耐病性遺伝子 | |
| CN100422325C (zh) | 病原菌应答性启动子 | |
| JPWO2003022039A1 (ja) | 植物ウイルスの移行タンパク質と結合する植物タンパク質を利用したウイルス抵抗性の付与 | |
| US5968804A (en) | Amphipathic protein-1 | |
| WO2000008189A2 (en) | Plant resistance gene | |
| CN116064463A (zh) | 番茄基因SlPKG及其编码蛋白在抗病中的应用 | |
| WO2002033051A1 (en) | A plant autophagy gene | |
| Chappell et al. | Elicitin-Mediated Plant Resistance | |
| AU5940100A (en) | Transcriptional control sequences and methods |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 19990408 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN |
|
| 18W | Application withdrawn |
Withdrawal date: 20000224 |