EP0944725A1 - Phosphodiesterase 8a - Google Patents

Phosphodiesterase 8a

Info

Publication number
EP0944725A1
EP0944725A1 EP98953651A EP98953651A EP0944725A1 EP 0944725 A1 EP0944725 A1 EP 0944725A1 EP 98953651 A EP98953651 A EP 98953651A EP 98953651 A EP98953651 A EP 98953651A EP 0944725 A1 EP0944725 A1 EP 0944725A1
Authority
EP
European Patent Office
Prior art keywords
polypeptide
pde8a
polynucleotide
pde8
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
EP98953651A
Other languages
German (de)
English (en)
Other versions
EP0944725B1 (fr
Inventor
Kate Loughney
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Icos Corp
Original Assignee
Icos Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=25491965&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=EP0944725(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Icos Corp filed Critical Icos Corp
Priority to EP05009465A priority Critical patent/EP1571216A3/fr
Publication of EP0944725A1 publication Critical patent/EP0944725A1/fr
Application granted granted Critical
Publication of EP0944725B1 publication Critical patent/EP0944725B1/fr
Anticipated expiration legal-status Critical
Revoked legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00

Definitions

  • the present invention relates generally to a family of phosphodiesterases designated PDE8A and uses thereof
  • Phosphodiesterases hvdrolyze 3 , 5 ' cyclic nucleotides to their respective nucleoside 5 monophosphates
  • the cyclic nucleotides cAMP and cGMP are synthesized by adenylyl and guanylyl cyclases, respectively, and serve as second messengers in a number of cellular signaling pathways
  • the duration and strength of the second messenger signal is a function of the rate of synthesis and the rate of hydrolysis of the cyclic nucleotide
  • PDE1-7 seven families (PDE1-7) which are classified by (i) primary structure, (ii) substrate preference; (iii) response to different modulators, (iv) sensitivity to specific inhibitors; and (v) modes of regulation [Loughney and Ferguson, in Phosphodiesterase Inhibitors. Schudt, et al.
  • the amino acid sequences of all mammalian PDEs identified to date include a highly conserved region of approximately 270 amino acids located in the carboxy terminal half of the protein [Charbonneau. et al., Proc. Natl. Acad. Sci. (USA) 83 9308- 9312 (1986)]
  • the conserved domain includes the catalytic site for cAMP and/or cGMP hydrolysis and two putative zinc binding sites as well as family specific determinants [Beavo, Physiol. Rev. 75 725-748 (1995), Francis, et al., J. Biol. Chem. 269:22477- 22480 (1994)].
  • the amino terminal regions of the various PDEs are highly variable and include other family specific determinants such as: (i) calmodulin binding sites (PDE1); (ii) non-catalytic cyclic GMP binding sites (PDE2, PDE5, PDE6); (iii) membrane targeting sites (PDE4); (iv) hydrophobic membrane association sites (PDE3); and (v) phosphorylation sites for either the calmodulin-dependent kinase II (PDE1), the cAMP- dependent kinase (PDE1, PDE3, PDE4), or the cGMP dependent kinase (PDE5) [Beavo, Physiol. Rev. 75:725-748 (1995); Manganiello, et al, Arch. Biochem. Acta 322: 1-13 (1995); Conti, et al, Physiol. Rev. 75:723-748 (1995)].
  • PDE1 calmodulin binding sites
  • PDE2, PDE5, PDE6 non-cata
  • PDE1 family are activated by calcium-calmodulin.
  • Three genes have been identified; PDE IA and PDEIB preferentially hydrolyze cGMP while PDE1C has been shown to exhibit a high affinity for both cAMP and cGMP.
  • the PDE2 family is characterized as being specifically stimulated by cGMP [Loughney and Ferguson, supra]. Only one gene has been identified, PDE2A, the enzyme product of which is specifically inhibited by erythro-9-(2-hydroxy-3-nonyl)adenine (EHNA).
  • EHNA erythro-9-(2-hydroxy-3-nonyl)adenine
  • Enzymes in the PDE3 family are specifically inhibited by cGMP
  • Two genes are known, PDE3A and PDE3B, both having high affinity for both cAMP and cGMP, although the V ⁇ for cGMP hydrolysis is low enough that cGMP functions as a competitive inhibitor for cAMP hydrolysis.
  • PDE3 enzymes are specifically inhibited by milrinone and enoximone [Loughney and Ferguson, supra].
  • the PDE4 family effects cAMP hydrolysis and includes four genes, PDE4A, PDE4B, PDE4C, and PDE4D, each having multiple splice variants.
  • PDE5 family bind cGMP at non-catalytic sites and preferentially hydrolyze cGMP. Only one gene, PDE5A, has been identified.
  • the photoreceptor PDE6 enzymes specifically hydrolyze cGMP [Loughney and Ferguson, supra]. Genes include PDE6A and PDE6B (the protein products of which dimerize and bind two copies of a smaller ⁇ inhibitory subunit to form rod PDE), in addition to PDE6C which associates with three smaller proteins to form cone PDE.
  • PDE7 effects cAMP hydrolysis but, in contrast to the PDE4 family, is not inhibited by rolipram [Loughney and Ferguson, supra]. Only one gene, PDE7A, has been identified. 1. Given the importance of cAMP and cGMP in intracellular second messenger signaling, there thus exists an ongoing need in the art to identify addition PDE species. Identification of heretofore unknown families of PDEs, and genes and splice variants thereof, will provide additional pharmacological approaches to treating conditions in which cyclic nucleotide pathways are aberrant as well as conditions in which modulation of intracellular cAMP and/or cGMP levels in certain cell types is desirable.
  • the present invention provides polypeptides and underlying polynucleotides for a novel PDE family designated PDE8.
  • the invention includes both naturally occurring and non-naturally occurring PDE8 polynucleotides and polypeptide products thereof.
  • Naturally occurring PDE8 products include distinct gene and polypeptide species within the PDE8 family (i.e., PDE8A); these species include those which are expressed within cells of the same animal and well as corresponding species homologs expressed in cells of other animals
  • the invention further provides splice variants encoded by the same polynucleotide but which arise from distinct mRNA transcripts (i.e., PDE8A1 and PDE8A2).
  • Non-naturally occurring PDE8 products include variants of the naturally occurring products such as analogs (i.e., wherein one or more amino acids are added, substituted, or deleted) and those PDE8 products which include covalent modifications (i.e., fusion proteins, glycosylation variants, Met " 'PDE ⁇ s, MeOLys '1 -
  • the invention provides a polynucleotide comprising the sequence set forth in SEQ ID NO: 1.
  • the invention also embraces polynucleotides encoding the amino acid sequence set out in SEQ ID NO: 2.
  • a presently preferred polypeptide of the invention comprises the amino acid sequence set out in SEQ ID NO: 2.
  • the invention provides two splice variant cDNAs which give rise to two polypeptides designated PDE8A1 and PDE8A2 PDE8A1 and PDE8A2 polypeptides, and the polynucleotides encoding the polypeptides, are discussed herein as representative of the PDE8 enzyme family embraced by the invention
  • the present invention provides novel purified and isolated polynucleotides (e g , DNA sequences and RNA transcripts, both sense and complementary antisense strands, including splice variants thereof) encoding the human PDE8s DNA sequences of the invention include genomic and cDNA sequences as well as wholly or partially chemically synthesized DNA sequences "Synthesized,” as used herein and is understood in the art, refers to purely chemical, as opposed to enzymatic, methods for producing polynucleotides "Wholly" synthesized DNA sequences are therefore produced entirely by chemical means, and "partially" synthesized DNAs embrace those wherein only portions of the resulting DNA were produced by chemical means
  • a preferred DNA sequence encoding a human PDE8 polypeptide is set out in SEQ ID NO 1
  • the invention also embraces DNA sequences encoding PDE8 species which hybridize under moderately stringent conditions to the non-coding strands, or complements, of the polynucleotides in SEQ ID NOs 1, 3 and 5 DNA sequences encoding PDE8A polypeptides which would hybridize thereto but for the redundancy of the genetic code are contemplated by the invention
  • Exemplary moderate hybridization conditions are as follows hybridization at 65 °C in 3X SSC, 0 1% sarkosyl, and 20 mM sodium phosphate, pH 6 8, and washing at 65 °C in 2X SSC with 0 1% SDS It is understood in the art that conditions of equivalent stringency can be achieved through variation of temperature and buffer, or salt concentration as described Ausebel, et al.
  • host cells including procaryotic and eukaryotic cells, either stably or transiently transformed with DNA sequences of the invention in a manner which permits expression of PDE8 polypeptides of the invention.
  • Host cells of the invention are a valuable source of immunogen for development of antibodies specifically immunoreactive with PDE8.
  • Host cells of the invention are also conspicuously useful in methods for large scale production of PDE8 polypeptides wherein the cells are grown in a suitable culture medium and the desired polypeptide products are isolated from the cells or from the medium in which the cells are grown by, for example, immunoaffinity purification.
  • PDE8 DNA sequences allows for modification of cells to permit, or increase, expression of endogenous PDE8 Cells can be modified (e.g. , by homologous recombination) to provide increased PDE8 expression by replacing, in whole or in part, the naturally occurring PDE8 promoter with all or part of a heterologous promoter so that the cells express PDE8 at higher levels.
  • the heterologous promoter is inserted in such a manner that it is operatively-linked to PDE8 encoding sequences. See, for example, PCT International Publication No. WO 94/12650, PCT International Publication No. WO 92/20808. and PCT International Publication No. 91/09955.
  • amplifiable marker DNA e.g., ada, dhfr, and the multifunctional CAD gene which encodes carbamyl phosphate synthase, aspartate transcarbamylase. and dihydroorotase
  • intron DNA may be inserted along with the heterologous promoter DNA. If linked to the PDE8 coding sequence, amplification of the marker DNA by standard selection methods results in co-amplification of the PDE8 coding sequences in the cells.
  • the DNA sequence information provided by the present invention also makes possible the development through, e.g. homologous recombination or "knock-out” strategies [Capecchi, Science 244A2&&-1292 (1989)], of animals that fail to express functional PDE8 or that express a variant of PDE8. Such animals are useful as models for studying the in vivo activities of PDE8 and modulators of PDE8.
  • the invention also provides purified and isolated mammalian PDE8 polypeptides.
  • Presently preferred PDE8A polypeptides are set out in SEQ ID NOs: 4 and 6.
  • Most preferred is a PDE8 polypeptide comprising the amino acid sequence set out in SEQ ID NO: 2.
  • PDE8 polypeptides of the invention may be isolated from natural cell sources or may be chemically synthesized, but are preferably produced by recombinant procedures involving host cells of the invention.
  • Use of mammalian host cells is expected to provide for such post-translational modifications (e.g., glycosylation, truncation, lipidation, and phosphorylation) as may be needed to confer optimal biological activity on recombinant expression products of the invention.
  • PDE8 products of the invention may be full length polypeptides, biologically active fragments, or variants thereof which retain specific PDE8 biological activity.
  • Variants may comprise PDE8 polypeptide analogs wherein one or more of the specified (i.e.. naturally encoded) amino acids is deleted or replaced or wherein one or more non-specified amino acids are added: (1) without loss of one or more of the biological activities or immunological characteristics specific for PDE8; or (2) with specific disablement of a particular biological activity of PDE8.
  • Variant products of the invention include mature PDE8A products, i.e., PDE8 products wherein leader or signal sequences are removed, having additional amino terminal residues.
  • PDE8 products having an additional methionine residue at position -1 are contemplated, as are PDE8 products having additional methionine and lysine residues at positions -2 and -1 (MeOLys ⁇ -PDES).
  • Variants of these types are particularly useful for recombinant protein production in bacterial cell types.
  • the invention also embraces PDE8 variants having additional amino acid residues which result from use of specific expression systems.
  • a desired polypeptide such as a glutathione-S- transferase (GST) fusion product
  • GST glutathione-S- transferase
  • Variants which result from expression in other vector systems are also contemplated.
  • the invention further embraces PDE8 products modified to include one or more water soluble polymer attachments.
  • PDE8 products covalently modified with polyethylene glycol (PEG) subunits.
  • PEG polyethylene glycol
  • Water soluble polymers may be bonded at specific positions, for example at the amino terminus of the PDE8 products, or randomly attached to one or more side chains of the polypeptide.
  • antibodies e.g., monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies, CDR- grafted antibodies and the like
  • binding proteins can be developed using isolated or recombinant PDE8 products, PDE8 variants, or cells expressing such products. Binding proteins are useful for purifying PDES products and detection or quantification of PDE8 products in fluid and tissue samples using known immunological procedures. Binding proteins are also manifestly useful in modulating (i.e., blocking, inhibiting or stimulating) biological activities of PDE8, especially those activities involved in signal transduction. Anti-idiotypic antibodies specific for anti-PDE8 antibodies are also contemplated.
  • DNA and amino acid sequences of the present invention are manifest.
  • knowledge of the sequence of a cDNA for PDE8A makes possible through use of Southern hybridization or polymerase chain reaction (PCR) the identification of genomic DNA sequences encoding PDE8 and PDE8 expression control regulatory sequences such as promoters, operators, enhancers, repressors, and the like.
  • DNA/DNA hybridization procedures carried out with DNA sequences of the invention under moderately to highly stringent conditions are likewise expected to allow the isolation of DNAs encoding allelic variants of PDE8A; allelic variants are known in the art to include structurally related proteins sharing one or more of the biochemical and/or immunological properties specific to PDE8A.
  • non-human species genes encoding proteins homologous to PDE8A can also be identified by Southern and/or PCR analysis.
  • complementation studies can be useful for identifying other human PDE8 products as well as non-human proteins, and DNAs encoding the proteins, sharing one or more biological properties of PDE8A.
  • Polynucleotides of the invention are also useful in hybridization assays to detect the capacity of cells to express PDE8. Polynucleotides of the invention may also be the basis for diagnostic methods useful for identifying a genetic alteration(s) in a PDE8 locus that underlies a disease state or states. Also made available by the invention are anti-sense polynucleotides which recognize and hybridize to polynucleotides encoding PDE8. Full length and fragment anti-sense polynucleotides are provided. Anti-sense polynucleotides are particularly relevant to regulating expression of PDE8 by those cells expressing PDE8 mRNA.
  • DNA and amino acid sequence information provided by the present invention also makes possible the systematic analysis of the structure and function of PDE8s.
  • DNA and amino acid sequence information for PDE8 also permits identification of molecules with which PDE8A will interact.
  • Agents that modulate (i.e., increase, decrease, or block) PDE8 activity may be identified by incubating a putative modulator with PDE8 and determining the effect of the putative modulator on PDE8 phosphodiesterase activity.
  • the selectivity of a compound that modulates the activity of the PDE8 can be evaluated by comparing its activity on the PDE8 to its activity on other PDE enzymes.
  • Selective modulators may include, for example, antibodies and other proteins or peptides which specifically bind to the PDE8 or PDE8 nucleic acid, oligonucleotides which specifically bind to the PDE8 or PDE8 nucleic acid, and other non- peptide compounds (e.g.. isolated or synthetic organic molecules) which specifically react with PDE8 or PDE8-encoding nucleic acid.
  • Mutant forms of PDE8 which affect the enzymatic activity or cellular localization of the wild-type PDES are also contemplated by the invention.
  • Presently preferred targets for the development of selective modulators include, for example: (1) regions of the PDE8 which contact other proteins and/or localize the PDE8 within a cell, (2) regions of the PDE8 which bind substrate, (3) allosteric cyclic nucleotide-binding site(s) of PDE8, (4) phosphorylation site(s) of PDE8 and (5) regions of the PDES which are involved in multimerization of PDE8 subunits.
  • Modulators of PDE8 activity may be therapeutically useful in treatment of a wide range of diseases and physiological conditions in which PDE activity is known to be involved.
  • the invention further contemplates small molecule modulators of PDE8A enzyme activity.
  • libraries used for the identification of small molecule modulators These include ( 1 ) chemical libraries, (2) natural product libraries, and (3) combinatorial libraries comprised of random peptides, oligonucleotides or organic molecules.
  • Chemical libraries consist of structural analogs of known compounds or compounds that are identified as “hits” or “leads " via natural product screening.
  • Natural product libraries are collections of microorganisms, animals, plants, or marine organisms which are used to create mixtures for screening by (1) fermentation and extraction of broths from soil, plant or marine microorganisms or (2) extraction of plants or marine organisms.
  • Combinatorial libraries are composed of large numbers of peptides, oligonucleotides or organic compounds as a mixture They are relatively easy to prepare by traditional automated synthesis methods. PCR, cloning or proprietary synthetic methods. Of particular interest are peptide and oligonucleotide combinatorial libraries.
  • Still other libraries of interest include peptide, protein, peptidomimetic, multiparallel synthetic collection, recombinatorial, and polypeptide libraries.
  • combinatorial chemistry and libraries created therefrom see Myers, Curr. Opion, Biotechnol. 8.701-707 (1997).
  • the invention further provides methods to identify a specific binding partner compound of a PDE8A polypeptide of the invention comprising the steps of: a) contacting the PDE8A polypeptide with a compound under conditions which permit binding between the compound and the PDE8A polypeptide; b) detecting binding of the compound to the PDE8A polypeptide; and c) identifying the compound as a specific binding partner of the PDE8A polypeptide.
  • Binding partner identified in the methods of the invention preferably modulate PDE8A enzyme activity, either through inhibition or activation, or enhancement, of the enzyme.
  • the invention also provides methods to identify a specific binding partner compound of a PDE8A polynucleotide of the invention comprising the steps of: a) contacting the PDE8A polynucleotide with a compound under conditions which permit binding between the compound and the PDESA polynucleotide; b) detecting binding of the compound to the PDESA polynucleotide; and c) identifying the compound as a specific binding partner of the PDESA polynucleotide.
  • the binding partner of the PDE8A polynucleotide preferably modulates expression of the PDE8A polypeptide encoded by the PDE8A polynucleotide, either through inhibiting expression or enhancing expression.
  • the invention also provides compounds identified by a method of the invention, as well as compositions comprising a compound identified and a pharmaceutically acceptable carrier.
  • Example 1 describes methods for searching expressed sequence tag (EST) databases in order to identify probes potentially useful for isolating DNAs of the invention.
  • Example 2 relates to identification of PDE8A-encoding polynucleotides.
  • Example 3 addresses sequence analysis of the isolated polynucleotides.
  • Example 4 describes analysis of polypeptides encoded by the PDE8A polynucleotides.
  • Example 5 addresses expression of recombinant PDE8A polypeptides.
  • Example 6 relates to Northern analysis of PDESA expression.
  • Example 7 describes chromosome mapping of the gene encoding PDESA.
  • Example 8 describes confirmation that PDE8A1 and PDE8A2 are splice variants.
  • Example 9 addresses expression and characterization of recombinant PDE8A.
  • Example 10 details production of anti-PDE8A monoclonal antibodies.
  • Example 11 describes an analysis of PDE8A expression by in situ hybridization.
  • NCBI NCBI Expressed Sequence Tags (EST) database was undertaken in order to identify cDNA fragments that could potentially be useful for the identification of novel phosphodiesterase (PDE) genes.
  • This database contains DNA sequences representing one or both ends of cDNAs collected from a variety of tissue sources. A single sequencing run is performed on one or both ends of the cDNA and the quality of the DNA sequence varies tremendously.
  • the EST sequence database contained more than 600.000 cDNA sequences from a variety of organisms. The search for novel PDE sequences included three steps. First the search is performed.
  • the BLASTN results were examined and EST sequences that were judged as corresponding to each of the fifteen known PDE cDNAs were identified and collected into a table.
  • the PDE6A and PDE6B sequences used as queries were truncated at 3 ' end (removing a portion of the 3 ' untranslated region) due to the presence of repetitive elements in the 3 ' untranslated region of the cDNAs.
  • NCBI TBLASTN program was used to examine the homology between the protein sequence of the fifteen known human PDEs (as above) and the six different possible proteins encoded by each of the EST DNA sequences.
  • the EST sequences are translated in six frames and the amino acid sequences generated are compared to the query PDE amino acid sequences
  • Sequences identified as homologous at the amino acid level were examined and any EST sequences positively identified as corresponding to a known PDE during the BLASTN search described above were discarded.
  • the third step of the search involved analyzing the sequences that were not known PDEs. These amino acid sequences were homologous to a known PDE but were not identified as one of the 15 known PDE genes during the BLASTN searches.
  • the database sequence for WO4835 is set out in SEQ ID NO: 7. Results from the database analysis as discussed below are exemplified using the PDE4D sequence.
  • WO4835 cDNA was obtained from American Type Culture Collection (Rockville, MD) which maintains and makes publicly available deposits of ESTs identified and sequenced by I.M.A.G.E., Lawrence Livermore National Laboratory, Livermore, CA). The WO4835 DNA was sequenced upon receipt to confirm its identity and determined to be consistent with SEQ ID NO: 7.
  • the amino acid sequence encoded by the -1 reading frame of EST sequence WO4835 was recognized by all of the PDE query cDNA sequences except PDEIA, IB and IC.
  • PDE4D3 Using the TBLASTN results with PDE4D3 as an example, two regions of similarity were detected. The first region showed 15/37 exact matches or 40% identity (19/37 similar amino acids) and included the HD(X) 2 HXG(X) 13 A (SEQ ID NO: 8) motif found in all of the query sequences. [Charboneau, Mol. Pharmacol. Cell Regul. 2:267-298 (1990)]. The second region showed 9/20 exact matches or 45% identity and included the YHNxxHA motif found in most of the query sequences.
  • WO4835 BLASTN analysis of the WO4835 sequence revealed that it was unique in that it was not identical to any other human DNA sequences in the Genbank database.
  • the EST database entry for WO4835 identified the sequence as being similar to PIR:A48719, the bovine cGMP binding, cGMP hydrolyzing PDE5 A 1 sequence
  • Comparison of the protein sequence of WO4835 frame -1 to the bovine PDE5A1 sequence revealed 58/153 matches for an overall identify of 38%. Within this region were small regions of greater homology; one region showed a 12/14 identical amino acids. Given the unique nature of the W04835 sequence, its relatively low homology to bovine PDE5A and the presence of the amino acid motifs found in most other known human PDE amino acid sequences, WO4835 represents a novel human PDE cDNA.
  • WO4835 cDNA insert was digested from the pT7T3D vector into two fragments with the restriction enzymes Eco ⁇ and H dIII and the two fragments were purified using two sequential low melting agarose gels. Both fragments were used as probes to screen cDNA libraries derived from human heart (Stratagene, La Jolla, CA), and human fetal brain (Stratagene) using procedures routinely practiced in the art.
  • the DNA sequence of FB66a was determined for both strands using DNA oligonucleotide primers set out below in SEQ ID NOs: 9 to 31 and a Perkin Elmer
  • W48A4 TTGGCAAGGCCTCTGCAT SEQ ID NO: 12
  • W48S1 CCTCTATGAACTGAGCAG SEQ ID NO: 13
  • the FB66a cDNA set out in SEQ ID NO' 3. is 4389 nucleotides in length and, from nucleotide 3 to nucleotide 241 1 , encodes a protein of 803 amino acids with a predicted molecular weight of approximately 90,775 Da
  • the deduced amino acid sequence for FB66a is set out in SEQ ID NO 4
  • the first methionine is encoded at nucleotide 45; the absence of an upstream in frame stop codon makes it unclear whether this residue is an internal methionine or the beginning of the open reading frame
  • the DNA sequence of FB85c-2 (SEQ ID NO: 5) was similarly determined using primers Ml 3Rev.l, W48A2, W48A9, W48A4.
  • FB85c-2 appeared to include two distinct DNA inserts, only one of which was homologous to WO4835.
  • the region homologous to WO4835 was approximately 2.8 kb in length. The precise sequence at the 5 ' end of the insert could not be determined and thus a few hundred bases of sequence in what may be a 5 '-untranslated region are not included in the 2573 nucleotide sequence set out in SEQ ID NO' 5.
  • Nucleotide 67 to nucleotide 2406 encodes a protein having 779 amino acid protein (SEQ ID NO' 6) having a predicted molecular weight of 88,353 Da. An in frame upstream stop codon makes it likely that the methionine encoded at nucleotide position 67 is the initiation methionine.
  • the proteins encoded by FB66a and FB85c-2 have different amino terminal sequences which may be due to alternative splicing.
  • the DNA sequences diverge from each other 5 ' of nucleotide 112 in FB66a and nucleotide 104 in FB85c-2.
  • FB85c-2 has 13 amino acids at the amino terminus that are not found in the FB66a protein.
  • the FB66a protein includes 23 unique amino terminal residues if the initiating methionine at presumed to be encoded at nucleotide 35; the protein includes more than 37 unique amino terminal residues if the open reading frame in the FB66a clone is incomplete.
  • AA307865 SEQ ID NO: 32
  • HCC colon cancer cell line KM12C
  • PDE8A1 and PDE8A2 The PDEs encoded by clones FB85c-2 and FB66a were designated PDE8A1 and PDE8A2, respectively. Both PDE8A proteins, having complete amino acid sequence identity beyond the point of divergence discussed above, are most similar to human PDE2A, PDE5A, PDE6A, PDE6B. and PDE6C. Tables 1 and 2 show percent amino acid identity between PDESA and PDE2A, PDE5A and PDE6A.
  • PDE8A1 and PDE8A2 share homology with other PDEs over the catalytic region (amino acids 492 through 748 in PDE8A1) and with the putative cGMP binding domain conserved in the amino terminal region of the PDE2A, PDE5A, PDE6A, PDE6B, AND PDE6C.
  • the potential cGMP binding domain of PDE8A extends from amino acids 75 to amino acid 445 in the PDE8A1 polypeptide.
  • An expression construct for PDE8A was generated that included DNA sequences 3' from the point of divergence of PDE8A1 and PDE8A2 through the stop codon.
  • the expression construction included DNA encoding an eight amino acid epitope tag.
  • the so-called "FLAG tag,” comprising the peptide sequence set out in SEQ ID NO:
  • PCR was performed using FB66a DNA as a template using primers set out in SEQ ID NOs: 35 (below) and W48A2 (SEQ ID NO: 10, p. 14) in a reaction mixture containing 2 ⁇ l each primer (stock
  • SEQ ID NO: 35 an Ncol site is in bold and the FLAG tag encoding region is underlined. SEQ ID NO: 35
  • PCR was carried out in a Perkin Elmer DNA Thermal Cycler under the following conditions: 94 C C for 4 minutes followed by 30 cycles of 94°C for one minute, 50°C for one minute, and 72 °C for two minutes.
  • the resulting PCR product was digested with Ncol and Kpnl, gel purified, and subcloned into Bluescript SKII vector previously digested with the same enzymes.
  • the Bluescript vector had previously been modified to include a SacllNcol alcohol dehydrogenase 2 (ADH2) promoter fragment removed from a YEpC-PADH2d vector [Price, et al, Meth. Enzymol. 755:308-315 (1990)] .
  • the resulting plasmid was designated W48pcrl.
  • AKpnl/Sstl fragment containing the 3' portion of the open reading frame was isolated from a FB66a cDNA and inserted into W48pcrl previously digested with Kp ⁇ and EcoRV. The resulting plasmid was designated W485.1.
  • a SacVKpril fragment containing the ADH2 promoter and the 5' portion of the PD ⁇ 8A gene was isolated from W49pcrl .
  • a KpnllSaH fragment containing the 3 ' region of PDE8A was isolated from W485.1.
  • the two fragments were ligated into the yeast expression vector YEpC-PADH2d that had been previously digested with S ⁇ cl and Sail.
  • the resulting plasmid was designated W48-2ADH2 and was deposited on October 2, 1997 under the terms of the Budapest Treaty with the American Type Culture Collection (A.T.C.C.), 12301 Parklawn Drive, Rockville, MD 20852.
  • the bacterial strain bearing plasmid W48-2ADH2 was assigned accession number ATCC 98552.
  • the DNA sequences generated by PCR and the DNA sequences at the PDE8/vector junctions were determined to insure proper plasmid construction.
  • the plasmid was transformed into a yeast strain BJ2-54 lacking endogenous PDE activity (ura3-52;trpl;leu2;cir °;gal2;pep4-3;prbl-1122;prcl-402; ⁇ PDEl::URA3;HIS3; ⁇ PDE2::TRP1).
  • the host cells were grown overnight in SC-leu selective media including
  • Frozen cell pellets (0.06 ml) were thawed and suspended in 0.2 ml lysis buffer containing 100 mM MOPS, pH 8.0, 200 mM NaCl, 2 ⁇ M ZnSO 2 , 2 mM dithiothreitol, and 10 ⁇ g/ml each protease inhibitors pepstatin, leupeptin, and aprotinin.
  • PDE activity was assayed by detection of 32 P-phosphate released from 32 P- cAMP or 32 P-cGMP as described previously [Loughney et al., J. Bio Chem. 271 796- 806 (1996)]
  • the yeast extract was diluted in 0 5X lysis buffer also containing 0 5 mg/ml bovine serum albumin Twenty ⁇ l of the yeast extract, or diluted yeast extract, was assayed in a 100 ⁇ l reaction volume which included an additional 50 mM Tris-HCl (pH 8 0), 5 mM MgCl 2 1 ⁇ M Zn SO 2 , and 0 1 mg/ml bovine serum albumin Protein concentration was assayed by the method of Bradford
  • the IC 50 values for inhibition of PDE8A activity were determined using a set of isozyme-selective PDE inhibitors and the non-selective inhibitor isomethyl butyl xanthine (IBMX). Since these assays were performed at a cAMP concentration of 60 nM, the IC 50 values reflect inhibition of the low K,,, form only. The results are set out in Table 3 with values shown in micromolar units.
  • the IC 50 values for each of the selective inhibitors were at least 30 times higher against PDE8 than against their target isozymes which suggests that the inhibitory profile of PDE8 is distinct from that of PDEs 1-5.
  • the hydrolysis of cAMP and cGMP clearly distinguishes the enzymatic activity of PDE8A from that of PDE6 and PDE7A.
  • the IC 50 of the non-selective inhibitor IBMX for PDE8 was in the range observed for known human PDEs suggesting that the catalytic site of PDE8 resembles those of other human and mammalian PDEs and is distinct from lower eukaryotic forms that are insensitive to IBMX.
  • Results showed a 9.5 kb mRNA in all tissues examined but band intensity varied.
  • the signal was strongest in heart, brain, and kidney; the signal was weaker in liver, placenta, pancreas, and skeletal muscle. The signal was weakest in lung.
  • Yeast artificial chromosomes containing the human PDE8A gene were isolated from a panel of human YACs purchased from Research Genetics and screened by PCR as follows.
  • the YAC super-pools were screened with two nested pairs of primers.
  • sense primer W48S8 (SEQ ID NO: 36) was paired with the anti-sense primer W48A10 (SEQ ID NO: 37).
  • PCR was carried out with 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 2 mM MgSO 4 , 0.2 mM of each dNTP, 10 ⁇ g/ml of each primer, 0.5 units of Taq polymerase (Perkin-Elmer) and 1.5 ⁇ l of YAC pool DNA as template. Reactions were carried out for 30 cycles, each cycle consisting of one minute at 94° C, two minutes at 60° C, and four minutes at 72 °C. After the first round of amplification, the reaction products were reamplified with the internal pair of primers W48S12 (SEQ ID NO: 36) and W48A12 (SEQ ID NO: 37).
  • CATTGTCCTGAGGCTGTGG The reactions were carried out as described above except that the template was 1 ⁇ l of a 1 : 10 dilution (in water) of the first round reaction. Super-pools yielding the correct size PCR product were identified and the corresponding sub-pools were screened with the same nested pairs of primers under the same conditions to identify unique addresses for YACs containing PDE8A.
  • Yeast strains harboring the relevant YACs were purchased from Research Genetics. In order to verify the presence of the PDE8A gene in the various YACs, DNA was prepared from each strain and analyzed by PCR with primers W48S8 and W48A10. DNA was prepared from each strain according to a method previously described [Hoffman and Winston, Gene 57:267-272 (1987)] but modified as follows. Strains were grown overnight at 30° C in YEP media containing glucose.
  • Ten ml of culture was pelleted by centrifugation and resuspended in 200 ⁇ l of aqueous buffer containing 10 mM Tris-HCl, pH 8.0, 100 mM NaCl, 1 mM Na 2 EDTA, 1 % SDS, and 2 % Triton-XlOO.
  • the cells were lysed by vortexing in the presence of 200 ⁇ l of phenol/chloroform (1:1 mixture) and 100 ⁇ l of glass beads (425-600 ⁇ m).
  • 200 ⁇ l of TE Buffer (10 mM Tris, pH 8.0, 1 mM Na 2 EDTA) was added and the sample was centrifuged to separate the phases.
  • the organic phase was extracted again with 200 ⁇ l of aqueous buffer.
  • the pooled aqueous phase was treated with 100 units of bovine pancreatic RNase (Boehringer Mannheim) for 1 hour at 37 °C and the sample was extracted with phenol/chloroform, re-extracted with chloroform, and ethanol precipitated according to established methods.
  • the resultant pellet was resuspended in 50 ⁇ l TE Buffer.
  • PCR was carried out as described above except that the reaction volume was 25 ⁇ l and the template consisted of 1 ⁇ l of the relevant yeast DNA preparation.
  • Three human YACs containing the PDE8 gene were identified with addresses 805B6, 919H10 and 920 A3 (as per the CEPH designation).
  • the three YACs overlap one another and are part of a singly-linked contig (WC6.16) on human chromosome 6.
  • D6S305 and D6S411) Two sequence tagged sites within this contig (D6S305 and D6S411) have been placed on the chromosomes 6 genetic map at a position 167 cM from the end of 6p in work at the Center for Genome Research; D6S305 has been mapped to a position 173 cM from the end of 6p in work at CEPH-Genethon.
  • Three other YACs within the WC6.16 contig (932F1, 956B1 and 947D5) have been mapped by florescence in situ hybridization at CEPH-Genethon.
  • the hybridization signals fall between 0.94 - and 0.99 fractional length units from the end of 6p.
  • this region corresponds to the cytogenetic region 6q26-27.
  • Heritable defects that have been associated with this region of the human genome include retinal cone degeneration (OMIM database), Insulin-dependent diabetes mellitus [Davies et al. Nature 377: 130-136 (1994); Luo et al. Am. J. Hum. Genet. 57:911-919 (1995)] and juvenile onset parkinsonism [Matsumine et al Am. J. Hum. Genet. (50:588-596 (1997)].
  • LHO loss of heterozygosity
  • PDE8A1 nor PDE8A2 sequences were adjacent the DNA sequence of the common region.
  • the genomic sequences upstream of the common region were present in a third PDE8A cDNA, FB74b, which was identified in the group of six original clones that hybridized to the 5' end of probe W04835 described in Example 2.
  • the partial sequence (755 nucleotides at the 3 ' end) of clone FB74b is set out in SEQ ID NO: 39.
  • an in-frame stop codon was closer to the point of divergence than an initiating methionine codon indicating that, if FB74b represented a cDNA rather than an unspliced precursor, the initiating methionine would necessarily be located in the sequence common to both FB66a and FB85c-2.
  • PCR analysis was performed using one primer designated FB74bSl (SEQ ID NO: 40) within the FB74b upstream sequences and a second primer designated W48A9 (SEQ ED NO: 11) within the sequences common to FB74b, FB66a, and FB85c-2.
  • FB74b sequence may represent an unspliced intron or may represent a third splice variant that would encode a protein with an initiating methionine within the common region. In either case, the FB85c-2 and FB66a sequences are presumably generated by splicing.
  • RNA isolated from human cortex, cerebellum, heart, liver and lung tissues was isolated from frozen tissue fragments as described [Loughney et al, J. Biol. Chem. 271: 796-806 (1996)] and poly A " mRNA was selected using the Fast Track TM mRNA isolation system (Invitrogen). Double stranded cDNA was prepared using 5 ⁇ g poly A + mRNA and a cDNA synthesis kit (Boehringer Mannheim). The cDNA was ligated to a linker formed by annealing oligonucleotides L15 (SEQ ID NO: 41) and L30 (SEQ ID NO: 42).
  • the linker-ligated cDNA was amplified by PCR using oligonucleotides LI 8 (SEQ ID NO: 43) and W48A13 (SEQ ID NO: 44).
  • the reaction contained 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl 2 , 0.2 mM of each dNTP, 10 ⁇ g/ml of each primer and 1 ⁇ l of linker-ligated cDNA in a reaction volume of 25 ⁇ l.
  • PCR was initiated by the addition of 0.1 unit of Taq polymerase (Boehringer Mannheim) and continued with 30 cycles of one minute at 94°C, two minutes at 60°C, and four minutes at 72°C.
  • the products of the PCR reaction were diluted ten-fold with water and used as template in a second PCR reaction with oligonucleotides L21 (SEQ ID NO: 45) and W48A9S (SEQ ID NO: 46) under the same conditions described above.
  • DNA amplified in the second PCR reaction was cleaved with EcoRI and Sail and ligated into the vector Bluescript (Stratagene) previously digested with the same enzymes.
  • a second round of RACE PCR was repeated using the L21 primer (SEQ ID NO: 45) with primer W48A14S (SEQ ID NO: 47).
  • the resultant clones were screened by PCR and the longest ones were chosen for sequencing. Only two clones were longer than the original FB66a cDNA and they extended the 5 ' sequence 8 and 12 bp, respectively, in the untranslated region.
  • the FB66a sequences were extended with 5 '-CCCAGGGCGCCA. The extreme 5 ' end of FB66a is very GC rich which may contribute to the difficulty in isolating full length cDNAs.
  • the recombinant PDE8A described in Example 5 existed in both low affinity and high affinity forms in yeast extract. Because of the possibility that the low affinity form represented partially inactive enzyme, PDESA expression was carried out in sf9 and COS cells in an attempt to either obtain a homogeneous enzyme or determine if the two kinetic forms are always expressed from the cDNA.
  • the PDE8 sf9 expression construct was generated with a 3 ' Kpnl-SaH fragment from plasmid W485.1 (described in Example 5) and a 5 ' fragment generated by PCR as follows.
  • the primers FLAG-1 (SEQ ID NO: 48) and W48A4 (SEQ ID NO: 12) were used in PCR with PDE8 COS-1 DNA (described below) as template.
  • FLAG-1 GATCGGATCCACCATGGACTACAAGG SEQ ID NO: 48 PCR was performed as described in Example 8 except that 2 mM MgSO 4 was used in place of MgCl 2 and 0.02 U Taq polymerase was used. Following a four minute initial incubation at 94° C, 30 cycles were performed with one minute at 94°C, one minute at 50°C, and two minutes at 72 °C. The 5 ' amplification product was cleaved with BamHl and Kpnl, gel purified, and ligated with the 3 ' fragment into vector pFASTBAC (Gibco BRL, Gaithersburg, MD) previously digested with Bam and Sa l. The resulting plasmid was designated pFBRPDE ⁇ . All PCR amplification products and all new junctions were verified by sequencing.
  • Recombinant viral stocks were produced using the FastBac system (Gibco BRL) according to the manufacturer's suggested protocol and protein expression was carried out as follows. Sf9 cells were grown at 27° C in CCM3 media (Hyclone, Logan, UT) containing 50 U/ml penicillin and 50 ⁇ g/ml streptomycin sulfate (Gibco). Exponentially growing cells were infected at a multiplicity of approximately two virus per cell and incubated for 48 hours.
  • CMF-PBS 2.7 mM KCl, 1.5 mM KH 2 PO 4 , 137 mM NaCl, 8.1 mM Na ⁇ O , and the pellets were frozen and stored at -80°C until use.
  • Cells were lysed in buffer (50 mM MOPS pH 7.2, 10 ⁇ M zinc sulfate, 1 mM DTT, 2 mM benzamidine, 10 ⁇ g/ml each pepstatin, leupeptin, and aprotinin, and 20 ⁇ g/ml each calpain I and calpain II inhibitors) by vortexing in the presence of an equal volume of glass beads (acid washed, 0.5 mm, Sigma) and PDE activity was determined as described in Example 5.
  • buffer 50 mM MOPS pH 7.2, 10 ⁇ M zinc sulfate, 1 mM DTT, 2 mM benzamidine, 10 ⁇ g/ml each pepstatin, leupeptin, and aprotinin, and 20 ⁇ g/ml each calpain I and calpain II inhibitors
  • PDE8 COS-1 was generated by combining a 3 ' Kpnl/SaH fragment from plasmid W485.1 (Example 5) and a NhellKpnl fragment obtained by cleavage of a PCR amplification product from a reaction including FB66a cDNA as a template with primers W48A2 (SEQ ID NO: 10) and ATG (SEQ ID NO: 35).
  • Conditions for the PCR included an initial incubation for four minutes at 94 °C followed by 30 cycles of one minute at 94 °C, one minute at 50 °C and two minutes at 72 °C in a Perkin Elmer Cetus DNA thermal cycler.
  • the resulting 5 ' fragment and the 3 ' fragment described above were ligated into vector pClneo (Promega, Madison, WI) which had been previously digested with Nhel and Sail.
  • DMEM Dulbecco's Modified Eagle Media, 100 U/ml penicillin and 100 ⁇ g/ml streptomycin sulfate, GIBCO
  • 14 ml of DMEM/DEAE- dextran/chloroquine was added per plate.
  • DMEM/DEAE dextran/chloroquine is comprised of 75 ml DMEM and 30 ⁇ l 0.25 M chloroquine in PBS (2.7 mM KCl, 1.5 mM KH 2 PO 4 , 137 mM NaCl, 8.1 mM Na 2 PO 4 , 0.9 mM CaCl 2 0.5 mM MgCl j ), together with 0.75 ml 50 ⁇ g/ml DEAE-dextran (Pharmacia, Uppsala, Sweden). Twenty ⁇ g of plasmid DNA in 135 ⁇ l Tris/EDTA buffer (TE) was added per plate and the plates were incubated for two hours at 37°C in 5 % CO 2 .
  • PBS 2.7 mM KCl, 1.5 mM KH 2 PO 4 , 137 mM NaCl, 8.1 mM Na 2 PO 4 , 0.9 mM CaCl 2 0.5 mM MgCl j
  • the media was removed and 12 ml of 10% DMSO/PBS was added for one minute and removed.
  • the cells were washed once with 25 ml DMEM, after which another 25 ml of DMEM containing 10% fetal calf serum (Hyclone, Logan, UT) was added and the cells were incubated overnight at 37 °C in 5 % CO 2 .
  • the media was removed and the monolayer was washed with 25 ml of CMF-PBS.
  • Six ml of a solution containing 0.05 %trypsin 0.5 mM EDTA (Gibco) was added and the cells were incubated five minutes at 37° C. Cells were removed from the plates by trituration and transferred to conical centrifuge tubes.
  • the plates were washed with six ml of complete DMEM to harvest any remaining cells and the wash solution was added to the centrifuge tubes. Cells were pelleted by centrifugation for five minutes at approximately 340 x g, resuspended in five ml complete DMEM, removed to a 15 cm tissue culture dish containing 20 ml complete DMEM, and incubated overnight in 5 % CO 2 .
  • the monolayer was washed two times with CMF-PBS, incubated five minutes at 37°C in versene (0.5 mM Na 2 EDTA 2H 2 O, 137 mM NaCl, 2.68 mM KCl, 8.1 mM Na 2 HPO 4 , 1.1 mM glucose, pH 7.4), and harvested as described above. Pelleted cells were washed with CMF-PBS, frozen in dry ice, and stored at -80 °C until use.
  • Cells were lysed in buffer (50 mM MOPS, pH 7.2, 10 ⁇ M zinc sulfate, 1 mM DTT, 2 mM benzamidine, 10 ⁇ g/ml each pepstatin, leupeptin, and aprotinin, and 20 ⁇ g/ml each calpain I and calpain ⁇ inhibitors) by passage through a French pressure cell (SLM Instruments) at 20,000 psi and PDE activity was determined as described in Example 5.
  • buffer 50 mM MOPS, pH 7.2, 10 ⁇ M zinc sulfate, 1 mM DTT, 2 mM benzamidine, 10 ⁇ g/ml each pepstatin, leupeptin, and aprotinin, and 20 ⁇ g/ml each calpain I and calpain ⁇ inhibitors
  • the enzyme including a FLAG tag at the amino terminus (Example 5) is purified from a 100,000 x g supernatant of cell extract using an anti-FLAG M2 affinity column (Sigma) according to the manufacturer's suggested protocol.
  • expression of a recombinant protein that is truncated at the amino terminus but retains the catalytic region is carried out as described in Example 5 in an attempt to obtain a homogenous protein.
  • a GST fusion protein was produced in E. coli to provide an antigen for generation of monoclonal antibodies to PDE8A.
  • An Ec ⁇ RI fragment from FB70a (a
  • PDE8A cDNA that includes nucleotides 182-1330 of FB85c-2 and which was one of the nine clones originally identified which hybridized to the full length W04835 probe described in Example 2) was inserted into the Ec ⁇ RI site of pG ⁇ X5Xl (Pharmacia) and the resultant construct was transformed in the E. coli strain XL1 Blue.
  • a GST-PDE8A fusion protein including 382 amino acids from PDE8A was produced from this construct following induction with IPTG. The fusion protein was isolated using
  • mice On day 0, four Balb/c mice were pre-bled and injected subcutaneously with a panel of antigens including 30 ⁇ g/mouse GST-PDE8 fusion protein in complete Freund's adjuvant in 200 ⁇ l total volume. The same injections were repeated at weeks three and nine in incomplete Freund's adjuvant. Ten days after the last immunization, test bleeds were obtained and screened by antigen capture EUSA and Western analysis. In the ELISA, Immulon 4 plates (Dynex, Cambridge, Massachusetts) were coated at 4°C with 50 ⁇ l/well of a solution containing 2 ⁇ g/ml GST-PDE8 in 50 mM carbonate buffer, pH 9.6.
  • Antibody was detected with addition of tetramethyl benzidine (Sigma Chemical, St. Louis, Missouri) and the color reaction was stopped after five minutes with the addition of 50 ⁇ l of 15 % H 2 SO 4 . Absorbance at 450 nM was measured on a plate reader.
  • SDS-PAGE gels were run with approximately 10 ⁇ g yeast PDE8 extract and approximately 200 ng of gel-purified GST-PDE8 and the proteins were transferred to Immobilon-PVDF.
  • a standard enhanced chemiluminescence (ECL) Western blot protocol was performed using BioRad goat anti-mouse IgG horseradish peroxidase as the secondary antibody.
  • splenocytes from mice giving a positive result from the ELISA and/or Western blotting protocols above were fused to NS-1 cells in a ratio of 5:1 by standard methods using polyethylene glycol 1500 (Boehringer Mannheim) (Harlow and Lane, Antibodies, a Laboratory Manual, Cold Spring Harbor Laboratory, 1988).
  • the fused cells were resuspended in 200 ml RPMI containing 15 % FBS, 100 mM sodium hypoxanthine, 0.4 mM aminopterin, 16 mM thymidine (HAT) (Gibco), 25 units/ml IL-6 (Boehringer Mannheim) and 1.5 x 10 6 murine thymocytes/ml and dispensed into ten 96-well flat bottom tissue culture plates (Corning, United Kingdom) at 200 ⁇ l/well.
  • FBS fetal bovine serum
  • HAT thymidine
  • IL-6 Boehringer Mannheim
  • PDE8XR2A (corresponding to nucleotides 571 to 1226 of SEQ ID NO: 1) was subcloned into a Bluescript vector (Stratagene, La Jolla, CA) to generate an expression plasmid designated PDE8XR2A.
  • the plasmid was cleaved with Xhol and transcribed (see below) with T3 polymerase to generate an antisense probe.
  • a sense probe was generated by cleaving PDE8XR2A with Ec ⁇ RI and transcribing with T7 polymerase.
  • the PDE8A templates were transcribed using a RNA Transcription kit (Stratagene, La Jolla, CA) in a reaction containing 5 ⁇ l of 5X transcription buffer (Stratagene), 30 mM DTT (Stratagene), 0.8 mM each ATP, CTP, GTP (10 mM (Stratagene), 40 U RNase Block ⁇ (Stratagene), 12.5 U T3 or T7 polymerase (Stratagene), and 300 ng linearized plasmid template, 50 ⁇ Ci 35 S-UTP (greater than 1000 Ci/mmol, Amersham, Arlington Heights, IL).
  • a RNA Transcription kit (Stratagene, La Jolla, CA) in a reaction containing 5 ⁇ l of 5X transcription buffer (Stratagene), 30 mM DTT (Stratagene), 0.8 mM each ATP, CTP, GTP (10 mM (Stratagene), 40 U RNase Block ⁇ (Stratagene),
  • the mixture was incubated at 37 °C for one hour after which the template DNA was removed by addition of 1 ⁇ l of RNase-free DNase I (Stratagene) and incubation for 15 minutes at 37° C.
  • the probe was hydrolyzed by adding 4 ⁇ l 1 M NaHCO 3 and 6 ⁇ l 1 M Na j CC ⁇ for 22 minutes at 60 °C and the reaction mixture was neutralized by addition of 25 ⁇ l of a solution containing 100 ⁇ l 3 M sodium acetate, 5 ⁇ l acetic acid (VWR, So. Plainfield, NJ), and 395 ⁇ l dH 2 0.
  • a Quick Spin G50 RNA column (5 '-3' Inc. , Boulder, CO) was prepared according to the manufacturer's suggested protocol.
  • the probe was placed in the center of the column and the column centrifuged for four minutes at 1,000 rpm in a desk top centrifuge.
  • the column flow- through was mixed with 50 ⁇ l dH 2 O, 2 ⁇ l of a 10 mg/ml tRNA solution, 10 ⁇ l 3 M sodium acetate, and 200 ⁇ l 100% ethanol (VWR) and the resulting mixture was incubated at -20 °C overnight.
  • the probe solution was microfuged for 15 minutes at 4°C, the supernatant was removed, and the pellet was resuspended in 40 ⁇ l IX TBE containing l ⁇ l of 0.1 M DTT.
  • the probe was stored at -70°C until the in situ hybridization assay was performed.
  • Tissues National Disease Research Interchange, Philadelphia, PA and Cooperative Human Tissue Network, Philadelphia, PA were sectioned at 6 ⁇ m and placed on Superfrost Plus slides (VWR). Sections were fixed for 20 minutes at 4 C C in 4% paraformaldehyde (Sigma, St. Louis, MO). The slides were rinsed in three changes of IX CMF-PBS, dehydrated with three successive washes with 70% ethanol, 95% ethanol and 100% ethanol , and dried for 30 minutes at room temperature. The slides were placed in 70% formamide (J.T.
  • the probe as described above, was prepared by mixing 4 x 10 s cpm/tissue section with 5 ⁇ l of a 10 mg/ml tRNA solution per section and heating the mixture at 95°C for three minutes. Ice cold rHB2 buffer was added to bring the final volume to 20 ⁇ l/section.
  • the probe- containing solution (20 ⁇ l/section) w s added to 100 ⁇ l rHB2 buffer previously applied.
  • the slides were incubated at 55 °C for 12 to 16 hours. Following hybridization, the slides were washed once in 4X SSC containing 10 mM DTT for one hour at room temperature, once in 50 '/ ⁇ deionized formamide (J.T. Baker), IX SSC, and 1 mM DTT for 40 minutes at 60 C. once in 2X SSC for 30 minutes at room temperature; and once in 0.1X SSC for 30 minutes at room temperature. The sections were dehydrated through 70%, 95 % . and 100% ethanol washes and air dried for 30 minutes.
  • the slides were dipped in Kodak NTB2 nuclear emulsion, dried for one to three hours at room temperature in the dark and stored in the dark at 4°C with desiccant until time of development .
  • the slides were developed in 4°C Kodak Dektol developer for four minutes, dipped four times in 4°C dH 2 O, and placed in 4°C Kodak fixer for four minutes.
  • the slides were rinsed in dH 2 O and a standard H&E stain was performed as follows.
  • the slides were rinsed in dH-,0 and stained with hematoxylin and eosin by transfer of the slides through a series of the following step: five minutes in formaldehyde/alcohol (100 ml formaldehyde.
  • PDE8A signal was detected throughout much of the cerebellum, in a subset of cells in the seminiferous tubules of the testes, on scattered cells of yet undetermined origin in skeletal muscle, in granulosa cells and ovarian stroma in the ovary, in epithelial cells in the loop of Henle in the kidney and on the smooth muscle of some arterioles in the heart.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Saccharide Compounds (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Cereal-Derived Products (AREA)

Abstract

Cette invention se rapporte à des polypeptides de phosphodiestérase 8 (PDE8) humains, à des polynucléotides codant ces polypeptides, à des produits synthétisés d'expression comprenant ces polynucléotides, à des cellules hôtes transformées à l'aide de ces produits synthétisés d'expression; à des procédés de production de polypeptides de PDE8; à des polynucléotides anti-sens; ainsi qu'à des anticorps entrant spécifiquement en immunoréaction avec ces polypeptides de PDE8.
EP98953651A 1997-10-16 1998-10-16 Phosphodiesterase 8 Revoked EP0944725B1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP05009465A EP1571216A3 (fr) 1997-10-16 1998-10-16 Phosphodiestérase 8A

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US08/951,648 US5932465A (en) 1997-10-16 1997-10-16 Phosphodiesterase 8A
US951648 1997-10-16
PCT/US1998/021956 WO1999019495A1 (fr) 1997-10-16 1998-10-16 Phosphodiesterase 8a

Related Child Applications (1)

Application Number Title Priority Date Filing Date
EP05009465A Division EP1571216A3 (fr) 1997-10-16 1998-10-16 Phosphodiestérase 8A

Publications (2)

Publication Number Publication Date
EP0944725A1 true EP0944725A1 (fr) 1999-09-29
EP0944725B1 EP0944725B1 (fr) 2005-05-11

Family

ID=25491965

Family Applications (2)

Application Number Title Priority Date Filing Date
EP05009465A Withdrawn EP1571216A3 (fr) 1997-10-16 1998-10-16 Phosphodiestérase 8A
EP98953651A Revoked EP0944725B1 (fr) 1997-10-16 1998-10-16 Phosphodiesterase 8

Family Applications Before (1)

Application Number Title Priority Date Filing Date
EP05009465A Withdrawn EP1571216A3 (fr) 1997-10-16 1998-10-16 Phosphodiestérase 8A

Country Status (14)

Country Link
US (4) US5932465A (fr)
EP (2) EP1571216A3 (fr)
JP (1) JP2001512327A (fr)
CN (2) CN1800399A (fr)
AT (1) ATE295423T1 (fr)
AU (1) AU1097499A (fr)
BR (1) BR9806318A (fr)
CA (1) CA2275135A1 (fr)
DE (1) DE69830143T2 (fr)
ES (1) ES2245485T3 (fr)
IL (3) IL130287A0 (fr)
NO (1) NO992916L (fr)
RU (2) RU2272841C2 (fr)
WO (1) WO1999019495A1 (fr)

Families Citing this family (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2238283C (fr) 1997-05-30 2002-08-20 Cell Pathways, Inc. Methode d'identification de composes visant a inhiber les lesions neoplasiques, compositions pharmaceutiques a prtir de ces composes et compositions pour traiter les lesions neoplasiques
US5858694A (en) * 1997-05-30 1999-01-12 Cell Pathways, Inc. Method for identifying compounds for inhibition of cancerous lesions
EP0967284A1 (fr) * 1998-05-28 1999-12-29 Pfizer Limited Phosphodiestérases
US6130053A (en) * 1999-08-03 2000-10-10 Cell Pathways, Inc. Method for selecting compounds for inhibition of neoplastic lesions
GB9922125D0 (en) 1999-09-17 1999-11-17 Pfizer Ltd Phosphodiesterase enzymes
US6673564B2 (en) * 1999-10-18 2004-01-06 Millennium Pharmaceuticals, Inc. Methods for using 22045, a human cyclic nucleotide phosphodiesterase
CN1297049A (zh) * 1999-11-23 2001-05-30 上海博容基因开发有限公司 一种新的多肽——人环磷酸鸟嘌呤抑制的磷酸二酯酶17和编码这种多肽的多核苷酸
US6555547B1 (en) 2000-02-28 2003-04-29 Cell Pathways, Inc. Method for treating a patient with neoplasia by treatment with a vinca alkaloid derivative
US6569638B1 (en) 2000-03-03 2003-05-27 Cell Pathways, Inc Method for screening compounds for the treatment of neoplasia
CN1312381A (zh) * 2000-03-07 2001-09-12 上海博德基因开发有限公司 一种新的多肽——人环腺苷酸磷酸二脂酶13和编码这种多肽的多核苷酸
ATE373717T1 (de) * 2000-09-12 2007-10-15 Univ Washington Pde8a und seine verwendung
IL159722A0 (en) * 2001-07-10 2004-06-20 Oligos Etc Inc Pharmaceutical compositions containing oligonucleotides
WO2004042388A2 (fr) * 2002-11-08 2004-05-21 Bayer Healthcare Ag Diagnostics et medicaments pour des maladies associees a la phosphodiesterase 8a (pde8a) humaine
AU2005223847A1 (en) 2004-03-19 2005-09-29 Yale University Detection, isolation and uses of renalase (Monoamine Oxidase C)
AU2006304787A1 (en) 2005-10-21 2007-04-26 Braincells, Inc. Modulation of neurogenesis by PDE inhibition
CA2630085A1 (fr) 2005-11-21 2007-05-24 Yale University Procedes de regulation de la renalase (monoamine oxydase c)
AU2008230710B2 (en) * 2007-03-27 2014-04-10 Omeros Corporation The use of PDE7 inhibitors for the treatment of movement disorders
JP6148007B2 (ja) * 2009-05-12 2017-06-14 コーニンクレッカ フィリップス エヌ ヴェＫｏｎｉｎｋｌｉｊｋｅ Ｐｈｉｌｉｐｓ Ｎ．Ｖ． 前立腺癌マーカーとしてのホスホジエステラーゼ４ｄ７
SG193024A1 (en) * 2011-03-11 2013-10-30 Synageva Biopharma Corp Npp1 fusion proteins
RU2760943C2 (ru) * 2011-09-15 2021-12-01 Алексион Фармасьютикалз, Инк. Гибридные белки NPP1
EP2804603A1 (fr) 2012-01-10 2014-11-26 President and Fellows of Harvard College Composés promoteurs de réplication des cellules bêta et leurs procédés d'utilisation

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP3501286B2 (ja) * 1989-12-22 2004-03-02 アプライド リサーチ システムズ，エーアールエス ホールディング ナームロゼ ベノートスハップ 一定の細胞系又は微生物の内因性遺伝子の発現特徴の変性のための方法
EP0539573A4 (en) * 1991-05-15 1993-12-29 Cell Genesys, Inc. Genomic modifications with homologous dna targeting
TW402639B (en) * 1992-12-03 2000-08-21 Transkaryotic Therapies Inc Protein production and protein delivery
US5798246A (en) * 1996-03-25 1998-08-25 Incyte Pharmaceuticals, Inc. Cyclic nucleotide phosphodiesterase

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9919495A1 *

Also Published As

Publication number Publication date
EP1571216A2 (fr) 2005-09-07
EP0944725B1 (fr) 2005-05-11
NO992916L (no) 1999-08-06
AU1097499A (en) 1999-05-03
EP1571216A3 (fr) 2006-04-26
IL175698A0 (en) 2008-02-09
DE69830143D1 (en) 2005-06-16
JP2001512327A (ja) 2001-08-21
ES2245485T3 (es) 2006-01-01
US6133007A (en) 2000-10-17
US20030215919A1 (en) 2003-11-20
CN1229499C (zh) 2005-11-30
NO992916D0 (no) 1999-06-15
ATE295423T1 (de) 2005-05-15
CA2275135A1 (fr) 1999-04-22
WO1999019495A1 (fr) 1999-04-22
RU2005136013A (ru) 2007-05-27
CN1248291A (zh) 2000-03-22
RU2272841C2 (ru) 2006-03-27
DE69830143T2 (de) 2006-03-02
US5932465A (en) 1999-08-03
IL130287A0 (en) 2000-06-01
US6566087B1 (en) 2003-05-20
IL130287A (en) 2006-08-20
BR9806318A (pt) 2000-03-14
CN1800399A (zh) 2006-07-12

Similar Documents

Publication Publication Date Title
EP0944725B1 (fr) Phosphodiesterase 8
EP1060251B1 (fr) Phosphodiesterase 10
EP1038963B1 (fr) Phosphodiésterase de fixation du monophosphate de guanosine cyclique et avec specificité pour celui-ci et procédé d'obtention
US5798246A (en) Cyclic nucleotide phosphodiesterase
JP2002534091A (ja) ヒト・サイクリックヌクレオチド・ホスホジエステラーゼ
Her et al. Cloning, Structural Characterization, and Chromosomal Localization of the Human Orthologue ofSaccharomyces cerevisiaeMSH5 Gene
WO2000003685A2 (fr) Homologues de nitrilase
AU2003200898B2 (en) Phosphodiesterase 8A
US20030087317A1 (en) Human NIM1 kinase
Olsen et al. Physical mapping and promoter structure of the murine cAMP-specific phosphodiesterase pde4a gene
MXPA99005529A (es) Fosfodiesterasa 8a
AU701901B2 (en) Cytoplasmic tyrosine kinase
Kroiher et al. A gene whose major transcript encodes only the substrate-binding domain of a protein-tyrosine kinase
US20030054385A1 (en) Human ubiquitin-conjugating enzymes
CA2261297A1 (fr) Nouvelle proteine-kinase a maturation inhibee

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

17P Request for examination filed

Effective date: 19991007

17Q First examination report despatched

Effective date: 20030219

RTI1 Title (correction)

Free format text: PHOSPHODIESTERASE 8

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

GRAS Grant fee paid

Free format text: ORIGINAL CODE: EPIDOSNIGR3

GRAA (expected) grant

Free format text: ORIGINAL CODE: 0009210

AK Designated contracting states

Kind code of ref document: B1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: FI

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20050511

REG Reference to a national code

Ref country code: GB

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: CH

Ref legal event code: EP

REG Reference to a national code

Ref country code: IE

Ref legal event code: FG4D

REF Corresponds to:

Ref document number: 69830143

Country of ref document: DE

Date of ref document: 20050616

Kind code of ref document: P

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: GR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20050811

Ref country code: DK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20050811

REG Reference to a national code

Ref country code: SE

Ref legal event code: TRGR

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: CY

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20051016

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: PT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20051019

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: MC

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20051031

Ref country code: LU

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20051031

REG Reference to a national code

Ref country code: CH

Ref legal event code: NV

Representative=s name: ISLER & PEDRAZZINI AG

REG Reference to a national code

Ref country code: ES

Ref legal event code: FG2A

Ref document number: 2245485

Country of ref document: ES

Kind code of ref document: T3

PLBI Opposition filed

Free format text: ORIGINAL CODE: 0009260

26 Opposition filed

Opponent name: BAYER HEALTHCARE AG

Effective date: 20060118

PLAX Notice of opposition and request to file observation + time limit sent

Free format text: ORIGINAL CODE: EPIDOSNOBS2

ET Fr: translation filed
REG Reference to a national code

Ref country code: GB

Ref legal event code: 732E

NLR1 Nl: opposition has been filed with the epo

Opponent name: BAYER HEALTHCARE AG

PLAF Information modified related to communication of a notice of opposition and request to file observations + time limit

Free format text: ORIGINAL CODE: EPIDOSCOBS2

PLBB Reply of patent proprietor to notice(s) of opposition received

Free format text: ORIGINAL CODE: EPIDOSNOBS3

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: AT

Payment date: 20061011

Year of fee payment: 9

RDAF Communication despatched that patent is revoked

Free format text: ORIGINAL CODE: EPIDOSNREV1

REG Reference to a national code

Ref country code: CH

Ref legal event code: PCAR

Free format text: ISLER & PEDRAZZINI AG;POSTFACH 1772;8027 ZUERICH (CH)

RDAG Patent revoked

Free format text: ORIGINAL CODE: 0009271

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: PATENT REVOKED

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: NL

Payment date: 20071003

Year of fee payment: 10

Ref country code: ES

Payment date: 20071120

Year of fee payment: 10

Ref country code: DE

Payment date: 20071011

Year of fee payment: 10

27W Patent revoked

Effective date: 20071003

GBPR Gb: patent revoked under art. 102 of the ep convention designating the uk as contracting state

Free format text: 20071003

REG Reference to a national code

Ref country code: CH

Ref legal event code: PL

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: CH

Payment date: 20071015

Year of fee payment: 10

Ref country code: IT

Payment date: 20071027

Year of fee payment: 10

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: SE

Payment date: 20071004

Year of fee payment: 10

Ref country code: BE

Payment date: 20071220

Year of fee payment: 10

NLR2 Nl: decision of opposition

Effective date: 20071003

REG Reference to a national code

Ref country code: SE

Ref legal event code: ECNC

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: GB

Payment date: 20071010

Year of fee payment: 10

Ref country code: FR

Payment date: 20071009

Year of fee payment: 10

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: FR

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20061031

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: IE

Payment date: 20071011

Year of fee payment: 10