Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
  • C12N15/1034—Isolating an individual clone by screening libraries
  • C12N15/1051—Gene trapping, e.g. exon-, intron-, IRES-, signal sequence-trap cloning, trap vectors
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6809—Methods for determination or identification of nucleic acids involving differential detection

Definitions

• the present invention relates to a method for identifying genes that are translationally regulated. More specifically, the present invention relates to the rapid isolation of differentially expressed or developmentally regulated gene sequences through segregation of mRNAs into translated and untranslated pools and comparing the relative abundance of the mRNAs found in these pools by differential analysis.
• coli are transformed with the cDNA containing vectors, linearized fragments are generated from the cloned inserts by digestion with at least one restriction endonuclease that is different from the first and second restriction endonucleouseases and a cDNA preparation of the anti-sense cDNA transcripts is generated by incubating the linearized fragments with a T3 RNA polymerase.
• the cDNA population is divided into subpools and the first strand cDNA from each subpool is transcribed using a thermostable reverse transcriptase and one of sixteen primers.
• the transcription product of each of the sixteen reaction pools is used as a template for a polymerase chain reaction (PCR) with a 3'-primer and a 5'-primer and the polymerase chain reaction amplified fragments are resolved by electrophoresis to display bands representing the 3 '-ends of the mRNAs present in the sample.
• PCR polymerase chain reaction
• This method is useful for the identification of differentially expressed mRNAs and the measurement of their relative concentrations. This type of methodology, however, is unable to identify mRNAs whose levels remain constant but their translatability is variable or changes.
• Schena et al. developed a high capacity system to monitor the expression of many genes in parallel utilizing microarrays.
• the microarrays are prepared by high speed robotic printing of cDNAs on glass providing quantitative expression measurements of the corresponding genes (Schena et al., 1995). Differential expression measurements of genes are made by means of simultaneous, two color fluorescence hybridization. However, this method alone is insufficient for the identification of translationally regulated genes.
• the translation of eukaryotic mRNAs is dependent upon 5' cap-mediated ribosome binding.
• the ribosome small sub- unit (40S) binds to the 5'-cap structure on a transcript and then proceeds to scan along the mRNA molecule to the translation initiation site where the large sub-unit (60S) forms the complete ribosome initiation site.
• the translation initiation site is the first AUG codon.
• IRES containing mRNA transcripts have been discovered in non-viral systems such as the mRNA encoding for immunoglobulin heavy chain binding protein, the antenapedia gene in Drosophila, and the mouse Fgl-2 gene. These discoveries have promoted speculation for the role of cap- independent translation in the developmental regulation of gene expression during both normal and abnormal processes.
• a method for identifying translationally regulated genes in an organism including the steps of selectively stimulating translation of an unknown target mRNA with a stress inducing element, the target mRNA being part of a larger sample of mRNA, dividing the sample of mRNA into pools of translated and untranslated mRNA and differentially analyzing the pools of mRNA to identify genes translationally regulated by the stress inducing element.
• the stress inducing element can include pathologic, environmental including chemical and physical stressors or other stimulus that induces mRNA translation.
• a method for identifying gene sequences coding for internal ribosome entry sites are provided.
• the method includes inhibiting 5 'cap-dependant mRNA translation in a cell, collecting a pool of mRNA from the cells, and differentially analyzing the pool of mRNA to identify genes with sequences coding for internal ribosome entry sites.
• Figure 1 A is an absorbance profile of a fractionation of cytoplasmic
• RNA on a sucrose density gradient wherein the absorbance (at 254nm) is plotted against the sedimentation rate of the cytoplasmic RNA
• Figure IB is a photograph of purified RNA electrophoresed on an agarous gel and stained with ethidium bromide illustrating the fractionation of RNA;
• Figure 2 is a photograph of a 5% acrylamide gel illustrating a differential translation analysis of mRNA from sucrose density gradients according to the present invention
• Figure 3A-C are schematic representations of plasmids that contain the Polio virus 2 A genes (A) in plasmid pTK-OP3-WT2A, (B) in the plasmid miniTK-WT2A, and (C) in a plasmid containing a hygromycin selectable marker;
• Figure 4 is graph illustrating the induction of Polio virus 2A protease leading to cell death after induction of the 2A protease;
• Figure 5 is a photograph of a gel illustrating the presence of Polio virus 2A protease expression in transformed HEK-293 cells (293-2A) following induction with IPTG and the absence of the Polio virus 2 A protease in HEK-293 (293) parental cells following treatment with IPTG; and
• Figure 6 is a photograph of a Western blot illustrating the activity of the Polio virus 2A protease in cleaving the p220 protein component of the 40S ribosomal subunit demonstrating that clones which were induced for Polio virus
• the present invention provides a method for identifying translationally regulated genes in an organism by selectively stimulating translation of an unknown target mRNA with a stress inducing element, the target mRNA being part of a larger sample.
• the organism may be any organism which provides suitable mRNA.
• the mRNA sample is divided into pools of translated and untranslated mRNA which are differentially analyzed to identify genes which are translationally regulated by the stress inducing element.
• This method is designed for identifying and cloning genes which are regulated at the translational level. That is, the present method is designed for identifying and cloning genes which are either up- or down- regulated including identifying genes responsive to a specific pathology or stress condition.
• the method of the present invention provides a novel approach to the identification and cloning of genes that are involved in fundamental cellular functions and which are regulated at the level of translation in an organism.
• the basic underlying theory for this method relies on the assumption that an mRNA encoding a protein required for a quick response to an external cue is generally stored as an untranslated mRNA. Following the appropriate external cue, the mRNA is translated and the encoded protein quickly appears. By comparing mRNA populations that are "active” or "non-active" at a given time, genes that are regulated by a mechanism referred to as the "shift mechanism" can be identified.
• the method can also be applied to identify in addition to genes regulated at the translational level; genes regulated at the transcription level; genes regulated by RNA stability; gene regulated by mRNA transport rate between the nucleus and the cytoplasm; and gene regulated by differential splicing. That is, genes whose expression in part, is controlled/regulated at the mRNA level can be identified.
• the method will identify genes encoding secreted and membrane proteins; genes encoding for nuclear proteins; genes encoding for mitochondrial proteins; and genes encoding for cytoskeletal proteins. In addition, any other gene whose expression can be controlled at the mRNA level can be identified by this method.
• RNA refers to RNA isolated from cell cultures, cultured tissues or cells or tissues isolated from organisms which are stimulated, differentiated, exposed to a chemical compound, are infected with a pathogen or otherwise stimulated.
• translation is defined as the synthesis of protein on an mRNA template.
• stimulating translation of unknown target mRNA or stimulating element includes chemically, pathogenically, physically, or otherwise inducing or repressing an mRNA population from genes which can be derived from native tissues and/or cells under pathological and/or stress conditions that are regulated by the "shift mechanism.”
• stimulating the translation of mRNA with a stress inducing element or "stressor” can include the application of an external cue, stimulus, or stimuli which stimulates or initiates translation of a mRNA stored as untranslated mRNA in the cells from the sample.
• stimulation can include induction and/or repression of genes under pathological and/or stress conditions.
• the present method utilizes a stimulus or stressor to identify unknown target genes which are translationally regulated by the stress inducing element or stressor.
• the method of the present invention integrates two previously known methodologies which were otherwise used separately.
• the first method is the division of an mRNA sample into separate translated and untranslated pools of mRNA.
• the second methodology involves the simultaneous comparison of the relative abundance of the mRNA species found in the separate pools by a method of differential analysis such as differential display, representational difference analysis (RDA), gene expression microarray (GEM), suppressive subtraction hybridization (SSH) (Diatchenko et al., 1996), and techniques such as chip technology exemplified by United States Patent No. 5,545,531 to Rava et al. assigned to Affymax Technologies N.V. and direct sequencing exemplified by WO
• RDA representational difference analysis
• GEM gene expression microarray
• SSH suppressive subtraction hybridization
• subtractive hybridization is defined as subtraction of mRNA by hybridization in solution. RNA that are common to the two pools form a duplex that can be removed, enriching for RNAs that are unique or more abundant in one pool.
• Differential Display is defined as reverse transcription of mRNA into cDNA and PCR amplification with degenerated primers. Comparison of the amounts amplification products (by electrophoresis) from two pools indicate transcript abundance. RDA, GEM, SSH, SAGE are described herein above.
• the specific cells/tissues which are to be analyzed in order to identify translationally regulated genes can include any suitable cells and/or tissues. Any cell type or tissue can be used, whether an established cell line or culture or whether directly isolated from an exposed organism.
• the cells/tissues to be analyzed under the present method are selectively stimulated utilizing a physiological, chemical, environmental and/or pathological stress inducing element or stressor, in order to stimulate the translation of mRNA within the sample tissue and identify genes whose expression is regulated at least in part at the mRNA level.
• the RNA from the cells/tissues is isolated or extracted from the cells/tissues. The isolation of the RNA can be performed utilizing techniques which are well known to those skilled in the art and are described, for example, in
• the mRNAs which are actively engaged in translation and those which remain untranslated can be separated utilizing a procedure such as fractionation on a sucrose density gradient, high performance gel filtration chromatography, or polyacrylamide gel matrix separation (Ogishima et al., 1984, Menaker et al., 1974, Hirama et al., 1986, Mechler, 1987, and Bharucha and Murthy, 1992), since mRNAs that are being translated are loaded with ribosomes and, therefore, will migrate differently on a density gradient than ribosome-free untranslated mRNAs.
• genes that are regulated by the "shift mechanism" can be identified.
• Polysomal fractionation and specific analysis can be facilitated by treatment of target cell/tissue with drugs that will specifically inhibit or modulate transcription or translation. Examples of such drugs are actinomycin D and cyclohexamide, respectively.
• the fractionation can be completed to create polysomal subdivisions.
• the subdivisions can be made to discriminate between total polyribosomes or membrane bound ribosomes by methods known in the art
• the mRNA sample can be in addition fractionated into one or more of at least the following subsegments or fractions: cytoplasmatic, nuclear, polyribosomal, sub polyribosomal, microsomal or rough endoplasmic reticulum, mitochondrial and splicesome associated mRNA by methods known in the art (see also Table 1).
• differential analysis technique such as differential display, representational difference analysis (RDA), GEM-Gene Expression Microarrays (Schena et al.,
• RNA isolated from the fractions can be further purified into mRNA without the ribosomal RNA by poly A selection. It should be noted that multiple pools can be analyzed utilizing this method. That is, different cell aliquots subjected to different stressors can be compared with each other as well as with the reference sample.
• Labeled mRNA in a cDNA or PCR product form
• polysomal, non-polysomal or mRNPs pools or individual fractions
• label can be radioactive, fluorescent, or incorporating a modified base such as digoxigenin and biotin.
• the polysomal fractions or groups can include membrane bound polysomes, loose or tight polysomes, or free unbound polysome groups.
• Example 2 The importance of utilizing the polysomal sub-population in order to identify differentially (translationally) expressed genes is shown in Example 2 where a number of genes were not detected as translationally expressed under heat shock inducement when total mRNA was used as the detection probe but, however, when polysomal mRNA was used as a probe, a number of genes were identified as differentially expressed. These genes were previously thought to be non- differentially expressed when total mRNA was used as a probe. That is, as shown in Example 2, a number of genes that were not detected as translationally expressed under heat shock inducement with total mRNA were detected when probed with polysomal mRNA fractions.
• the present method for identifying translationally regulated genes is not limited by the source of the mRNA pools. Therefore, the present method can be utilized to clone genes from native cells/tissue under pathological and/or stress conditions that are regulated by the "shift mechanism," as well as genes that are induced/repressed under pathological and/or stress conditions.
• Pathologies can include disease states including those diseases caused by pathogens and trauma. Stress conditions can also include disease states, physical and psychological trauma, and environmental stresses.
• the genes which have been identified as being regulated by translation can be cloned by any suitable cloning methodologies known to those skilled in the art. (Lisitsyn and Wigler, 1993).
• Differential comparisons can also include polysomal vs. non- polysomal fractions in each condition.
• condition it is meant that cells from the same source, such as a cell line, a primary cell, or a tissue that undergoes different treatment or has been modified to have different features or to express different sets of genes. For example, this can be accomplished by differentiation, transformation, application of the stress such as oxygen deprivation, chemical treatment, or radiation. Permutations can include, for example:
• each of the fractions being polysomal and non-polysomal individually (migrating in the same density) or in a pool that can be compared to total RNA that is unfractionated.
• the method described above for the identification of translationally regulated genes has a number of applications. A particular application for this method is its use for the detection of changes in the pattern of mRNA expression in cells/tissue associated with any physiological or pathological change. By comparing the translated versus untranslated mRNAs, the effect of the physiological or pathological cue or stress on the change of the pattern of mRNA expression in the cell/tissue can be observed and/or detected.
• This method can be used to study the effects of a number of cues, stimuli, or stressors to ascertain their effect or contribution to various physiological and pathological activities of the cell/tissue.
• the present method can be used to analyze the results of the administrations of pharmaceuticals (drugs) or other chemicals to an individual by comparing the mRNA pattern of a tissue before and after the administration of the drug or chemical. This analysis allows for the identification of drugs, chemicals, or other stimuli which affect cells/tissue at the level of translational regulation.
• a further embodiment of the present invention provides a method for identifying gene sequences coding for internal ribosome entry sites (IRES) and includes the general steps of inhibiting 5 'cap-dependant mRNA translation in a cell, collecting a pool of mRNA from the cells, and differentially analyzing the pool of mRNA to identify genes with sequences coding for internal ribosome entry sites.
• IRS internal ribosome entry sites
• the mechanism(s) of standard scanning-type translation initiation should be substantially, if not totally, turned off or shut down to, in essence, shift the translation equilibrium in favor of IRES initiated translation. That is, recognition of the 5'-cap structure is inhibited by disrupting the normal mechanism for 5'-cap mediated initiation.
• the mechanism for inhibiting the 5'-cap translation can include any known means or mechanisms for preventing the initiation of 5 '-cap mediated translation.
• One such mechanism for inhibiting 5 '-cap mediated translation is the expression of Polio virus 2 A protease into a cell, cell system, or tissue to be analyzed for the presence of IRES sequences.
• Polio virus 2 A protease inhibits 5 '-cap-dependent mRNA translation by inactivating the cellular 5 '-cap-dependent translation machinery. This enables the identification of cellular IRES containing genes which may be translationally controlled and play a critical role in the immediate response of the cell following the application of a stress inducing element/stressor such as heat shock, hypoxia, or other stress inducing elements as set forth above, prior to gene activation.
• the Polio virus 2A protease prevents 5 '-cap-mediated translation by cleaving the large sub-unit of elF- 4 ⁇ (p220) of eukaryotic translation initiation factor 4 (eIF-4) which is involved in the recognition of the mRNA 5'-cap.
• the Polio virus 2A protease In order to inhibit the 5 '-cap-mediated translation, the Polio virus 2A protease must be incorporated into the cell or cells being analyzed for the presence of gene sequences coding for internal ribosome entry sites and/or for identifying translationally regulated genes.
• One such method for incorporating the Polio virus 2A protease In order to inhibit the 5 '-cap-mediated translation, the Polio virus 2A protease must be incorporated into the cell or cells being analyzed for the presence of gene sequences coding for internal ribosome entry sites and/or for identifying translationally regulated genes.
• One such method for incorporating the Polio virus 2A protease must be incorporated into the cell or cells being analyzed for the presence of gene sequences coding for internal ribosome entry sites and/or for identifying translationally regulated genes.
• Polio virus 2A protease into a cell involves the transformation of a target cell with an expression vector containing the gene which codes for the Polio virus 2A protease. Because the Polio virus 2A protease is deleterious to living cells when it is constitutively expressed, the expression vector containing the Polio virus 2A protease gene is coupled with a bacterial Lad inducible system wherein a Lad repressor is constituitively expressed under a CMV promoter.
• the Polio virus 2A protease may be expressed under a number of suitable promoters including the RSV, the TK, or the mini-TK promoter coupled at their 3' end to the Lad repressor binding sites.
• the expression of the Polio virus 2 A protease can be induced upon treatment of the cells with isopropyl- ⁇ -D-thiogalatopyranoside (IPTG).
• IPTG isopropyl- ⁇ -D-thiogalatopyranoside
• Treatment of the target cells with IPTG relieves the binding of the Lad repressor molecules bound at the repressor binding sites thus enabling transcription of the Polio virus 2A protease.
• IPTG isopropyl- ⁇ -D-thiogalatopyranoside
• RNA presumably containing internal ribosome entry sites, can be collected and analyzed utilizing the methods described above to identify genes whose translation is up-regulated by the effects of the Polio virus 2A protease.
• RNA-lysis of cells from a tissue or a cell line
• hypotonic buffer Collection of nuclei by centrifugation and organic extraction of the RNA.
• Polyribosomal/subpolyribosomal fractionation Lysis of cells by homogenization hypotonic buffer, removal of nuclei and fractionation of polyribosome on linear sucrose gradients and organic extraction of the RNA from each fraction of the gradient.
• Secreted and membrane encoding transcripts secreted and membrane encoding transcripts.
• X-100 and 0.2M sucrose was added.
• the cells were homogenized with a Dounce homogenizer (five strokes with B pestle).
• the cell lysate was centrifuged at 2300g for ten minutes at 4°C.
• the supernatant was transferred to a new tube.
• HLB containing lOmg/ml heparin was added to a final concentration of lmg/ml heparin.
• NaCl was added to a final concentration of 0.15M.
• the supernatant was frozen at
• a linear sucrose gradient from 0.5M to 1.5M sucrose in HLB was prepared. Polyallomer tubes (14X89mm) were used. 0.5 to 1.0ml of cell extract was loaded on the gradient. The cells were centrifuged at 36,000 RPM for 110 minutes at 4°C.
• RNA purification SDS was added to 0.5% and Proteinase K to O.lmg/ml and incubated at 37°C for
• DEPC DEPC-treated water
• each reaction is done in 20 ⁇ l and contains 50 ⁇ M dNTP mix, l ⁇ M from each primer, lx polymerase buffer, 1 unit expand Polymerase
• oligonucleotides are used in this procedure: R-Bgl-12 5' GATCTGCGGTGA 3' (SEQ ID No: 22) R-Bgl-24 5' AGCACTCTCCAGCCTCTCACCGCA 3' (SEQ ID No:23) J-Bgl-12 5' GATCTGTTCATG 3' (SEQ ID No: 24)
• R-Bgl-12 and R-Bgl-24 oligos were ligated to Tester and Driver: 1.2 ⁇ g DpnII digested cDNA. 4 ⁇ l from each oligo and 5 ⁇ l ligation buffer X10 and annealed at 60°C for ten minutes. 2 ⁇ l ligase was added and incubated overnight at 16°C. The ligation mixture was diluted by adding 140 ⁇ l TE. Amplification was carried out in a volume of 200 ⁇ l using R-Bgl-24 primer and 2 ⁇ l ligation product and repeated in twenty tubes for each sample. Before adding Taq DNA polymerase, the tubes were heated to 72°C for three minutes.
• PCR conditions were as follows: five minutes at 72°C, twenty cycles of one minute at 95°C and three minutes at 72°C, followed by ten minutes at 72°C. Every four reactions were combined, extracted with phenol/chloroform and precipitated. Amplified DNA was dissolved to a concentration of 0.5 ⁇ g/ ⁇ l and all samples were pooled. Subtraction: Tester DNA (20 ⁇ g) was digested with DpnII as above and separated on a 1.2% agarous gel. The DNA was extracted from the gel and 2 ⁇ g was ligated to J-Bgl-12 and J-Bgl24 oligos as described above for the R-oligos. The ligated Tester DNA was diluted to 1 Ong/ ⁇ l with TE. Driver DNA was digested with
• Amplification Amplification of subtracted DNA in a final volume of 200 ⁇ l as follows: Buffer, nucleotides and 20 ⁇ l of the diluted DNA were added, heated to
• C6 glioma cells were grown under normal conditions (Normoxia) or under oxygen deprivation conditions (Hypoxia) for eight hours. The cells were then harvested and cytoplasmic extracts were applied onto sucrose gradients. RNA was extracted from the fractions obtained from the sucrose gradient and pooled into polysomal and non-polysomal samples. Following reverse transcription, the differential display technique was applied using the primers Tl and PIO as set forth in Table 2. The PCR products were separated on a 5% acrylamide sequencing gel. The gel was then dried and exposed to X-ray film. The results are shown in Figure
• A shows an mRNA species apparent only in a non-polysomal fraction of cells after eight hours of hypoxia. This represents a potentially transcriptionally induced mRNA species which was still translationally repressed but which could be actively transcribed after prolonged hypoxia.
• B represents an mRNA species found in the non-polysomal fraction of cells grown under normal oxygen levels which was transferred into the polysomal fraction following hypoxia.
• the experimental cells were grown under both normal temperature (37°C) and heat shock temperature (43 °C) for four hours. The cells were then harvested and cytoplasmic extracts were obtained and RNA extracted therefrom. Then, the extracted RNA was analyzed utilizing GEM technology as disclosed above.
• Tables 3 and 4 demonstrate the utility of utilizing polysomal probes versus total mRNA probes in differential expression analysis to identify genes which are differentially expressed in response to a stimulus such as heat shock.
• a stimulus such as heat shock.
• Tables illustrate that fibronectin, pyruvate kinase, protein disulfide isomerese, poly(ADPribose) polymerase, thymopoietin, 90Kd heat shock protein, acylamino acid-releasing enzyme, ⁇ -spectrin, and pyruvate kinase were all identified as being differentially expressed utilizing a polysomal probe whereas, with the exception of fibronectin, the other proteins were not identified as being differentially expressed when a total mRNA probe was utilized.
• This example demonstrates the utility of the present invention for identifying translationally or differentially regulated genes which are regulated by a stress inducing element. Additionally, in Table 3, the results of heat shock differential gene expression analysis with both polysomal probes and total mRNA probes is provided. Table 3 illustrates that a number of differentially expressed genes were identified using a polysomal probe whereas when a total mRNA probe was used, these genes were not necessarily identified as being differentially expressed. Table 4 statistically illustrates the number of differentially expressed genes identified utilizing either total mRNA or polysomal mRNA as a probe. Table 4 clearly illustrates that polysomal mRNA probes yielded between two and greater than ten fold increases in the number of differentially expressed genes versus total mRNA probes.
• HEK-293 human (ATCC CRL-1573) cells were used as a model system for Polio virus 2A protease induced expression, since preliminary study indicated that 2 A protease enhances expression of IRES containing genes in this cell line.
• HEK-293 cells were co-transfected with CMV-LacI - (constructed by applicant using techniques known to those skilled in the art) in combination with either one of the Polio virus 2 A protease expression vectors PTK-OP3-WT2A, miniTK-WT2A, on PCIbb-LacI-Hyg (constructed by applicant on basis of vectors from Stratagene) as shown in Figures 3A-C, respectively.
• the Lad expression vector contained a hygromycin selectable marker
• the Polio virus 2A protease expression vector contained a neomycin selectable marker which enabled the isolation of clones resistant to both markers, presumably expressing both Lad repressor and Polio virus 2A proteins.
• Polio virus 2A protease expression Death assay - Resistant clones which grew after selection on hygromycin
• PCR is a very sensitive method, and was used to monitor the induction of the mRNA encoding for Polio virus 2A protease in HEK-293miniTK#l clones following IPTG treatment.
• mRNA was prepared from HEK-293 parental cells and HEK-293miniTK-2A clones following treatment with IPTG at different time points. The RNAs were subjected to the RT-PCR reaction using Polio virus 2A protease specific oligonucleotides:
• Polio virus 2A protease mRNA was not detected in HEK-293 parental cells, however it was induced following IPTG treatment and reached its highest level after 48 hours of IPTG treatment as shown in Figure 5.
• Analysis of 2 A protease activity p220 cleavage - A well characterized function of Polio virus 2A protease is the cleavage of the p220 protein (4F ⁇ translational factor), a component of the 40S ribosomal subunit. Cleavage of p220 yields three N-terminal cleavage products of 100-120KDa molecular weight due to post-translational modification.
• FIG. 6 demonstrates such an analysis in which HEK-293 miniTK2A#l clone and HEK-293TK2A#14 clone were induced for Polio virus 2A protease expression to generate cleavage products of p220.
• HEK-293 cell lysate was treated with Polio virus 2A protease produced by in vitro translation, and was found to generate identical cleavage products with the same mobility on 7% SDS PAGE as in the HEK-293 2A clones.
• MOLECULE TYPE other nucleic acid
• MOLECULE TYPE other nucleic acid
• MOLECULE TYPE other nucleic acid
• MOLECULE TYPE other nucleic acid
• MOLECULE TYPE other nucleic acid
• MOLECULE TYPE other nucleic acid
• MOLECULE TYPE other nucleic acid
• MOLECULE TYPE other nucleic acid
• MOLECULE TYPE other nucleic acid
• MOLECULE TYPE other nucleic acid
• MOLECULE TYPE other nucleic acid
• MOLECULE TYPE other nucleic acid
• MOLECULE TYPE other nucleic acid
• MOLECULE TYPE other nucleic acid
• MOLECULE TYPE other nucleic acid
• MOLECULE TYPE other nucleic acid
• MOLECULE TYPE other nucleic acid
• MOLECULE TYPE other nucleic acid
• MOLECULE TYPE other nucleic acid
• MOLECULE TYPE other nucleic acid
• MOLECULE TYPE other nucleic acid
• MOLECULE TYPE other nucleic acid
• MOLECULE TYPE other nucleic acid
• MOLECULE TYPE other nucleic acid
• MOLECULE TYPE other nucleic acid
• MOLECULE TYPE other nucleic acid
• MOLECULE TYPE other nucleic acid

Landscapes

• Chemical & Material Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Health & Medical Sciences (AREA)
• Organic Chemistry (AREA)
• Genetics & Genomics (AREA)
• Engineering & Computer Science (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• General Engineering & Computer Science (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Biotechnology (AREA)
• Molecular Biology (AREA)
• Biochemistry (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Biomedical Technology (AREA)
• Microbiology (AREA)
• Physics & Mathematics (AREA)
• Analytical Chemistry (AREA)
• Biophysics (AREA)
• General Health & Medical Sciences (AREA)
• Bioinformatics & Computational Biology (AREA)
• Crystallography & Structural Chemistry (AREA)
• Plant Pathology (AREA)
• Immunology (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Applications Claiming Priority (5)

Publications (1)

Family

ID=27114885

Family Applications (1)

Country Status (6)

Families Citing this family (18)

Family Cites Families (1)

• 1997
  • 1997-11-12 EP EP97947522A patent/EP0942969A1/de not_active Withdrawn
  • 1997-11-12 IL IL12987297A patent/IL129872A0/xx active IP Right Revival
  • 1997-11-12 AU AU52580/98A patent/AU5258098A/en not_active Abandoned
  • 1997-11-12 CA CA002271068A patent/CA2271068A1/en not_active Abandoned
  • 1997-11-12 JP JP52285498A patent/JP2002515754A/ja active Pending
  • 1997-11-12 WO PCT/US1997/020831 patent/WO1998021321A1/en not_active Application Discontinuation
• 1999
  • 1999-05-10 IL IL129872A patent/IL129872A/en not_active IP Right Cessation

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events