EP0815200B1 - Cellule hote exprimant des niveaux reduits de metalloprotease, et procedes relatifs a l'utilisation de cette cellule en fabrication des proteines - Google Patents

Cellule hote exprimant des niveaux reduits de metalloprotease, et procedes relatifs a l'utilisation de cette cellule en fabrication des proteines Download PDF

Info

Publication number
EP0815200B1
EP0815200B1 EP96905768A EP96905768A EP0815200B1 EP 0815200 B1 EP0815200 B1 EP 0815200B1 EP 96905768 A EP96905768 A EP 96905768A EP 96905768 A EP96905768 A EP 96905768A EP 0815200 B1 EP0815200 B1 EP 0815200B1
Authority
EP
European Patent Office
Prior art keywords
host cell
aspergillus
enzyme
metalloprotease
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
EP96905768A
Other languages
German (de)
English (en)
Other versions
EP0815200A1 (fr
Inventor
Jan Lehmbeck
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novozymes AS
Original Assignee
Novozymes AS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novozymes AS filed Critical Novozymes AS
Publication of EP0815200A1 publication Critical patent/EP0815200A1/fr
Application granted granted Critical
Publication of EP0815200B1 publication Critical patent/EP0815200B1/fr
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6478—Aspartic endopeptidases (3.4.23)
    • C12N9/6483—Chymosin (3.4.23.4), i.e. rennin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/58—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from fungi
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/58—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from fungi
    • C12N9/62—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from fungi from Aspergillus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/23—Aspartic endopeptidases (3.4.23)
    • C12Y304/23004—Chymosin (3.4.23.4), i.e. rennin

Definitions

  • the present invention relates to novel host cells and to methods of producing proteins. More specifically the invention relates to an Aspergillus host cell useful for the expression of heterologous proteins. Moreover the invention relates to a method of producing a heterologous protein, which method comprises cultivating the host cell in a suitable growth medium, followed by recovery of the desired protein.
  • Metalloproteases have been isolated from a number of eucaryotic sources. Neutral metalloproteases, i.e. metalloproteases having optimal activity at neutral pH, isolated from strains of Aspergillus also have been reported. Neutral metalloproteases have been classified into two groups. Npl and Npll [ Sekine; Agric. Biol. Chem. 1972 36 207-216].
  • nucleotide sequence of a neutral metalloprotease II cDNA from Aspergillus oryzae have been disclosed [ Tatsumi H, Murakaml S, Tsuji R F, Ishida Y, Murakami K, Masaki A, Kawabe H, Arimura H, Nakano E and Motai H; Mol. Gen. Genet. 1991 228 97-103]-
  • the nucleotide sequence of a neutral metalloprotease I cDNA from Aspergillus oryzae have never been disclosed.
  • Aspergillus neutral metalloproteases may reduce significantly the stability of the product obtained by a cell.
  • the present invention provides an Aspergillus host cell useful for the expression of a heterologous protein product, which cell has been genetically modified in order to express significantly reduced levels of an metalloprotease, NpII, having optimal proteolytic activity in the range of pH 6-8, as compared to the parental cell.
  • NpII metalloprotease
  • the invention provides a method of producing a heterologous protein product in a host cell of the invention, which method comprises introducing into the host cell a nucleic acid sequence encoding the protein, cultivating the host cell in a suitable growth medium, and isolating the heterologous protein product.
  • the proteolytic action arising from NpII metalloprotease NpII have been significantly reduced, thereby improving the stability of the protein obtained by the method.
  • the protein obtained by the method of the invention can be obtained as a precursor protein, i.e. a zymogen, a hybrid protein, a protein obtained as a pro sequence or pre-pro sequence, or in unmaturated form.
  • the present invention provides an Aspergillus host cell useful for the expression of heterologous proteins, which cell, when compared to the parental cell, has been genetically modified in order to express significantly reduced levels of an Aspergillus neutral metalloprotease, NpII, having optimal proteolytic activity in the range of pH 6-8.
  • NpII Aspergillus neutral metalloprotease
  • the parental cell is the source of said host cell. It may be a wild-type cell. Alternatively, besides a decrease in neutral metalloprotease level, it may be genetically altered in another respect.
  • the host cell of the invention In order to produce the desired protein, the host cell of the invention obviously must hold structural (i.e. regions comprising the coding nucleotide sequences) and regulatory (i.e. regions comprising nucleotide sequences necessary for e.g. transcription, translation and termination) genetic regions necessary for the expression of the desired product.
  • structural and regulatory regions greatly depends on the product and the host cell in question.
  • the genetic design of the host cell of the invention may be accomplished by the person skilled in the art, using standard recombinant DNA technology for the transformation or transfection of a host cell [vide e.g. Sambrook et al.; Molecular Cloning, Cold Spring Harbor. NY, 1989].
  • the host cell is modified by methods known in the art for introduction of an appropriate cloning vehicle, i.e. a plasmid or a vector, comprising a DNA fragment encoding the desired product.
  • an appropriate cloning vehicle i.e. a plasmid or a vector, comprising a DNA fragment encoding the desired product.
  • the cloning vehicle may be introduced into the host cell either as an autonomously replicating plasmid or integrated into the chromosome.
  • the cloning vehicle comprises one or more structural regions operably linked to one or more appropriate regulatory regions.
  • the structural regions are regions holding nucleotide sequences encoding the desired product.
  • the regulatory regions include promoter regions comprising transcription and translation control sequences, terminator regions comprising stop signals, and polyadenylation regions.
  • the promoter i.e. a nucleotide sequence exhibiting a transcriptional activity in the host cell of choice, may be one derived from a gene encoding an extracellular or an intracellular protein, preferably an enzyme, such as an amylase, a glucoamylase, a protease, a lipase, a cellulase, a xylanase, a oxidoreductase, a pectinase, a cutinase, or a glycolytic enzyme.
  • promotors for transcription in a fungal host cell are promotors derived from the gene encoding Aspergillus oryzae TAKA amylase, Aspergillus niger neutral ⁇ -amylase, Aspergillus niger acid stable ⁇ -amylase, Aspergillus niger or Aspergillus awamsii glucoamylase (gluA).
  • the cloning vehicle may also comprise a selectable marker, e.g- a gene, the product of which complements a defect in the host cell, or one which confers antibiotic resistance, such as ampicillin, kanamycin, chloramphenicol or tetracycline resistance.
  • a selectable marker e.g- a gene, the product of which complements a defect in the host cell, or one which confers antibiotic resistance, such as ampicillin, kanamycin, chloramphenicol or tetracycline resistance.
  • Aspergillus selection markers include amdS, pyrG, argB, niaD and sC , a marker giving rise to hygromycin resistance.
  • Preferred for use in an Aspergillus host cell are the amdS and pyrG markers of Aspergillus nidulans or Aspergillus oryzae .
  • a frequently used mammalian marker is the dihydrofolate reductase (DHFR) gene
  • the host cell of the invention may be any Aspergillus host cell conventionally used for heterologous expression of proteins.
  • the Aspergillus fungus is a strain selected from the group consisting of Aspergillus oryzae, Aspergillus niger, Aspergillus nidulans, Aspergillus awamori, Aspergillus phoenicis, Aspergillus japonicus, Aspergillus foetus.
  • the desired end product i.e. the heterologous protein expressed by the host cell of the invention, may be any eubacterial or eucaryotic protein.
  • a "heterologous protein product” is a protein which is not native to the host cell, or a native protein in which modifications have been made to alter the native sequence, or a native protein whose expression is quantitatively altered as a result of a manipulation of a native regulatory sequence required for the expression of the native protein, such as a promoter, a ribosome binding site, etc., or other manipulation of the host cell by recombinant DNA techniques.
  • the heterologous protein expressed by the host cell may also be a precursor protein, i.e. a zymogen, a hybrid protein, a protein obtained as a pro sequence or pre-pro sequence, or in unmaturated form.
  • the product is an enzyme.
  • the product is an eucaryotic enzyme, such as insulin, growth hormone, glucagon, somatostatin, interferon, PDGF, factor VII, factor VIII, urokinase, EPO, chymosin, tissue plasminogen activator, or serum albumin.
  • eucaryotic enzyme such as insulin, growth hormone, glucagon, somatostatin, interferon, PDGF, factor VII, factor VIII, urokinase, EPO, chymosin, tissue plasminogen activator, or serum albumin.
  • the product is an enzyme of fungal, of yeast, or of bacterial origin.
  • the enzyme is a glycosidase enzyme, e-g- an amylase, in particular an ⁇ -amylase (EC 3.2.1.1), a ⁇ -amylase (EC 3.2.1.2), a glucan 1,4- ⁇ -glucosidase (EC 3.2.1.3), a cellulase (EC 3,2.1.4), an endo-1,3(4)- ⁇ -glucanase (EC 3.2.1,6), an endo-1,4- ⁇ -glucanase (EC 3.2.1.8), a polygalacturonase (EC 3,2.1.15), an ⁇ -glucosidase (EC 3.2.1.20), a ⁇ -glucosidase (EC 3.2.1.21), an ⁇ -galactosidase (EC 3.2.1.22), a ⁇ -galactosidase (EC 3.2.1.23), a xylan-endo-1,3- ⁇ -xylosidase (EC 3.2.1.32), an end
  • the enzyme is a lipolytic enzyme, in particular a lipase, an esterase, a phospholipase, or a lyso-phospholipase.
  • the enzyme is a phytase, in particular a 3-phytase (EC 3.1.3.8) or a 6-phytase (EC 3.1.3.26).
  • the enzyme is a proteolytic enzyme.
  • the enzyme is an oxidoreductase, such as a peroxidase or a laccase, a pectinase, or a cutinase.
  • Preferred hybrid polypeptides are prochymosin and pro-trypsin-like proteases.
  • a metalloprotease is a proteolytic enzyme containing a catalytic zinc metal center which participates in the hydrolysis of the peptide backbone.
  • the active zinc center differentiates these proteases from calpains, whose activities are dependent upon the presence of calcium. Confirmation of a protease as a metalloprotease is loss of proteolytic activity accomplished by removal of the zinc center.
  • the zinc center can be removed with 1,10-phenanthroline (1 mM). After titration with Zn 2+ (0.1-100 ⁇ M), proteolytic activity is restored.
  • the metalloprotease contemplated in the context of this invention is a neutral metalloprotease, which is a metalloprotease possessing optimal proteolytic activity in the neutral pH region, i.e. in the range of about pH 6-8, preferably the range of about pH 6.5-7.5, around pH 7.
  • the metalloprotease contemplated in the context of this invention is a neutral Aspergillus metalloprotease of group NpII.
  • the host cell of the invention genetically modified in order to express significantly reduced levels of a neutral metalloprotease, may be modified using standard recombinant DNA technology, known to the person skilled in the art.
  • the gene sequence responsible for the production of metalloprotease may be inactivated or eliminated entirely.
  • the host cell of the invention is one genetically modified at the structural or regulatory regions encoding the metalloprotease.
  • Known and useful techniques include, but are not limited to, specific or random mutagenesis, PCR generated mutagenesis, site specific DNA deletion, insertion and/or substitution, gene disruption or gene replacement techniques, anti-sense techniques, or a combination thereof.
  • Mutagenesis may be performed using a suitable physical or chemical mutagenizing agent.
  • a physical or chemical mutagenizing agent suitable for the present purpose includes ultraviolet (UV) irradiation, hydroxylamine, N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), O-methyl hydroxylamine, nitrous acid, ethyl methane sulphonate (EMS), sodium bisulfite, formic acid, and nucleotide analogues.
  • UV ultraviolet
  • MNNG N-methyl-N'-nitro-N-nitrosoguanidine
  • EMS ethyl methane sulphonate
  • sodium bisulfite formic acid
  • nucleotide analogues ethyl methane sulphonate
  • Modification may also be accomplished by introduction, substitution or removal of one or more nucleotides in the metalloprotease encoding sequence or a regulatory element required for the transcription or translation thereof. Nucleotides may, e,g., be inserted or removed so as to result in the introduction of a stop codon, the removal of the start codon or a change of the open reading frame.
  • the modification or inactivation of the structural sequence or a regulatory element may be accomplished by site-directed mutagenesis or PCR generated mutagenesis in accordance with methods known in the art. Although in principle, the modification may be performed in vivo, i.e. directly on the cell carrying the metalloprotease gene, it is presently preferred to conduct the modification in vitro.
  • a convenient way to inactivate or reduce the metalloprotease production of a host cell of choice is based on the principles of gene interruption.
  • This method involves the use of a DNA sequence corresponding to the endogenous gene or gene fragment which it is desired to destroy. Said DNA sequence is in vitro mutated to a defective gene and transformed into the host cell. By homologous recombination, the defective gene replaces the endogenous gene or gene fragment. It may be desirable that the defective gene or gene fragment encodes a marker which may be used for selection of transformants in which gene encoding the metalloprotease has been modified or destroyed.
  • the modification or inactivation of the DNA sequence may be performed by use of established anti-sense techniques using a nucleotide sequence complementary to the metalloprotease encoding sequence.
  • the host cell of the invention expresses significantly reduced levels of metalloproteases.
  • the level of metalloprotease expressed by the host cell is reduced more than about 50%, preferably more than about 85%, more preferred more than about 90%, most preferred more than about 95%.
  • the product expressed by the host cell is essentially free of any metalloprotease activity.
  • the invention provides a method of producing proteins (i.e. polypeptides and/or proteins), which method comprises cultivating the host cell of the invention in a suitable growth medium, followed by recovery of the desired product.
  • proteins i.e. polypeptides and/or proteins
  • the proteolytic action of neutral metalloprotease, NpII has been significantly reduced, thereby improving the stability of the product obtained.
  • the heterologous protein expressed by the host cell may be obtained as a precursor protein, i.e. a zymogen, a hybrid protein, a protein obtained as a pro sequence or pre-pro sequence, or in unmaturated form.
  • the broth or medium used for culturing may be any conventional medium suitable for growing the host cell in question, and may be composed according to the principles of the prior art.
  • the medium preferably contain carbon and nitrogen sources and other inorganic salts.
  • Suitable media e.g. minimal or complex media, are available from commercial suppliers, or may be prepared according to published receipts, e.g. the American Type Culture Collection (ATCC) Catalogue of strains.
  • ATCC American Type Culture Collection
  • the protein is recovered by conventional method for isolation and purification proteins from a culture broth.
  • Well-known purification procedures include separating the cells from the medium by centrifugation or filtration, precipitating proteinaceous components of the medium by means of a salt such as ammonium sulphate, and chromatographic methods such as e.g. ion exchange chromatography, gel filtration chromatography, affinity chromatography, etc.
  • Aspergillus oryzae IFO 4177 available from Institute for Fermentation, Osaka, 17-25 Juso Hammachi 2-Chome Yodogawa-Ku, Osaka, Japan.
  • NpII which gene encodes Neutral Metalloprotease II.
  • pyrG which gene encodes orotidine-5'-phosphate decarboxylase, an enzyme involved in the biosynthesis of uridine.
  • pJaL218 Construction of this plasmid from pJaL218 is described in Example 2.
  • pToC90 A subclone of p3SR2.
  • a primer (CTAGGATCCAAGGCATTT ATGCGTGTCACTACTCTC ; SEQ ID NO: 7) was constructed so that the 3' end of the nucleotide sequence corresponds to the N-terminal part of the NpII gene (underlined), and the 5'-end is for facilitating cloning (contains a BamHI restriction endonuclease site).
  • a primer (CTACTCGAG TTAGCACTTGAGCTCGATAGC; SEQ ID NO: 8) was constructed so that the 3' end of the nucleotide sequence corresponds to the C.terminal part of the NpII gene (underlined), and the 5'-end is for facilitating cloning (contains a XhoI restriction endonuclease site).
  • Genomic DNA from Aspergillus oryzae IFO 4177 was used as template in the PCR reaction.
  • Amplification reaction was performed in 100 ⁇ l volumes containing 2.5 units Taq-polymerase, 100 ng of Aspergillus oryzae genomic DNA, 50 mM KCl, 10 mM Tris-HCl pH 8.0, 1.5 mM MgCl 2 , 250 nM of each dNTP, and 100 pM of each of the two primers described above.
  • Amplification was carried out in a Perkin-Elmer Cetus DNA Termal 480, and consisted of one cycle of 3 minutes at 94°C, followed by 25 cycles of 1 minutes at 94°C, 30 seconds at 55°C, and 1 minutes at 72°C.
  • the PCR reaction produces one DNA fragment of approx. 1.1 kb in length. This fragment was isolated by gel electrophoresis, purified, cloned into the vector pCR TM II (Invitrogen Corporation), and sequenced using standard methods known in the art of molecular biology. The resulting plasmid was called pJaL 198.
  • the Aspergillus oryzae pyrG gene was cloned by cross hybridization with the Aspergillus niger pyrG gene [ W. van Hartingsveldt et al.: Mol, Gen. Genet. 1987 206 71-75].
  • a lambda library of partial SaulllA digested Aspergillus oryzae IFO 4177 DNA was probed at low stringency with a 1 kb DNA fragment from the Aspergillus niger pyrG gene.
  • DNA from a positive clone was subcloned into a pUC118 vector.
  • the resultant plasmid, pS02 was shown to contain the pyrG gene by complementation of an Aspergillus niger pyrG - mutant, cf. Fig. 1.
  • the strain Aspergillus oryzae IFO 4177 was transformed with this construct, and transformants were selected by resistance to 5-fluoro-orotic acid, a phenotype characteristic of pyrG mutants.
  • One transformant. HowB101 was shown by Southern analysis to have the expected deletion at the pyrG locus. Being a pyrG mutant. HowB101 requires uridine for growth. HowB101 can be transformed with the wt pyrG gene by selection for ability to grow without uridine.
  • Plasmid pJaL198 is digested with BstEII and treated with Klenow polymerase to make the ends blunt.
  • the 4.9 kb fragment was isolated by gel electrophoresis and purified. This DNA fragment was then treated with bacterial alkaline phosphatase to remove the 5' phosphate groups, according to the manufacturers instructions, phenol extracted and precipitated.
  • Plasmid pJers4 was digested with HindIII and treated with Klenow polymerase to make the ends blunt.
  • the 1.8 kb fragment encoding the Aspergillus oryzae pyrG gene was isolated by gel electrophoresis and purified.
  • pJaL218 consists of the pCR TM II vector containing a fragment which carries the Npll gene flanked by EcoRI sites, in which the central BstEII fragment has been replaced by a 1.8 kb DNA fragment encoding the Aspergillus oryzae pyrG gene.
  • Aspergillus oryzae HowB101 host strain was performed by the protoplast method [ Christensen et al. : Biotechnology 1988 6 1419-1422].
  • Aspergillus oryzae mycelia was grown in a rich nutrient broth. The mycelia was separated from the broth by filtration.
  • Novozyme TM (available from Novo Nordisk A/S, Denmark) was added to the mycelia in an osmotically stabilizing buffer, 1.2 M MgSO 4 , sodium phosphate buffer pH 5.0. The suspension was incubated for 60 minutes at 37°C with agitation. The protoplast was filtered through Miracloth to remove mycelial debris.
  • the protoplast was harvested and washed twice with STC (1.2 M sorbitol, 10 mM CaCl 2 , 10 mM Tris-HCl pH 7.5). The protoplast was finally resuspended in 200-1000 ⁇ l STC.
  • the primers used were CCCTTCTTTCCAAACCG (SEQ ID NO: 9), which is located 5' from the encoding region of the NpII gene, and pyrG-5' (GGGTGAGCCACTGCCTC; SEQ ID NO: 10), which is specific for the pyrG gene.
  • CCCTTCTTTCCAAACCG SEQ ID NO: 9
  • pyrG-5' GGGTGAGCCACTGCCTC; SEQ ID NO: 10
  • Aspergillus oryzae strain JaL121 was transformed with the plasmid pToC56 (cf. Fig. 4), which is a fungal expression plasmid for the mammalian enzyme chymosin, by co-transformation with pToC90.
  • plasmid pToC56 is described in EP 98 993 A.
  • Transformants were selected for growth on minimal medium containing 10 mM acetamide, and screened for the presence of pToC56 by the ability to produce chymosin.
  • a transformant was grown in shake flasks for 4 days at 30°C in a medium containing maltodextrin, soybean meal and peptone.
  • a transformant of pToC56 in Aspergillus oryzae IFO 4177 was grown together with the JaL121 transformant.

Claims (18)

  1. Cellule hôte Aspargillus utilisable pour l'expression d'un produit protéique hétérologue, ladite cellule ayant été modifiée génétiquement de manière à exprimer des niveaux significativement réduits d'une métalloprotéase neutre d'Aspergillus, NpII, ayant une activité protéolytique optimale dans la zone de pH 6-8, en comparaison à une cellule parente.
  2. Cellule hôte selon la revendication 1, qui est une souche choisie dans le groupe constitué de Aspergillus oryzae, Aspergillus niger, Aspergillus nidulans, Aspergillus awamori, Aspergillus phoenicis, Aspergillus japonicus, Aspergillus foetus.
  3. Cellule hôte selon l'une des revendications 1-2, ladite cellule ayant été modifiée génétiquement dans les régions structurales ou régulatrices codant la métalloprotéase.
  4. Cellule hôte selon la revendication 3, qui a été modifiée génétiquement par mutagénèse spécifique ou aléatoire ; mutagénèse générée par PCR ; délétion, insertion et/ou substitution d'ADN site-spécifique ; techniques de destruction de gène ou de remplacement de gène ; techniques anti-sens ; ou une combinaison de celles-ci.
  5. Cellule hôte selon l'une des revendications 1-4, le niveau de métalloprotéase exprimée dans ladite cellule étant réduit de plus de 50% environ, de préférence de plus de 85% environ, plus préférentiellement de plus de 90% environ ; tout préférentiellement de plus de 95% environ.
  6. Cellule hôte selon l'une des revendications 1-4, ladite cellule étant essentiellement dépourvue de toute activité métalloprotéase.
  7. Procédé pour produire un produit protéique hétérologue dans la cellule hôte de la revendication 1, ledit procédé comprenant :
    (a) l'introduction dans ladite cellule hôte d'une séquence d'acide nucléique codant ledit produit protéique ;
    (b) la culture, dans un milieu de croissance approprié, de la cellule hôte de l'étape (a) ; et
    (c) l'isolement dudit produit protéique hétérologue.
  8. Procédé selon la revendication 7, dans lequel la cellule hôte est une souche choisie dans le groupe constitué de Aspergillus oryzae, Aspergillus niger, Aspergillus nidulans, Aspergillus awamori, Aspergillus phoenicis, Aspergillus japonicus, Aspergillus foetus.
  9. Procédé selon l'une quelconque des revendications 7-8, dans lequel la cellule hôte a été modifiée génétiquement dans les régions structurales ou régulatrices codant la métalloprotéase.
  10. Procédé selon la revendication 9, dans lequel la cellule hôte a été modifiée génétiquement par mutagénèse spécifique ou aléatoire ; mutagénèse générée par PCR ; délétion, insertion et/ou substitution d'ADN site-spécifique ; techniques de destruction de gène ou de remplacement de gène ; techniques anti-sens ; ou une combinaison de celles-ci.
  11. Procédé selon l'une des revendications 7-10, dans lequel le niveau de métalloprotéase exprimée par la cellule hôte est réduit de plus de 50%, de préférence de plus de 85%, plus préférentiellement de plus de 90%; tout préférentiellement de plus de 95%.
  12. Procédé selon l'une des revendications 7-10, dans lequel le produit exprimé par la cellule hôte est essentiellement dépourvu de toute activité métalloprotéase.
  13. Procédé selon l'une des revendications 7-12, dans lequel le produit protéique est une enzyme eucaryote, telle que l'insuline, l'hormone de croissance, le glucagon, la somatostatine, l'interféron, le PDGF, le facteur VII, le facteur VIII, l'urokinase, l'EPO, la chymosine, l'activateur de plasminogène tissulaire, ou l'albumine sérique.
  14. Procédé selon l'une des revendications 7-13, dans lequel le produit protéique est une protéine d'origine fongique.
  15. Procédé selon la revendication 14, dans lequel le produit protéique est une enzyme fongique, en particulier une enzyme amylolytique, telle que une alpha-amylase, une beta-amylase, une glucoamylase, une beta-galactosidase, une enzyme cellulytique, une enzyme lipolytique, une enzyme xylanolytique, une enzyme protéolytique, une oxydoréductase, telle que une peroxydase ou une laccase, une pectinase ou une cutinase.
  16. Procédé selon l'une des revendications 7-15, dans lequel le produit protéique est une protéine bactérienne.
  17. Procédé selon la revendication 16, dans lequel le produit protéique est une enzyme bactérienne, en particulier une enzyme amylolytique, telle que une alpha-amylase, une beta-amylase, une glucoamylase, une beta-galactosidase, une enzyme cellulytique, une enzyme lipolytique, une enzyme xylanolytique, une enzyme protéolytique, une oxydoréductase, telle que une peroxydase ou une laccase, une pectinase ou une cutinase.
  18. Procédé selon l'une des revendications 7-17, dans lequel le produit protéique est une protéine précurseur, c'est-à-dire un zymogène, une protéine hybride, une protéine obtenue en tant que séquence pro ou séquence pré-pro, ou une forme non maturée.
EP96905768A 1995-03-20 1996-03-20 Cellule hote exprimant des niveaux reduits de metalloprotease, et procedes relatifs a l'utilisation de cette cellule en fabrication des proteines Expired - Lifetime EP0815200B1 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
DK28495 1995-03-20
DK28495 1995-03-20
PCT/DK1996/000111 WO1996029391A1 (fr) 1995-03-20 1996-03-20 Cellule hote exprimant des niveaux reduits de metalloprotease, et procedes relatifs a l'utilisation de cette cellule en fabrication des proteines

Publications (2)

Publication Number Publication Date
EP0815200A1 EP0815200A1 (fr) 1998-01-07
EP0815200B1 true EP0815200B1 (fr) 2007-02-14

Family

ID=8091831

Family Applications (1)

Application Number Title Priority Date Filing Date
EP96905768A Expired - Lifetime EP0815200B1 (fr) 1995-03-20 1996-03-20 Cellule hote exprimant des niveaux reduits de metalloprotease, et procedes relatifs a l'utilisation de cette cellule en fabrication des proteines

Country Status (10)

Country Link
US (2) US5861280A (fr)
EP (1) EP0815200B1 (fr)
JP (2) JP3974171B2 (fr)
CN (2) CN1225550C (fr)
AT (1) ATE353953T1 (fr)
AU (1) AU4940096A (fr)
DE (1) DE69636899T2 (fr)
DK (1) DK0815200T3 (fr)
ES (1) ES2281079T3 (fr)
WO (1) WO1996029391A1 (fr)

Families Citing this family (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5776730A (en) * 1995-12-15 1998-07-07 University Of Hawaii Neurospora hosts for the production of recombinant proteins, and methods for producing same
DE69734936T2 (de) * 1996-09-19 2006-08-24 Novozymes A/S Wirtszellen und methoden für die produktion von proteinen
US7883872B2 (en) 1996-10-10 2011-02-08 Dyadic International (Usa), Inc. Construction of highly efficient cellulase compositions for enzymatic hydrolysis of cellulose
US6015703A (en) * 1998-03-10 2000-01-18 Iogen Corporation Genetic constructs and genetically modified microbes for enhanced production of beta-glucosidase
AU4188099A (en) * 1998-05-15 1999-12-06 Novo Nordisk A/S Methods for producing polypeptides in filamentous fungal mutant cells
ES2237159T3 (es) 1998-10-06 2005-07-16 Mark Aaron Emalfarb Sistema de transformacion en el campo de los hongos micoticos filamentosos en chrysosporium.
AU6188599A (en) 1998-10-26 2000-05-15 Novozymes A/S Constructing and screening a dna library of interest in filamentous fungal cells
US7063962B2 (en) 2001-07-20 2006-06-20 Novozymes A/S DNA sequences for regulating transcription
WO2004027067A2 (fr) * 2002-09-20 2004-04-01 Cym1P A/S Procedes pour augmenter la production d'un polypeptide recombinant a partir d'une cellule hote
US7169881B2 (en) * 2004-10-29 2007-01-30 Clariant (France) Aminoplast resin compositions
US8680252B2 (en) 2006-12-10 2014-03-25 Dyadic International (Usa), Inc. Expression and high-throughput screening of complex expressed DNA libraries in filamentous fungi
US9430042B2 (en) * 2006-12-27 2016-08-30 Immersion Corporation Virtual detents through vibrotactile feedback
US8551751B2 (en) 2007-09-07 2013-10-08 Dyadic International, Inc. BX11 enzymes having xylosidase activity
MX355226B (es) 2012-01-05 2018-03-23 Glykos Finland Oy Celulas de hongos filamentosas deficientes de proteasa y metodos de uso de las mismas.
EP2852610B1 (fr) 2012-05-23 2018-07-11 Glykos Finland Oy Production de glycoprotéines fucosylées
KR20160035587A (ko) 2013-07-10 2016-03-31 노파르티스 아게 복수개의 프로테아제 결핍 사상형 진균 세포들 및 그의 이용방법
CN104711200B (zh) * 2013-12-12 2018-01-16 青岛蔚蓝生物集团有限公司 一种中性蛋白酶生产菌株及其应用
CN104711242B (zh) * 2013-12-12 2017-11-10 青岛蔚蓝生物集团有限公司 一种中性蛋白酶及其应用
US10513724B2 (en) 2014-07-21 2019-12-24 Glykos Finland Oy Production of glycoproteins with mammalian-like N-glycans in filamentous fungi
US20240052000A1 (en) 2020-12-15 2024-02-15 Novozymes A/S Mutated host cells with reduced cell motility on

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5179003A (en) * 1988-01-05 1993-01-12 Boehringer Mannheim Gmbh Process for the production of proteins or protein-containing gene products
AU614121B2 (en) * 1988-05-04 1991-08-22 Novartis Ag Improvements in the production of polypeptides
CA1333777C (fr) * 1988-07-01 1995-01-03 Randy M. Berka Champignons filamenteux deficients en proteinase aspartique
DE69232666T2 (de) * 1991-04-01 2003-03-20 Merck & Co Inc Gene, die die proteolytische aktivitaet von pichia beeinflussen und deren verwendung
IL102259A0 (en) * 1991-07-01 1993-01-14 Amgen Inc Isolation and characterization of a protease from streptomyces lividans

Also Published As

Publication number Publication date
JP2006204304A (ja) 2006-08-10
DE69636899T2 (de) 2007-10-31
ES2281079T3 (es) 2007-09-16
AU4940096A (en) 1996-10-08
ATE353953T1 (de) 2007-03-15
JP3974171B2 (ja) 2007-09-12
CN1179178A (zh) 1998-04-15
DK0815200T3 (da) 2007-06-11
JPH11502111A (ja) 1999-02-23
EP0815200A1 (fr) 1998-01-07
US5968774A (en) 1999-10-19
CN1225550C (zh) 2005-11-02
CN1769423A (zh) 2006-05-10
US5861280A (en) 1999-01-19
DE69636899D1 (de) 2007-03-29
WO1996029391A1 (fr) 1996-09-26

Similar Documents

Publication Publication Date Title
EP0815200B1 (fr) Cellule hote exprimant des niveaux reduits de metalloprotease, et procedes relatifs a l'utilisation de cette cellule en fabrication des proteines
US6291209B1 (en) Alkaline protease deficient filamentaous fungi
US6352841B1 (en) Host cells and methods of producing proteins
EP0770139B1 (fr) CHAMPIGNON DANS LEQUEL ON A MODIFIE LE GENE areA ET GENE areA PROVENANT DE L'ASPERGILLUS ORYZAE
US7858360B2 (en) Use of fungal mutants for expression of antibodies
US9593342B2 (en) Methods for producing polypeptides in enzyme-deficient mutants of Fusarium venentatum
US6103490A (en) Heterologous polypeptides expressed in filamentous fungi, processes for making same, and vectors for making same
JP2002539793A (ja) 菌類細胞中で遺伝子を発現させるためのプロモーター
JP2007267752A (ja) ａｒｅＡ，ｐｅｐＣ及び／又はｐｅｐＥ遺伝子及びプロテアーゼ
Zheng et al. Construction of a low-serine-type-carboxypeptidase-producing mutant of Aspergillus oryzae by the expression of antisense RNA and its use as a host for heterologous protein secretion
AU678019B2 (en) Processes for producing an enzyme
JP2002515252A (ja) 糸状菌変異体細胞においてポリペプチドを生産するための方法
EP2652138B1 (fr) Promoteurs destines a l'expression de genes dans une cellule de champignon
AU782116B2 (en) Novel means of transformation of fungi and their use for heterologous protein production
JPH0823984A (ja) 発現系、組込みベクター及びその組込みベクターによって形質転換された細胞
JP2000513223A (ja) 真菌中で発現される異種遺伝子中の陰性スプライス部位の変更

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19971020

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LI LU NL PT SE

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: NOVOZYMES A/S

17Q First examination report despatched

Effective date: 20020628

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

GRAS Grant fee paid

Free format text: ORIGINAL CODE: EPIDOSNIGR3

GRAA (expected) grant

Free format text: ORIGINAL CODE: 0009210

AK Designated contracting states

Kind code of ref document: B1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LI LU NL PT SE

REG Reference to a national code

Ref country code: GB

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: CH

Ref legal event code: EP

REF Corresponds to:

Ref document number: 69636899

Country of ref document: DE

Date of ref document: 20070329

Kind code of ref document: P

REG Reference to a national code

Ref country code: IE

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: GR

Ref legal event code: EP

Ref document number: 20070401287

Country of ref document: GR

REG Reference to a national code

Ref country code: SE

Ref legal event code: TRGR

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: PT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20070716

ET Fr: translation filed
REG Reference to a national code

Ref country code: ES

Ref legal event code: FG2A

Ref document number: 2281079

Country of ref document: ES

Kind code of ref document: T3

PLBE No opposition filed within time limit

Free format text: ORIGINAL CODE: 0009261

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: NO OPPOSITION FILED WITHIN TIME LIMIT

26N No opposition filed

Effective date: 20071115

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: LU

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20070320

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: IT

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20100320

PGRI Patent reinstated in contracting state [announced from national office to epo]

Ref country code: IT

Effective date: 20110616

REG Reference to a national code

Ref country code: FR

Ref legal event code: PLFP

Year of fee payment: 20

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: DK

Payment date: 20150330

Year of fee payment: 20

Ref country code: CH

Payment date: 20150313

Year of fee payment: 20

Ref country code: FI

Payment date: 20150311

Year of fee payment: 20

Ref country code: DE

Payment date: 20150317

Year of fee payment: 20

Ref country code: IT

Payment date: 20150226

Year of fee payment: 20

Ref country code: IE

Payment date: 20150309

Year of fee payment: 20

Ref country code: NL

Payment date: 20150309

Year of fee payment: 20

Ref country code: ES

Payment date: 20150212

Year of fee payment: 20

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: SE

Payment date: 20150311

Year of fee payment: 20

Ref country code: FR

Payment date: 20150309

Year of fee payment: 20

Ref country code: GB

Payment date: 20150318

Year of fee payment: 20

Ref country code: AT

Payment date: 20150225

Year of fee payment: 20

Ref country code: GR

Payment date: 20150211

Year of fee payment: 20

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: BE

Payment date: 20150311

Year of fee payment: 20

REG Reference to a national code

Ref country code: DE

Ref legal event code: R071

Ref document number: 69636899

Country of ref document: DE

REG Reference to a national code

Ref country code: DK

Ref legal event code: EUP

Effective date: 20160320

REG Reference to a national code

Ref country code: NL

Ref legal event code: MK

Effective date: 20160319

REG Reference to a national code

Ref country code: CH

Ref legal event code: PL

REG Reference to a national code

Ref country code: GB

Ref legal event code: PE20

Expiry date: 20160319

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: GB

Free format text: LAPSE BECAUSE OF EXPIRATION OF PROTECTION

Effective date: 20160319

REG Reference to a national code

Ref country code: SE

Ref legal event code: EUG

REG Reference to a national code

Ref country code: IE

Ref legal event code: MK9A

REG Reference to a national code

Ref country code: AT

Ref legal event code: MK07

Ref document number: 353953

Country of ref document: AT

Kind code of ref document: T

Effective date: 20160320

REG Reference to a national code

Ref country code: GR

Ref legal event code: MA

Ref document number: 20070401287

Country of ref document: GR

Effective date: 20160321

REG Reference to a national code

Ref country code: ES

Ref legal event code: FD2A

Effective date: 20160627

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: ES

Free format text: LAPSE BECAUSE OF EXPIRATION OF PROTECTION

Effective date: 20160321

Ref country code: IE

Free format text: LAPSE BECAUSE OF EXPIRATION OF PROTECTION

Effective date: 20160320