EP0769050A1 - Nicht-glykosylierte plasminogenaktivator-derivate und ihre verwendung bei erhöhtem blutungsrisiko - Google Patents
Nicht-glykosylierte plasminogenaktivator-derivate und ihre verwendung bei erhöhtem blutungsrisikoInfo
- Publication number
- EP0769050A1 EP0769050A1 EP95924298A EP95924298A EP0769050A1 EP 0769050 A1 EP0769050 A1 EP 0769050A1 EP 95924298 A EP95924298 A EP 95924298A EP 95924298 A EP95924298 A EP 95924298A EP 0769050 A1 EP0769050 A1 EP 0769050A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- plasminogen activator
- tissue plasminogen
- derivative
- derivative according
- inhibitor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
- C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
- C12N9/6424—Serine endopeptidases (3.4.21)
- C12N9/6456—Plasminogen activators
- C12N9/6459—Plasminogen activators t-plasminogen activator (3.4.21.68), i.e. tPA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
- C12Y304/21—Serine endopeptidases (3.4.21)
- C12Y304/21069—Protein C activated (3.4.21.69)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- Non-glycosylated plasminogen activator derivatives and their use when there is an increased risk of bleeding
- the invention relates to new plasminogen activator derivatives, their production and use of therapeutic agents for the treatment of thromboembolic disorders with an increased risk of bleeding.
- the invention also relates to processes for the production of these variants and pharmaceutical compositions which contain these variants.
- Tissue plasminogen activator is a multi-domain serine protease that catalyzes the conversion of plasminogen to plasmin and is used for fibrinolytic therapy.
- fibrinolysis is regulated in part by the interaction between t-PA and plasminogen activator inhibitor 1 (PAI-1, a serine protease inhibitor from the Se family).
- PAI-1 plasminogen activator inhibitor 1
- the binding of PAI-1 to t-PA takes place essentially via amino acids 296-302.
- a mutation in this region reduces the inhibitory influence of PAI-1 on t-PA (EL Madison et al. (1990) (S).
- S plasminogen activator inhibitor
- the mechanism of the interaction between the amino acid region 296-302 of t-PA with PAI-1 has been extensively investigated (cf.
- tPA variants the use of which results in a reduced bleeding frequency, are described in WO 93/24635 (11) and by BA Keyt et al., Proc. Natl. Acad. Be. USA 91 (1994) 3670-3674 (31). These t-PA variants have an additional glycosylation site at amino acid positions 103-105. In addition, these t-PA variants can have a modification on amino acids 296-302, which increases the fibrin specificity. The object of the present invention was to provide further t-PA derivatives which show reduced bleeding complications when used.
- the object of the invention is achieved by a non-glycosylated tissue plasminogen activator derivative which contains the essential parts of at least one Kringledomain and a B-chain of t-PA, characterized in that the amino acids 296 - 299 (Lys-His-Arg -Arg (SEQ ID NO: 2)) are each exchanged for the sequence Ala-Ala-Ala-Ala (SEQ ID NO: 3).
- the derivative according to the invention preferably additionally contains N-terminal at least one amino acid from the sequence Gly Ala Arg Ser Thr Gin Val Ile (amino acids -3 - +5 of the tPA sequence, SEQ ID NO: 4).
- the derivative according to the invention particularly preferably contains the amino acids +1 to +3 of the tPA sequence (Ser Thr Gin) at the N-terminal.
- plasminogen activators are far less active in vitro than unmodified derivatives or wild-type plasminogen activators. Surprisingly, however, the use of the plasminogen activator variants according to the invention shows a significantly reduced risk of bleeding and an increased in vivo activity.
- Unmodified t-PA in its form found in plasma, consists of 527 amino acids and can be split into two chains by plasmin, which are then held together by a disulfide bridge.
- the A chain also called heavy chain
- the finger domain (amino acids 1-49) shows certain similarities with the finger structures in fibronectin.
- the growth factor domain (amino acids 50-86) is to a certain extent homologous to murine and human epidermal growth factors.
- the two Kringled domains (amino acids 87-175 and 176-262) are largely homologous to the fourth and fifth Kringledomain of plasminogen.
- the finger and kringle 2 domains of t-PA are particularly involved in fibrin binding and in the stimulation of proteolytic activity by fibrin.
- the B chain of t-PA (amino acids 276-527) is a serine protease and largely homologous to the B chains of urokinase and plasmin (TJR Harris (1987) (1) and J. Krause (1988) (2) ).
- the essential parts of the domains are to be understood as the amino acid ranges which are necessary for the biological activity of the plasminogen activator. This is preferably at least 80%, particularly preferably at least 90%, of the domains mentioned.
- the finger and / or the growth factor domain are preferably deleted in the plasminogen activator derivatives according to the invention.
- the Kringled domains are either both preserved, only one domain is obtained (preferably the K2 domain ne) or one of the domains (preferably Kj or K2) is present multiple times (preferably doubled).
- the t-PA variants according to the invention can be produced by the methods familiar to the person skilled in the art.
- the compounds according to the invention are preferably produced by genetic engineering. Such a method is described, for example, in WO 90/09437 (25), EP-A 0 297 066 (26), EP-A 0 302 456 (27), EP-A 0 245 100 (28) and EP-A 0 400 545 (29), which are the subject of the disclosure for such manufacturing processes.
- the mutations at position 296-299 are then introduced into the cDNA of t-PA or a derivative thereof by "oligonucleotide-directed site-specific mutagenesis".
- the "site-specific mutagenesis” is, for example, by Zoller and Smith (1984) (12), modified from T.A. Kunkel (1985) (13)) and Morinaga et al. (1984) (19).
- the method of PCR mutagenesis which is described, for example, in Ausubel et al. (1991) (30).
- nucleic acid sequence of the protein according to the invention can additionally be modified. Such modifications are, for example:
- the nucleic acid obtained in this way is used to express the t-PA derivative according to the invention if it is present on an expression vector suitable for the host cell used.
- non-glycosylated t-PA derivatives according to the invention are produced either in eukaryotic host cells, the glycosylated product initially obtained being obtained by Methods familiar to the person skilled in the art must be deglycosylated, or preferably by expression in non-glycosylating host cells, particularly preferably in prokaryonic host cells.
- E. coli, Streptomyces spec. are prokaryotic host organisms. or Bacillus subtilis.
- the prokaryotic cells are fermented in a customary manner and, after the bacteria have been digested, the protein is isolated in a customary manner. If the protein is obtained in inactive form (inclusion bodies), it is solubilized and naturalized according to the methods familiar to the person skilled in the art. It is likewise possible, according to the methods familiar to the person skilled in the art, to secrete the protein as active protein from the microorganisms.
- An expression vector which is suitable for this purpose preferably contains a signal sequence which is suitable for the secretion of proteins in the host cells used, and the Nucleic acid sequence which codes for the protein.
- the protein expressed with this vector is secreted either into the medium (for gram-positive bacteria) or into the periplasmic space (for gram-negative bacteria).
- a sequence coding for a cleavage site which allows the protein to be split off either during processing or by treatment with a protease.
- the selection of the base vector into which the nucleic acid (preferably DNA) coding for the t-PA derivative according to the invention is introduced depends on the host cells used later for expression. Suitable plasmids and the minimum requirements placed on such a plasmid (e.g. origin of replication, restriction sites) are known to the person skilled in the art. In the context of the invention, a cosmid, the replicative double-stranded form of phage ( ⁇ , Ml 3) or other vectors known to the person skilled in the art can also be used instead of a plasmid.
- the t-PA derivatives according to the invention are preferably purified in the presence of L-arginine, in particular at an arginine concentration of 10-1000 mmol 1.
- Foreign proteins are preferably separated off by affinity chromatography and particularly preferably by means of an adsorber column on which ETI (Erythrina Trypsin Inhibitor) is immobilized.
- Sepharose® for example, is used as the carrier material.
- Cleaning via an ETI adsorber column has the advantage that the ETI adsorber column material can be loaded directly from the concentrated renaturation batch even in the presence of arginine concentrations as high as 0.8 mol / 1 arginine.
- the plasminogen activators according to the invention are preferably purified via an ETI adsorber column in the presence of 0.6-0.8 mol / 1 arginine.
- the solution used here preferably has a pH of over 7, particularly preferably between 7.5 and 8.6.
- the elution of the t-PA derivatives according to the invention from the ETI column is carried out by lowering the pH both in the presence and in the absence of arginine under conditions in which the tPA derivatives according to the invention are readily soluble.
- the pH is preferably in the acidic range, particularly preferably between pH 4.0 and 5.5.
- the t-PA variants according to the invention can be formulated for the production of therapeutic agents in a manner familiar to those skilled in the art, the compounds according to the invention usually being combined with a pharmaceutically acceptable carrier.
- Such compositions typically contain an effective amount of 0.1-7 mg / kg, preferably 0.3-7 mg / kg, particularly preferably 0.7-5 mg / kg body weight as a dose. A dose of 1-3 mg / kg proved to be particularly suitable.
- the therapeutic compositions are usually in the form of sterile, aqueous solutions or sterile, soluble dry formulations such as lyophilisates.
- the compositions usually contain a suitable amount of a pharmaceutically acceptable salt used to prepare an isotonic solution.
- Buffers such as arginine buffers and phosphate buffers can also be used to stabilize a suitable pH (preferably 5.5-8.0, particularly preferably 5.5-7.5).
- the amount of the dosage of the compounds according to the invention can be readily determined by any person skilled in the art. It depends, for example, on the type of application (infusion or bolus) and the duration of the therapy. Because of their longer half-life, the compounds according to the invention are particularly suitable for a bolus application (single bolus, multiple bolus).
- a suitable form for a bolus application is, for example, an ampoule which contains 5-1000 mg, preferably 25-1000 mg, of the compound according to the invention, arginine and buffer.
- the compounds according to the invention are preferably used as a multiple bolus. Suitable time intervals are between 20 and 180 minutes, an interval between 30 and 90 minutes is particularly preferred and an interval between 30 and 60 minutes is particularly preferred.
- the compounds according to the invention are particularly suitable for the treatment of all thromboembolic diseases, such as e.g. acute heart attack, cerebral infarction, pulmonary embolism, deep leg vein thrombosis, acute arterial occlusion, etc.
- the compounds according to the invention are used with particular preference for the treatment of subchronic thromboembolic diseases in which prolonged thrombolysis has to be carried out.
- the compounds of the invention in combination with an anticoagulant such as. B. heparin or hirudin and / or an inhibitor of platelet aggregation, whereby the vascular opening effect is increased with minor side effects.
- an anticoagulant such as. B. heparin or hirudin and / or an inhibitor of platelet aggregation, whereby the vascular opening effect is increased with minor side effects.
- Figure 3 shows the inhibition of CHO-tPA (curve I), r-PA (curve II) and r-PA
- the starting plasmid pA27fd contains the following components: tac promoter, lac operator Region with an ATG start codon, the coding region for the t-PA derivative rPA, consisting of the N-terminal amino acids +1 to +3 of tPA, the Kringle2 domain (K2) and the protease domain (P), and the fd transcription terminator; the starting vector is the plasmid pKK223-3, which is described in EP-A 0 382 174 (17).
- Fragment B Plasmid pA27fd is linearized with the restriction enzyme Pvul and also obtained preparatively after gel electrophoresis. The following oligonucleotide is synthesized for mutagenesis:
- fragment A, fragment B (450 fmol each) and the oligonucleotide (75 pmol) are mixed and first in the presence of 50 mmol of 1 NaCl, 10 mmol / 1 Tris-HCl pH 7.5 and 10 mmol / l MgSÜ4 incubated for three minutes at 100 ° C and immediately transferred to ice. The DNA is renatured for 30 minutes at 60 ° C. The following is added to the heteroduplex for repair synthesis:
- E. coli (1989) (20) and EP-A 0 373 365 (22) (these publications being the subject of the disclosure) transformed into E. coli (for example C600 + , see EP-A 0 373 365 (22)).
- the transformants are selected by adding ampicillin and kanamycin (50 ⁇ g / ml each) to the nutrient medium.
- the plasmid obtained is designated pA27Ala. It differs from the starting plasmid in that the codons for the amino acids KHRR are replaced by AAAA and by an additional PvuII site at the mutagenesis site.
- the E. coli strain transformed with the plasmids pA27Ala and pUBS520 is incubated in LB medium (Sambrook et al., 1989, Molecular Cloning, Cold Spring Harbor) (14) in the presence of ampicillin and kanamycin (50 ⁇ g each / ml) up to an OD at 550 nm of 0.4.
- Expression is initiated by adding 5 mmol of 1 IPTG (isopropyl- ⁇ -D-H-thiogalactoside). The culture is incubated for an additional 4 hours.
- IPTG isopropyl- ⁇ -D-H-thiogalactoside
- coli cells are then collected by centrifugation and resuspended in buffer (50 mmol / 1 Tris-HCl pH 8, 50 mmol / 1 EDTA); the cells are lysed by sonication.
- the insoluble protein fractions are collected by renewed centrifugation and resuspended in the above-mentioned buffer by sonication.
- 1/4 suspension of application buffer 250 mmol / l Tris-HCl pH 6.8, 10 mmol / l EDTA, 5% SDS, 5% mercaptoethanol, 50% glycerol and 0.005% bromophenol blue
- a 12.5 % SDS polyacrylamide gels analyzed is added to the suspension and a 12.5 % SDS polyacrylamide gels analyzed.
- the same preparation is carried out with a culture of E. coli with the two plasmids pA27Ala and pUBS520, which has not been treated with IPTG, and applied in the polyacrylamide gel.
- IPTG-induced culture after staining the gel with Coomassie Blue R250 (dissolved in 30% methanol and 10% acetic acid), a clear band with a molecular weight of about 40 kD can be seen. This band is not present in the control preparation.
- IB's 100 g IB's (wet weight) are dissolved in 450 ml 0.1 mol / 1 Tris-HCl / 6 mol / 1 guanidine HCl / 0.2 mol / 1 DTE (1,4-dithioerythritol) / 1 mmol / 1 EDTA pH 8, 6 suspended and stirred at 25 ° C for 2.5 h.
- Guanidine hydrochloride (solid) is introduced so that after final dilution of the above dialysate with 10 mmol / 1 HCl the concentration of guanidine HCl is 6 mol / 1.
- the mixture is preincubated at 25 ° C. for 1.5 h, then oxidized glutathione (GSSG) is added to a final concentration of 0.1 mol / 1 and Tris-HCl to a final concentration of 0.05 mol / 1 and the pH value is 5 mol / 1 NaOH titrated to pH 9.3.
- the mixture is stirred at 25 ° C for 3.5 h.
- dialysis against 10 mmol / 1 HCl (3 x 100 1, 48 h, 4 ° C.) is carried out. After dialysis, centrifugation is carried out and the clear supernatant is processed further.
- a 10 1 reaction vessel is filled with 0.1 mol / 1 Tris-HCl, 0.8 mol 1 L-arginine, 2 mmol / l GSH (glutathione, reduced form), 1 mmol / 1 EDTA pH 8.5.
- the naturation is carried out at 20 ° C by adding 3 times each 100 ml of derivative (mixed disulfide see above) at intervals of 24 h.
- the renaturation preparation can be concentrated using a hemodialyzer.
- r-PA r-PA
- r-PA r-PA (KHRR296-299AAAA)
- CHO-t-PA Actilyse®, recombinant glycosylated t-PA with the complete sequence according to Pennica et al. (1983) (18), produced from CHO cell lines) diluted with 0.01 M Tris HCl pH 7.5, 0.015% Tween 80® in such a way that a comparable increase in extinction was achieved after 2 h in the plasminogenetic assay.
- the plasminogenolytic activity was determined by the method described in H. Lill (1987) (23), the content of this publication being the subject of the disclosure.
- r-PA, r-PA (KHRR296 - 299 AAAA) and CHO-t-PA were adjusted with buffer to the concentrations given in the table and in the figures and their activity was determined in the clot lysis assay. Carrying out the clot-lysis assay
- the sample is adjusted to the protein concentration required in each case by adding buffer (0.06 M Na2HP04, pH 7.4, 5 mg / ml BSA (bovine serum albumin), 0.01% Tween®).
- buffer 0.06 M Na2HP04, pH 7.4, 5 mg / ml BSA (bovine serum albumin), 0.01% Tween®.
- 0.1 ml of the sample is mixed with 1 ml of human fibrinogen solution (IMCO) (2 mg / ml 0.006 M Na2HP ⁇ 4, pH 7.4, 0.5 mg / ml BSA, 0.01% Tween 80®) and 5 incubated min at 37 ° C.
- IMCO human fibrinogen solution
- CHO-t-PA, r-PA and r-PA (KHRR296 - 299 AAAA) were dialyzed against 0.5 M arginine H 3 PO 4, pH 7.2 and adjusted to a protein concentration of 0.15 mg / ml. All samples were adjusted to a protein concentration of 1.5 ⁇ g ml with 0.05 M Tris HCl, pH 7.5, 0.15 M NaCl, 0.01% Tween 80®.
- each of the samples were mixed with 770 ⁇ l test buffer, 100 ⁇ l fibrinogen (final concentration as shown in the figure), 10 ⁇ l BSA (100 mg / ml H2O), 10 ⁇ l thrombin (100 units / ml), 10 ⁇ l aprotinin (3, 75 mg / ml H2O) mixed and incubated for 1 h at 37 ° C.
- the clot formed was separated by centrifugation (13,000 rpm, Sigma centrifuge) and the amount of enzyme present in the supernatant was determined by ELISA. A separate calibration curve was created for each protein.
- r-PA and r-PA have identical fibrin binding, which differs significantly from the fibrin binding of CHO-t-PA (Fig. 2).
- r-PA, Actilyse® and r-PA were diluted with 0.01 M Tris / HCl, pH 7.5, 0.015% Tween 80® so that they had an absorbance of 0.7 in the plasminogenolytic assay - 0.9 (wavelength 405 nm) reached after 2 h.
- 40 ⁇ l of the diluted sample were mixed with 40 ⁇ l PAI-1 and incubated at 25 ° C. for 15 min. 25 ⁇ l of the sample were used in the plasminogenolytic test. The determination was made according to Lill et al. (1987) (23).
- the rabbit model of neck vein thrombolysis established by D. Collen (1983) (21) was used to test the thrombolytic potency and efficiency.
- Alteplase recombinant glycosylated tissue plasminogen activator from CHO cells, commercially available as Actilyse® from Thomae, Biberach, Germany
- r-PA KHRR296 - 299AAAA
- solvents 0.2 M arginine phosphate buffer
- r-PA KHRR296 - 299AAAA
- the solvent was applied in a volume dose of 26.7 ml. Additional experiments were carried out with iv bolus injection of r-PA (KHRR296 - 299AAAA) (1 mg / kg; after 2 h measurement of thrombolysis). Plasma samples were obtained repeatedly before, during and after the infusion or bolus injection. The plasminoge- nolytic activity was measured with a spectrophotometric test according to Lill (1987) (23). The half-life was taken from the semi-logarithmic plasma concentration time curve using graphical methods. Fibrinogen was determined according to Clauss
- r-PA (KHRR296 - 299AAAA) had a dominant half-life of 15 min after iv bolus injection of 1 mg / kg in rabbits. This half-life is five times longer than the half-life of Alteplase (3 min) after iv bolus injection of 1 mg / kg (Martin et al., Thromb Res 1991; 62: 137-146) (24).
- r-PA (KHRR296 - 299AAAA) is a thrombolytically active protein that has a 5-times longer half-life compared to Alteplase.
- r-PA KHRR296 - 299AAAA
- r-PA KHRR296 - 299AAAA
- therapy with r-PA did not show any other usual bleeding from the cut wounds on the neck, although the fibrin specificity of r-PA (KHRR296 - 299AAAA) did not differ from that of Alteplase.
- This property is of great importance for improving the safety profile of new thrombolytically active substances, since it reduces or even eliminates the side effects of bleeding that are otherwise common with thrombolytics, such as, for example, Alteplase.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Ein nicht glykosyliertes Gewebsplasminogenaktivator-Derivat, welches die wesentlichen Teile mindestens einer Kringledomäne und eine B-Kette mit Serinproteasen-Aktivität des Gewebsplasminogenaktivators enthält und welches dadurch gekennzeichnet ist, dass die Aminosäuren 296 - 299 (Lys-His-Arg-Arg) jeweils gegen ein Alanin ausgetauscht sind, ist aufgrund des geringen Blutungsrisikos insbesondere zur Behandlung von subchronischen thromboembolischen Erkrankungen geeignet.
Description
Nicht-glykosylierte Plasminogenaktivator-Derivate und ihre Verwendung bei erhöhtem Blutungsrisiko
Die Erfindung betrifft neue Plasminogenaktivator-Derivate, ihre Herstellung und Verwendung von Therapeutika zur Behandlung von thromboembolischen Erkrankungen bei erhöhtem Blutungsrisiko. Die Erfindung betrifft ebenso Verfahren zur Herstellung dieser Varianten und pharmazeutische Zusammensetzungen, welche diese Varianten enthalten.
Gewebsplasminogenaktivator (t-PA) ist eine aus mehreren Domänen bestehende Serinprotease, welche die Umwandlung von Plasminogen in Plasmin katalysiert und zur fibrinolytischen Therapie verwendet wird.
Es sind eine Vielzahl von t-PA- Varianten und Mutationen bekannt, vgl. beispielsweise die Über¬ sichtsartikel T.J.R. Harris (1987) (1) und J. Krause (1988) (2).
Unter anderem ist bekannt, daß die Fibrinolyse teilweise durch die Interaktion zwischen t-PA und Plasminogenaktivator-Inhibitor 1 (PAI-1, ein Serinprotease-Inhibitor aus der Se infamilie) regu¬ liert wird. Die Bindung von PAI-1 an t-PA erfolgt im wesentlichen über die Aminosäuren 296 - 302. Eine Mutation dieses Bereichs vermindert den inhibitorischen Einfluß von PAI-1 auf t-PA (E.L. Madison et al. (1990) (S ). Zum Mechanismus der Interaktion zwischen dem Aminosäurebe¬ reich 296 - 302 von t-PA mit PAI-1 wurden umfangreiche Untersuchungen durchgeführt (vgl. auch E.L. Madison, Nature 339 (1989) 721 - 723 (4), R.V. Schohet, Thrombosis and Haemostasis 71 (1994) 124-128 (5), C.J. Refino, Thrombosis and Haemostasis 70 (1993) 313 - 319 (6), N.F. Paoni, Protein Engineering 6 (1993) 529 - 534 (7) und Thrombosis and Haemostasis 70 (1993) 307 - 312 (8), W.F. Bennett, J. Biol. Chem. 266 (1991) 5191 - 5201 (9), D. Eastman, Biochemistry 31 (1992) 419 - 422) (10).
tPA- Varianten, bei deren Anwendung eine verminderte Blutungshäufigkeit auftritt, sind in der WO 93/24635 (11) und von B.A. Keyt et al., Proc. Natl. Acad. Sei. USA 91 (1994) 3670 - 3674 (31) beschrieben. Diese t-PA- Varianten besitzen eine zusätzliche Glykosylierungsstelle an den Aminosäurepositionen 103 - 105. Zusätzlich können diese t-PA-Varianten eine Modifikation an den Aminosäuren 296 - 302 aufweisen, wodurch die Fibrinspezifität erhöht wird.
Aufgabe der vorliegenden Erfindung war es, weitere t-PA-Derivate zur Verfügung zu stellen, die bei der Anwendung verminderte Blutungskomplikationen zeigen.
Die Aufgabe der Erfindung wird gelöst durch ein nicht-glykosyliertes Gewebsplasminogenaktiva- tor-Derivat, welches die wesentlichen Teile mindestens einer Kringledomäne und einer B-Kette von t-PA enthält, dadurch gekennzeichnet, daß die Aminosäuren 296 - 299 (Lys-His-Arg-Arg (SEQ ID NO:2)) jeweils gegen die Sequenz Ala-Ala-Ala-Ala (SEQ ID NO: 3) ausgetauscht sind.
Vorzugsweise enthält das erfindungsgemäße Derivat zusätzlich N-terminal mindestens eine Ami¬ nosäure aus der Sequenz Gly Ala Arg Ser Thr Gin Val Ile (Aminosäuren -3 - +5 der tPA-Sequenz, SEQ ID NO:4). Besonders bevorzugt enthält das erfindungsgemäße Derivat N-terminal die Ami¬ nosäuren +1 - +3 der tPA-Sequenz (Ser Thr Gin).
Derartige Plasminogenaktivatoren sind in vitro weit weniger aktiv als unmodifizierte Derivate oder Wildtyp-Plasminogenaktivator. Überraschenderweise zeigt sich jedoch bei der Anwendung der erfindungsgemäßen Plasminogenaktivator- Varianten ein deutlich vermindertes Blutungsrisiko und eine erhöhte in vivo-Aktivität.
Nicht modifizierter t-PA besteht in seiner im Plasma vorkommenden Form aus 527 Aminosäuren und kann durch Plasmin in zwei Ketten, die dann noch über eine Disulfidbrücke zusammengehalten werden, gespalten werden. Die A-Kette (auch schwere Kette genannt) besteht aus vier struk¬ turellen Domänen. Die Fingerdomäne (Aminosäuren 1 - 49) zeigt gewisse Ähnlichkeiten mit den Fingerstrukturen in Fibronektin. Die Growth-Factor-Domäne (Aminosäuren 50 - 86) ist in gewis¬ sem Umfang homolog zu murinen und humanen epidermalen Wachstumsfaktoren. Die beiden Kringledomänen (Aminosäuren 87 - 175 und 176 - 262) sind im großen Umfang homolog zur vier¬ ten und fünften Kringledomäne von Plasminogen. Die Finger- und Kringle-2-Domänen von t-PA sind in der Fibrinbindung und in der Stimulation der proteolytischen Aktivität durch Fibrin beson¬ ders involviert. Die B-Kette von t-PA (Aminosäuren 276 - 527) ist eine Serinprotease und weit¬ gehend homolog zu den B-Ketten von Urokinase und Plasmin (T.J.R. Harris (1987) (1) und J. Krause (1988) (2)). Unter den wesentlichen Teilen der Domänen sind die Aminosäurebereiche zu verstehen, welche für die biologische Wirksamkeit des Plasminogenaktivators erforderlich sind. Vorzugsweise sind dies mindestens 80 %, besonders bevorzugt mindestens 90 % der genannten Domänen.
Vorzugsweise sind in den erfindungsgemäßen Plasminogenaktivator-Derivaten die Finger¬ und/oder die Growth-Factor-Domäne deletiert. In den erfindungsgemäßen Derivaten sind die Kringledomänen entweder beide erhalten, nur eine Domäne erhalten (vorzugsweise die K2-Domä-
ne) oder es ist eine der Domänen (vorzugsweise Kj oder K2) mehrfach (vorzugsweise verdoppelt) vorhanden.
Die Herstellung der erfindungsgemäßen t-PA- Varianten kann nach den dem Fachmann geläufigen Methoden erfolgen. Vorzugsweise werden die erfindungsgemäßen Verbindungen gentechnologisch hergestellt. Ein derartiges Verfahren ist beispielsweise in der WO 90/09437 (25), EP-A 0 297 066 (26), EP-A 0 302 456 (27), EP-A 0 245 100 (28) und EP-A 0 400 545 (29), welche Gegenstand der Offenbarung für derartige Herstellverfahren sind, beschrieben. Danach werden die Mutationen an Position 296-299 durch "oligonucleotide-directed site-specific mutagenesis" in die cDNA von t-PA oder einem Derivat davon eingeführt. Die "site-specific mutagenesis" ist beispielsweise von Zoller und Smith (1984) (12), modifiziert nach T.A. Kunkel (1985) (13)) und Morinaga et al. (1984) (19) beschrieben. Ebenso geeignet ist das Verfahren der PCR-Mutagenese, welches beispielsweise in Ausubel et al. (1991) (30) beschrieben ist.
Die Nukleinsäuresequenz des erfindungsgemäßen Proteins kann zusätzlich noch modifiziert sein. Derartige Modifikationen sind beispielsweise:
Veränderung der Nukleinsäuresequenz, um verschiedene Erkennungsse¬ quenzen von Restriktionsenzymen zur Erleichterung der Schritte der Ligation, Klonierung und Mutagenese einzuführen
Veränderung der Nukleinsäuresequenz zum Einbau von bevorzugten Codons für die Wirtszelle
Ergänzung der Nukleinsäuresequenz, um zusätzliche Regulations- und Transkriptionselemente, um die Expression in der Wirtszelle zu optimieren.
Die auf diese Weise erhaltene Nukleinsäure dient zur Expression des erfindungsgemäßen t-PA- Derivats, wenn sie auf einem für die verwendete Wirtszelle geeigneten Expressionsvektor vor¬ handen ist.
Alle weiteren Verfahrensschritte zur Herstellung von geeigneten Expressionsvektoren und zur Expression sind Stand der Technik und dem Fachmann geläufig. Beschrieben sind derartige Methoden beispielsweise bei Sambrook et al. (1989) (14).
Die Herstellung der erfindungsgemäßen, nicht glykosylierten t-PA-Derivate erfolgt entweder in eukaryontischen Wirtszellen, wobei das dabei zunächst gewonnene glykosylierte Produkt durch
dem Fachmann geläufige Methoden deglykosyliert werden muß, oder vorzugsweise durch Expres¬ sion in nicht glykosylierenden Wirtszellen, besonders bevorzugt in prokaryonfischen Wirtszellen.
Als prokaryontische Wirtsorganismen sind beispielsweise E. coli, Streptomyces spec. oder Bacillus subtilis geeignet. Zur Herstellung der erfindungsgemäßen Proteine werden die Prokaryontenzellen in üblicher Weise fermentiert und nach Aufschluß der Bakterien das Protein in üblicher Weise iso¬ liert. Falls das Protein in inaktiver Form (Inclusion Bodies) anfallt, wird es nach den dem Fach¬ mann geläufigen Verfahren solubilisiert und naturiert. Ebenso ist es nach den dem Fachmann ge¬ läufigen Methoden möglich, das Protein als aktives Protein aus den Mikroorganismen zu sekretie- ren. Ein hierfür geeigneter Expressionsvektor enthält vorzugsweise eine Signalsequenz, die für die Sekretion von Proteinen in den verwendeten Wirtszellen geeignet ist, und die Nukleinsäurese¬ quenz, welche für das Protein codiert. Das mit diesem Vektor exprimierte Protein wird dabei ent¬ weder in das Medium (bei gram-positiven Bakterien) oder in den periplasmatischen Raum (bei gram-negativen Bakterien) sekretiert. Zwischen der Signalsequenz und der für das erfindungsge¬ mäße t-PA-Derivat codierenden Sequenz ist zweckmäßig eine Sequenz enthalten, die für eine Spaltstelle codiert, die entweder bei der Prozessierung oder durch Behandlung mit einer Protease die Abspaltung des Proteins erlaubt.
Die Auswahl des Basisvektors, in den die für das erfindungsgemäße t-PA-Derivat codierende Nukleinsäure (vorzugsweise DNA) eingebracht wird, ist abhängig von den später zur Expression verwendeten Wirtszellen. Geeignete Plasmide sowie die Minimalanforderungen, die an ein derar¬ tiges Plasmid gestellt werden (z.B. Replikationsursprung, Restriktionsschnittstellen), sind dem Fachmann geläufig. Im Rahmen der Erfindung können auch anstelle eines Plasmids ein Cosmid, die replikative doppelsträngige Form von Phagen (λ, Ml 3) oder andere dem Fachmann bekannte Vektoren verwendet werden.
Bei der Herstellung der erfindungsgemäßen t-PA-Derivate in Prokaryonten ohne Sekretion ist es bevorzugt, die sich bildenden Inclusion Bodies von den löslichen Zellpartikeln abzutrennen, die t-PA enthaltenden Inclusion Bodies durch Behandlung mit Denaturierungsmitteln unter reduzie¬ renden Bedingungen zu solubilisieren, anschließend mit GSSG zu derivatisieren und das t-PA- Derivat durch Zugabe von GSH und von Denaturierungsmitteln in nicht denaturierender Konzentration oder von L-Arginin zu renaturieren. Derartige Verfahren zur Aktivierung von t-PA und Derivaten aus Inclusion Bodies sind beispielsweise in der EP-A 0 219 874 (15) und EP- A 0241 022 (16) beschrieben. Es können jedoch auch andere Verfahren zur Gewinnung des akti¬ ven Proteins aus den Inclusion Bodies verwendet werden.
Vorzugsweise erfolgt die Aufreinigung der erfindungsgemäßen t-PA-Derivate in Anwesenheit von L-Arginin, insbesondere bei einer Arginin-Konzentration von 10 - 1000 mmol 1.
Die Abtrennung von Fremdproteinen erfolgt vorzugsweise durch Affinitätschromatographie und besonders bevorzugt über eine Adsorbersäule, an der ETI (Erythrina Trypsin Inhibitor) immobili¬ siert ist. Als Trägermaterial wird beispielsweise Sepharose® verwendet. Die Reinigung über eine ETI-Adsorbersäule hat den Vorteil, daß das ETI-Adsorbersäulenmaterial direkt aus dem konzentrierten Renaturierungsansatz sogar in Gegenwart von so hohen Argininkonzentrationen wie 0,8 mol/1 Arginin beladen werden kann. Vorzugsweise erfolgt die Reinigung der erfindungs¬ gemäßen Plasminogenaktivatoren über eine ETI-Adsorbersäule in Gegenwart von 0,6 - 0,8 mol/1 Arginin. Die dabei verwendete Lösung hat vorzugsweise einen pH von über 7, besonders bevor¬ zugt zwischen 7,5 und 8,6.
Die Elution der erfindungsgemäßen t-PA-Derivate von der ETI-Säule erfolgt durch pH-Erniedri¬ gung sowohl in Gegenwart als auch in Abwesenheit von Arginin unter Bedingungen, in denen die erfindungsgemäßen tPA-Derivate gut löslich sind. Vorzugsweise liegt dabei der pH-Wert im sau¬ ren Bereich, besonders bevorzugt zwischen pH 4,0 und 5,5.
Die erfindungsgemäßen t-PA- Varianten können zur Herstellung von Therapeutika in einer dem Fachmann geläufigen Weise formuliert werden, wobei die erfindungsgemäßen Verbindungen übli¬ cherweise mit einem pharmazeutisch verträglichen Träger kombiniert werden. Solche Zusammen¬ setzungen enthalten typischerweise eine effektive Menge von 0,1 - 7 mg/kg, vorzugsweise 0,3 - 7 mg/kg, besonders bevorzugt 0,7 - 5 mg/kg Körpergewicht als Dosis. Als besonders geeignet erwies sich eine Dosis von 1 - 3 mg/kg. Die therapeutischen Zusammensetzungen liegen üblicherweise als sterile, wäßrige Lösungen oder sterile, lösliche Trockenformulierungen wie Lyophilisate vor. Die Zusammensetzungen enthalten üblicherweise eine geeignete Menge eines pharmazeutischen akzeptablen Salzes, mit der eine isotonische Lösung hergestellt wird. Weiter können Puffer wie Argininpuffer, Phosphatpuffer zur Stabilisierung eines geeigneten pH-Wertes (vorzugsweise 5,5 - 8,0, besonders bevorzugt 5,5 - 7,5) verwendet werden. Die Höhe der Dosierung der erfindungsgemäßen Verbindungen ist durch jeden Fachmann ohne weiteres zu er¬ mitteln. Sie hängt beispielsweise ab von der Art der Anwendung (Infusion oder Bolus) und der Dauer der Therapie. Aufgrund ihrer verlängerten Halbwertszeit sind die erfindungsgemäßen Ver¬ bindungen besonders geeignet für eine Bolusanwendung (Einmalbolus, Mehrfachbolus). Eine ge¬ eignete Form für eine Bolusanwendung ist beispielsweise eine Ampulle, welche 5 -1000 mg, vorzugsweise 25 - 1000 mg erfindungsgemäße Verbindung, Arginin und Puffer enthält. Die An¬ wendung erfolgt vorzugsweise intravenös, aber auch subkutan, intramuskulär oder intraarteriell.
Die erfindungsgemäßen Verbindungen werden vorzugsweise als Mehrfachbolus angewendet. Ge¬ eignete Zeitintervalle sind zwischen 20 und 180 Minuten, besonders bevorzugt ist ein Intervall zwischen 30 und 90 Minuten und ganz besonders ist ein Intervall zwischen 30 und 60 Minuten bevorzugt.
Die erfindungsgemäßen Verbindungen eignen sich insbesondere zur Behandlung von allen throm- boembolischen Erkrankungen, wie z.B. akuter Herzinfarkt, Hirninfarkt, Lungenembolie, tiefe Beinvenenthrombose, akuter arterieller Verschluß usw.. Besonders bevorzugt werden die erfin¬ dungsgemäßen Verbindungen zur Behandlung von subchronischen thromboembolischen Erkran¬ kungen, bei denen eine längere Thrombolyse durchgeführt werden muß, angewendet.
Es ist bevorzugt, die erfindungsgemäßen Verbindungen in Kombination mit einem Hemmstoff der Gerinnung (Antikoagulans), wie z. B. Heparin oder Hirudin und/oder einem Hemmstoff der Plättchenaggregation anzuwenden, wodurch die Gefäßöfϊhungswirkung bei geringen Nebenwir¬ kungen gesteigert wird.
Die folgenden Beispiele, Abbildungen und das Sequenzprotokoll erläutern die Erfindung weiter.
Fig. 1 zeigt die Clot-Lyse-Aktivität von r-PA (Kurve I), r-PA (KHRR296-299AAAA)
(Kurve II) und CHO-tPA (Kurve III) in Abhängigkeit von der Proteinkonzentra¬ tion (ug bedeutet μg).
Fig. 2 zeigt die Fibrinbindung von r-PA (Kurve I), r-PA (KHRR296-299AAAA)
(Kurve II) und CHO-tPA (Kurve III) in Abhängigkeit von der zugesetzten Menge an Fibrinogen (ug bedeutet μg).
Fig. 3 zeigt die Hemmung von CHO-tPA (Kurve I), r-PA (Kurve II) und r-PA
(KHRR296-299AAAA) (Kurve III) in Abhängigkeit von der PAI-1 -Konzentra¬ tion.
Beispiel 1
Expression in E. coli
a Konstruktion des Expressionsplasmids
Das Ausgangsplasmid pA27fd, beschrieben in EP-A 0 382 174 (17), wobei diese Veröffentlichung Gegenstand der Offenbarung ist, enthält die folgenden Komponenten: tac-Promoter, lac-Operator-
Region mit einem ATG-Startcodon, die codierende Region für das t-PA-Derivat rPA, bestehend aus den N-terminalen Aminosäuren +1 bis +3 von tPA, der Kringle2-Domäne (K2) und der Protease-Domäne (P), und den fd-Transkriptionsterminator; der Ausgangsvektor ist das Plasmid pKK223-3, welches in der EP-A 0 382 174 (17) beschrieben ist.
Zur Einführung der Mutation in die für das Derivat codierende Sequenz, nämlich der Austausch der Aminosäuren KHRR (SEQ ID NO:2) gegen AAAA (SEQ ID NO:3) in den Positionen 296 - 299 (Zählung der Aminosäuren gemäß Pennica et al. (1983) (18)) wird im wesentlichen die Methode von Morinaga et al. (1984) (19) durchgeführt. Das nach Mutagenese erhaltene Derivat wird im weiteren als rPA (KHRR296 - 299 AAAA), abgekürzt rPA (KHRR), bezeichnet. Zur Heteroduplexbildung werden aus pA27fd zwei Fragmente isoliert. Fragment A: pA27fd wird mit dem Restriktionsenzym EcoRI gespalten. Die Spaltprodukte werden gelelektrophoretisch aufge¬ trennt und das größte EcoRI-Fragment aus dem Gel eluiert. Fragment B: Plasmid pA27fd wird mit dem Restriktionsenzym Pvul linearisiert und ebenfalls nach Gelelektrophorese präparativ erhalten. Für die Mutagenese wird das folgende Oligonukleotid synthetisch hergestellt:
5' CATCTTTGCCGCGGCAGCTGCATCGCCCGGAG 3' (SEQ ID NO:l)
Zur Heteroduplex-Bildung werden Fragment A, Fragment B (je 450 fmol) und das Oligonukleotid (75 pmol) gemischt und in Gegenwart von 50 mmol 1 NaCl, 10 mmol/1 Tris-HCl pH 7,5 und 10 mmol/l MgSÜ4 zunächst drei Minuten bei 100°C inkubiert und sofort auf Eis überführt. Die Renaturierung der DNA erfolgt für 30 Minuten bei 60°C. Zur Reparatursynthese wird dem Heteroduplex folgendes hinzugefügt:
Desoxynukleotidtriphosphat (0,25 mmol/1), ATP (1 mmol 1), NaCl (100 mmol/1), Tris-HCL pH 7,5 (6,5 mmol/1), MgCl2 (8 mmol/1), ß-Mercaptoethanol (1 mmol/1), Klenow-Fragment der DNA- Polymerase aus E. coli (0,125 U/μl Ansatz) und T4-Ligase (0,1 U/μl Ansatz). Die Reparatursyn¬ these erfolgt für mindestens 4 Stunden bei 16°C. Anschließend wird dieser Ansatz zusammen mit dem Expressionshilfsplasmid Plasmid pUBS520, beschrieben in Brinkmann et al. (1989) (20) und EP-A 0 373 365 (22) (wobei diese Veröffentlichungen Gegenstand der Offenbarung sind) in E. coli (z.B. C600+, vgl. EP-A 0 373 365 (22)) transformiert. Die Transformanten werden durch Zugabe von Ampicillin und Kanamycin (jeweils 50 μg/ml) zum Nährmedium selektioniert. Das erhaltene Plasmid wird mit pA27Ala bezeichnet. Es unterscheidet sich vom Ausgangsplasmid durch den Austausch der Codons für die Aminosäuren KHRR durch AAAA und durch eine zusätzliche PvuII-Schnittstelle an der Mutagenesestelle.
b) Expression in E. coli
Zur Überprüfung der Expressionsleistung wird der mit den Plasmiden pA27Ala und pUBS520 transformierte E. coli-Stamm in LB-Medium (Sambrook et al., 1989, Molecular Cloning, Cold Spring Harbor) (14) in Gegenwart von Ampicillin und Kanamycin (jeweils 50 ug/ml) bis zu einer OD bei 550 nm von 0,4 angezüchtet. Die Expression wird durch Zugabe von 5 mmol 1 IPTG (Isopropyl-ß-D-H-thiogalactosid) initiiert. Die Kultur wird für weitere 4 Stunden inkubiert. Im Anschluß daran werden die E. coli Zellen durch Zentrifugation gesammelt und in Puffer resus¬ pendiert (50 mmol/1 Tris-HCl pH 8, 50 mmol/1 EDTA); durch Beschallung wird die Lyse der Zel¬ len herbeigeführt. Durch erneute Zentrifugation werden die unlöslichen Proteinfraktionen gesam¬ melt und in oben genannten Puffer durch Beschallung resuspendiert. Die Suspension wird mit 1/4 Volumen Auftragspuffer (250 mmol/l Tris-HCl pH 6,8, 10 mmol/l EDTA, 5% SDS, 5% Mercaptoethanol, 50% Glycerin und 0,005% Bromphenolblau) versetzt und mit Hilfe eines 12.5% SDS-Polyacrylamidgels analysiert. Als Kontrolle wird die gleiche Präparation mit einer Kultur von E. coli mit den beiden Plasmiden pA27Ala und pUBS520, die nicht mit IPTG versetzt worden ist, durchgeführt und im Polyacrylamidgel aufgetragen. In der Präparation der IPTG-induzierten Kul¬ tur kann man, nach Anfärben des Gels mit Coomassie Blue R250 (gelöst in 30% Methanol und 10% Essigsäure), eine deutliche Bande mit einem Molekulargewicht von etwa 40 kD erkennen. Diese Bande ist in der Kontrollpräparation nicht vorhanden.
c) Solubilisierung der unlöslichen Proteinfrakion (Inclusion Bodies. IB's
100 g IB's (Naßgewicht) werden in 450 ml 0,1 mol/1 Tris-HCl / 6 mol/1 Guanidin HCl / 0,2 mol/1 DTE (1,4-Dithioerythrit) / 1 mmol/1 EDTA pH 8,6 suspendiert und 2,5 h bei 25°C gerührt.
Nach Einstellen des pH-Werts auf pH 3 mit HCl (25 %) wird eine Dialyse gegen 10 mmol/1 HCl (3 x 50 1, 24 h, 4°C) durchgeführt.
d) Derivatisierung
Guanidinhydrochlorid (fest) wird vorgelegt, so daß nach Endverdünnung des obengenannten Dialysats mit 10 mmol/1 HCl die Konzentration von Guanidin-HCl 6 mol/1 beträgt.
Der Ansatz wird bei 25°C 1,5 h vorinkubiert, anschließend oxidiertes Glutathion (GSSG) auf 0,1 mol/1 Endkonzentration und Tris-HCl auf 0,05 mol/1 Endkonzentration zugegeben und der pH- Wert mit 5 mol/1 NaOH auf pH 9,3 titriert. Es wird bei 25°C 3,5 h gerührt.
Nach Einstellen des pH-Werts auf pH 3 mit HCl (25 %) wird eine Dialyse gegen 10 mmol/1 HCl (3 x 100 1, 48 h, 4°C) durchgeführt. Nach der Dialyse wird zentrifύgiert und der klare Überstand weiterverarbeitet.
ei Naturierung
Ein 10 1-Reaktionsgefäß wird mit 0,1 mol/1 Tris-HCl, 0,8 mol 1 L-Arginin, 2 mmol/l GSH (Glutathion, reduzierte Form), 1 mmol/1 EDTA pH 8,5 gefüllt. Die Naturierung wird bei 20°C durch 3fache Zugabe von jeweils 100 ml Derivat (gemischtes Disulfid s.o.) im Zeitabstand von 24 h durchgeführt.
Der Renaturierungsansatz kann bei Bedarf über einen Hämodialysator konzentriert werden.
Beispiel 2
Vergleich der plasminogenolytischen Aktivität von r-PA, r-PA (KHRR296 - 299AAAA) und CHO-t-PA
r-PA, r-PA (KHRR296-299AAAA) und CHO-t-PA (Actilyse®, rekombinanter glykosylierter t-PA mit der vollständigen Sequenz gemäß Pennica et al. (1983) (18), hergestellt aus CHO-Zellinien) wurden mit 0.01 M Tris HCl pH 7,5, 0,015% Tween 80® so verdünnt, daß im plasminoge¬ nolytischen Assay nach 2 h ein vergleichbarer Extinktionsanstieg erreicht wurde.
Die Bestimmung der plasminogenolytischen Aktivität erfolgte nach der in H. Lill (1987) (23) beschriebenen Methode, wobei der Inhalt dieser Publikation Gegenstand der Offenbarung ist.
Ergebnis: Während die "spezifische" plasminogenolytische Aktivität von r-PA um den Faktor 2 niedriger liegt als die von CHO-t-PA, ist die Aktivität von r-PA (KHRR296 - 299 AAAA) um den Faktor 30 - 36 gegenüber r-PA erniedrigt (vgl. Tabelle 1 bis 3)
Tabelle 1
Plasminogenolytische Aktivität von r-PA
Tabelle 2
Plasminogenolytische Aktivität von r-PA (KHRR296- 299AAAA)
Tabelle 3
Plasminogenolytische Aktivität von CHO-t-PA
Beispiel 3
Vergleich der Clot-Lyse-Aktivität von r-PA, r-PA (KHRR296 - 299 AAAA) und CHO-t-PA
r-PA, r-PA (KHRR296 - 299 AAAA) und CHO-t-PA wurden mit Puffer auf die in der Tabelle und in den Abbildungen angegebenen Konzentrationen eingestellt und ihre Aktivität im Clot-Lyse- Assay bestimmt.
Durchführung des Clot-Lyse Assays
Die Probe wird durch Zugabe von Puffer (0,06 M Na2HPθ4, pH 7,4, 5 mg/ml BSA (Rinderserumalbumin), 0,01% Tween®) auf die jeweils benötigte Proteinkonzentration eingestellt. 0,1 ml der Probe werden mit 1 ml Human Fibrinogen-Lösung (IMCO) (2 mg/ml 0,006 M Na2HPθ4, pH 7,4, 0,5 mg/ml BSA, 0,01% Tween 80®) gemischt und 5 min bei 37°C inkubiert. Anschließend werden je 100 μl einer Plasminogen-Lösung (10 CU/ml 0,06 M Na2__Pθ4/H3Pθ4, pH 7,4, 0,5 mg/ml BSA, 0,01% Tween 80®) und einer Thrombin-Lösung (30 U/ml 0,06 M Na2HP04, pH 7,4, 0,5 mg/Im BSA, 0,01% Tween 80) hinzugegeben und der Testansatz erneut bei 37°C inkubiert. Nach 2 min wird eine Teflon®-Kugel auf den Fibrin-Clot aufgelegt und die Zeit gestoppt, bis zu der die Kugel den Boden des Test-Röhrchens erreicht hat.
Ergebnis: Während die Clot-Lyse-Aktivität von r-PA um den Faktor 3 - 4 gegenüber der Aktivität von CHO-t-PA reduziert ist, ist die Aktivität von r-PA (KHRR296 - 299AAAA) gegenüber r-PA nochmals um den Faktor 100 erniedrigt (Tabelle 4, Fig. 1).
Tabelle 4
Beispiel 4
Vergleich der Fibrinbindung von CHO-t-PA, r-PA und r-PA (KHRR296 - 299AAAA)
CHO-t-PA, r-PA und r-PA (KHRR296 - 299 AAAA) wurden gegen 0,5 M Arginin H3Pθ4, pH 7,2 dialysiert und auf einen Proteinkonzentration von 0,15 mg/ml eingestellt. Alle Proben wurden mit 0,05 M Tris HCl, pH 7,5, 0,15 M NaCl, 0,01% Tween 80® auf eine Proteinkonzentration von 1,5 μg ml eingestellt. Jeweils 100 μl der Proben wurden mit 770 μl Testpuffer, 100 μl Fibrinogen (Endkonzentration wie in der Abbildung angegeben), 10 μl BSA (100 mg/ml H2O), 10 μl Thrombin (100 Units/ml), 10 μl Aprotinin (3,75 mg/ml H2O) gemischt und 1 h bei 37°C inkubiert. Der gebildete Clot wurde durch Zentrifugation (13.000 UPM, Sigma Zentrifuge) abgetrennt und die im Überstand vorhandene Enzym-Menge über ELISA bestimmt Für jedes Protein wurde eine eigene Eichkurve erstellt.
Ergebnis: r-PA und r-PA (KHRR296 - 299 AAAA) weisen eine identische Fibrinbindung auf, die sich deutlich von der Fibrinbindung von CHO-t-PA unterscheidet (Fig. 2).
Beispiel 5
Vergleich der Hemmung von r-PA, CHO-t-PA und r-PA (KHRR296-299AAAA) durch PAI- 1
r-PA, Actilyse® und r-PA (KHRR296 - 299 AAAA) wurden mit 0,01 M Tris/HCl, pH 7,5, 0,015% Tween 80® so verdünnt, daß sie im plasminogenolytischen Assay eine Extinktion von 0,7 - 0,9 (Wellenlänge 405 nm) nach 2 h erreichten. 40 μl der verdünnten Probe wurden mit 40 μl PAI-1 gemischt und 15 min bei 25°C inkubiert. 25 μl der Probe wurden in den plasminogenolytischen Test eingesetzt. Die Bestimmung erfolgte nach Lill et al. (1987) (23).
Ergebnis: r-PA und CHO-t-PA werden durch PAI-1 vergleichbar gehemmt. Eine weitgehend voll¬ ständige Hemmung der beiden Enzyme wurde mit ca. 50 U/ml PAI-1 erreicht. Im Gegensatz dazu konnte r-PA (KHRR296 - 299 AAAA) nur partiell gehemmt werden (Tabelle 5, Fig. 3).
Tabelle 5
Beispiel 6
In vivo Charakterisierung von rPA-(KHRR296 - 299AAAA)
Zur Prüfung der thrombolytischen Potenz und Effizienz wurde das von D. Collen (1983) (21) etablierte Kaninchenmodell der Halsvenenthrombolyse angewandt. Alteplase (rekominanter glyko- sylierter Gewebe-Plasminogenaktivator aus CHO-Zellen, kommerziell erhältlich als Actilyse® von der Firma Thomae, Biberach, Deutschland), r-PA (KHRR296 - 299AAAA), oder Lösungsmittel (0,2 M Argininphosphatpuffer) wurden den Kaninchen intravenös verabreicht: 10% der Gesamt¬ dosis wurde anfänglich als i.v. Einmalbolusinjektion gegeben, der Rest über 4 h dauerinfundiert (6 ml/h). Im Anschluß an die Infusion wurde 4 h nach Beginn der Therapie der Restthrombus entfernt und das Ausmaß der Thrombusauflösung (Thrombolyse) mittels der Abnahme der Radioaktivität im Thrombus bestimmt.
Alteplase wurde in einer Dosis von 1 mg/kg untersucht, r-PA (KHRR296 - 299AAAA) wurde in Dosen von 0,3; 1 und 7 mg/kg verabreicht. Das Lösungsmittel wurde in einer Volumendosis von 26,7 ml appliziert. Zusätzliche Experimente wurden mit i.v. Bolus-Injektion von r-PA (KHRR296 - 299AAAA) durchgeführt (1 mg/kg; nach 2 h Messung der Thrombolyse). Plasmaproben wurden vor, während und nach der Infusion bzw. Bolusinjekton wiederholt gewonnen. Die plasminoge-
nolytische Aktivität wurde mit einem spektrophotometrischen Test nach Lill (1987) (23) gemessen. Die Halbwertszeit wurde mit graphischen Methoden der halblogarithmischen Plasmakonzentra- tionszeitkurve entnommen. Fibrinogen wurde nach Clauss bestimmt
Ergebnisse:
Eine Zusammenfassung der Ergebnisse ist der nachfolgenden Tabelle zu entnehmen:
Tabelle 6
Mittelwert von 2-3 Experimenten pro Gruppe
Bei 1 mg/kg r-PA (KHRR296 - 299AAAA), gegeben als 4-h Infusion oder als i.v. Einmalbolusin- jektion, wurde die gleiche thrombolytische Potenz und Effizienz wie bei 4-h Infusion der gleichen Dosis von 1 mg/kg Alteplase gefunden. Auch die Reduktion des Plasmafibrinogens war vergleich¬ bar zwischen r-PA (KHRR296 - 299 AAAA) und Alteplase. Überraschenderweise fand sich bei der 4-h Infusion von r-PA (KHRR296 - 299 AAAA) nur ein Drittel der Plasmakonzentration von Alteplase, trotzdem wurde der gleiche thrombolytische Effekt gefunden. Eine weitere überra¬ schende Beobachtung war, daß Tiere mit 1 mg/kg r-PA (KHRR296 - 299 AAAA) nicht aus den Wunden am Hals bluteten, die bei der Präparation entstehen, während bei 1 mg/kg Alteplase diese Blutungen typischerweise auftraten.
r-PA (KHRR296 - 299AAAA) hatte nach i.v. Bolusinjektion von 1 mg/kg am Kaninchen eine dominante Halbwertszeit von 15 min. Diese Halbwertszeit ist fünfmal länger als die Halbwertszeit von Alteplase (3 min) nach i.v. Bolusinjektion von 1 mg/kg (Martin et al., Thromb Res 1991; 62: 137-146) (24).
Zusammenfassend stellt sich r-PA (KHRR296 - 299AAAA) als ein thrombolytisch aktiyes Protein dar, das im Vergleich mit Alteplase eine 5-mal längere Halbwertszeit aufweist. Damit ist r-PA (KHRR296 - 299AAAA) für die Verabreichung als i.v. Bolus geeignet und erzielt die gleiche thrombolytische Wirkung wie die Standardinfüsion von Alteplase bei der gleichen Dosis von 1 mg/kg. Überraschenderweise zeigten sich bei der Therapie mit r-PA (KHRR296 - 299AAAA) keine sonst üblichen Blutungen aus den Schnittwunden am Hals, obwohl sich die Fibrinspezifität von r-PA (KHRR296 - 299 AAAA) nicht von der von Alteplase unterscheidet. Diese Eigenschaft hat große Bedeutung für die Verbesserung des Sicherheitsprofils neuer thrombolytisch aktiver Substanzen, da es die sonst bei Thrombolytika, wie z.B. Alteplase, übliche Blutungsnebenwirkung verringert oder sogar beseitigt.
Referenzliste
(1) T.J.R. Harris, Protein Engineering 1 (1987) 449-459
(2) J. Krause, Fibrinolysis 2 (1988) 133-142
(3) E.L. Madison et al., Proc. Natl. Acad. Sei. USA 87 (1990) 3530-3533
(4) E.L. Madison, Nature 339 (1989) 721 - 723
(5) R.V. Schohet, Thrombosis and Haemostasis 71 (1994) 124-128
(6) C.J. Refino, Thrombosis and Haemostasis 70 (1993) 313 - 319
(7) N.F. Paoni, Protein Engineering 6 (1993) 529 - 534
(8) Thrombosis and Haemostasis 70 (1993) 307 - 312
(9) W.F. Bennett, J. Biol. Chem. 266 (1991) 5191 - 5201
(10) D. Eastman, Biochemistry 31 (1992) 419 - 422)
(11) WO 93/24635
(12) Zoller und Smith, DNA 3 (1984) 479 - 488
(13) T.A. Kunkel, Proc. Natl. Acad. Sei. USA 82 (1985) 488 - 492
(14) Sambrook et al., "Expression of cloned genes in E. coli" in Molecular Cloning: A Laboratory Manual (1989), Cold Spring Harbor Laboratory Press, New York, USA
(15) EP-A 0 219 874
(16) EP-A 0 241 022
(17) EP-A 0 382 174
(18) Pennica et al., Nature 301 (1983) 214 - 221
(19) Morinaga et al., Biotechnology 21 (1984) 634
(20) Brinkmann et al., Gene 85 (1989) 109 - 114
(21) D. Collen, J. Clin. Invest. 71 (1983) 368-376
(22) EP-A 0 373 965
(23) H. Lill et al., ZGJMAL 42 (1987) 478-486
(24) Martin et al., Thromb Res 62 (1991) 137-146
(25) WO 90/09437
(26) EP-A 0 297 066
(27) EP-A 0 302 456
(28) EP-A 0 245 100
(29) EP-A 0 400 545
(30) Ausubel et al., Current Protocols in Molecular Biology, eds. Greene Publ. Assoc. and Wiley Interscience, Vol. 2, Chapter 15 (1991)
(31) B. A. Keyt et al., Proc. Natl. Acad. Sei. USA 91 (1994) 3670 - 3674
SEQUENZPROTOKO
(1) ALLGEMEINE ANGABEN:
(i) ANMELDER:
(A) NAME: BOEHRINGER MANNHEIM GMBH
(B) STRASSE: Sandhoferstr. 116
(C) ORT: Mannheim
(E) LAND: Deutschland
(F) POSTLEITZAHL: D-68305
(G) TELEFON: 0885660-3446 (H) TELEFAX: 0885660-3451
(ii) BEZEICHNUNG DER ERFINDUNG: Nicht glycosvlierte
Plasminogenaktivator-Derivate und ihre Verwendung bei erhoehtem Blutungsrisiko
(iii) ANZAHL DER SEQUENZEN: 4
(iv) COMPUTER-LESBARE FASSUNG:
(A) DATENTRÄGER: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) BETRIEBSSYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: Patentin Release #1.0, Version #1.30B (EPA)
(vi) DATEN DER URANMELDUNG:
(A) ANMELDENUMMER: DE P 44 23 574.7
(B) ANMELDETAG: 05-JUL-1994
(2) ANGABEN ZU SEQ ID NO: 1:
(i) SEQUENZKENNZEICHEN:
(A) LÄNGE: 32 Basenpaare
(B) ART: Nucleotid
(C) STRANGFORM: Einzelstrang
(D) TOPOLOGIE: linear
(ii) ART DES MOLEKÜLS: other nucleic acid
(A) BESCHREIBUNG: /desc = "synthetisches Oligonucleotid"
(xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 1:
CATCTTTGCC GCGGCAGCTG CATCGCCCGG AG 32
(2) ANGABEN ZU SEQ ID NO: 2:
(i) SEQUENZKENNZEICHEN:
(A) LÄNGE: 4 Aminosäuren
(B) ART: Aminosäure
(C) STRANGFORM: Einzelstrang
(D) TOPOLOGIE: linear
(ii) ART DES MOLEKÜLS: Peptid
(xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 2:
Lys His Arg Arg
1
(2) ANGABEN ZU SEQ ID NO: 3:
(i) SEQUENZKENNZEICHEN:
(A) LÄNGE: 4 Aminosäuren
(B) ART: Aminosäure
(C) STRANGFORM: Einzelstrang
(D) TOPOLOGIE: linear
(ii) ART DES MOLEKÜLS: Peptid
(xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 3:
Ala Ala Ala Ala
1
(2) ANGABEN ZU SEQ ID NO: 4:
(i) SEQUENZKENNZEICHEN:
(A) LÄNGE: 8 Aminosäuren
(B) ART: Aminosäure
(C) STRANGFORM: Einzelstrang
(D) TOPOLOGIE: linear
(ii) ART DES MOLEKÜLS: Peptid
(xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 4:
Gly Ala Arg Ser Thr Gin Val Ile 1 5
Claims
1. Nicht glykosyliertes Gewebsplasminogenaktivator(t-PA)-Derivat, welches die wesentli¬ chen Teile mindestens einer Kringledomäne und eine B-Kette von t-PA enthält, dadurch gekennzeichnet, daß die Aminosäuren 296 - 299 (Lys-His-Arg-Arg) jeweils gegen ein Alanin ausgetauscht sind.
2. Gewebsplasminogenaktivator-Derivat nach Anspruch 1, dadurch gekennzeichnet, daß die Fingerdomäne uήd/oder die Epidermal Growth Factor-Domäne deletiert sind.
3. Gewebsplasminogenaktivator-Derivat nach den Ansprüchen 1 oder 2, dadurch gekenn¬ zeichnet, daß die Kringledomäne Kl oder K2 deletiert ist.
4. Gewebsplasminogenaktivator-Derivat nach den Ansprüchen 1 bis 3, dadurch gekenn¬ zeichnet, daß die Fingerdomäne, die Epidermal Growth Factor-Domäne und Kringle 1 deletiert sind und als aktive Domänen die K2- und die Proteasen-Domäne noch vorhan¬ den sind.
5. Gewebsplasminogenaktivator-Derivat nach den Ansprüchen 1 bis 4, dadurch gekenn¬ zeichnet, daß es am N-Terminus mindestens eine Aminosäure aus der Sequenz SEQ ID NO:4 enthält.
6. Verfahren zur Herstellung eines Gewebsplasminogenaktivator-Derivats nach den Ansprüchen 1 bis 5, dadurch gekennzeichnet, daß ein Expressionsvektor, der eine Nukleinsäure, welche für den gewünschten Plasminogenaktivator codiert, enthält, in einer prokaryontischen Wirtszelle exprimiert, das entstandene Protein isoliert wird und, falls es in inaktiver Form entstanden ist, solubilisiert und aktiviert wird.
7. Verwendung eines nicht-glykosylierten Gewebsplasminogenaktivator-Derivats nach den Ansprüchen 1 bis 5 zur Herstellung eines Therapeutikums zur Behandlung von throm- boembolischen Erkrankungen.
8. Verwendung gemäß Anspruch 7 zur Herstellung eines Therapeutikums zur Behandlung von tiefen Venenthrombosen, Myocardinfarkt oder Hirninfarkt.
9. Verwendung gemäß den Ansprüchen 7 und 8, dadurch gekennzeichnet, daß das Thera- peutikum eine effektive Menge des nicht-glykosylierten Gewebsplasminogenaktivator- Derivats von 0,1 bis 7 mg/kg Körpergewicht als Dosis enthält.
10. Verwendung nach den Ansprüchen 7 bis 9 zur Herstellung eines Therapeutikums, wel¬ ches als Mehrfachbolus im Zeitintervall zwischen 20 und 180 Minuten angewendet wird.
11. Verwendung nach den Ansprüchen 7 bis 10 in Kombination mit einem Hemmstoff der Gerinnung (Antikoagulans) oder einem Hemmstoff der Platt chenaggregation .
12. Pharmazeutische Zusammensetzung eines nicht-glykosylierten Gewebsplasminogehak- tivator-Derivats nach den Ansprüchen 1 bis 5, enthaltend ein pharmazeutisch akzepta¬ bles Salz in einer isotonischen Lösung.
13. Pharmazeutische Zusammensetzung nach Anspruch 12, welche einen pH-Wert von 5,5 bis 8,0 besitzt.
14. Pharmazeutische Zusammensetzung nach den Ansprüchen 12 und 13, dadurch gekenn¬ zeichnet, daß sie einen Hemmstoff der Gerinnung (Antikoagulans) oder einen Hemm¬ stoff der Plättchenaggregation enthält.
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DE4423574 | 1994-07-05 | ||
| DE19944423574 DE4423574A1 (de) | 1994-07-05 | 1994-07-05 | Nicht-glykosylierte Plasminogenaktivator-Derivate und ihre Verwendung bei erhöhtem Blutungsrisiko |
| PCT/EP1995/002391 WO1996001312A1 (de) | 1994-07-05 | 1995-06-20 | Nicht-glykosylierte plasminogenaktivator-derivate und ihre verwendung bei erhöhtem blutungsrisiko |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP0769050A1 true EP0769050A1 (de) | 1997-04-23 |
Family
ID=6522310
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP95924298A Withdrawn EP0769050A1 (de) | 1994-07-05 | 1995-06-20 | Nicht-glykosylierte plasminogenaktivator-derivate und ihre verwendung bei erhöhtem blutungsrisiko |
Country Status (4)
| Country | Link |
|---|---|
| EP (1) | EP0769050A1 (de) |
| AU (1) | AU2886195A (de) |
| DE (1) | DE4423574A1 (de) |
| WO (1) | WO1996001312A1 (de) |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5262170A (en) * | 1988-09-02 | 1993-11-16 | Genentech, Inc. | Tissue plasminogen activator having zymogenic or fibrin specific properties and substituted at amino acid positions 296-299, DNA molecules encoding them, vectors, and host cells |
| US5714145A (en) * | 1988-09-02 | 1998-02-03 | Genentech, Inc. | Tissue plasminogen activator having zymogenic or fibrin specific properties |
| US6346510B1 (en) | 1995-10-23 | 2002-02-12 | The Children's Medical Center Corporation | Therapeutic antiangiogenic endostatin compositions |
| JP4666767B2 (ja) * | 1999-02-10 | 2011-04-06 | ザ チルドレンズ メディカル センター コーポレイション | プラスミノーゲンの脱グリコシル化クリングル1〜5領域フラグメント及びこれらの使用方法 |
| US7157556B1 (en) | 1999-02-10 | 2007-01-02 | The Children's Medical Center Corporation | Deglycosylated kringle 1-3 region fragments of plasminogen and methods of use |
| DE10153601A1 (de) | 2001-11-02 | 2003-05-22 | Paion Gmbh | DSPA zur Behandlung von Schlaganfall |
| DE10342518A1 (de) * | 2003-09-12 | 2005-05-12 | Paion Gmbh | Plasminogen-Aktivatoren mit verringerter Lysin-Bindungskapazität |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5156969A (en) * | 1988-09-02 | 1992-10-20 | Genentech Inc. | Tissue plasminogen activator variant with deletion of amino acids 466-470 having fibrin specific properties |
| DE3903581A1 (de) * | 1989-02-07 | 1990-08-16 | Boehringer Mannheim Gmbh | Gewebs-plasminogenaktivator-derivat |
| PT786257E (pt) * | 1992-06-03 | 2003-12-31 | Genentech Inc | Variantes de glicosilacao do activador de plasminogenio tissular com propriedades terapeuticas meloradas |
-
1994
- 1994-07-05 DE DE19944423574 patent/DE4423574A1/de not_active Withdrawn
-
1995
- 1995-06-20 WO PCT/EP1995/002391 patent/WO1996001312A1/de not_active Ceased
- 1995-06-20 AU AU28861/95A patent/AU2886195A/en not_active Abandoned
- 1995-06-20 EP EP95924298A patent/EP0769050A1/de not_active Withdrawn
Non-Patent Citations (1)
| Title |
|---|
| See references of WO9601312A1 * |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2886195A (en) | 1996-01-25 |
| DE4423574A1 (de) | 1996-01-11 |
| WO1996001312A1 (de) | 1996-01-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP0382174B1 (de) | Gewebs-Plasminogenaktivator-Derivat | |
| DE68923298T2 (de) | Gewebe-plasminogenaktivator mit zymogenen oder fibrinspezifischen eigenschaften. | |
| DE69434332T2 (de) | Thrombin mutanten | |
| DE68923741T2 (de) | Fledermausspeichel-Plasminogenaktivatoren. | |
| DE3689943T2 (de) | Degradierte Spezies eines Gewebeplasminogenaktivators, pharmazeutische Zubereitung und Verfahren zur Herstellung derselben. | |
| EP1472346A2 (de) | Verfahren zur herstellung von rekombinanten proteinen in mikroorganismen | |
| DE3853100T2 (de) | Gewebs-Plasminogen-Aktivator-Analoge mit modifizierten Wachstumsfaktordomänen. | |
| DE3786317T2 (de) | Proteinanaloge des gewebs-plasminogenaktivators. | |
| EP0669394B1 (de) | Bifunktionelle Urokinasevarianten mit verbesserten fibrinolytischen Eigenschaften und thrombinhemmender Wirkung | |
| EP0769050A1 (de) | Nicht-glykosylierte plasminogenaktivator-derivate und ihre verwendung bei erhöhtem blutungsrisiko | |
| DE3886517T2 (de) | Menschlicher Prourokinase ähnliches Polypeptid. | |
| EP0677107B1 (de) | Thrombininhibitor aus speichel von protostomiern | |
| WO1990003388A1 (de) | Präparat von in prokaryonten exprimiertem plasminogenaktivator | |
| DE69321134T2 (de) | Plasminogen-derivate die durch thrombin aktivierbar sind | |
| EP0714982A2 (de) | Chimäre Proteine mit fibrinolytischen und thrombinhemmenden Eigenschaften | |
| EP0917567A1 (de) | Thrombinaktivierbarer plasminogenaktivator | |
| EP0712934A2 (de) | Proteine mit fibrinolytischen und gerinnungshemmenden Eigenschaften | |
| DE69215537T2 (de) | t-PA SUBSTITUTIONSVARIANTEN MIT VERBESSERTER FIBRINSPEZIFITÄT | |
| EP0400545B1 (de) | Gewebs-Plasminogen-Aktivator-Derivat | |
| US5908625A (en) | Use of the protease domain of human plasminogen activator for the treatment of thromboembolic diseases | |
| WO1999009184A1 (de) | Plasminogenaktivator mit verbesserter zymogenität und verminderter fibrinbindung | |
| DE69003342T2 (de) | Pharmazeutische Zusammensetzungen. | |
| DE4443273A1 (de) | Verwendung der Proteasedomäne von humanem Plasminogenaktivator zur Behandlung von thromboembolischen Erkrankungen | |
| WO1999009185A1 (de) | Plasminogenaktivator mit verbesserter zymogenität | |
| EP0796323A1 (de) | Verwendung der proteasedomäne humanes gewebsplasminakilivators für die behandlung von thromboembolischen erkrankungen |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 19970205 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU NL PT SE |
|
| RAP3 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: ROCHE DIAGNOSTICS GMBH |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20030103 |