WO1999009184A1 - Plasminogenaktivator mit verbesserter zymogenität und verminderter fibrinbindung - Google Patents

Plasminogenaktivator mit verbesserter zymogenität und verminderter fibrinbindung Download PDF

Info

Publication number
WO1999009184A1
WO1999009184A1 PCT/EP1998/005012 EP9805012W WO9909184A1 WO 1999009184 A1 WO1999009184 A1 WO 1999009184A1 EP 9805012 W EP9805012 W EP 9805012W WO 9909184 A1 WO9909184 A1 WO 9909184A1
Authority
WO
WIPO (PCT)
Prior art keywords
plasminogen activator
clot
zymogenicity
plasminogen
activity
Prior art date
Application number
PCT/EP1998/005012
Other languages
English (en)
French (fr)
Inventor
Richard Engh
Ulrich Kohnert
Stephan Fischer
Martin Renatus
Wolfram Bode
Robert Huber
Original Assignee
Roche Diagnostics Gmbh
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Roche Diagnostics Gmbh filed Critical Roche Diagnostics Gmbh
Priority to AU88643/98A priority Critical patent/AU8864398A/en
Publication of WO1999009184A1 publication Critical patent/WO1999009184A1/de

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6424—Serine endopeptidases (3.4.21)
    • C12N9/6456—Plasminogen activators
    • C12N9/6459—Plasminogen activators t-plasminogen activator (3.4.21.68), i.e. tPA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/21—Serine endopeptidases (3.4.21)
    • C12Y304/21069—Protein C activated (3.4.21.69)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the invention relates to new plasminogen activators with improved zymogenicity and reduced fibrin binding, medicaments for the treatment of thromboembolic disorders, pharmaceutical compositions which contain such plasminogen activators and their use.
  • Tissue plasminogen activator is a multi-domain serine protease that catalyzes the conversion of plasminogen to plasmin and is used for fibrinolytic therapy.
  • Unmodified human t-PA (hereinafter referred to as t-PA) consists of 527 amino acids in its form in the plasma and can be split into two chains by plasmin, which are then still held together by a disulfide bridge.
  • the A chain (also called heavy chain) consists of four structural domains.
  • the finger domain (amino acids 1 - 49) shows certain similarities with the finger structures in Fibronectin.
  • the growth factor domain (amino acids 50 - 86) is to a certain extent homologous to murine and human epidermal growth factors.
  • the Kringledomain (amino acids 87-261) is largely homologous to the fourth and fifth Kringledomain of plasminogen.
  • the finger and kringle 2 domains of t-PA are particularly involved in fibrin binding and in the stimulation of proteolytic activity by fibrin.
  • the B chain of t-PA (amino acids 276-527, protease domain) is a serine protease and largely homologous to the B chains of urokinase and plasmin (TJR Harris (1987) and J. Krause (1988).
  • the stimulability of the activity by fibrin or by fibrin cleavage products is an essential feature of t-PA, which t-PA from the other known plasminogen activators, such as. B. urokinase or streptokinase differs.
  • the stimulability can be further improved by modifying the amino acid sequence of t-PA.
  • a measure of the stimulability is the ratio of the catalytic efficiency (K cat / K m ) in the presence and in the absence of fibrin.
  • K ca ⁇ is the rate constant of the catalytic reaction and K m is the Michaelis constant.
  • the stimulability of t-PA can increase 19 to 81 times, for example, when amino acids 292 and / or 305 are modified (EL Madison et al., Science 262 (1993) 419-421.
  • t-PA derivatives which are modified in the region of the amino acids 272-280, in particular in the region 274-277 and additionally in the region of the glycosylation sites (117-119 and 184-186).
  • Such t-PA derivatives have improved proteolytic and plasminogenolytic activity, a reduced sensitivity to inhibition, an improved affinity for fibrin and / or improved fibrin dependence of the plasminogenolytic activity.
  • t-PA activates plasminogen to plasmin. Plasmin splits fibrin into soluble fibrin products.
  • Natural human tPA and also recombinantly produced t-PA are usually essentially in single-chain form. Single-chain t-PA is cleaved in the blood by protease / plasmin between amino acid 275 (arginine) and 276 (isoleucine) in two-chain t-PA, which increases activity.
  • Dual chain t-PA has greater activity than small chain and plasmin, in the absence of fibrin, than single chain t-PA. However, in the presence of fibrin, the activities of both t-PA forms are approximately the same.
  • WO 90/02798 describes t-PA variants with increased zymogenicity, which contain substitutions, deletions or insertions around position 305, preferably 297-305. Furthermore, zymogenic variants are described there, which are located at other positions, e.g. at position 267 contain an amino acid exchange. However, these variants show the high fibrin binding specific for t-PA.
  • the object of the invention is to provide improved t-PA mutants which are in particular able to penetrate deep into the clot and reliably, safely and quickly dissolve clots which are difficult to resolve.
  • the object is achieved by a plasminogen activator of the tissue plasminogen activator type, which is characterized by
  • plasminogen activators according to the invention are able to dissolve blood clots very quickly, safely and sustainably. It is assumed that the plasminogen activators according to the invention can penetrate the blood clot largely and homogeneously in their single-chain form and can only be converted into plasmin into the two-chain form deep in the clot after activation of fibrin-bound plasminogen. As a result, clots that are difficult to resolve, as are present in deep vein thrombosis or peripheral, arterial occlusions, can be quickly and successfully resolved with the plasminogen activators according to the invention. At the same time, the systemic activation of plasminogen to plasmin is avoided.
  • Zymogenicity is the quotient of the activity of the two-chain form and the activity of the single-chain form. The activity is determined in the amidolytic test.
  • a plasminogen activator achieves high selectivity and effectiveness of thrombus dissolution in vivo with drastically reduced side effects.
  • the zymogenicity can be increased according to the invention by changing the amino acid sequence of the plasminogen activator. Such changes are known to the person skilled in the art and are described, for example, by W.F. Bennett et al. (1991) (see above) and in WO 90/02798. Further modifications of the plasminogen activator, which lead to increased zymogenicity, are described in European Patent Application No. 971 13937.3.
  • the crystal structure of the catalytic domain of recombinant human t-PA in a covalent complex with dansyl-Glu-Gly-Arg-chloromethylketone inhibitor shows that the Lys 429 side chain is bound in the Ile 276 pocket and an asymmetric salt bridge with Asp 477 forms. Asp 477, the activation site and the substrate recognition site are arranged in single-chain t-PA as well as in two-chain t-PA (Lamba, D. et al, J. Mol. Biol. 258 (1996) 117-135). Lys 429 plays an essential role for the activity of the single-chain t-PA and thus leads to a low zymogenicity.
  • the N-terminal segment of the catalytic domain is bound to the rest of the molecule via the disulfide bridge Cys 264-Cys 386.
  • the "activation loop” comprises the residues Gin 273 to Phe 281 and includes the activation gap Arg 275, Ile 276.
  • the zymogenicity of the t-PA mutants according to the invention can essentially be increased by destabilizing the structure of the “activation loop”. This can be done, for example, by interrupting the salt bridge between Lys 277 and Glu 418.
  • the salt bridge can be interrupted, for example, by exchange of these amino acids in order to effect a charge change or an alternative salt bridge.
  • the destabilization of the “activation loop” can also be caused by disturbing the interaction between the “activation loop” at Thr 461 and the amino acid region Gly 265 - Phe 274 and the salt bridge Arg 267 - Glu 411.
  • the preferably partially or completely deleted amino acid region Gly 265-Phe 274, with the modification of which the zymogenicity can be increased, represents a loop, as can be seen from structural analyzes by the inventors.
  • amino acids 265 - 274 form an "activation loop", which in the conformation forms a kind of lid or shield that protects the activation pocket against the ingress of water.
  • this activation pocket contains a salt bridge between Asp 477 (194) and the N-terminal Ile 276 (16). This salt bridge is essential for the development of proteolytic activity.
  • the shield formed by the loop stabilizes a salt bridge between Asp 477 (194) and Lys 429 (156) by preventing water from entering.
  • This structural stabilization also stabilizes the activity of the single-chain protein. The result of a shortening or complete removal of the loop is that the activation pocket becomes more accessible and an inactive conformation of the single-chain protein is stabilized.
  • the mutations and deletions in the areas mentioned make it possible to increase the zymogenicity by at least a factor of 1.5 compared to human t-PA.
  • the fibrin binding of the plasminogen activator according to the invention is reduced to such an extent that the plasminogen activator can penetrate more than 50% into a blood clot and can thus be homogeneously distributed in the blood clot. Such a homogeneous distribution can be assessed visually by staining the clot.
  • the plasminogen activators according to the invention penetrate into the interior of the clot and thus ensure efficient activation of plasminogen to plasmin in the clot.
  • Such plasminogen activators are based, for example, on the protease domain of t-PA (WO 96/17928) or on a substance which essentially contains the Kringle 2 domain and the protease domain, but not the finger domain, as t-PA domains (WO 90/09437, U.S. Patent 5,223,256, EP-B 0 297 066, EP-B 0 196 920).
  • the reduction in fibrin binding can take place by deleting or mutating the domain of t-PA which is specific for fibrin binding (finger domain) fibrin binding via the finger domain cannot or only to a limited extent (no functionally effective finger domain).
  • the plasminogen activator can penetrate the clot (preferably more than 50%) and is distributed evenly. There it is split by plasmin and unfolds its activity in the active two-chain form. Such a plasminogen activator therefore no longer exhibits high affinity fibrin binding typical of tPA.
  • the combination of a lack of fibrin binding and zymogenicity increases the potency of the plasminogen activator and drastically reduces side effects.
  • the penetration of the plasminogen activator according to the invention into a clot can be determined in an in vitro model. The extent of clot penetration and distribution in the clot can be determined visually.
  • the plasminogen activator described in US Pat. No. 5,223,256 is used as the standard for assessment, which penetrates into the clot, distributes itself homogeneously and thus by definition represents the 100% value (determined at a concentration of 3 ⁇ g / ml).
  • recombinant human tissue plasminogen activator according to EP-B 0 093 619 is used, which by definition does not penetrate the clot and essentially binds to the surface.
  • the investigation of the clot penetration is carried out as described in Example 3 c.
  • non-penetration into the clot means that the vast majority (80% or more) of the plasminogen activator is in the first quarter of the clot, whereas with a "homogeneous distribution" at least 50% of the plasminogen activator penetrate further into the clot and are thus located in the remaining three quarters.
  • a plasminogen activator of the tissue plasminogen activator type is to be understood as a plasminogen activator whose sequence is recognizably derived from the sequence of human plasminogen activator.
  • the plasminogen activator according to the invention is additionally modified such that it cannot be inhibited by PAI-1.
  • Modification is preferably carried out by mutating amino acids 296-302 (Madison, EL et. Al, Proc. Natl. Acad. Sci. USA 87 (1990) 3530-3533) and particularly preferably by replacing amino acids 296-299 (KHRR) with AAAA (WO 96/01312).
  • the plasminogen activator according to the invention has a longer plasma half-life than t-PA, preferably at least 10 minutes or longer (half-life in the alpha phase).
  • the compounds according to the invention are thrombolytically active proteins which, in contrast to t-PA (Alteplase), are preferably administered as i.v. Bolus injection are suitable. They are effective in a lower dose and show practically the same thrombolytic effect as a clinically customary infusion of Alteplase.
  • t-PA Alteplase
  • the compounds according to the invention can advantageously also be used in acute diseases, such as heart attack or pulmonary embolism.
  • the plasminogen activators used according to the invention can be produced in eukaryotic or prokaryotic cells by the methods familiar to the person skilled in the art.
  • the compounds according to the invention are preferably produced by genetic engineering. Such a process is described, for example, in WO 90/09437, EP-A 0 297 066, EP-A 0 302 456, EP-A 0 245 100 and EP-A 0 400 545, which are the subject of the disclosure for such production processes .
  • Mutations can be introduced into the cDNA of t-PA or a derivative thereof by "oligonucleotide-directed site-specific mutagenesis".
  • site-specific mutagenesis is described, for example, by Zoller and Smith (1984), modified from TA Kunkel (1985) and Morinaga et al. (1984). Also suitable net is the method of PCR mutagenesis, which is described, for example, in Ausubel et al. (1991).
  • the nucleic acid obtained in this way serves to express the plasminogen activator used according to the invention if it is present on an expression vector suitable for the host cell used.
  • nucleic acid sequence of the protein according to the invention can additionally be modified. Such modifications are, for example:
  • the glycosylated plasminogen activators used according to the invention are produced in eukaryotic host cells.
  • the non-glycosylated plasminogen activators used according to the invention are either produced in eukaryotic host cells, the glycosylated product initially obtained thereby having to be deglycosylated by methods familiar to the person skilled in the art, or preferably by expression in non-glycosylating host cells, particularly preferably in prokaryotic host cells.
  • E. coli, Streptomyces spec. are prokaryotic host organisms. or Bacillus subtilis.
  • the pro- Caryotic cells are fermented in the usual way and the protein is isolated in the usual way after the bacteria have been digested. If the protein is obtained in an inactive form (inclusion bodies), it is solubilized and naturalized according to the methods familiar to the person skilled in the art. It is also possible according to the methods familiar to the person skilled in the art to secrete the protein from the microorganisms as the active protein.
  • An expression vector suitable for this preferably contains a signal sequence which is suitable for the secretion of proteins in the host cells used, and the nucleic acid sequence which codes for the protein.
  • the protein expressed with this vector is secreted either into the medium (for gram-positive bacteria) or into the periplasmic space (for gram-negative bacteria).
  • the signal sequence and the sequence coding for the t-PA derivative according to the invention there is expediently a sequence which codes for a cleavage site which allows the protein to be split off either during processing or by treatment with a protease.
  • the selection of the base vector into which the DNA sequence coding for the plasminogen activator according to the invention is introduced depends on the host cells used later for expression. Suitable plasmids and the minimum requirements placed on such a plasmid (e.g. origin of replication, restriction sites) are known to the person skilled in the art. In the context of the invention, a cosmid, the replicative double-stranded form of phage ( ⁇ , Ml 3) or other vectors known to the person skilled in the art can also be used instead of a plasmid.
  • the plasminogen activators according to the invention When producing the plasminogen activators according to the invention in prokaryotes without secretion, it is preferred to separate the forming inclusion bodies from the soluble cell particles, to solubilize the inclusion bodies containing the plasminogen activator by treatment with denaturing agents under reducing conditions, then to derivatize them with GSSG and to add the plasminogen activator to be renatured from GSH and from denaturing agents in non-denaturing concentration or from L-arginine.
  • Such methods for activating t-PA and derivatives from inclusion bodies are described, for example, in EP-A 0 219 874 and EP-A 0 241 022. However, other methods of obtaining the active protein from the inclusion bodies can also be used.
  • the plasminogen activators according to the invention are preferably purified in the presence of L-arginine, in particular at an arginine concentration of 10-1000 mmol / l.
  • Foreign proteins are preferably separated off by affinity chromatography and particularly preferably via an adsorber column on which ETI (Erythrina Trypsin Inhibitor) is immobilized.
  • ETI Erythrina Trypsin Inhibitor
  • Sepharose® for example, is used as the carrier material. Cleaning via an ETI adsorber column has the advantage that the ETI adsorber column material can be loaded directly from the concentrated renaturation batch even in the presence of such high arginine concentrations as 0.8 mol / 1.
  • the plasminogen activators according to the invention are preferably purified via an ETI adsorber column in the presence of 0.6-0.8 mol / 1 arginine.
  • the solution used here preferably has a pH of more than 7, particularly preferably between 7.5 and 8.6.
  • the plasminogen activators according to the invention are eluted from the ETI column by lowering the pH both in the presence and in the absence of arginine.
  • the pH is preferably in the acidic range, particularly preferably between pH 4.0 and 5.5.
  • Another object of the invention is a pharmaceutical composition containing a thrombolytically active protein according to the invention, the protein preferably containing the protease domain and optionally the Kringel 2 domain of the human tissue plasminogen activator as the only structure causing the thrombolytic activity.
  • the plasminogen activators used according to the invention can be formulated for the production of therapeutic agents in a manner familiar to the person skilled in the art, the compounds according to the invention usually being combined with a pharmaceutically acceptable carrier.
  • Such compositions typically contain an effective amount of 0.1-7 mg / kg, preferably 0.7-5 mg / kg and particularly preferably 1-3 mg / kg body weight as a dose.
  • the therapeutic compositions are usually in the form of sterile, aqueous solutions or sterile, soluble dry formulations such as lyophilisates.
  • the compositions usually contain a suitable amount of a pharmaceutically acceptable salt used to prepare an isotonic solution. Buffers such as arginine buffer and phosphate buffer can also be used to stabilize a suitable pH (preferably 5.5-7.5).
  • the amount of the dosage of the compounds according to the invention can be easily determined by any person skilled in the art. It depends, for example, on the type of application (infusion or bolus) and the duration of the therapy. Because of their prolonged plasma half-life, the compounds according to the invention are particularly suitable for a bolus application (single bolus, multiple bolus).
  • a suitable form for a bolus application is, for example, an ampoule which contains 25-1000 mg of the invention.
  • appropriate compound a substance which improves the solubility of the plasminogen activator (such as tranexamic acid) and contains buffers. It is preferably used intravenously, but also subcutaneously, intramuscularly or intraarterially. Likewise, plasminogen activators according to the invention can be infused or applied locally.
  • the compounds according to the invention can be used as a multiple bolus (preferably as a double bolus). Suitable time intervals are between 20 and 180 minutes, an interval between 30 and 90 minutes is particularly preferred and an interval between 30 and 60 minutes is particularly preferred. In addition, infusion over a longer period of time is also possible.
  • the compounds according to the invention are particularly suitable for the treatment of all thromboembolic disorders, such as e.g. acute heart attack, cerebral infarction, pulmonary embolism, but preferably from deep vein thrombosis and acute arterial occlusion.
  • An infusion over several days e.g. 1-4 days
  • the compounds according to the invention are particularly preferably used for the treatment of subchronic thromboembolic disorders in which prolonged thrombolysis has to be carried out.
  • an anticoagulant such as. B. heparin and / or an inhibitor of platelet aggregation, whereby the vascular opening effect is increased with minor side effects.
  • the administration of anticoagulants can take place at the same time or with a time delay when the compound according to the invention is administered.
  • the addition of substances that promote blood circulation or substances that improve the microcirculation is particularly preferred.
  • RPA is further understood to mean a recombinant plasminogen activator which consists of the domains K2 and P of human tPA.
  • the production of such plasminogen activators is described, for example, in US Pat. No. 5,223,256.
  • rPA ⁇ G265, L266
  • amino acids 265 and 266 were deleted in the plasminogen activator consisting of domains K2 and P (amino acid name analogous to TJ. Harris (1987)).
  • Figure 1 is a schematic representation of the plasma clot penetration model.
  • the pressure was generated by a buffer compartment (hatched). Mixing of buffer and plasma over the clot (dotted) was prevented by using a bubble trap.
  • 1st buffer reservoir
  • 2nd peristaltic pump
  • 3rd bubble trap
  • 4th syringe for the injection of the fibrinolytic agent
  • 5th pipette tip with clot (double hatched)
  • 6th hose clamp
  • 7th pressure element.
  • FIG. 5 shows the comparison of the fibrin binding of t-PA, r-PA and r-PA (F274P, E418K).
  • the starting plasmid pA27fd contains the following components: tac promoter, lac operator region with an ATG start codon, the coding region for the t-PA mutein, consisting of the Kringle 2 domain and the Protease domain (rPA) and the fd transcription terminator.
  • the starting vector represents the plasmid pkk 223-3.
  • fragment A the large BamHI fragment
  • fragment B the vector linearized with Pvu I
  • the heteroduplex batch was transformed together with the plasmid pUBS520 into E. coli (Brinkmann et al., Gene 85 (1989) 109).
  • the transformants were selected by adding ampicillin and kanamycin (50 ⁇ g / ml each) to the nutrient medium.
  • K 429 Y means that amino acid K at position 429 is replaced by Y.
  • buffer 50 mmol / 1 Tris-HCl pH8, 50 mmol / 1 EDTA
  • the insoluble protein fractions were collected by centrifugation and resuspended in the above-mentioned buffer by sonication.
  • a volume of application buffer 250 mmol / 1 Tris-HCl pH 6.8, 10 mmol / 1 EDTA, 5% SDS, 5% mercaptoethanol, 50% glycerol and 0.005% bromophenol blue
  • As a control the same preparation was carried out with a culture of E. coli with the respective plasmids, which had not been induced with IPTG, and separated in the gel.
  • the rabbit model of neck vein thrombolysis established by D. Collen (J. Clin. Invest. 71 (1983) 368-376) was used to test the thrombolytic potency and efficiency of the proteins according to the invention.
  • a radiolabelled thrombus was created in the animals in the cervical vein. The animals were subcutaneously anticoagulated with 100 IU / kg heparin.
  • Alteplase recombinant wild-type tissue plasminogen activator, "t-PA", commercially available as Actilyse® from Thomae, Biberach, Germany
  • t-PA tissue plasminogen activator
  • the protein described in Example 1 streptokinase (commercially available as Streptase® from Behring, Marburg, Germany ) or solvents (0.2 M arginine phosphate buffer) were administered intravenously to the rabbits.
  • the placebo group received an intravenous single bolus injection of 1 mg / kg solvent.
  • the Alteplase group received a total dose of 1.45 mg / kg intravenously, of which 0.2 mg / kg as an initial bolus injection, 0.75 mg / kg as a 30-minute infusion, directly followed by 0.5 mg / kg as a 60-minute continuous infusion (total infusion: 90 min.).
  • the streptokinase group received a 60 minute intravenous infusion of 64,000 IU / kg.
  • the group with the protein according to the invention received an intravenous single bolus injection.
  • thrombolysis thrombolysis
  • Blood samples for obtaining plasma were taken before therapy and two hours after the start of therapy.
  • the activated thromboplastin time was measured using standard methods.
  • Blood loss due to thrombolytic therapy was also quantified. For this purpose, a defined skin incision of 4 cm in length and 0.3 cm in depth was added to the animals on the thigh before administration of the thrombolytics using a template and a scalpel. The resulting bleeding stopped due to natural coagulation.
  • Alteplase and the proteins according to the invention from Example 1 are thrombolytically highly active substances and, compared to solvent control, significantly dissolved the thrombi.
  • the sample is prepared by adding buffer (0.06 M Na2HPO_ ⁇ , pH 7.4, 5 mg / ml BSA (bovine serum albumin), 0.01% o Tween® with 1 ml human fibrinogen solution (IMCO) (2 mg / ml 0.006 M Na 2 HPO_ ⁇ , pH 7.4, 0.5 mg / ml BSA, 0.01% Tween® 80) and incubated for 5 min at 37 ° C.
  • buffer 0.06 M Na2HPO_ ⁇ , pH 7.4, 5 mg / ml BSA (bovine serum albumin), 0.01% o Tween® with 1 ml human fibrinogen solution (IMCO) (2 mg / ml 0.006 M Na 2 HPO_ ⁇ , pH 7.4, 0.5 mg / ml BSA, 0.01% Tween® 80
  • a plasminogen solution (10 IU / ml 0.06 M Na 2 HP ⁇ 4 / ⁇ 3 P ⁇ 4, pH 7.4, 0.5 mg / ml BSA, 0.01% Tween® 80) and a thrombin solution (30 U / ml 0.06 M Na 2 HPO 4 , pH 7.4, 0.5 mg / ml BSA, 0.01% Tween® 80), and the test mixture is incubated again at 37 ° C. After two minutes, a Place the Teflon® ball on the fibrin clot and stop the time until the ball has reached the bottom of the test tube.
  • the substances according to the invention are investigated under conditions which are quite similar to the in vivo conditions.
  • the substances are placed in the plasma over the clot under the influence of a peristaltic pressure similar to the pressure caused by the heartbeat.
  • Branch A contains the 1 ml pipette tip filled with the plasma clot, which closes this branch.
  • Branch B is a blind line running parallel to branch A. The pressure was set to 10 mbar using a hose clamp in branch B. Plasma (1 ml) was added to the clot. The pump was turned on and the stability of each clot checked for 15 minutes.
  • the fibrinolytic (final plasma concentration between 0.5 and 10 and 20 ⁇ g / ml for the proteins of Example 1 or CHO-t-PA) was injected using a 1 ml tuberculin syringe with a hypodermic needle for intramuscular injection (Braun, Melsungen, FRG) carefully injected into the plasma.
  • the clot lysis time was calculated as the time difference between the addition of the fibrinolytic enzyme and the drop in pressure to 50% of the value before the addition of the fibrinolytic.
  • the pressure was determined using a water-calibrated piezoelectric pressure detection system and documented using a computer-aided documentation program. The results are shown in FIGS. 2-4.
  • 800 ⁇ l human citrate plasma (healthy donor) are mixed with 75 ⁇ l Ca buffer (50 mmol / 1 Tris / HCl, pH 7.2, 0.25 mol / 1 CaCl 2 ), 20 ⁇ l gelatin solution (10% w / v) in 0.9% NaCl) and 100 ml thrombin solution (8 U / ml, 0.05 mol / 1 sodium citrate / HCl, pH 6.5, 0.15 mol / l NaCl). 800 ⁇ l of this mixture are carefully transferred into a 2 ml column (Pierce, Rockfort, IL, USA). A plasma clot is formed by incubation for three hours at 37 ° C.
  • Ca buffer 50 mmol / 1 Tris / HCl, pH 7.2, 0.25 mol / 1 CaCl 2
  • 20 ⁇ l gelatin solution (10% w / v) in 0.9% NaCl
  • 100 ml thrombin solution 8 U /
  • 2 ml of buffer (0.008 mol / 1 Na 2 HP ⁇ 4, 0.001 mol / 1 KH 2 PO_ ⁇ , 0.003 mol / 1 KC1, 0.137 mol / 1 NaCl, 0.1% bovine serum albumin, 0.01% Tween® 80) are with the plasminogen activator , which was previously inhibited with Glu-Gly-Arg-chloromethyl ketone, adjusted to the desired concentrations (0, 0.5, 1, 2 and 3 ⁇ g / ml) and 1 ml of this solution applied to the surface of the clot. The remaining buffer is discarded.
  • the surface of the clot is washed with 2 ml PBS buffer (0.008 mol / 1 Na 2 HPO_ ⁇ , 0.001 mol / 1 KH PO_ ⁇ , 0.003 mol / 1 KC1 and 0.137 mol / 1 NaCl) and the protein is fixed by adding 2 ml glutardialdehyde Solution in PBS.
  • the clot surface is then washed with 2 ml of 50 mmol / 1 Tris / HCl, pH 8.0 and incubated with 1 ml of peroxidase-labeled polyclonal antibodies against t-PA (250 mU / ml). After washing the clot with 1 ml of PBS, the antibody-bound protein is determined by incubation with 3-amino-9-ethylcarbazole, which is converted into an insoluble red color by peroxidase.
  • Plasminogen activators according to the invention are not concentrated on the surface of the clot, but penetrate into the clot and are distributed evenly.
  • the intensity of the immunologically colored part of the clot increases with increasing concentration of the plasminogen activators according to the invention in the plasma.
  • the thrombolytically active proteins of Example 1 are tested for their ability to bind to fibrin and compared with this with Alteplase.
  • Samples of Alteplase and a protein according to the invention were prepared as solutions of 1.5 ⁇ g protein / ml. Subsequently, samples (100 ⁇ l) of the thrombolytically active protein were each treated with 770 ⁇ l buffer (0.05 M Tris / HCl, pH 7.4, 0.15 NaCl, 0.01% Tween® 80), 10 ⁇ l bovine serum albumin solution ( 100 mg / ml), 10 ⁇ l aprotinin (3.75 mg / ml), 10 ⁇ l bovine thrombin (concentration 100 U / ml) and increasing amounts of fibrinogen (10 ⁇ g / ml to 300 ⁇ g / ml) mixed. All of the solutions were aqueous.
  • Thrombin is known to convert fibrinogen to an insoluble fibrin clot.
  • the components were mixed and incubated at 37 ° C for one hour.
  • the supernatant was then separated from the fibrin clot by centrifugation (15 minutes, 13,000 rpm, at 4 ° C.) and the amount of plasminogen activator protein present in the supernatant was determined by an ELISA using its own standard curve for each variant.
  • the results of fibrin binding of t-PA, r-PA and r-PA are shown in FIG. 5.
  • the fibrinogen fragments acting as a stimulator were produced by treating human fibrinogen with cyanogen bromide (1 g human fibrinogen, 1.3 g CNBr in 100 ml water) in 70% v / v formic acid over a period of 17 hours at room temperature, followed by dialysis against distilled water.
  • test buffer 0.1 mol / 1 Tris, pH 7.5, 0.15% Tween® 80
  • t-PA stimulator (1 mg / ml cyanogen bromide fragments from human fibrinogen) 1 ml substrate solution (3 mmol / 1 S2251, H-D-Val-Leu-Lys-pNA; Chromogenix, Moelndal,
  • the activity in the presence of the t-PA stimulator is divided by the activity in the absence of the t-PA stimulator.
  • the dilution should be such that an almost identical absorbance is achieved in both preparations.
  • 1 ml H 2 O is added to the reaction mixture without t-PA stimulator instead of 1 ml t-PA stimulator.
  • the activity is measured in the same way both in the absence and in the presence of the stimulator.
  • the stimulation factor F is calculated as follows:
  • the specific activity is the quotient of plasminogenolytic activity (KU / ml) and protein concentration (mg / ml).
  • the thrombolysis by the proteins of Example 1 produced in E. coli can be evaluated in a dog model of thrombosis of the left coronary artery induced by electrical stimulation.
  • r-PA ⁇ G265, L266
  • plasmin-Sepharose 5 mg plasmin / ml Sepharose
  • the plasmin -Sepharose is removed by centrifugation.
  • amidolytic activity of r-PA ( ⁇ G265, L266) and t-PA was determined as described in Example 7.
  • the zymogenicity was calculated as the quotient of the specific Activity of the two-chain form and the single-chain form calculated and is significantly increased compared to t-PA.
  • r-PA E418K
  • r-PA E418K
  • tc 2 ml plasmin-Sepharose
  • the plasmin-Sepharose is removed by centriguation.
  • the other mutants were created analogously.
  • amidolytic activity of r-PA (E418K) and r-PA (E418K) (tc) was determined using the method already available.
  • the zymogenicity was calculated as the quotient of the specific activity of the two-chain form and the single-chain form.
  • Tables 1.1 and 1.2 show the amidolytic activity and the zymogenicity of the mutants according to the invention.
  • ⁇ Zymogenicity quotient of the amidolytic activity of the two-chain and the single-chain form
  • the mutants were incubated with plasma (5 ⁇ g / ml, 30 min, 37 ° C). The following parameters important for coagulation were then determined:
  • Plasminogen (BM Id.No. 233722 140) ⁇ 2 -antiplasmin (Chromogenix, No. 41208) Fibrinogen (BM Id.No. 658642 140) Thrombin time (thrombin reagent BM Id. No. 126594 140)
  • the examined variants show better results than the starting substance r-PA.
  • the thrombin time increases with r-PA to 40 s, with the variants it is between 20 and 35 s (FIG. 7).
  • the fibrinogen drops to 70 mg / dl, with variants M5 and M5.1 values between 100 and 150 mg / dl are still achieved.
  • M6 and M8 are comparable with this parameter to r-PA (Fig. 6).
  • the plasminogen drops significantly more when incubated with r-PA than when incubated with the variants (FIG. 8).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Ein Plasminogenaktivator vom Gewebsplasminogenaktivatortyp, gekennzeichnet durch a) eine proteolytische Spaltbarkeit der einkettigen Form durch Plasmin, b) eine Zymogenität, die mindestens um den Faktor 1,5 größer ist als die Zymogenität von t-PA, c) und einer Fibrinbindung, die soweit reduziert ist, daß der genannte Plasminogenaktivator zu mehr als 50 % in einen Blutclot eindringen kann, ist zur Behandlung von thromboembolischen Krankheiten besonders geeignet.

Description

Plasminogenaktivator mit verbesserter Zymogenität und verminderter Fibrinbindung
Die Erfindung betrifft neue Plasminogenaktivatoren mit verbesserter Zymogenität und verminderter Fibrinbindung, Arzneimittel zur Behandlung von thromboembolischen Erkrankungen, pharmazeutische Zusammensetzungen, welche solche Plasminogenaktivatoren enthalten und deren Verwendung.
Gewebsplasminogenaktivator (t-PA) ist eine aus mehreren Domänen bestehende Serinprotea- se, welche die Umwandlung von Plasminogen in Plasmin katalysiert und zur fibrinolyti sehen Therapie verwendet wird.
Es sind eine Vielzahl von t-PA- Varianten und Mutationen bekannt, vgl. beispielsweise die Übersichtsartikel T.J.R. Harris (1987) und J. Krause (1988).
Zur Wirkungsweise von t-PA ist unter anderem bekannt, daß die Fibrinolyse teilweise durch die Interaktion zwischen t-PA und Plasminogenaktivator-Inhibitor 1 (PAI-1, ein Serinpro- tease-Inhibitor aus der Seφinfamilie) reguliert wird. Die Bindung von PAI-1 an t-PA erfolgt im wesentlichen über die Aminosäuren 296 - 302. Eine Mutation dieses Bereichs vermindert den inhibitorischen Einfluß von PAI-1 auf t-PA (E.L. Madison et al. (1990)). Zum Mechanismus der Interaktion zwischen dem Aminosäurebereich 296 - 302 von t-PA mit PAI-1 wurden umfangreiche Untersuchungen durchgeführt (vgl. auch E.L. Madison, Nature 339 (1989) 721 - 723; RN. Schohet, Thrombosis and Haemostasis 71 (1994) 124-128; C.J. Refmo, Thrombosis and Haemostasis 70 (1993) 313 - 319; Ν.F. Paoni, Protein Engineering 6 (1993) 529 - 534 und Thrombosis and Haemostasis 70 (1993) 307 - 312; W.F. Bennett, J. Biol. Chem. 266 (1991) 5191 - 5201, D. Eastman, Biochemistry 31 (1992) 419 - 422).
Nicht modifizierter humaner t-PA (im weiteren als t-PA bezeichnet) besteht in seiner im Plasma vorkommenden Form aus 527 Aminosäuren und kann durch Plasmin in zwei Ketten, die dann noch über eine Disulfidbrücke zusammengehalten werden, gespalten werden. Die A-Kette (auch schwere Kette genannt) besteht aus vier strukturellen Domänen. Die Finger- domäne (Aminosäuren 1 - 49) zeigt gewisse Ähnlichkeiten mit den Fingerstrukturen in Fibronektin. Die Growth-Factor-Domäne (Aminosäuren 50 - 86) ist in gewissem Umfang homolog zu murinen und humanen epidermalen Wachstumsfaktoren. Die Kringledomäne (Aminosäuren 87 - 261) ist im großen Umfang homolog zur vierten und fünften Kringledomäne von Plasminogen. Die Finger- und Kringle-2-Domänen von t-PA sind in der Fibrinbindung und in der Stimulation der proteolytischen Aktivität durch Fibrin besonders involviert. Die B-Kette von t-PA (Aminosäuren 276 - 527, Proteasendomäne) ist eine Serinprotease und weitgehend homolog zu den B-Ketten von Urokinase und Plasmin (T.J.R. Harris (1987) und J. Krause (1988).
Die Stimulierbarkeit der Aktivität durch Fibrin oder durch Fibrin-Spaltprodukte ist ein wesentliches Merkmal von t-PA, das t-PA von den anderen bekannten Plasminogenaktivatoren, wie z. B. Urokinase oder Streptokinase unterscheidet. Die Stimulierbarkeit kann durch Modifikation der Aminosäuresequenz von t-PA weiter verbessert werden. Ein Maß für die Stimulierbarkeit ist das Verhältnis der katalytischen Effizienz (Kcat/Km) in Gegenwart und in Abwesenheit von Fibrin. Kca{ ist die Geschwindigkeitskonstante der katalytischen Reaktion und Km ist die Michaeliskonstante. Die Stimulierbarkeit von t-PA kann z.B. bei Modifikation der Aminosäuren 292 und/oder 305 auf das 19- bis 81 fache steigen (E.L. Madison et al., Science 262 (1993) 419 - 421.
Aus dem US-Patent 5,501,853 sind t-PA-Derivate bekannt, welche im Bereich der Aminosäuren 272 - 280, insbesondere im Bereich 274 - 277 und zusätzlich im Bereich der Glykosylierungsstellen (117 - 119 und 184 - 186) modifiziert sind. Solche t-PA-Derivate besitzen eine verbesserte proteolytische und plasminogenolytische Aktivität, eine verringerte Empfindlichkeit für Inhibition, eine verbesserte Affinität für Fibrin und/oder verbesserte Fibrinabhängigkeit der plasminogenolytischen Aktivität.
Der Wirkmechanismus von t-PA in vivo ist beispielsweise in Korninger und Collen, Thromb. Haemostasis 46 (1981) 561 - 565 beschrieben. t-PA aktiviert Plasminogen zu Plasmin. Plasmin spaltet Fibrin zu löslichen Fibrinspaltprodukten. Natürlicher humaner tPA und auch rekombinant hergestellter t-PA liegen üblicherweise im wesentlichen in einkettiger Form vor. Einkettiger t-PA wird durch im Blut vorhandene Protease/Plasmin zwischen Aminosäure 275 (Arginin) und 276 (Isoleucin) in zweikettigen t-PA gespalten, wodurch die Aktivität zunimmt.
Die enzymatische Aktivität der einkettigen Form bei der therapeutischen Anwendung ist nicht vernachlässigbar, was zu unerwünschten Wirkungen außerhalb des aufzulösenden Blut- clots führt. Zweikettiges t-PA hat gegenüber kleinen Substraten und gegenüber Plasmin, in der Abwesenheit von Fibrin, eine größere Aktivität als einkettiger t-PA. In der Gegenwart von Fibrin, sind die Aktivitäten beider t-PA-Formen jedoch etwa annähernd gleich.
Aus W.F. Bennett et al., J. Biol. Chem. 266 (1991) 5191 - 5201 ist bekannt, daß durch Modifikation des Aminosäurebereichs um Aminosäure 275, durch Modifikation der Bereiche 339 - 351 oder 410 - 440, insbesondere an den Aminosäuren 417, 428 und 433, das Verhältnis der Aktivität der einkettigen und zweikettigen Form (Zymogenität) um den Faktor fünf bis sieben, gegenüber Wildtyp-t-PA erhöht werden kann.
In der WO 90/02798 sind t-PA- Varianten mit erhöhter Zymogenität beschrieben, die Substitutionen, Deletionen oder Insertionen um die Position 305, vorzugsweise 297 - 305, enthalten. Weiter werden dort zymogene Varianten beschrieben, welche an weiteren Positionen, u.a. an Position 267, einen Aminosäureaustausch enthalten. Diese Varianten zeigen jedoch die für t-PA spezifische hohe Fibrinbindung.
Die Aufgabe der Erfindung besteht darin, verbesserte t-PA-Mutanten zur Verfugung zu stellen, die insbesondere in der Lage sind, tief in das Gerinnsel einzudringen und schwer aufzulösende Clots zuverlässig, sicher und schnell aufzulösen.
Die Aufgabe wird gelöst durch einen Plasminogenaktivator vom Gewebsplasminogenaktiva- tortyp, der gekennzeichnet ist durch
a) eine proteolytische Spaltbarkeit der einkettigen Form durch Plasmin,
b) eine Zymogenität, die mindestens um den Faktor 1,5 größer ist als die Zymogenität von t-PA
c) und dessen Fibrinbindung soweit reduziert ist, daß der genannte Plasminogenaktivator zu mehr als 50 % in einen Blutclot eindringen kann.
Es hat sich überraschenderweise gezeigt, daß erfindungsgemäße Plasminogenaktivatoren in der Lage sind, Blutclots sehr schnell, sicher und nachhaltig aufzulösen. Es wird angenommen, daß die erfindungsgemäßen Plasminogenaktivatoren in ihrer einkettigen Form weitgehend und homogen den Blutclot durchdringen können und erst tief im Clot nach Aktivierung von fibringebundenem Plasminogen zu Plasmin in die zweikettige Form überführt werden. Dadurch können schwer aufzulösende Clots, wie sie bei tiefen Venenthrombosen oder peri- pheren, arteriellen Verschlüssen vorliegen, mit den erfindungsgemäßen Plasminogenaktivatoren schnell und erfolgreich aufgelöst werden. Gleichzeitig wird die systemische Aktivierung von Plasminogen zu Plasmin vermieden.
Unter der Zymogenität ist der Quotient aus der Aktivität der zweikettigen Form und der Aktivität der einkettigen Form zu verstehen. Die Aktivität wird im amidolytischen Test bestimmt. Mit einem solchen Plasminogenaktivator wird eine hohe Selektivität und Effektivität der Thrombusauflösung in vivo bei drastisch verminderten Nebenwirkungen erreicht.
Die Zymogenität kann durch Änderungen der Aminosäuresequenz des Plasminogenaktivators erfindungsgemäß erhöht werden. Derartige Veränderungen sind dem Fachmann bekannt und beispielsweise von W.F. Bennett et al.(1991) (s.o.) sowie in der WO 90/02798 beschrieben. Weitere Modifikationen des Plasminogenaktivators, die zu einer erhöhten Zymogenität führen, sind in der europäischen Patentanmeldung Nr. 971 13937.3 beschrieben.
Aus der Kristallstruktur der katalytischen Domäne von rekombinantem, humanem t-PA in einem kovalenten Komplex mit Dansyl-Glu-Gly-Arg-Chloromethylketoninhibitor zeigt sich, daß die Lys 429 Seitenkette in der Ile 276-Tasche gebunden ist und eine asymmetrische Salzbrücke mit Asp 477 bildet. Asp 477, die Aktivierungsstelle und die Substraterkennungsstelle sind in einkettigem t-PA ebenso arrangiert wie in zweikettigem t-PA (Lamba, D. et al, J. Mol. Biol. 258 (1996) 117 - 135). Lys 429 spielt eine wesentliche Rolle für die Aktivität des einkettigen t-PA und führt damit zu einer geringen Zymogenität. Das N-terminale Segment der katalytischen Domäne ist an den Rest des Moleküls über die Disulfidbrücke Cys 264-Cys 386 gebunden. Der „Activation loop" umfaßt die Reste Gin 273 bis Phe 281 und schließt hierbei die Aktivierungsspaltstelle Arg 275, Ile 276 ein.
Die Zymogenität der erfindungsgemäßen t-PA-Mutanten kann im wesentlichen durch Desta- bilisierung der Struktur des „activation loops" erhöht werden. Dies kann beispielsweise durch Unterbrechung der Salzbrücke zwischen Lys 277 und Glu 418 erfolgen. Die Unterbrechung der Salzbrücke ist beispielsweise möglich durch Austausch dieser Aminosäuren, um eine Ladungsveränderung oder eine alternative Salzbrücke zu bewirken. Die Destabilisierung des „activation loops" kann auch durch Störung der Wechselwirkung zwischen dem „activation loop" bei Thr 461 und dem Aminosäurebereich Gly 265 - Phe 274 sowie der Salzbrücke Arg 267 - Glu 411 erfolgen. Auch hier ist es zweckmäßig, Aminosäuren auszutauschen. Eine weitere Möglichkeit zur Erhöhung der Zymogenität ist die vollständige Deletion des Aminosäurebereichs Gly 265 - Phe 274. Es hat sich gezeigt, daß die teilweise oder vollständige Deletion des Aminosäurenbereichs Gly 265 - Phe 274 die Zymogenität von t-PA und t-PA-Mutanten wesentlich erhöht. Dies ist deshalb besonders überraschend, da bisher davon ausgegangen wurde (Bennett et al., J. Biol. Chem. 266 (1991) 5191 - 5201), daß lediglich der Austausch von Aminosäuren zu einer Verbesserung der Zymogenität führt.
Der bevorzugt teilweise oder vollständig deletierte Aminosäurebereich Gly 265 - Phe 274, mit dessen Modifikation die Zymogenität erhöht werden kann, stellt einen Loop dar, wie sich aus Strukturanalysen der Erfinder ergibt. In der einkettigen Form des Proteins bilden die Aminosäuren 265 - 274 einen "activation loop", der in der Konformation eine Art Deckel oder Schild bildet, welches die Aktivierungstasche gegen Wasserzutritt schützt. In der zweikettigen Form des aktivierten Proteins enthält diese Aktivierungstasche eine Salzbrücke zwischen Asp 477 (194) und dem N-terminalen Ile 276 (16). Diese Salzbrücke ist wesentlich für die Ausbildung der proteolytischen Aktivität. In der einkettigen Form des Proteins stabilisiert das durch den loop gebildete Schild, durch Verhinderung des Wasserzutritts, eine Salzbrücke zwischen Asp 477 (194) und Lys 429 (156). Durch diese strukturelle Stabilisierung wird ebenfalls die Aktivität des einkettigen Proteins stabilisiert. Damit hat eine Verkürzung oder vollständige Entfernung des loops zur Folge, daß die Aktivierungstasche besser zugänglich wird und eine inaktive Konformation des einkettigen Proteins stabilisiert wird.
Durch die Mutationen und Deletionen in den genannten Bereichen gelingt es, die Zymogenität, im Vergleich zu humanem t-PA, mindestens um den Faktor 1,5, zu erhöhen.
Erfmdungsgemäß ist die Fibrinbindung des erfindungsgemäßen Plasminogenaktivators soweit reduziert, daß der Plasminogenaktivator zu mehr als 50 % in einen Blutclot eindringen kann und sich somit homogen im Blutclot verteilen kann. Eine solche homogene Verteilung ist durch Anfärben des clots visuell beurteilbar. Die erfindungsgemäßen Plasminogenaktivatoren dringen in das Innere des Gerinnsels ein und sorgen somit für eine effiziente Aktivierung von Plasminogen zu Plasmin im Clot. Derartige Plasminogenaktivatoren basieren beispielsweise auf der Proteasendomäne von t-PA (WO 96/17928) oder auf einer Substanz, welche als t-PA-Domänen im wesentlichen die Kringle 2-Domäne und die Proteasendomäne, nicht aber die Finger-Domäne, enthält (WO 90/09437, US-Patent 5,223,256, EP-B 0 297 066, EP-B 0 196 920).
Die Reduzierung der Fibrinbindung kann dadurch erfolgen, daß die Domäne von t-PA, welche für die Fibrinbindung spezifisch ist (Fingerdomäne) deletiert oder so mutiert ist, daß eine Fibrinbindung über die Fingerdomäne nicht oder nur in geringem Umfang erfolgen kann (keine fünktionell wirksame Fingerdomäne). Durch die Verminderung der Fibrinbindung wird erreicht, daß der Plasminogenaktivator in den Clot eindringen kann (vorzugsweise zu mehr als 50 %) und sich gleichmäßig verteilt. Dort wird er durch Plasmin gespalten und entfaltet seine Aktivität in der aktiven zweikettigen Form. Ein solcher Plasminogenaktivator zeigt damit keine für tPA typische hochaffine Fibrinbindung mehr. Durch die Kombination von fehlender Fibrinbindung und Zymogenität wird die Potenz des Plasminogenaktivators gesteigert und Nebenwirkungen drastisch vermindert. Das Eindringen des erfindungsgemäßen Plasminogenaktivators in einen Clot kann in einem in vitro-Modell ermittelt werden. Der Umfang der Clotdurchdringung und Verteilung im Clot kann visuell ermittelt werden. Zur Beurteilung wird als Standard der in dem US-Patent 5,223,256 beschriebene Plasminogenaktivator verwendet, welcher in den Clot eindringt, sich homogen verteilt und damit definitionsgemäß den 100 % Wert (bestimmt bei einer Konzentration von 3 μg/ml) darstellt. Als weiterer Standard wird rekombinanter humaner Gewebsplasminogenaktivator gemäß EP-B 0 093 619 verwendet, der definitionsgemäß nicht in den Clot eindringt und im wesentlichen an der Oberfläche bindet. Zur Untersuchung der Clotdurchdringung wird wie in Beispiel 3 c beschrieben vorgegangen. Aus dem Vergleich dieser Standards zeigt sich, daß "Nichteindringen in den Clot" bedeutet, daß der weitaus größte Teil (80 % oder mehr) des Plasminogenaktivators sich im ersten Viertel des Clots befindet, während bei einer "homogenen Verteilung" mindestens 50 % des Plasminogenaktivators weiter in den Clot eindringen und damit in den restlichen drei Vierteln lokalisiert sind.
Gemäß der Erfindung ist unter einem Plasminogenaktivator vom Gewebsplasminogenaktiva- tortyp ein Plasminogenaktivator zu verstehen, dessen Sequenz erkennbar von der Sequenz von humanem Plasminogenaktivator abgeleitet ist. Dies bedeutet zum einen, daß die tPA- charakteristischen Strukturmerkmale (Domänen) zumindest teilweise strukturell erhalten sind. Es hat sich beispielsweise gezeigt, daß Plasminogenaktivatoren, bei denen die Struktur der Kringel 2 und/oder Proteasendomäne noch erhalten sind und zusätzlich die erfindungsgemäßen Modifikationen tragen, im Sinne der Erfindung verwendbar sind. Es ist ebenso möglich, daß weitere Domänen erhalten sind und die erfindungsgemäßen Merkmale durch Dele- tionen, Mutationen und/oder Additionen von Aminosäuren entstehen. Die Veränderungen der Aminosäuresequenz können durch die dem Fachmann geläufigen Verfahren, wie site directed mutagenesis oder PCR, durchgeführt werden.
In einer weiteren bevorzugten Ausführungsform ist der erfindungsgemäße Plasminogenaktivator zusätzlich noch so modifiziert, daß er nicht durch PAI-1 hemmbar ist. Eine solche Modifikation erfolgt vorzugsweise durch Mutation der Aminosäuren 296 - 302 (Madison, E.L. et. al, Proc. Natl. Acad. Sei. USA 87 (1990) 3530 - 3533) und besonders bevorzugt durch Austausch der Aminosäuren 296 - 299 (KHRR) durch AAAA (WO 96/01312).
In einer weiteren bevorzugten Ausführungsform besitzt der erfindungsgemäße Plasminogenaktivator eine gegenüber t-PA verlängerte Plasma-Halbwertszeit, vorzugsweise mindestens 10 Minuten oder länger (Halbwertszeit in der Alpha-Phase).
Die erfindungsgemäßen Verbindungen sind thrombolytisch aktive Proteine, die vorzugsweise im Gegensatz zu t-PA (Alteplase) für die Verabreichung als i.v. Bolus-Injektion geeignet sind. Sie sind in einer geringeren Dosis wirksam und zeigen praktisch die gleiche thromboly- tische Wirkung wie eine klinisch übliche Infusion von Alteplase.
Die verbesserte Wirkung an schwer aufzulösenden Blutclots und die höhere Sicherheit machen die erfindungsgemäßen Verbindungen zu einem außerordentlich wertvollen Throm- bolytikum für die Behandlung aller thromboembolischen Erkrankungen. Im Gegensatz zu den bisher nur bei äußerst lebensbedrohlichen Erkrankungen wie Herzinfarkt und massiver Lungenembolie zugelassenen Thrombolytika, eröffnet die Benutzung solcher Varianten die Möglichkeit, die Thrombolyse durch die erfindungsgemäßen Verbindungen auch bei weniger akut lebensbedrohlichen Erkrankungen, wie z.B. tiefe Beinvenenthrombose oder arteriellen Verschlüssen, einzusetzen. Darüberhinaus kann die Verwendung von Thrombolytika auf Basis der durch die erfindungsgemäßen Verbindungen nun viel breiter als bisher erfolgen, da die Gefahr der Blutungskomplikationen ebenfalls geringer ist. Unabhängig davon, können die erfindungsgemäßen Verbindungen vorteilhaft auch bei akuten Erkrankungen, wie Herzinfarkt oder Lungenembolie, angewendet werden.
Die Herstellung der erfindungsgemäß verwendeten Plasminogenaktivatoren kann nach den dem Fachmann geläufigen Methoden in eukaryontischen oder prokaryontischen Zellen erfolgen. Vorzugsweise werden die erfindungsgemäßen Verbindungen gentechnologisch hergestellt. Ein derartiges Verfahren ist beispielsweise in der WO 90/09437, EP-A 0 297 066, EP-A 0 302 456, EP-A 0 245 100 und EP-A 0 400 545, welche Gegenstand der Offenbarung für derartige Herstellverfahren sind, beschrieben. Mutationen können durch "oligonucleotide- directed site-speeifie mutagenesis" in die cDNA von t-PA oder einem Derivat davon eingeführt werden. Die "site-speeifie mutagenesis" ist beispielsweise von Zoller und Smith (1984), modifiziert nach T.A. Kunkel (1985) und Morinaga et al. (1984) beschrieben. Ebenso geeig- net ist das Verfahren der PCR-Mutagenese, welches beispielsweise in Ausubel et al. (1991) beschrieben ist.
Die auf diese Weise erhaltene Nukleinsäure dient zur Expression des erfindungsgemäß verwendeten Plasminogenaktivators, wenn sie auf einem für die verwendete Wirtszelle geeigneten Expressionsvektor vorhanden ist.
Die Nukleinsäuresequenz des erfindungsgemäßen Proteins kann zusätzlich noch modifiziert sein. Derartige Modifikationen sind beispielsweise:
Veränderung der Nukleinsäuresequenz, um verschiedene Erkennungssequenzen von Restriktionsenzymen zur Erleichterung der Schritte der Ligation, Klonierung und Mutagenese einzuführen
Veränderung der Nukleinsäuresequenz zum Einbau von bevorzugten Codons für die Wirtszelle
Ergänzung der Nukleinsäuresequenz, um zusätzliche Regulations- und Transkriptionselemente, um die Expression in der Wirtszelle zu optimieren.
Alle weiteren Verfahrensschritte zur Herstellung von geeigneten Expressionsvektoren und zur Expression sind Stand der Technik und dem Fachmann geläufig. Beschrieben sind derartige Methoden beispielsweise bei Sambrook et al., "Expression of cloned genes in E.coli" in Molecular Cloning: A laboratory manual (1989) Cold Spring Harbor Laboratory Press, New York, USA.
Die Herstellung der erfindungsgemäß verwendeten glykosylierten Plasminogenaktivatoren erfolgt in eukaryontischen Wirtszellen. Die Herstellung der erfindungsgemäß verwendeten, nicht glykosylierten Plasminogenaktivatoren erfolgt entweder in eukaryontischen Wirtszellen, wobei das dabei zunächst gewonnene glykosylierte Produkt durch dem Fachmann geläufige Methoden deglykosyliert werden muß, oder vorzugsweise durch Expression in nicht glykosylierenden Wirtszellen, besonders bevorzugt in prokaryontischen Wirtszellen.
Als prokaryontische Wirtsorganismen sind beispielsweise E. coli, Streptomyces spec. oder Bacillus subtilis geeignet. Zur Herstellung der erfindungsgemäßen Protein werden die Pro- karyontenzellen in üblicher Weise fermentiert und nach Aufschluß der Bakterien das Protein in üblicher Weise isoliert. Falls das Protein in inaktiver Form (Inclusion Bodies) anfällt, wird es nach den dem Fachmann geläufigen Verfahren solubilisiert und naturiert. Ebenso ist es nach den dem Fachmann geläufigen Methoden möglich, das Protein als aktives Protein aus den Mikroorganismen zu sekretieren. Ein hierfür geeigneter Expressionsvektor enthält vorzugsweise eine Signalsequenz, die für die Sekretion von Proteinen in den verwendeten Wirtszellen geeignet ist, und die Nukleinsäuresequenz, welche für das Protein codiert. Das mit diesem Vektor exprimierte Protein wird dabei entweder in das Medium (bei gram-positiven Bakterien) oder in den periplasmatischen Raum (bei gram-negativen Bakterien) sekre- tiert. Zwischen der Signalsequenz und der für das erfindungsgemäße t-PA-Derivat codierenden Sequenz ist zweckmäßig eine Sequenz enthalten, die für eine Spaltstelle codiert, die entweder bei der Prozessierung oder durch Behandlung mit einer Protease die Abspaltung des Proteins erlaubt.
Die Auswahl des Basisvektors, in den die für den erfindungsgemäßen Plasminogenaktivator codierende DNA-Sequenz eingebracht wird, ist abhängig von den später zur Expression verwendeten Wirtszellen. Geeignete Plasmide sowie die Minimalanforderungen, die an ein derartiges Plasmid gestellt werden (z.B. Replikationsursprung, Restriktionsschnittstellen), sind dem Fachmann geläufig. Im Rahmen der Erfindung können auch anstelle eines Plasmids ein Cosmid, die replikative doppelsträngige Form von Phagen (λ, Ml 3) oder andere dem Fachmann bekannte Vektoren verwendet werden.
Bei der Herstellung der erfindungsgemäßen Plasminogenaktivatoren in Prokaryonten ohne Sekretion ist es bevorzugt, die sich bildenden Inclusion Bodies von den löslichen Zellpartikeln abzutrennen, die Plasminogenaktivator enthaltenden Inclusion Bodies durch Behandlung mit Denaturierungsmitteln unter reduzierenden Bedingungen zu solubilisieren, anschließend mit GSSG zu derivatisieren und den Plasminogenaktivator durch Zugabe von GSH und von Denaturierungsmitteln in nicht denaturierender Konzentration oder von L-Arginin zu renaturieren. Derartige Verfahren zur Aktivierung von t-PA und Derivaten aus Inclusion Bodies sind beispielsweise in der EP-A 0 219 874 und EP-A 0 241 022 beschrieben. Es können jedoch auch andere Verfahren zur Gewinnung des aktiven Proteins aus den Inclusion Bodies verwendet werden.
Vorzugsweise erfolgt die Aufreinigung der erfindungsgemäßen Plasminogenaktivatoren in Anwesenheit von L-Arginin, insbesondere bei einer Arginin-Konzentration von 10 - 1000 mmol/1. Die Abtrennung von Fremdproteinen erfolgt vorzugsweise durch Affinitätschromatographie und besonders bevorzugt über eine Adsorbersäule, an der ETI (Erythrina Trypsin Inhibitor) immobilisiert ist. Als Trägermaterial wird beispielsweise Sepharose® verwendet. Die Reinigung über eine ETI-Adsorbersäule hat den Vorteil, daß das ETI-Adsorbersäulenmaterial direkt aus dem konzentrierten Renaturierungsansatz sogar in Gegenwart von so hohen Argi- ninkonzentrationen wie 0,8 mol/1 beladen werden kann. Vorzugsweise erfolgt die Reinigung der erfindungsgemäßen Plasminogenaktivatoren über eine ETI-Adsorbersäule in Gegenwart von 0,6 - 0,8 mol/1 Arginin. Die dabei verwendete Lösung hat vorzugsweise einen pH von über 7, besonders bevorzugt zwischen 7,5 und 8,6.
Die Elution der erfindungsgemäßen Plasminogenaktivatoren von der ETI-Säule erfolgt durch pH-Erniedrigung sowohl in Gegenwart als auch in Abwesenheit von Arginin. Vorzugsweise liegt dabei der pH-Wert im sauren Bereich, besonders bevorzugt zwischen pH 4,0 und 5,5.
Ein weiterer Gegenstand der Erfindung ist eine pharmazeutische Zusammensetzung, enthaltend ein thrombolytisch erfindungsgemäßes aktives Protein, wobei das Protein vorzugsweise als die einzige die thrombolytische Aktivität bewirkende Struktur die Proteasendomäne und gegebenenfalls die Kringel 2-Domäne des humanen Gewebsplasminogenaktivators enthält.
Die erfindungsgemäß verwendeten Plasminogenaktivatoren können zur Herstellung von Therapeutika in einer dem Fachmann geläufigen Weise formuliert werden, wobei die erfindungsgemäßen Verbindungen üblicherweise mit einem pharmazeutisch verträglichen Träger kombiniert werden. Solche Zusammensetzungen enthalten typischerweise eine effektive Menge von 0,1 - 7 mg/kg, vorzugsweise 0,7 - 5 mg/kg und besonders bevorzugt 1 - 3 mg/kg Körpergewicht als Dosis. Die therapeutischen Zusammensetzungen liegen üblicherweise als sterile, wäßrige Lösungen oder sterile, lösliche Trockenformulierungen wie Lyophilisate vor. Die Zusammensetzungen enthalten üblicherweise eine geeignete Menge eines pharmazeutischen akzeptablen Salzes, mit der eine isotonische Lösung hergestellt wird. Weiter können Puffer wie Argininpuffer, Phosphatpuffer zur Stabilisierung eines geeigneten pH- Wertes (vorzugsweise 5,5 - 7,5) verwendet werden. Die Höhe der Dosierung der erfindungsgemäßen Verbindungen ist durch jeden Fachmann ohne weiteres zu ermitteln. Sie hängt beispielsweise ab von der Art der Anwendung (Infusion oder Bolus) und der Dauer der Therapie. Aufgrund ihrer verlängerten Plasma-Halbwertszeit sind die erfindungsgemäßen Verbindungen besonders geeignet für eine Bolusanwendung (Einmalbolus, Mehrfachbolus). Eine geeignete Form für eine Bolusanwendung ist beispielsweise eine Ampulle, welche 25 - 1000 mg erfmdungs- gemäße Verbindung, eine Substanz, welche die Löslichkeit des Plasminogenaktivators verbessert (wie z.B. Tranexamsäure) und Puffer enthält. Die Anwendung erfolgt vorzugsweise intravenös, aber auch subkutan, intramuskulär oder intraarteriell. Ebenso können erfindungsgemäße Plasminogenaktivatoren infundiert oder lokal appliziert werden.
Die erfindungsgemäßen Verbindungen können als Mehrfachbolus (vorzugsweise als Doppel- bolus) angewendet werden. Geeignete Zeitintervalle sind zwischen 20 und 180 Minuten, besonders bevorzugt ist ein Intervall zwischen 30 und 90 Minuten und ganz besonders ist ein Intervall zwischen 30 und 60 Minuten bevorzugt. Darüber hinaus ist auch eine Gabe als Infusion über einen längeren Zeitraum möglich.
Die erfmdungsgemäßen Verbindungen eignen sich insbesondere zur Behandlung von allen thromboembolischen Erkrankungen, wie z.B. akuter Herzinfarkt, Hirninfarkt, Lungenembolie, vorzugsweise aber von tiefen Beinvenenthrombosen und akuten arteriellen Verschlüssen. Insbesondere bei tiefen Beinvenenthrombosen oder peripheren arteriellen Verschlüssen, kann eine Infusion über mehrere Tage (z.B. 1 - 4 Tage) vorteilhaft sein. Besonders bevorzugt werden die erfindungsgemäßen Verbindungen zur Behandlung von subchronischen thromboembolischen Erkrankungen, bei denen eine längere Thrombolyse durchgeführt werden muß, angewendet.
Es ist bevorzugt, die erfindungsgemäßen Verbindungen in Kombination mit einem Hemmstoff der Gerinnung (Antikoagulans), wie z. B. Heparin und/oder einem Hemmstoff der Plätt- chenaggregation anzuwenden, wodurch die Gefäßöff ungswirkung bei geringen Nebenwirkungen gesteigert wird. Die Gabe von Antikoagulantien kann zeitgleich oder zeitversetzt zur Gabe der erfindungsgemäßen Verbindung erfolgen. Ebenso bevorzugt ist der Zusatz von durchblutungsfördernden Stoffen oder die Mikrozirkulation verbessernde Stoffe.
Die folgenden Beispiele, Publikationen, das Sequenzprotokoll und die Abbildung erläutern die Erfindung, deren Schutzumfang sich aus den Patentansprüchen ergibt, weiter. Die beschriebenen Verfahren sind als Beispiele zu verstehen, die auch noch nach Modifikationen den Gegenstand der Erfindung beschreiben.
Unter "rPA" ist im weiteren ein rekombinanter Plasminogenaktivator zu verstehen, der aus den Domänen K2 und P von humanem tPA besteht. Die Herstellung solcher Plasminogenaktivatoren ist beispielsweise im US-Patent 5,223,256 beschrieben. Unter rPA (ΔG265, L266) ist zu verstehen, daß im aus den Domänen K2 und P bestehenden Plasminogenaktivator die Aminosäuren 265 und 266 deletiert wurden (Aminosäurenbezeichnung analog TJ. Harris (1987)).
Figur 1 ist eine schematische Darstellung des Plasma-Clot-Penetrations-Modells. Um eine durch Scherkräfte induzierte Koagulation des Plasmas zu vermeiden, wurde der Druck durch ein Pufferkompartiment (schraffiert) erzeugt. Die Mischung von Puffer und Plasma über dem Clot (gepunktet) wurde durch Verwendung einer Blasenfalle verhindert.
1.: Pufferreservoir, 2.: peristaltische Pumpe, 3.: Blasenfalle, 4.: Spritze für die Injektion des fibrinolytischen Agens, 5.: Pipettenspitze mit Clot (doppelt schraffiert), 6.: Schlauchklemme, 7.: Druckelement.
Fig. 2 - 4 zeigt die Ergebnisse von Beispiel 3 b). Es wurden r-PA (E418K), r-PA (H417T) und r-PA (K429Y) jeweils mit r-PA verglichen.
Fig. 5 zeigt den Vergleich der Fibrinbindung von t-PA, r-PA und r-PA (F274P, E418K).
Fig. 6 zeigt den konzentrationsabhängigen Einfluß von r-PA und r-PA- Varianten auf den Fibrinogengehalt im Plasma.
Fig. 7 zeigt den konzentrationsabhängigen Einfluß von r-PA und r-PA-Varianten auf die Thrombinzeit.
Fig. 8 zeigt den konzentrationsabhängigen Einfluß von r-PA und r-PA- Varianten auf den Plasminogengehalt.
Fig. 9 zeigt den konzentrationsabhängigen Einfluß von r-PA und r-PA- Varianten auf den α2- Antiplasmingehalt im Plasma. Beispiel 1
Rekombinante Herstellung der erfindungsgemäßen Verbindungen
a) Konstruktion des Expressionsplasmids (Deletion Δ G265, L266)
Das Ausgangsplasmid pA27fd, beschrieben in EP 0 382 174, enthält die folgenden Komponenten: tac-Promoter, lac-Operator-Region mit einem ATG-Startcodon, die kodierende Region für das t-PA-Mutein, bestehend aus Kringle 2-Domäne und der Proteasendomäne (rPA) und den fd-Transkriptionsterminator. Der Ausgangsvektor stellt das Plasmid pkk 223-3 dar.
Zur Einführung der Deletion wurde im wesentlichen die Methode von Morinaga et al., Biotechnology (1984) 636 durchgeführt. Zur Heteroduplexbildung werden aus pA27fd zwei geeignete Fragmente isoliert (z. B. Fragment A: das große BamHI-Fragment, Fragment B: der mit Pvu I linearisierte Vektor).
Als Oligonukleotid wurde verwendet: CTCCACCTGCAGACAGTACA (SEQ ID NO:l)
Der Heteroduplexansatz wurde zusammen mit dem Plasmid pUBS520 in E.coli transformiert (Brinkmann et al., Gene 85 (1989) 109). Die Transformanten wurden durch Zugabe von Ampicillin und Kanamycin (jeweils 50 ug/ml) zum Nährmedium selektioniert.
In analoger Weise wurden z.B. die rPA- Varianten
rPA (K 429 Y) rPA (E 418 K) rPA (H 417 T)
hergestellt. (K 429 Y bedeutet z.B., daß Aminosäure K an der Position 429 durch Y ersetzt ist.)
b) Expression in E.coli
Zur Überprüfung der Expressionsleistung wurde der E.coli mit dem jeweiligen Plasmid (siehe Tabelle 1) und pUBS520 in LB-Medium (Sambrook et al., 1989, Molecular Cloning, Cold Spring Harbor) in Gegenwart von Ampicillin und Kanamycin (jeweils 50 ug/ml) bis zu einer OD bei 550 nm von 0.4 angezüchtet. Die Expression wurde durch Zugabe von 3 x 5 g/1 Lactose initiiert. Die Kultur wurde für weitere 4 Stunden inkubiert. Im Anschluß daran wurden die E.coli Zellen durch Zentrifugati on gesammelt und in Puffer resuspendiert ( 50 mmol/1 Tris-HCl pH8, 50 mmol/1 EDTA); durch Beschallung wurde die Lyse der Zellen herbeigeführt. Durch erneute Zentrifugation wurden die unlöslichen Proteinfraktionen gesammelt und in oben genannten Puffer durch Beschallung resuspendiert. Die Suspension wurde mit A Volumen Auftragspuffer (250 mmol/1 Tris-HCl pH 6.8, 10 mmol/1 EDTA, 5% SDS, 5% Mercaptoethanol, 50% Glycerin und 0.005% Bromphenolblau) versetzt und mit Hilfe eines 12.5% SDS-Polyacrylamidgels analysiert. Als Kontrolle wurde die gleiche Präparation mit einer Kultur von E.coli mit den jeweiligen Plasmiden, die nicht mit IPTG induziert worden war, durchgeführt und im Gel aufgetrennt. In der Präparation der IPTG-induzierten Kultur kann man, nach Anfärben des Gels mit Coomassie Blue R250 (gelöst in 30% Methanol und 10% Essigsäure), eine deutliche Bande mit einem Molekulargewicht von etwa 40 kD erkennen; diese Bande ist in der Kontrollpräparation nicht vorhanden.
Weitere Schritte zur Herstellung der aktiven Verbindung entsprechen den Beispielen 2 und 3 der EP-A 0 382 174.
Beispiel 2
In vivo Charakterisierung
Zur Prüfung der thrombolytischen Potenz und Effizienz der erfindungsgemäßen Proteine wurde das von D. Collen (J. Clin. Invest. 71 (1983) 368-376) etablierte Kaninchenmodell der Halsvenenthrombolyse angewandt. Dabei wurde bei den Tieren in der Halsvene ein radioaktiv markierter Thrombus erzeugt. Die Tiere wurden mit 100 IU/kg Heparin subkutan antikoa- guliert. Alteplase (rekombinanter Wildtyp-Gewebsplasminogenaktivator, "t-PA", kommerziell erhältlich als Actilyse® von der Firma Thomae, Biberach, Deutschland), das in Beispiel 1 beschriebene Protein, Streptokinase (kommerziell erhältlich als Streptase® von der Firma Behring, Marburg, Deutschland) oder Lösungsmittel (0,2 M Argininphosphatpuffer) wurden den Kaninchen intravenös verabreicht.
Die Placebo-Gruppe erhielt eine intravenöse Einmalbolus-Iηjektion von 1 mg/kg Lösungsmittel. Die Alteplase-Gruppe erhielt eine Gesamtdosis von 1,45 mg/kg intravenös verabreicht, davon 0,2 mg/kg als Anfangsbolusinjektion, 0,75 mg/kg als 30-minütige Infusion, direkt gefolgt von 0,5 mg/kg als 60-minütige Dauerinfusion (Gesamtinfusion: 90 min.). Die Streptokinase-Gruppe erhielt eine 60-minütige intravenöse Infusion von 64.000 IU/kg. Die Gruppe mit dem erfindungsgemäßen Protein erhielt eine intravenöse Einmalbolus-Injektion.
Zwei Stunden nach Beginn der Therapie wurde der Restthrombus entfernt und das Ausmaß der Thrombusauflösung (Thrombolyse) mittels der Abnahme der Radioaktivität im Thrombus bestimmt. Blutproben zur Gewinnung von Plasma wurden vor Therapie und zwei Stunden nach Therapiebeginn abgenommen. Die aktivierte Thromboplastinzeit wurde mittels Standardverfahren gemessen. Außerdem wurde der Blutverlust aufgrund der thrombolyti- schen Therapie quantifiziert. Hierzu wurde vor Gabe der Thrombolytika den Tieren auf dem Oberschenkel mit Hilfe einer Schablone und eines Skalpells ein definierter Hautschnitt von 4 cm Länge und 0,3 cm Tiefe zugefügt. Die dabei entstehende Blutung kam durch die natürliche Gerinnung zum Stillstand. Nach Beginn der Therapie wurde auf die Wunde ein Schwamm gelegt, der das Blut aus der durch die Thrombolyse neu ausgebrochenen Blutung aufsog. Durch Wiegen des Schwammes (nach Abzug des Eigenwichtes) wurde die Menge des ausgetretenen Blutes gemessen und so das Ausmaß der Blutungsnebenwirkung beschrieben.
Sowohl Alteplase als auch die erfindungsgemäßen Proteine von Beispiel 1 sind thrombolytisch hochaktive Substanzen und lösten im Vergleich zur Lösungsmittelkontrolle die Thromben signifikant auf.
Beispiel 3
Vergleich der Clot-Lyse-Aktivität
a) Durchführung des Clot-Lyse-Assays
Im Clot-Lyse-Assay wurde die Aktivität von t-PA und der rekombinanten Proteine von Beispiel 1 bestimmt.
Die Probe wird durch Zugabe von Puffer (0,06 M Na2HPO_ι, pH 7,4, 5 mg/ml BSA (Rinderserumalbumin), 0,01%o Tween® wurden mit 1 ml Human-Fibrinogen-Lösung (IMCO) (2 mg/ml 0,006 M Na2HPO_ι, pH 7,4, 0,5 mg/ml BSA, 0,01% Tween® 80) versetzt und 5 min. bei 37°C inkubiert. Anschließend wurden jeweils 100 μl einer Plasminogenlösung (10 IU/ml 0,06 M Na2HPθ4/Η3Pθ4, pH 7,4, 0,5 mg/ml BSA, 0,01% Tween® 80) und einer Thrombinlösung (30 U/ml 0,06 M Na2HPO4, pH 7,4, 0,5 mg/ml BSA, 0,01% Tween® 80) hinzugegeben und der Testansatz erneut bei 37°C inkubiert. Nach zwei Minuten wird eine Teflon®-Kugel auf den Fibrin-Clot aufgelegt und die Zeit gestoppt, bis zu der die Kugel den Boden des Test-Röhrchens erreicht hat.
b) Bestimmung der Aktivität im dynamischen Plasmamodell
In diesem dynamischen Plasmamodell werden die erfindungsgemäßen Substanzen unter Bedingungen, die den in vivo Bedingungen ziemlich ähnlich sind, untersucht. Die Substanzen werden in das Plasma über dem Clot gegeben, unter Einwirkung eines dem durch den Herzschlag verursachten Druck ähnelnden peristaltischen Druckes.
200 μl Citratplasma wurden mit 20 μl einer 0,25 mol/1 CaCl2-Lösung gemischt und bei 37°C inkubiert. 0,16 U Thrombin wurden hinzugefügt und die Mischung in eine 1 ml-Pipetten- spitze (Eppendorff, Hamburg, BRD) gegeben. Die Pipettenspitze wurde 2 min. bei 23°C vertikal gelagert, 60 min. in 0,01 mol/1 Tris/HCl, pH 7,4, 0,15 mol/l NaCl2, 0,025 mol/1 CaCl2, 0,01% Tween® 80 inkubiert und in den Clot-Lyse- Apparat gegeben. Die Clot-Lyse- Aktivität wurde in einem aus elastischen Schläuchen zusammengebauten Schaltsystem (Figur 1) bestimmt. Der Durchfluß wird durch eine peristaltische Pumpe erzeugt und in zwei parallele Zweige aufgeteilt. Zweig A enthält die mit dem Plasma-Clot gefüllte 1 ml- Pipettenspitze, welche diesen Zweig verschließt. Zweig B ist eine zu Zweig A parallel verlaufende blinde Leitung. Der Druck wurde mittels einer Schlauchklemme in Zweig B auf lO mbar eingestellt. Plasma (1 ml) wurde auf den Clot gegeben. Die Pumpe wurde eingeschaltet und die Stabilität eines jeden Clots 15 Minuten übeφrüft. Das Fibrinolytikum (Plasma-Endkonzentration zwischen 0,5 und 10 und 20 μg/ml für die Proteine von Beispiel 1 bzw. CHO-t-PA) wurde mittels einer 1 ml-Tuberkulinspritze mit einer hypodermatischen Nadel zur intramuskulären Injektion (Braun, Melsungen, BRD) vorsichtig in das Plasma injiziert. Die Clot-Lyse-Zeit wurde errechnet als Zeitdifferenz zwischen der Zugabe des fibri- nolytischen Enzyms und dem Druckabfall auf 50% des Wertes vor Zugabe des Fibrinolyti- kums. Der Druck wurde mittels eines wasser-geeichten piezoelektrischen Druckerkennungssystems bestimmt und mittels eines Computer-gestützten Dokumentationsprogramms dokumentiert. Die Ergebnisse sind in den Figuren 2 - 4 wiedergegeben.
c) Clotdurchdringung im statischen Modell
800 μl humanes Citratplasma (gesunder Spender) werden gemischt mit 75 μl Ca-Puffer (50 mmol/1 Tris/HCl, pH 7,2, 0,25 mol/1 CaCl2), 20 μl Gelatinelösung (10 % w/v) in 0,9 % NaCl) und 100 ml Thrombinlösung (8 U/ml, 0,05 mol/1 Natriumcitrat/HCl, pH 6,5, 0,15 mol/l NaCl). 800 μl dieser Mischung werden vorsichtig in eine 2 ml-Säule (Pierce, Rockfort, IL, USA) transferiert. Durch Inkubation für drei Stunden bei 37°C bildet sich ein Plasmaclot. 2 ml Puffer (0,008 mol/1 Na2HPθ4, 0,001 mol/1 KH2PO_ι, 0,003 mol/1 KC1, 0,137 mol/1 NaCl, 0,1 % Rinderserumalbumin, 0,01 % Tween® 80) werden mit dem Plasminogenaktivator, der zuvor mit Glu-Gly-Arg-Chlormethylketon inhibiert wurde, auf die gewünschten Konzentrationen (0, 0,5, 1, 2 und 3 μg/ml) eingestellt und 1 ml dieser Lösung auf die Oberfläche des Clots aufgetragen. Der restliche Puffer wird verworfen. Die Oberfläche des Clots wird mit 2 ml PBS-Puffer (0,008 mol/1 Na2HPO_ι, 0,001 mol/1 KH PO_ι, 0,003 mol/1 KC1 und 0,137 mol/1 NaCl) gewaschen und das Protein fixiert durch Zugabe von 2 ml Glutardialdehyd-Lösung in PBS. Anschließend wird die Clotoberfläche mit 2 ml 50 mmol/1 Tris/HCl, pH 8,0 gewaschen und mit 1 ml Peroxidase markierten polyklonalen Antiköφern gegen t-PA (250 mU/ml) inkubiert. Nach Waschen des Clots mit 1 ml PBS wird das Antiköφer-gebundene Protein durch Inkubation mit 3-Amino-9-ethylcarbazol bestimmt, welches durch Peroxidase in eine unlösliche rote Farbe umgewandelt wird.
Erfindungsgemäße Plasminogenaktivatoren werden nicht an der Oberfläche des Clots konzentriert, sondern dringen in den Clot ein und verteilen sich gleichmäßig. Die Intensität des immunologisch gefärbten Teils des Clots nimmt mit zunehmender Konzentration der erfindungsgemäßen Plasminogenaktivatoren im Plasma zu.
Beispiel 4
Vergleich der Fibrinbindung
In diesem Beispiel werden die thrombolytisch aktiven Proteine von Beispiel 1 auf ihre Fähigkeit geprüft, an Fibrin zu binden, und bezüglich dieser Eigenschaft auch mit Alteplase verglichen.
Proben von Alteplase und eines erfindungsgemäßen Proteins wurden als Lösungen von 1,5 μg Protein/ml hergestellt. Anschließend wurden Proben (100 ul) des thrombolytisch aktiven Proteins jeweils mit 770 μl Puffer (0,05 M Tris/HCl, pH 7,4, 0,15 NaCl, 0,01% Tween® 80), 10 μl Rinderserumalbumin-Lösung (100 mg/ml), 10 μl Aprotinin (3,75 mg/ml), 10 μl Rinderthrombin (Konzentration 100 U/ml) und steigenden Mengen von Fibrinogen (10 μg/ml bis 300 μg/ml) gemischt. Sämtliche Lösungen waren wäßrig. Es ist bekannt, daß Thrombin Fibrinogen in einen unlöslichen Fibrin-Clot überführt. Die Komponenten wurden gemischt und eine Stunde bei 37°C inkubiert. Anschließend wurde der Überstand durch Zentrifugation vom Fibrin-Clot abgetrennt (15 Minuten, 13.000 UPM, bei 4°C) und die Menge des im Überstand vorhandenen Plasminogenaktivator-Proteins durch einen ELISA, unter Verwendung seiner eigenen Standardkurve für jede Variante, bestimmt. Die Ergebnisse der Fibrinbindung von t-PA, r-PA und r-PA (F274P, E418K) sind in Fig. 5 gezeigt.
Beispiel 5
Vergleich der plasminogenolytischen Aktivität und der Stimulierbarkeit
Eine bekannte Verfahrensweise zur Bestimmung der Stimulierbarkeit der plasminogenolytischen Aktivität ist von Verheijen et al. in Thromb. Haemost. 48 (1982) 266-269 beschrieben.
Die als Stimulator wirkenden Fibrinogenfragmente wurden hergestellt durch Behandlung von Human-Fibrinogen mit Cyanogenbromid (l g Human-Fibrinogen, 1,3 g CNBr in 100 ml Wasser) in 70% v/v Ameisensäure über einen Zeitraum von 17 Stunden bei Raumtemperatur, mit anschließender Dialyse gegen destilliertes Wasser.
Bei der Durchführung des Assays wurden 5 ng/nl tPA bzw. eine äquivalente Konzentration der Proteine von Beispiel 1 inkubiert in 1 ml 0,1 mol/1 Tris/HCl (pH 7,5), enthaltend 0,1 % v/v Tween® 80, 0,13 μmo 1/1 Glu-Plasminogen, 0,3 mmol Substrat S2251 (chromogenes Substrat H-D-Val-Leu-Lys-p-Nitroanilide HC1) und 120 μg/ml Fibrinogenfragmente. Die Mischungen wurden zwei Stunden bei 25°C inkubiert und die Absoφtionsrate bei 405 nm ohne Unterbrechung der Reaktion gegen Kontroll-Leerwerte gemessen. Gemessen wurde die Spaltung des chromogenen Substrats S2251, als Maß für die plasminogenolytische Aktivität des Enzyms. Die Stimulierbarkeit errechnet sich als Aktivität mit Fibrinogenfragmenten geteilt durch die Aktivität ohne Fibrinogenfragmente.
Jeweils 25 μl der Probe, entsprechend vorverdünnt mit 0,1 mol/1 Tris, pH 7,5, 0.15% Tween ® 80, werden in ein "well" einer Mikrotiteφlatte pipettiert. Anschließend werden 200 μl Reagenzmischung hinzugegeben und die Extinktion bei 405 nm über einen Zeitraum von 2 h gegen den Leerwert bestimmt (25 μl, 0,1 mol/1 Tris, pH 7,5, 0,15% Tween® 80 mit 200 μl Reagenzmischung) . EProbe = (EProbe t - EBV t) - (EProbe 0 - EBV o)
EProbe t = Probenwert nach 2 h
EB V t = Reagenzienleerwert nach 2 h
EProbe 0 = Probenwert zum Zeitpunkt t = 0
EBV 0 = Reagenzienleerwert zum Zeitpunkt t = 0
Reagenzmischung :
5 ml Testpuffer (0,1 mol/1 Tris, pH 7,5, 0,15% Tween® 80)
1 ml t-PA Stimulator (1 mg/ml Bromcyanfragmente von Human-Fibrinogen) l ml Substratlösung (3 mmol/1 S2251, H-D-Val-Leu-Lys-pNA; Chromogenix, Moelndal,
SE)
1 ml Plasminogenlösung (7 U/ml Plasminogen, Boehringer Mannheim GmbH)
Berechnung des Stimulationsfaktors:
Zur Berechnung des Stimulationsfaktors wird die Aktivität in Gegenwart des t-PA Stimula- tors durch die Aktivität in Abwesenheit des t-PA Stimulators dividiert. Die Verdünnung soll jeweils so sein, daß in beiden Präparationen eine annähernd gleiche Extinktion erzielt wird.
Der Reaktionsmischung ohne t-PA Stimulator wird anstatt 1 ml t-PA Stimulator 1 ml H2O zugegeben.
Die Aktivitätsmessung erfolgt in gleicher Weise sowohl in Abwesenheit wie in Gegenwart des Stimulators. Der Stimulationsfaktor F wird wie folgt berechnet:
EProbe mit Stimulator x Verdünnungprobe mj_t stimulator
F =
EProbe ohne Stimulator x erdünnungprobe 0hne stimulator
Die spezifische Aktivität ist der Quotient aus plasminogenolytischer Aktivität (KU/ml) und Proteinkonzentration (mg/ml). Beispiel 6
Bolusinjektion der rekombinanten Proteine von Beispiel 1 des Ge ebsplasminogen- Aktivators induziert eine wirksame und sichere Thrombolyse in einem Hundemodell der Koronarthrombose
Die Thrombolyse, durch die in E.coli produzierten Proteine von Beispiel 1 können in einem Hundemodell einer durch elektrische Stimulation induzierten Thrombose der linken Herzkranzarterie evaluiert werden.
Beispiel 7
Bestimmung der amidolytischen Aktivität
Zur Bestimmung der amidolytischen Aktivität werden 200 ml Puffer (0,1 mol/1 Tris/HCl, pH 7,5, 0,15 % Tween®und 200 μl der Plasminogenaktivatorlösung (verdünnt mit Puffer auf eine Konzentration von 1 - 12 μg/ml) für 5 Minuten bei 37°C inkubiert. Die Bestimmung wird gestartet zur Zugabe von 200 μl S2288 (6 mmol/1, H-D-Ile-Pro-Arg-P-Nitroanilindihy- drochlorid, Kabi Vitrum, Schweden). Das S2288-Substrat wurde vorequilibriert bei 37°C. Die amidolytische Aktivität wird berechnet aus der Zunahme der Extinktion bei 405 nm innerhalb der ersten 2,5 Minuten, bei einem Extinktionskoeffizient für p-Nitroanilin von 9750 1/mol/cm.
Beispiel 8
Bestimmung der Zymogenität von r-PA (ΔG265, L266)
1. Herstellung von r-PA (ΔG265 , L266)
5.4 mg r-PA (ΔG265, L266) werden durch Inkubation mit 2 ml Plasmin-Sepharose (5 mg Plasmin/ml Sepharose) (45 min bei RT) in die zweikettige Form überführt (r-PA (ΔG265, L266). Die Plasmin-Sepharose wird durch Zentrifugation entfernt.
2. Bestimmung der Zymogenität von r-PA (ΔG265, L266)
Die Bestimmung der amidolytischen Aktivität von r-PA (ΔG265, L266) und t-PA erfolgte wie in Beispiel 7 beschrieben. Die Zymogenität wurde als Quotient aus der spezifischen Aktivität der zweikettigen Form und der einkettigen Form berechnet und ist gegenüber t-PA deutlich erhöht.
Beispiel 9
Bestimmung der Zymogenität von r-PA (E418K) und anderer erfindungsgemäßer
Mutanten
1. Herstellung von r-PA (E418K) (tc)
5.4 mg r-PA (E418K) werden durch Inkubation mit 2 ml Plasmin-Sepharose (5 mg Plasmin/ml Sepharose) (45 min bei RT) in die zweikettige Form überführt (r-PA (E418K) (tc)). Die Plasmin-Sepharose wird durch Zentriguation entfernt. Die anderen Mutanten wurden analog hergestellt.
2. Bestimmung der Zymogenität
Die Bestimmung der amidolytischen Aktivität von r-PA (E418K) und r-PA (E418K) (tc) erfolgte nach der bereits vorliegenden Methode. Die Zymogenität wurde als Quotient aus der spezifischen Aktivität der zweikettigen Form und der einkettigen Form berechnet.
Für r-PA (E418K) wurde eine Zymogenität von 23 gefunden. Im Gegensatz dazu beträgt die Zymogenität von r-PA nur ca. 4.0.
Die Tabellen 1.1 und 1.2 zeigen die amidolytische Aktivität und die Zymogenität der erfindungsgemäßen Mutanten.
1.1 Amidolytische Aktivität
Figure imgf000023_0001
1.2 Zymogenität
Figure imgf000024_0001
^Zymogenität = Quotient der amidolytischen Aktivität der zweikettigen und der einkettigen Form
Beispiel 10
Bestimmung der Spezifität
Zur Erfassung der Spezifität der neuen Varianten wurden die Mutanten mit Plasma inkubiert (5 μg/ml, 30 min, 37°C). Anschließend wurden folgende für die Gerinnung wichtigen Parameter bestimmt:
Plasminogen (BM Id.Nr. 233722 140) α2-Antiplasmin (Chromogenix, Nr. 41208) Fibrinogen (BM Id.Nr. 658642 140) Thrombinzeit (Thrombinreagenz BM Id.Nr. 126594 140)
Alle Bestimmungen erfolgten mit den in Klammern aufgeführten, kommerziell erhältlichen Testkits.
Die untersuchten Varianten weisen bezüglich aller Parameter bessere Ergebnisse auf als die Ausgangssubstanz r-PA.
Die Thrombinzeit steigt bei r-PA bis auf 40 s an, bei den Varianten liegt sie zwischen 20 und 35 s (Fig. 7).
Das Fibrinogen fällt bei der Inkubation mit r-PA bis auf 70 mg/dl ab, bei den Varianten M5 und M5.1 werden noch Werte zwischen 100 und 150 mg/dl erreicht. M6 und M8 sind bzgl. dieses Parameters vergleichbar mit r-PA (Fig. 6). Das Plasminogen fällt bei Inkubation mit r-PA deutlich mehr ab als bei Inkubation mit den Varianten (Fig. 8).
α2-Antiplasmin ist nach der Inkubation mit r-PA nicht mehr meßbar, bei den Varianten sind noch meßbare Mengen an α2-Antiplasmin, bei M5.1 und M8 ist die Ausgangskonzentration nahezu vollständig erhalten (Fig. 9).
M5: rPA (E418K)
M5.1: rPA (F274P, E418K)
M6: rPA (H417T)
M8: rPA (K429Y)
R e f e r e n z l i s t e
Ausubel et al., Current Protocols In Molecular Biology, Vol. 2, Chapter 15 (Greene Publ.
Associates & Wiley Interscience 1991)
Bennett, W.F., J. Biol. Chem. 266 (1991) 5191 - 5201
Brinkmann et al., Gene 85 (1989) 109
Eastman, D., Biochemistry 31 (1992) 419 - 422
EP-A 0 382 174
EP-A 0 245 100
EP-A 0 302 456
EP-A 0 400 545
EP-B 0 196 920
EP-B 0 297 066
EP-A 0 219 874
EP-A 0 241 022
Harris, T.J.R., Protein Engineering 1 (1987) 449 - 459
Kohnert, U. et al., Protein Engineering 5 (1992) 93 - 100
Korninger und Collen, Thromb. Haemostasis 46 (1981) 561 - 565
Krause, J., Fibrinolysis 2 (1988) 133 - 142
Kunkel, T.A., Proc. Natl. Acad. Sei. USA 82 (1985) 488 - 492
Lamba, D. et al., J. Mol. Biol. 258 (1996) 117 - 135
Madison, E.L. et al., Science 262 (1993) 419 - 421
Madison, E.L. et. al., Proc. Natl. Acad. Sei. USA 87 (1990) 3530 - 3533
Madison, E.L., Nature 339 (1989) 721 - 723
Morinaga et al., Biotechnology 21 (1984) 634
Paoni, N.F., Protein Engineering 6 (1993) 529 - 534
Paoni, N.F., Thrombosis and Haemostasis 70 (1993) 307 - 312
Refino, C.J., Thrombosis and Haemostasis 70 (1993) 313 - 319
Sambrook et al., "Expression of cloned genes in E.coli" in Molecular Cloning: A laboratory manual (1989) Cold Spring Harbor Laboratory Press, New York, USA
Schechter, J. und Berger, A., Biochem. Biophys. Res. Commun. 27 (1967) 157 - 162
Schohet, R.N., Thrombosis and Haemostasis 71 (1994) 124-128
US-Patent 5,223,256 US-Patent 5,501,853
WO 90/02798
WO 90/09437
WO 96/01312
WO 96/17928
Zoller und Smith, DNA 3 (1984) 479 - 488

Claims

P a t e n t a n s p r ü c h e
1. Plasminogenaktivator vom Gewebsplasminogenaktivatortyp, gekennzeichnet durch
a) eine proteolytische Spaltbarkeit der einkettigen Form durch Plasmin,
b) eine Zymogenität, die mindestens um den Faktor 1,5 größer ist als die Zymogenität von t-PA,
c) und einer Fibrinbindung die soweit reduziert ist, daß der genannte Plasminogenaktivator zu mehr als 50 % in einen Blutclot eindringen kann.
2. Plasminogenaktivator nach Anspruch 1, dadurch gekennzeichnet, daß die Salzbrücke Lys 277 Glu 418 unterbrochen ist, daß der Aminosäurebereich G 265 - F 274 vollständig oder teilweise deletiert ist, daß die Salzbrücke Arg 267 Glu 411 unterbrochen ist und/oder die Wechselwirkung von Thr 461 mit dem Aminosäurebereich G 265 - F 274 unterbrochen ist.
3. Plasminogenaktivator nach den Ansprüchen 1 oder 2, dadurch gekennzeichnet, daß die Fingerdomäne deletiert oder funktioneil nicht wirksam ist.
4. Plasminogenaktivator nach den Ansprüchen 1 - 3, dadurch gekennzeichnet, daß der genannte Plasminogenaktivator lediglich die Proteasedomäne oder die Kringel 2- Domäne und die Proteasedomäne von humanem Plasminogenaktivator enthält.
5. Nerwendung eines Plasminogenaktivators nach den Ansprüchen 1 - 4 zur Herstellung einer pharmazeutischen Zusammensetzung zur Behandlung von thromboembolischen Erkrankungen.
6. Verfahren zur rekombinanten Herstellung eines Plasminogenaktivators nach den Ansprüchen 1 - 4, dadurch gekennzeichnet, daß er eine prokaryontische oder eukaryontische Wirtszelle mit einem Vektor, welcher zur Expression des genannten Gewebsplas- minogenaktivators fähig ist, transformiert wird, diese Zelle gezüchtet und der genannte Plasminogenaktivator isoliert wird. Pharmazeutische Zusammensetzung eines Plasminogenaktivators nach den Ansprüchen 1 - 4 in einer therapeutisch wirksamen Menge und gegebenenfalls pharmazeutischen Hilfs-, Füll- oder Zusatzstoffen.
PCT/EP1998/005012 1997-08-13 1998-08-07 Plasminogenaktivator mit verbesserter zymogenität und verminderter fibrinbindung WO1999009184A1 (de)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU88643/98A AU8864398A (en) 1997-08-13 1998-08-07 Plasminogen activator with enhanced zymogenic power and reduced fibrin linking

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP97113936 1997-08-13
EP97113936.5 1997-08-13

Publications (1)

Publication Number Publication Date
WO1999009184A1 true WO1999009184A1 (de) 1999-02-25

Family

ID=8227205

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP1998/005012 WO1999009184A1 (de) 1997-08-13 1998-08-07 Plasminogenaktivator mit verbesserter zymogenität und verminderter fibrinbindung

Country Status (2)

Country Link
AU (1) AU8864398A (de)
WO (1) WO1999009184A1 (de)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113416724A (zh) * 2021-06-25 2021-09-21 福州大学 一种组织型纤溶酶原激活剂的重组蛋白及其应用

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0351246A2 (de) * 1988-07-15 1990-01-17 Novo Nordisk A/S Gewebeplasminogenaktivator-Analog
WO1990002798A1 (en) * 1988-09-02 1990-03-22 Genentech, Inc. Tissue plasminogen activator having zymogenic or fibrin specific properties
EP0382174A1 (de) * 1989-02-07 1990-08-16 Roche Diagnostics GmbH Gewebs-Plasminogenaktivator-Derivat
WO1996017928A1 (en) * 1994-12-06 1996-06-13 Boehringer Mannheim Gmbh Use of the protease domain of human plasminogen activator for the treatment of thromboembolic diseases
WO1998021320A2 (en) * 1996-11-12 1998-05-22 The Scripps Research Institute TISSUE TYPE PLASMINOGEN ACTIVATOR (t-PA) VARIANTS: COMPOSITIONS AND METHODS OF USE

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0351246A2 (de) * 1988-07-15 1990-01-17 Novo Nordisk A/S Gewebeplasminogenaktivator-Analog
WO1990002798A1 (en) * 1988-09-02 1990-03-22 Genentech, Inc. Tissue plasminogen activator having zymogenic or fibrin specific properties
EP0382174A1 (de) * 1989-02-07 1990-08-16 Roche Diagnostics GmbH Gewebs-Plasminogenaktivator-Derivat
WO1996017928A1 (en) * 1994-12-06 1996-06-13 Boehringer Mannheim Gmbh Use of the protease domain of human plasminogen activator for the treatment of thromboembolic diseases
WO1998021320A2 (en) * 1996-11-12 1998-05-22 The Scripps Research Institute TISSUE TYPE PLASMINOGEN ACTIVATOR (t-PA) VARIANTS: COMPOSITIONS AND METHODS OF USE

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
PETERSEN, LARS C. ET AL: "Quenching of the amidolytic activity of one-chain tissue-type plasminogen activator by mutation of lysine-416", BIOCHEMISTRY (1990), 29(14), 3451-7 CODEN: BICHAW;ISSN: 0006-2960, 1990, XP002053064 *
TACHIAS, KATHY ET AL: "Converting tissue type plasminogen activator into a zymogen. Important role of Lys156", J. BIOL. CHEM. (1997), 272(1), 28-31 CODEN: JBCHA3;ISSN: 0021-9258, 1997, XP002053066 *
TACHIAS, KATHY ET AL: "Converting tissue-type plasminogen activator into a zymogen", J. BIOL. CHEM. (1996), 271(46), 28749-28752 CODEN: JBCHA3;ISSN: 0021-9258, 1996, XP002053065 *
W. BENNETT ET AL: "High resolution analysis of functional determinants on human tissue-type plasminogen activator", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 266, 15 March 1991 (1991-03-15), MD US, pages 5191 - 5201, XP002053063 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113416724A (zh) * 2021-06-25 2021-09-21 福州大学 一种组织型纤溶酶原激活剂的重组蛋白及其应用
CN113416724B (zh) * 2021-06-25 2023-05-23 福州大学 一种组织型纤溶酶原激活剂的重组蛋白及其应用

Also Published As

Publication number Publication date
AU8864398A (en) 1999-03-08

Similar Documents

Publication Publication Date Title
DE69031127T2 (de) Aktivierbare fibrinolytische und antithrombotische proteine
EP0382174B1 (de) Gewebs-Plasminogenaktivator-Derivat
DE68923298T2 (de) Gewebe-plasminogenaktivator mit zymogenen oder fibrinspezifischen eigenschaften.
DE3689943T2 (de) Degradierte Spezies eines Gewebeplasminogenaktivators, pharmazeutische Zubereitung und Verfahren zur Herstellung derselben.
DE69006851T2 (de) Blutgerinnungshemmende zusammensetzungen aus faktor xa.
DE4411143C2 (de) Thrombosemittel
DE68923741T2 (de) Fledermausspeichel-Plasminogenaktivatoren.
EP1012303B1 (de) Faktor x-deletionsmutanten und analoge davon
DD251791A5 (de) Verfahren zur Herstellung von protease-resistenter Urokrinase
DE3853100T2 (de) Gewebs-Plasminogen-Aktivator-Analoge mit modifizierten Wachstumsfaktordomänen.
EP0669394B1 (de) Bifunktionelle Urokinasevarianten mit verbesserten fibrinolytischen Eigenschaften und thrombinhemmender Wirkung
WO1996001312A1 (de) Nicht-glykosylierte plasminogenaktivator-derivate und ihre verwendung bei erhöhtem blutungsrisiko
DE4442665A1 (de) Chimäre Proteine mit fibrinolytischen und thrombinhemmenden Eigenschaften
EP0917567A1 (de) Thrombinaktivierbarer plasminogenaktivator
WO1999009184A1 (de) Plasminogenaktivator mit verbesserter zymogenität und verminderter fibrinbindung
EP0361475A1 (de) Präparat von in Prokaryonten exprimiertem Plasminogenaktivator
DE4440892A1 (de) Proteine mit fibrinolytischen und gerinnungshemmenden Eigenschaften
WO1999009185A1 (de) Plasminogenaktivator mit verbesserter zymogenität
EP0400545B1 (de) Gewebs-Plasminogen-Aktivator-Derivat
DE69127346T2 (de) Behandlung thrombotischer ereignisse
US5723122A (en) Use of the protease domain of human plasminogen activator for the treatment of thromboembolic diseases
DE69003342T2 (de) Pharmazeutische Zusammensetzungen.
DE4443273A1 (de) Verwendung der Proteasedomäne von humanem Plasminogenaktivator zur Behandlung von thromboembolischen Erkrankungen
EP0796323A1 (de) Verwendung der proteasedomäne humanes gewebsplasminakilivators für die behandlung von thromboembolischen erkrankungen
EP0366091A2 (de) Domänenduplikations-Muteine des Gewebsplasminogen-Aktivators (t-PA)

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM HR HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: KR

NENP Non-entry into the national phase

Ref country code: JP

Ref document number: 1999512757

Format of ref document f/p: F

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: CA