EP0672183A1 - Procedes et trousses pharmaceutiques utilises pour detecter des micro-organismes associes aux infections vaginales - Google Patents

Procedes et trousses pharmaceutiques utilises pour detecter des micro-organismes associes aux infections vaginales

Info

Publication number
EP0672183A1
EP0672183A1 EP93914227A EP93914227A EP0672183A1 EP 0672183 A1 EP0672183 A1 EP 0672183A1 EP 93914227 A EP93914227 A EP 93914227A EP 93914227 A EP93914227 A EP 93914227A EP 0672183 A1 EP0672183 A1 EP 0672183A1
Authority
EP
European Patent Office
Prior art keywords
gram positive
nucleic acid
vaginalis
probe
oligonucleotide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP93914227A
Other languages
German (de)
English (en)
Other versions
EP0672183A4 (fr
Inventor
Diana K. Sheiness
Trevor H. Adams
Michael R. Stamm
Gerard Alan Cangelosi
Theresa Baden Britschgi
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanogen Inc
Original Assignee
MicroProbe Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by MicroProbe Corp filed Critical MicroProbe Corp
Publication of EP0672183A1 publication Critical patent/EP0672183A1/fr
Publication of EP0672183A4 publication Critical patent/EP0672183A4/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria

Definitions

  • the present invention relates to methods for diagnosing vaginal disorders associated with various microorganisms that may be used in a medical practitioner's private office or in a more structured clinical environment, such as a hospital, a commercial clinical microbiology laboratory or the like.
  • methods for simultaneously selectively detecting gram positive bacteria and at least one other microbial organism which is not a gram negative bacterial species are simultaneously selectively detecting gram positive bacteria and at least one other microbial organism which is not a gram negative bacterial species.
  • Bacterial vaginosis is characterized by an alteration of the microbiological flora of a woman's vaginal area. This alteration involves a reduction in the normally present Lactobacilli cell number and an overgrowth of anaerobes and other microorganisms, including Gardnerella vaginalis (Gv) . Other microorganisms also cause vaginal disorders as well.
  • BV is one common cause of vaginal complaints.
  • Other microorganisms commonly associated with such symptoms are Candida spp. and Trichomonas vaginalis.
  • the organisms are typically identified by wet mount or by culture. Summary of the Invention
  • the present invention provides methods for detecting the presence of various microorganisms that are found in vaginal samples. These methods are fast, accurate, and do not require an individual skilled in identifying clue cells, evaluating wet mounts or the like to assess the results.
  • non-gram positive microbe in a single complex biological sample are disclosed. They comprise:
  • the gram positive bacteria may be a Group B Streptococci and the non-gram positive microbe may be selected from the group consisting of yeasts, protozoa, mycoplasmas, and gram negative bacteria.
  • the non-gram positive microbe is Gardnerella vaginalis.
  • the oligonucleotide probe specific for the gram positive bacteria coats a first capture bead and the oligonucleotide probe specific for the non-gram positive microbe coats a second capture bead, both beads being attached to a dipstick comprising a nonporous solid support.
  • the gram positive-probe hybridization complex may be detected by a first signal oligonucleotide and the non-gram positive microbe-probe hybridization complex may be detected by a second signal oligonucleotide.
  • a method for releasing intact nucleic acid from gram positive bacteria comprising: combining a complex biological sample containing gram positive bacteria with a lysis solution of about pH 7.0 to about 8.0 containing a low ionic strength buffer and a detergent; then heating the combined solution to above 65°C for more than five minutes to release intact nucleic acid from gram positive bacteria in the absence of mechanical force.
  • Intact nucleic acid from gram negative bacteria may also be released from gram negative bacteria within the biological sample.
  • kits of the present invention can also contain dipsticks capable of specifically capturing nucleic acid from one or more of Group B Streptococci. Prevotella bivia, Ureaplasma urealyticum, Mobiluncus spp. , Bacteroides spp.. Mycoplasma spp. , Neisseria gonorrhea and Chlamvdia spp. in addition to or in lieu of Gardnerella vaginalis, Candida spp. or Trichomonas vaginalis.
  • dipsticks capable of specifically capturing nucleic acid from one or more of Group B Streptococci. Prevotella bivia, Ureaplasma urealyticum, Mobiluncus spp. , Bacteroides spp.. Mycoplasma spp. , Neisseria gonorrhea and Chlamvdia spp. in addition to or in lieu of Gardnerella vaginalis, Candida spp. or Trichomonas va
  • the present invention is directed to methods and kits useful in ;the diagnosis of microorganisms in vaginal fluid samples.
  • the invention provides means for lysing gram positive bacteria so that nucleic acid is released intact and is available for hybridization assays or other diagnostic or clinical applications. Lysis of such bacteria has heretofore been problematic, requiring mechanical means and equipment such as a French press. Further, the gram positive bacterial nucleic acid can be released along with that of other non-gram positive bacterial microbial organisms in the same sample, all such nucleic acid baing available for hybridization assays.
  • a G _ vaginalis cell number greater than or equal to a critical G . vaginalis cell number indicates that -the patient is BV- positive.
  • vaginal pH in women with BV is higher than pH 4.5, whereas the vaginal pH of women who are clinically negative for BV is almost always less than 4.5.
  • pH alone is not diagnostic for BV, because other conditions can lead to elevated vaginal pH.
  • women with BV have elevated levels of Gj. vaginalis in their vaginal tract, enumeration of G. vaginalis, taken alone, is not a good indicator of BV, because BV-negative women frequently have elevated levels of G s . vaginalis in their vaginas.
  • the present invention permits rapid measurement of pH and ( _ vaginalis levels in a patient sample, as an indication of Bacterial Vaginosis.
  • the claimed methods and kits involve determining whether the GL. vaginalis cell number in a patient sample is greater than or equal to a critical G_s_ vaginalis cell number.
  • the critical GL. vaginalis cell number is a predetermined cell number that is associated with BV.
  • the critical GL. vaginalis cell number may vary with the sample collection method employed, and is defined herein to be either cell number or cell concentration. To initially identify the critical GL. vaginalis cell number corresponding to a particular sampling method and assay procedure, the sampling method will be used to obtain specimens from a sufficient number of women that have been clinically diagnosed as BV-positive or BV-negative to establish the critical G . vaginalis cell number.
  • a range of GL_ vaginalis cell numbers from the BV-positive women will be determined, and the critical GL. vaginalis cell number will represent the bottom of this range.
  • This critical number is tied to the selected sampling method. Determination of the critical GL. vaginalis cell number will be dependent upon the sample collection procedure, such as vaginal wash, vaginal swab, or other sample obtaining means, as well as the assay used to measure the number of GL-. vaginalis cells present in that sample within a period of 6 hours or less.
  • the GL. vaginalis cell number may be measured by nucleic acid hybridization techniques, by techniques involving antibody-antigen interactions, or by any other method whose results can be correlated with a GL.
  • vaginalis cell number or GL. vaginalis cell concentration. While the critical G . vaginalis cell number may be dependent on the methods chosen for sample collection and for GL. vaginalis enumeration, the critical G. vaginalis cell number will be consistent over a 10-fold range for any selected protocol.
  • the GL. vaginalis cell number of the sample will be established by comparing patient test results to a standard curve generated by concurrently evaluating standards derived from a known number of purified, cultured GL. vaginalis. Serial dilutions of quantitated, cultured GL. vaginalis are subjected to the same assay procedures as the patient samples. The signal intensity of each, patient sample is compared to signal intensities of the diluted standards, and the patient sample can be correlated with an amount of GL. vaginalis equivalent to that i-a the matching standard dilution.
  • a specific molecule that serves as the target of the GL. vaginalis assay can be purified from a known number of cultured GL. vaginalis and used as a standard for comparison to the patient sample results.
  • 16S rRNA is the target of the assay
  • purified 16S rRNA could serve as the standard, with a given amount of 16S rRNA corresponding to a known number of G. -vaginalis cells.
  • the patient sample .results could be expressed in units equivalent to molecules of 16S rRNA; BV-positive and BV-negative women are characterized according to how many 16S rRNA equivalents are present in the sample.
  • This approach could i ⁇ e used for any other purified molecule obtained from a -known number of GL. vaginalis cells.
  • a separate experiment could determine the number of 16S rRNA molecules per GL. vaginalis cell, and thereafter the 16S rRNA standard could be used, but the results could be expressed per GL. vaginalis cell number. Since the number of target molecules (such as 16S rRNA) per cell can vary during different stages in the GL_ vaginalis cell growth cycle, the number of correlate molecules per cell should be established using a known number of GL. vaginalis cells that are in the mid-log phase of growth.
  • this numerical equivalency will be determined only once, and thereafter the purified target molecule, such as 16S rRNA, can be used as a standard, with conversion to numbers of GL. vaginalis cells according to the established numerical equivalency.
  • the critical G. vaginalis cell number may be determined (i.e., the minimum number of GL. vaginalis cells associated with BV- positive women) . While some of the BV-negative women may have G. vaginalis cell numbers greater than the critical level, these women will nearly always be found to have a vaginal pH ⁇ 4.5, and thus will be diagnosed as BV- negative when the diagnostic kit instructions are followed.
  • a critical cell number may be determined for an organism other than G. vaginalis in a manner similar to that set forth above for determining critical GL. vaginalis cell number.
  • the critical cell number for women presenting with Candidiasis may be determined relative to indigenous Candida spp. levels found in the vagina. For organisms not normally found in vaginal fluid, no critical cell number exists. The presence of such cells in any number indicates an abnormality.
  • the lower detection limit of the kit for IL. vaginalis under ideal conditions is about 5 x 10 3 cells. This cell number or one as close to it as possible will be used to indicate positive results of a "T__ vaginalis probe.
  • the concentrations of the reaction components of a solid phase assay kit of the present invention will be adjusted to ensure that a positive signal will be obtained only if the amount of GL. vaginalis present is equal to or greater than the critical GL. vaginalis cell number.
  • the lower limit of detection of the kit for GL_ vaginalis is about 2 x 10 5 cells.
  • the critical G. vaginalis cell number will generally range from about 5 x 10 6 to about 5 x 10 9 cells per ml of vaginal fluid, with about 8 x 10 6 to about 10 9 cell/ml of vaginal fluid preferred, and about 2 x 10 7 cells/ml of vaginal fluid particularly preferred.
  • vaginal fluid samples that may be tested in accordance with the present invention may be obtained in any conventional manner.
  • Exemplary sample obtaining methodologies involve the use of a vaginal swab, vaginal wash techniques or the like.
  • the pH determining step of the methods of the invention may be accomplished by conventional techniques, such as contacting a sample, such as a vaginal swab or speculum, with pH paper or another pH indicating substrate and observing an alteration in the color of the paper or substrate that is indicative of relevant sample pH.
  • the pH indicator may be included within a diagnostic kit of the present invention as a separate structural unit or as a portion of the structure of a diagnostic indicator card or dipstick. Alternatively, the pH indicator might be provided by the clinician. In addition, pH may be measured with electrodes or with commercially available pH indicators; alternatively, known pH indicators can be immobilized on a solid support.
  • the GL. vaginalis cell level may be determined by any method yielding an accurate measurement thereof that may be performed in 6 hours or less. Consequently, probes, including oligonucleotide sequences that are complementary to GL. vaginalis DNA or RNA, antibodies selective for GL. vaginalis or the like, may be used for this purpose. Direct hybridization assay techniques may be used in making the GL. vaginalis cell level determination. Sandwich assay techniques employing oligonucleotide probes or antibodies are preferred. In another embodiment of the present invention, several microorganisms associated with vaginal complaint are detected simultaneously and rapidly using one sample preparation. When patients present with vaginal complaints, microorganisms commonly associated with such symptomology include Candida spp.
  • the claimed invention describes lysis conditions suitable for releasing target nucleic acid from each of the microorganisms above plus mycoplasma, gram positive bacteria, other yeasts, and other protozoa (representing both prokaryotic and eukaryotic cells) .
  • the released nucleic acids, and preferably released ribosomal RNAs are then simultaneously processed and detected in a sandwich assay.
  • the present invention also contemplates diagnostic kits for determining whether a patient is afflicted with BV, including a first indicator capable of indicating pH; and a second indicator capable of indicating a GL. vaginalis cell number or level associated with the disease state. Indicators of the presence of other organisms, such as Candida albicans. Trichomonas vaginalis.
  • kits of the present invention may also be included in the kits of the present invention.
  • the kits of the present invention may be employed to detect BV, vaginitis or cervicitis.
  • the kit may contain a strip of pH indicating paper and a diagnostic indicator card, such as a dipstick.
  • a cell disruption buffer/hybridization solution or a ligand incubation solution may also be included within the kits of the present invention to facilitate employment of sandwich assay techniques.
  • the pH indicator may be structurally integrated with the GL. vaginalis cell number indicator.
  • the kits may be used in manual or semi-automatic testing procedures, and are preferably employable in sandwich assay techniques.
  • lysis solutions that effectively release nucleic acid from each target microorganism must be determined.
  • exemplary lysis solutions will include a buffer, a detergent, and may also include other buffers, detergents, enzymes, reducing agents, organic solvents, antibiotics, chaotropic agents, cations, chelates, preservatives or combinations thereof.
  • a low ionic strength buffer is a buffer having a total ion concentration of about 15 mM to about 150 mM.
  • Buffers useful in accordance with the present invention include, but not limited to, the following: brucine tetrahydrate, 4-(2-hydroxyethy1)-1-piperazinepropane sulfonic acid (“EPPS”) , tris(hydroxymethyl)aminomethane (“TRIS”), N-tris(hydroxymethyl)methylglycine (“TRICINE”) , glycinamide, N,N-bis(2-hydroxyethyl)glycine (“BICINE”) , N-tris(hydroxymethyl)methyl-2-aminopropane sulfonic acid (“TAPS”), N-glycyl-glycine, histidine, boric acid, Pyrophosph ⁇ ric acid, ethanolamine, glycine, trimethylamine, cyclopentanetetra-1,2,3,4-carboxylic, carbonic (H 2 C0 3
  • Detergents useful in the lysis solution of the present invention include the following: Anionic detergents including but not limited to, the following: cxaprylic acid, sodium salt, cholic acid, sodium salt, 1-decanesulfonic Acid, sodium salt, deoxycholic acid, sodium salt; glycocholic acid, sodium salt; glycodeoxycholic acid, sodium salt; lauryl sulfate, sodium salt ("SDS"); N-lauroylsarcosine, sodium salt; taurocholic acid, sodium salt; and taurodeoxycholic acid, sodium salt;
  • Anionic detergents including but not limited to, the following: cxaprylic acid, sodium salt, cholic acid, sodium salt, 1-decanesulfonic Acid, sodium salt, deoxycholic acid, sodium salt; glycocholic acid, sodium salt; glycodeoxycholic acid, sodium salt; lauryl sulfate, sodium salt (“SDS”); N-lauroylsarcosine, sodium salt; taurocholic acid
  • Cationic detergents including but not limited to the following: cetylpyridinium chloride, dodecyltrimethylammonium bromide, hexadecyltrimethylammonium bromide, tetradecyltrimethylammonium bromide;
  • Zwitterionic detergents including but not limited to, the following: CHAPS and CHAPSO; and Non-ionic detergents including but not limited to, the following: n-decyl-/3-D-glucopyranoside, digitonin, n-dodecyl J-D-glucopyranoside, n-dodecyl- j(3-D-maltoside, n-heptyl /3-D-glucopyranoside, n-octyl- jS-D-glucopyranoside, n-octyl ⁇ -D-glucopyranoside, nonidet P-40, n-nonyl-/3-D-glucopyranoside and Triton X-100.
  • a lysis solution in a low ionic strength buffer having a pH of about 7.0 to about 8.0. Once the sample and lysis solution have been combined, the combined solution is heated for over five minutes at at least 65°C. This enables the lysis and subsequent release of the nucleic acid.
  • the nucleic acid is "intact" in that it exists in sufficient form to be available for hybridization assays, i.e. fragments of at least 18 nucleotides are present.
  • Preferred capture oligonucleotides are selected for booth target specificity and duplex (or hybridization- complex) formation with target in a solid phase sandwich assay format. The latter characteristic is particularly important when the target is ribosomal RNA.
  • Signal oligonucleotides may be selected from a range of speci-ficities. That is, signal oligonucleotides may be specific for prokaryotic target nucleic acid or eukaryotic target nucleic acid, or may specifically hybridize with the genus and/or species of the target.
  • capture oligonucleotides may impact the sensitivity and selectivity of detection of a particular panel of microorganisms.
  • concentration of capture oligonucleotide on a bead may impact the sensitivity and selectivity of detection of a particular panel of microorganisms.
  • nucleic acid sandwich hybridization assays can determine modifications or adjustments of these parameters that optimize simultaneous detection of a particular panel of target microorganisms.
  • the target nucleic acid is usually released from the target microorganism into a solution.
  • the target nucleic acid solution is then transferred to or adjusted to solution conditions in which hybridization to a solid support can occur.
  • Such an assay technique may also be employed on a portion of the original patient sample that has been manipulated in some manner (i.e., purified, treated chemically or the like).
  • target nucleic acid is typically sequestered (captured) from the original patient sample by hybridization (i.e., pairing of complementary bases) with capture oligonucleotide probes that are covalently immobilized on the surface of a solid support.
  • the target nucleic acid from the original patient sample may be amplified to form an amplicon which is captured and hybridized to the signal probe.
  • the captured target nucleic acid is then hybridized to a signal oligonucleotide probe having a detectable label bound thereto, or having the capability of binding to a moiety having a detectable label bound thereto.
  • the signal probe is specific for an alternative site on the target nucleic acid.
  • signal hybridization can be performed simultaneously with capture hybridization by including the signal probe within, for example, the hybridization solution. This results in a "sandwich" of the capture oligonucleotide probe:target nucleic acid:signal oligonucleotide probe.
  • the solid support is washed to remove unhybridized material, and the labeled nucleic acid is then measured in accordance with detectable characteristics of the label.
  • sandwich assays involving antigen/antibody technology antigen is either present in the original sample, extracted therefrom or released from organisms contained in the original sample by reagents that disrupt the cell wall and/or membrane.
  • the antigen is sequestered (captured) from the test sample by interaction with antigen specific antibody that is covalently immobilized on the surface of a solid support.
  • the captured target antigen may then be incubated with a signal antibody having a detectable label bound thereto, or having the capability of binding to a moiety having a detectable label bound thereto.
  • the signal antibody is specific for an alternative site on the target antigen.
  • signal antibody binding can be performed simultaneously with capture by including the signal antibody within, for example, the incubation solution. This results in a "sandwich" of the capture antibody: arget antigen:signal antibody.
  • the solid support is washed to remove unbound signal antibody, and the labeled antigen is then measured in accordance with detectable characteristics of the label.
  • biotin/avidin or biotin/streptavidin technology may also be employed.
  • biotin/avidin interaction may be exploited to couple a more generalized detection system to the oligonucleotide probe or antigen/antibody sandwich assays.
  • the signal probe of the sandwich assay may be covalently bound to biotin.
  • This biotin-labeled signal probe can then be incubated with avidin or streptavidin, its complementary ligand, having a detectable label bound thereto.
  • avidin/detectable label can be prepared in large scale and can bind to signal/biotin moieties in a variety of sandwich assays.
  • Other ligand pairs are also useful in the solid phase assays of the present invention. Exemplary of such additional ligand pairs are lectin:sugar, hormone:hormone receptor and the like.
  • the preferred solid support for use in the diagnostic methods and kits of the present invention is a polymer-coated bead having activatable amine groups, as described in copending U.S. Patent Applications Serial Nos. 444,872 and 522,442.
  • Bead solid supports useful in accordance with the present invention possess certain advantages over known membrane or bead solid supports, to which capture nucleic acid sequences are noncovalently bound.
  • the capture rate of target nucleic acid sequences is improved 5- to 25-fold.
  • Virtually all of the capture nucleic acid sequence bound to the solid support is available for hybridization with a complementary sequence.
  • the quantity of immobilized capture nucleic acid can be increased approximately 20-fold on an apparent surface area basis.
  • the preferred solid supports may be more easily manufactured than their prior art counterparts.
  • such beads possess covalently immobilized capture nucleic acid sequences (oligonucleotides) that can withstand denaturation temperatures in excess of 90°C for 10 or more minutes.
  • a multisite dipstick employing a plurality of bead solid supports can be constructed, leading to miniaturization of the dipstick device and reduction in the volume of sample required for detection.
  • Capture nucleic acid sequences can be directly immobilized on a microtiter plate or on loose beads which are placed in the wells of a microtiter plate.
  • Covalent immobilization of an oligonucleotide on a solid support may be accomplished by the following procedure: treating a solid support with an activating agent, if necessary; reacting the treated solid support with an amine-containing polymer, whereby the polymer coats the solid support; activating an oligonucleotide with a monofunctional or multifunctional reagent, preferably the homotrifunctional reagent, cyanuric chloride; and conjugating the activated oligonucleotide and the polymer-coated solid support.
  • the unreacted amines on the support surface are then acylated to impart the proper surface charge to the solid support surface, thereby minimizing non-specific interaction with nucleic acid.
  • nucleic acid includes single stranded DNA and RNA, and double stranded DNA, RNA and DNA-RNA hybrids.
  • lysis refers to rendering nucleic acids or antigens of cells contained in the test sample available to the capture probe or ligand.
  • the cells acted upon by a lysing agent may or may not be structurally altered in a manner detectable by visual inspection under a microscope.
  • Exemplary lysing solutions useful in practicing the present invention include detergents (e.g., anionic, cationic and/or non-ionic) , chaotropic agents, enzymes (e.g., proteases, sialidases, glycosidases, .
  • glucanases chitinases, lyticase, lysozyme, lipases, hyaluronidase, and the like
  • organic solvents reducing agents (e.g., dithiothreitol, /3-mercaptoethanol or the like)
  • chelating agents e.g., EDTA, EGTA and the like
  • antibiotics or the like used alone or in combination.
  • One preferred embodiment of the present invention involves pretreatment with one or more enzymes, organic solvent, or reducing agent prior to addition of a chaotropic agent. Lysis may be conducted at ambient or at elevated tempe r ature.
  • solid support refers to any surface that is transferable from solution to solution and that has means for attaching a bead.
  • a bead may be attached to a perforation or depression in the solid support.
  • the term “bead” refers to a structure for conducting oligonucleotide-based assays, and includes beads, microbeads, powder, membranes, microtiter wells, strings, fabric, plastic strips, films, or any surface onto which nucleic acid probes or antigen may be immobilized.
  • Solid supports useful in the practice of the present invention may exhibit natural or intrinsic fluorescence.
  • the term “bead” encompasses any type of solid or hollow sphere, ball, bearing, cylinder, or other similar configuration composed of plastic, ceramic, metal, nylon, or polymeric material onto which a nucleic acid or antigen can be covalently immobilized. As such, the term also includes nylon string.
  • spherical nylon beads are employed in the methods and kits of the present invention.
  • a preferred diameter range for such beads is from about 0.01 inch to about 0.5 inch, more preferably from about 0.05 inch to about 0.1 inch, and most preferably about 0.06 inch (corresponding to commercially available 3/32 inch nylon beads) .
  • the nylon beads are burnished or roughened before treating with an alkylating agent.
  • a nylon bead (or beads or any composition or structure of nylon) is activated by treating the bead with an alkylating agent.
  • Alkylating agents react with amides present in the nylon polymer to form reactive imidate esters.
  • Preferred alkylating agents include, but are not limited to, dialkyl sulfates, alkyl triflates, alkyl- diphenyl sulfonium salts, alkyl perchlorates, and, more preferably, trialkyloxonium salts.
  • Exemplary trialkyl- oxonium salts useful in the present invention include lower alkyl salts, such as trimethyloxonium and triethyl- oxonium salts.
  • Exemplary salt counterions are hexachloro- antimonate, hexafluorophosphate, and tetrafluoroborate, with the last named counterion being preferred.
  • An alkylating agent solvent that does not dissolve nylon or render nylon tacky during the alkylation procedure is preferably employed in activating the preferred nylon solid support useful in the diagnostic methods and kits of the present invention.
  • Non- nucleophilic organic solvents such as dichloromethane, dimethylsulfoxide, tetrahydrofuran, and others, are exemplary solvents that may be employed for this purpose.
  • N-methyl-pyrrolidone is preferred, because it is a solvent that supports alkylation.
  • the resulting bead surface imidate esters are then reacted under suitable conditions with an amine- containing polymer, whereby amidine residues are formed.
  • Any primary or secondary amine-containing polymer can be employed to form amidine residues, thus covalently immobilizing the polymer onto the surface of the bead.
  • Poly(ethylene-imine) , polyallylamine, and polyvinylamine are preferred examples.
  • the preferred solvent used to dissolve the polymer during the conjugation of the polymer to the activated nylon bead is N-methyl-pyrrolidone.
  • nylon can also be partially hydrolyzed to yield reactive amine or carboxyl groups (capable of subsequently reacting with amine- or carboxyl- containing polymers) . In this manner, an activated solid support coated with reactive moieties may be produced.
  • Dipsticks are preferably employed in the methods and kits of the present invention. Dipsticks having utility in nucleic acid hybridizations indicating G. vaginalis. and including a nonporous bead support and a means for attaching a bead thereto, are so employed.
  • Nonporous bead supports are known in the art.
  • An example of bead attachment to a nonporous bead support involves a perforation or perforations (or a depression or depressions) in the nonporous bead support, wherein beads can be attached.
  • perforations are employed and the beads are attached by pressure fit within the circumference of the such perforations.
  • bead attachment methods may be employed in production of a dipstick useful in practicing the present invention.
  • the dipstick used in the methods and kits of the present invention may contain more than one bead.
  • the dipstick will contain from about two to one hundred beads, and more preferably about two to ten beads, each within its own perforation. More preferably, the plurality of bead-containing perforations will be situated in a row along one edge of the dipstick.
  • Such a dipstick can function as an indicator card. Specifically, multiple beads with covalently attached capture oligonucleotide probes or antigens with different sequences or specificities are closely aligned on a multisite dipstick, thereby facilitating the detection of a multiplicity of organisms in a single biological sample.
  • a particular bead may contain oligonucleotides representing a plurality of nonidentical nucleic acid sequences (for example, sequences from a group of related organisms) , or a bead may only contain a plurality of identical oligonucleotides having a specific nucleic acid sequence.
  • a dipstick useful in the practice of the present invention will include a bead specific for G. vaginalis. a positive control, a negative control and, optionally, a pH indicator bead or strip.
  • Conventional pH indicators can be absorbed onto or covalently attached to a solid support to be incorporated into a solid phase assay format. See, for example, "Indicators,” Bishop (ed.), in Belcher et al.
  • the dipstick may include beads specific for a gram positive bacteria in addition to a bead specific for GL. vaginalis. Such a dipstick will indicate whether the sample cell number is greater than or equal to the critical cell number for these two vaginal pathogens, and will provide a more comprehensive diagnostic tool, since vaginitis may also be detected (and causative organisms distinguished) through the practice of this embodiment of the present invention.
  • the dipstick may include beads specific for Neisseria gonorrhoea. Chlamydia spp..
  • dipsticks may be packaged with one or more lysis reagents capable of freeing target nucleic acid sequences for hybridization with the capture and signal probe components of the kits of the present invention.
  • Exemplary dipsticks of this embodiment of the present invention include the following: T-j. vaginalis. Group B Streptococcus and Prevotella bivia for prenatal risk assessment; GL. vaginalis. Mycoplasma hominis and Mobiluncus spp. for bacterial vaginosis; Chlamydia trachomatis and Neisseria gonorrhea for sexually transmitted diseases; and the like.
  • The*development of a dipstick-based assay capable of detecting the presence of multiple target nucleic acids requires identification of three key parameters: (1) the lysis or release of target nucleic acid from the: sample; (2) the capture and detection of the target nucleic acid; and (3) the reagent components of the assay format. ⁇ If the reagent components remain constant (i.e., hybridization conditions, wash solutions, detection enzyme, and the like) , one skilled in the art can identify and select specific capture and signal oligonucleotides for hybridization with the target nucleic acid. When the conditions for capture and detection of the target nucleic acid are defined, one skilled in the art can determine lysis conditions that allow the release of the target nucleic acid from a biological sample. The lysis conditions may vary for each of the target microorganisms, and a balance- of lytic conditions allows the simultaneous detection of the target organisms. If these parameters are identified, the critical cell number for each microorganism can be determined in biological samples.
  • the critical cell number may vary with the method used to acquire the sample, and can be defined as the cell number that leads to symptomatic presentation of a disorder. Symptomatic presentation is particularly relevant for disorders where an asymptomatic presence of the microorganism is possible.
  • oligonucleotide-coated beads may be employed in a micro-titer well format. This format may be advantageously used when a large number of patient samples are assayed. Further, the microtiter well format is compatible with signal probes that are detected through means of a soluble reaction product.
  • the first method involves direct immersion of the sample in 3 M guanidinium thio- cyanate (GuSCN) .
  • the second method (2) requires heating to 65'C in 1 mg/ml proteinase K, followed by the addition of GuSCN to a final concentration of 3 M.
  • the third method (3) requires heating at 85°C in a buffered solution containing detergents, followed by addition of GuSCN to a final concentration of 3 M.
  • a "Spiked” means a swab was taken from a BV-negative woman, and about 5 x 10 7 cultured organisms were placed directly onto the swab. The swab is then processed as if it were a patient sample.
  • a plus sign indicates successful detection of target nucleic acid in the presence of vaginal fluid samples.
  • patient samples are collected into proteinase K followed by GuSCN addition (method (2)) for Candida albicans and GL. vaginalis detection, and into 3 M GuSCN (method (1) ) for Trichomonas vaginalis detection.
  • GuSCN addition method (2)
  • Method (1) Trichomonas vaginalis detection
  • two patient samples are collected simultaneously, or one patient sample would be divided into aliquots, and incubated in 5 M GuSCN and 1 mg/ml proteinase K, respectively.
  • the two solutions are then mixed to a final GuSCN concentration of 3 M.
  • the sandwich assay is then performed on this mixture.
  • Still another alternative involves the identification and use of a lysis reagent useful for the release of nucleic acid from all organisms of interest (method 3, described above)
  • the components of the buffered detergent solution, heating temperature, and time of heating may be adjusted for each organism individually or for the organisms in combination. It will be obvious to one of ordinary skill in the art that, although the above discussion was set forth primarily in terms of nucleic acid hybridization assays, many other uses for these dipsticks are contemplated. Any member of a ligand pair can be attached to beads in the dipstick, and the dipstick can then be used to identify the corresponding ligand member.
  • antigens or antibodies could be attached to beads, as described above, in a: dipstick, and then corresponding antibodies or antigens, respectively, could be identified.
  • other ligand systems such as biotin and strept- avidin, can be used.
  • the diagnostic methods of the present invention correlate well with traditional clinical diagnoses of BV.
  • Illustrative patient samples used for comparative diagnostic testing were obtained from single, white females in their 20's at the Student Health Clinic at the University of Washington.
  • the "normal" (i.e., BV- negative) patients were attending the clinic for routine examinations and showed no symptoms of vaginitis. pH was routinely measured at the time the samples were taken.
  • a vaginal sample was obtained and analyzed in accordance with conventional techniques to obtain a conventional BV diagnosis. Subsequently, a vaginal wash was obtained, and a portion of this sample was mixed with concentrated 5 M GuSCN solution to yield a final concentration of 3 M GuSCN.
  • the sample was concentrated onto nitrocellulose paper by slot blot techniques and then hybridized with a radiolabeled, G. vaginalis-oligonucleotide probe (i.e., the probe hybridizes specifically with 16S rRNA of GL. vaginalis when challenged with more than 70 other potentially cross- reacting species that may be found in the normal microflora of the vagina) .
  • Hybridization of 32 P-labeled probe to each sample was determined by autoradiography, and levels of probe hybridization to samples and standards were compared.
  • a comparison of patient sample slot blot results with standards of known target nucleic acid concentrations allowed quantitative determination of the number of GL. vaginalis cells in the patient samples.
  • pH greater than 4.5
  • number of GL. vaginalis cells greater than or equal to approximately 2 x 10 7
  • diagnostic criteria of the present invention were used in evaluating the slot blots, BV was detected with a sensitivity of 95.3% and a specificity of 98.6.%.
  • the preferred diagnostic methods and kits of the present invention function through hybridization reactions, which constitute the established method for identifying specific nucleic acid sequences.
  • Hybridization is based upon the pairing of complementary nucleic acid strands. When complementary single stranded nucleic acids are incubated in appropriate buffer solutions and conditions, complementary nucleotide sequences pair to form stable, double stranded molecules (i.e., the sequences hybridize).
  • hybridization technique employed is not essential to the methods and kits of the present invention, and one of ordinary skill in the art will appreciate the variety of such techniques.
  • Hybridization techniques are generally described in Hames et al. (eds.), "Nucleic Acid Hybridization, A Practical Approach", IRL Press, New York, 1985. As improvements are made in hybridization techniques, they will be readily applicable to the present invention.
  • diagnostic dipstick and immunoassay technologies are known and employed in the art for a variety of purposes.
  • a second hybridization with a signal oligonucleotide probe must occur. In this manner, the presence of captured target nucleic acid is confirmed, and the amount of captured target nucleic acid may be quantified.
  • the detection of successful or unsuccessful hybridizations may be accomplished in accordance with methods known to practitioners in the art, such as colorimetric, chemiluminescent or fluorescent means.
  • Indirect quenching fluoroimmunoassay, double receptor fluoroimmunoassay, or protection fluoroimmuno ⁇ assay are known assay formats that use antibodies directed against the fluorescer. These assays are based on competition for the fluorescer-labeled antigen by the antigen-specific antibody and the fluorescer-specific antibody.
  • oligonucleotides covalently immobilized on polymer-coated beads or similar structures can serve as nucleic acid probes.
  • Hybridization assays that detect the presence of specific target nucleic acid in complex biological samples can be conducted utilizing such immobilized oligonucleotide probes.
  • oligonucleotide refers to a short nucleic acid sequence that is approximately 6 to 150 bases in length.
  • Such oligonucleotides can be used as capture or signal probes in hybridization assays, and are preferably chemically synthesized using commercially available methods and equipment.
  • the solid phase phosphoramidite method can be used to produce short probes of between 6 and 100 bases having a molecular weight of less than 16,000 daltons.
  • the oligonucleotides see generally Caruthers et al. , Cold Spring Harbour Symp. Quant. Biol. 47:411-18, 1982; and Adams et al. , J. Am. Chem. Soc.
  • Activated oligonucleotides refer in general to oligonucleotides that have been reacted with a chemical compound and rendered chemically active.
  • the term “activatable” refers to the potential of a moiety to become chemically reactive.
  • nucleic acid sequences from GL. vaginalis isolates one can select an oligonucleotide sequence for GL. vaginalis detection that is either type-specific, species-specific or genus- specific. Comparisons of nucleic acid regions and sequences can be conducted using commercially available computer programs.
  • Oligonucleotide probes useful in the present invention are capable of hybridizing with a nucleic acid sequence specific for GL. vaginalis 16S GL. vaginalis rRNA is a preferred GL. vaginalis nucleic acid target for this purpose, because it is present in several thousand copies per cell.
  • oligonucleotides complementary to sequences in the GL. vaginalis genome or in GL. vaginalis plasmids may also be employed.
  • oligonucleotide probes useful in the present methods and kits are provided in the "Materials" section of this description and in Example 6.
  • the preferred capture oligonucleotides for use in the present invention are synthetic oligonucleotides from about 15 to about 100 bases in length.
  • a spacer (linker) arm i.e., a chemical moiety that extends or links other chemical groups, and preferably is a carbon chain containing from about 2 to about 12 carbon atoms, more preferably about 6 carbon atoms
  • a primary amine is the preferred group for reaction with monofunctional or multifunctional reagents, and its attachment via a hexyl arm is preferred. Reagents useful for the attachment of spacer arms terminating in a primary amine are commercially available. Starting materials suitable for use in accordance with the present invention are known in the art.
  • an oligonucleotide possessing a 5' -terminal structure such as A
  • X is -NH- or -NHC:0(CH 2 ) m NH-, wherein m is 2-12, inclusive;
  • Y is 4,6-dichlorotriazine (preferred) or a thiol (sulfhydryl) -reactive moiety;
  • A is an oligonu ⁇ cleotide, ranging from about 9 to about 100 bases, preferably from about 15 to about 30 bases, with only the 5'-hydroxyl oligonucleotide moiety requiring modification for attachment.
  • the 3' end of the oligo ⁇ nucleotide may be similarly modified to contain a reactive group.
  • Selected oligonucleotides are then activated with a monofunctional or multifunctional reagent.
  • exemplary reagents include homotrifunctional, heterotrifunctional, homobifunctional, and heterobifunctional reagents.
  • Selected oligonucleotides may be activated and linked to polymer-coated solid supports according to the following chemistries.
  • An amine-tailed oligonucleotide can be activated with a monofunctional or multifunctional reagent (e.g., cyanuric chloride).
  • a monofunctional or multifunctional reagent e.g., cyanuric chloride.
  • the alkylamino dichloro- triazine formed in the activation step is reactive toward the amine-containing polymer bound to the solid support.
  • cyanuric chloride a homotrifunctional reagent
  • other activating reagents can be used.
  • N-succinimidyl-4- (iodoacetamido) - benzoate (SIAB) is a suitable heterobifunctional reagent
  • disuccinimidyl suberate is a suitable homobifunctional reagent.
  • the heterobifunctional reagent l-ethyl-3- (dimethyl- aminopropyl) -carbodiimide can be used.
  • Other similar monofunctional and multifunctional (heteromultifunctional and homomultifunctional) reagents are suitable for use in the practice of the present invention.
  • oligonucleotide activation and linking chemistries result in the selective activation of an amino group on an oligonucleotide, without modification of any of the purine and pyrimidine bases of the oligonucleotide.
  • the preferred chemistry employs cyanuric chloride (2,4,6,-trichloro-1,3,5, -triazine) .
  • Oligonucleotides possessing a 5' or 3' tethered (via a hexyl arm) nucleophilic amine moiety (or internal aminoalkyl groups substituted on pyrimidine or purine bases) are reacted with an excess, preferably 50- to 200-fold, of recrystallized cyanuric chloride at, preferably, 19-25°C in a part organic solvent, such as N-methyl pyrrolidone, for 1 to 2 hours.
  • a part organic solvent such as N-methyl pyrrolidone
  • the unreacted cyanuric chloride can be removed by exclusion chromatography or ultrafiltration.
  • the treated solid support and activated oligonucleotide are then conjugated. Specifically, they are mixed together and preferably incubated at from about 20 to 50°C for about 1 to 24 hours.
  • the residual (unreacted) amines on the bead surface can be capped (blocked) with an agent, such as succinic anhydride, preferably in N-methyl pyrrolidone in the presence of an appropriate base, such as sodium borate, to render the surface compatible (negatively charged) for nucleic acid hybridization.
  • an agent such as succinic anhydride, preferably in N-methyl pyrrolidone in the presence of an appropriate base, such as sodium borate, to render the surface compatible (negatively charged) for nucleic acid hybridization.
  • an agent such as succinic anhydride, preferably in N-methyl pyrrolidone in the presence of an appropriate base, such as sodium borate, to render
  • the target nucleic acid is usually a polynucleotide with an average length ranging from about 20 to about 20,000 bases or nucleotides in length.
  • Suitable conditions for hybridization relate to stringency conditions wherein base-pairing mismatching is minimized or non-existent. The degree of acceptable mismatching is dependent upon the specificity required, in a manner recognized by a practitioner in the art.
  • Signal oligonucleotide probes useful in accordance with the preferred methods and kits of the present invention are oligonucleotides conjugated to or conjugable with detectable labels.
  • Various labels can be used in hybridization assays of this invention. Such labels act as reporter groups for detecting duplex formation between the target nucleic acid and its complementary signal sequence.
  • a reporter group as used herein is a group having a physical or chemical characteristic that can be measured or detected. Detectability may be provided by such characteristics as enzymatic activity, color change, luminescence, fluorescence, or radioactivity, or it may be provided by the ability of the reporter group to serve as a ligand recognition site. Any haptenic or antigenic compound can be used in combination with a suitably labeled antibody for this purpose.
  • Exemplary enzymes of interest as reporter groups are hydrolases, particularly phosphatases, esterases, ureases, and glycosidases, oxidoreductases, particularly peroxidases, and the like.
  • Fluorescent compounds include fluorescein and its derivatives, rhodamine and its derivatives, dansyl, umbelliferone, and the like.
  • Chemiluminescers include luciferin, luminol, oxetane- diones, and the like. The above list is illustrative only, and the choice of label depends on sensitivity requirements, ease of conjugation with the probe, stability requirements, and available instrumentation.
  • the extent of hybridization may be quantified using a method or technique of fluorescent quenching, described in copending U.S. Patent Application Serial No. 558,967.
  • Dipstick (i.e., insoluble) diagnostic format fluorescent quenching employs a solid support, such as nylon, that fluoresces when irradiated with ultraviolet light (240 to 400 nanometers (nm) ) .
  • Colorimetric insoluble enzymatic product deposited on the solid support during the preferred assay procedure quenches the fluorescence of the solid support, thereby providing a means of quantifying the amount of product using commercially available fluorometers.
  • the solid supports described herein do not require a plurality of fluorescent chromophoric groups to be bound thereto, but rather rely on the intrinsic or natural fluorescence of the polymeric material forming the solid support.
  • the irradiation and detection of fluorescence in a hybridization assay methodology utilizing this type of support are also not dependent on the use of narrow or specific wavelengths of ultraviolet or visible light.
  • a sandwich may be formed in which a target nucleic acid is hybridized to the solid support; a signal biotinylated-oligonucleotide is then hybridized to the target nucleic acid; and reporter enzyme conjugated to streptavidin is bound to the biotinylated oligonucleotide.
  • reporter enzyme product is allowed to deposit or accumulate on the surface of the solid support. In most cases, the quantity of enzymatic product produced is directly proportional to the quantity of captured target nucleic acid.
  • the solid support is then irradiated with an ultraviolet light source (240 to 400 nm) and the resultant fluorescence is determined with a fluorometer.
  • the intensity of the measured fluorescence is inversely proportional to the quantity of enzymatic product deposited on the solid support.
  • the reporter enzyme product is colored, product deposited or accumulated on the surface of the bead can be qualitatively and/or quantitatively determined.
  • Quantitative determinations may be performed visually or by an instrument capable of analyzing and/or measuring gradations of color, either directly or using shades of grey. Such quantitative determinations generally include a comparison to standards.
  • the fluorescence quenching method the only required property of an enzymatic product useful in quantifying the amount of captured target nucleic acid is the ability to quench or mask the fluorescence of the solid support.
  • Any type of enzyme which produces a colorimetric product can be utilized in the fluorescent quenching assay.
  • Exemplary enzymes include horseradish peroxidase (HRP) , alkaline phosphatase (AP) , beta- galactosidase and the like.
  • Representative substrates for each exemplary enzyme include 4-methoxynaphthol (4MN) , 5-bromo-4-chloroindoyl-3-phosphate/nitroBlue tetrasolium (NBT) , and o-nitrophenyl-beta-D-galactopyranoside (ONG) , respectively. Since the quantity of enzymatic product produced is proportional to the quantity of captured target nucleic acid, and the quenching of fluorescence by the colored product is proportional to the quantity of product produced, a quantitative determination of captured target nucleic acid can be made. In most cases, the relation between captured target nucleic acid and fluorescence quenching is linear.
  • the solid support must necessarily possess some type of fluorescence when irradiated by ultraviolet or visible light.
  • the fluorescence can be intrinsic or inherent to the material composing the solid support, or fluorescent compounds can be bound (either covalently or non-covalently) to the solid support during the manufacturing or derivitization process.
  • Exemplary fluorescent compounds include fluorescein, Texas Red, rhodamine and the like.
  • Dipstick format diagnostics of the present invention may be evaluated by visual assessment only.
  • the bead will turn from its natural color to an indicator color, such as blue, to indicate positive results.
  • an indicator color such as blue
  • a dipstick might be designed to turn an indicator color visible to the eye when a sufficient amount of a target nucleic acid is present.
  • This embodiment of the present invention will not require irradiation of the sample with ultraviolet light or detection with a fluorometer.
  • fluorescent enzymatic product may be employed in a soluble detection format (e.g., 96 well format) of the present invention.
  • a soluble detection format e.g., 96 well format
  • the fluorescent enzymatic product must be measured in an environment that neither quenches the product nor is fluorescent itself. Since the preferred solid supports described herein possess a very high intrinsic fluorescence in their native state, it is not possible to accurately measure a fluorescent soluble enzymatic product in the presence of the preferred solid support. Such a solid support must therefore be removed from the substrate solution or the solution decanted and placed in a separate vessel to allow accurate determination of fluorescence.
  • colored or coated polymeric beads may be employed.
  • Coloring the preferred solid support with a dye of any color significantly reduces or quenches the intrinsic fluorescence thereof. Coating serves to mask any intrinsic fluorescence of a particular solid support. This reduction in fluorescence permits the solid support to be present during soluble enzymatic product fluorescence measurement, thereby obviating the need to transfer solutions or solid supports. Fluorescent signal detection may also be accomplished by employing microtiter wells directly coupled to the capture nucleic acid sequence. If a bead or solid support (preferably dyed or colored) remains in solution during fluorescent signal detection, bead-to-bead or solid support-to-solid support fluorescence must be relatively uniform.
  • the standard deviation of bead-to-bead intrinsic fluorescence should not exceed the standard deviation of the assay (typically 1 to 10%) or of the detected fluorescence (typically 1 to 5%) , in order to fully utilize the potential of the fluorescent substrate.
  • This procedure is used in the microtiter well format of the present invention, where a soluble fluorescent product is measured directly in the presence of the colored bead. Less meaningful measurements are obtained when deviations greater than those set forth above occur.
  • Virtually any color of dichlorotriazine, azo, or other permanent dyes will reduce the intrinsic fluorescence of the nylon approximately 500-fold. Exemplary dye colors are black, blue, red, green, yellow, purple, orange and the like, with the only requirement with respect to dye color being that the dye not fluoresce at the same wavelength as the fluorescent enzymatic product.
  • coloring the supports allows the development of solid supports with different capture oligonucleotides or different target nucleic acid specificities that are distinguishable by color.
  • the ability to distinguish different solid supports by color has the following advantages: 1) quality control can be enhanced, because solid supports possessing different specificities can be identified and distinguished; and 2) contrast between a colorimetric enzymatic product and the surface of the solid support can be maximized. This allows a greater level of sensitivity to be achieved when assay results are determined by visual inspection.
  • kits of the present invention can be used as part of a semi-automated method for BV diagnosis in accordance with the present invention.
  • Such kits would provide for the detection of GL. vaginalis when present at or above the level characteristic of BV, and may include a sample obtaining means, such as a vaginal swab; a pH indicating means, such as pH paper; lysis buffer/hybridization solution and ligand incubation solution; and GL. vaginalis cell number indicating means, such .as a diagnostic dipstick.
  • This kit may be used in conjunction with an incubation apparatus (such as a heating block) , an automated assay device and/or a bead reader.
  • a practitioner using the semi-automated method of the present invention for the diagnosis of BV will follow a procedure substantially as described below:
  • step 1 corresponds to determining pH of a vaginal sample obtained from the patient.
  • Step 2 may use a proteinase K lysis buffer.
  • Steps 2-6 constitute determining whether the critical GL. vaginalis cell number is equalled or exceeded by the patient sample.
  • kits of the present invention eliminate the need for skill in identifying clue cells or evaluating wet mounts. Consequently, the methods of the present invention could be practiced and the kits of the present invention could be used by individuals without the aforementioned skills. Specifically, a laboratory technician or physician's assistant could employ the methods and kits of the present invention with virtually no special training. Another ramification of using the methods and kits of the present invention is that the subjectivity involved in wet mount and Gram stain analysis is replaced with more objective procedures. Specifically, analyst-to-analyst variation is eliminated through the use of the present invention.
  • patient samples may be collected, processed and analyzed to simultaneously detect the presence of Gardnerella vaginalis.
  • Candida spp.. and/or Trichomonas vaginalis Samples are collected from symptomatic females presenting with vaginal complaint who have not been treated with anti-bacterial or anti-fungal medication within the week prior to sample collection and who have not douched within 24 hours.
  • a sterile swab is used to obtain vaginal fluid samples.
  • Dacron swabs with pre- scored handles are particularly preferred for sample collection.
  • Samples are obtained by twisting or rolling the swab against the vaginal wall two or three times, ensuring that the entire circumference of the swab has touched the vaginal wall.
  • the swab is then placed in a sample collection tube, the pre-scored handle of the swab is broken, and the tube is capped.
  • the unlubricated speculum is removed from the patient, and the vaginal pH is determined by touching a pH indicator strip to the speculum.
  • the swab/sample In a protocol for immediate sample preparation, the swab/sample is transported immediately at room temperature for processing and analysis. If the swab/ sample cannot be immediately processed, the swab/sample is held at 0 ⁇ C to 8°C for four hours or at room temperature for one hour.
  • lysis solution is added to the swab/sample, which is then swirled or agitated in the lysis solution for about 10-15 seconds.
  • the tube containing the swab and lysis solution is heated at 85°C for 5 minutes, and hybridization solution is mixed with the sample. At this point, samples may be stored for up to 24 hours at room temperature.
  • the swab contents are expressed by twirling the swab against the side of the tube, and the solution remaining in the tube may then be processed on an automated instrument. Generally, the solution remaining in the tube is filtered prior to further processing.
  • the sample is placed in the first well of a reagent cassette or multi-cavity container, and the semi- automated instrument moves a dipstick through each well of the cassette, thereby processing the sample.
  • a preferred dipstick contains five beads - a procedural control, a negative control, a bead with Gardnerella vaginalis- specific capture probe, a bead with Candida spp.-specific capture probe, and/or a bead with Trichomonas vaginalis- specific capture probe.
  • the detection of these three organisms be achieved through a colorimetric signal system, wherein the presence of color on a test bead at the end of automated sample processing is indicative of a detectable level of nucleic acid from that target organism.
  • the intensity of color on a bead can be estimated either visually or by a measuring device, such as an image analyzer or reflectometer.
  • the procedural control ensures that the procedure has been correctly performed and serves as a reagent quality check.
  • the negative control evaluates non-specific binding to the beads.
  • Example 1 describes quantitation of horseradish peroxidase insoluble product on 3/32nd inch nylon beads using the fluorescence quenching technique.
  • Example 2 describes the quantitation of alkaline phosphatase insoluble product on 3/32nd inch nylon beads using the fluorescence quenching technique.
  • Example 3 describes a comparison of direct fluorescence using soluble 4-methyl-umbelliferone in the presence of black and natural colored nylon beads.
  • Example 4 describes the reduction in fluorescence of nylons beads by dying the beads with a multiplicity of different colors.
  • Example 5 illustrates the correlation between the diagnostic criteria employed in the practice of the present invention and conventional BV diagnostic techniques.
  • Example 6 describes methods and kits for simultaneous detection of Gardnerella vaginalis, Candida spp.. and Trichomonas vaginalis target nucleic acid in a complex biological sample.
  • Example 7 describes improved methods and kits for simultaneous detection of Gardnerella vaginalis. Candida spp. and Trichomonas vaginalis target nucleic acids in a complex biological sample.
  • APB buffer is 0.18 M NaCl, 0.05 M Tris-HCl, pH 7.6, 5 mM EDTA, and 0.5% (v/v) Tween ® 20.
  • TMNZ buffer is 0.05 M Tris, pH 9.5, 1 mM MgCl 2 , and 0.5 mM ZnCl 2
  • FW filter wash is 0.09 M sodium chloride, 50 mM Tris, pH 7.6, and 25 mM EDTA.
  • SDS/FW is FW and 0.1% (w/v) sodium dodecyl sulfate (SDS) .
  • HRP (horseradish peroxidase) substrate solution is 0.1 M sodium citrate, pH 6.5, 0.2 M sodium phosphate, 0.5 mg/ml 4-methoxy-l-naphthol, 0.02 mg/ml 3-methyl-2-benzo- thiazolinone hydrazone and 0.0135% (v/v) hydrogen peroxide.
  • AP (alkaline phosphatase) substrate solution is 1 mM 5-bromo-4-chloroindoyl-3-phosphate, 1 mM nitroBlue tetrazolium, and 0.01% (v/v) Tween ® 20 in TMNZ.
  • GuSCN is 5 M guanidinium thiocyanate, 83.5 mM Tris, pH 8.0, 8.35% formamide, and 16.7 mM EDTA.
  • GuSCN is 3 M guanidinium thiocyanate, 50 mM Tris, pH 8.0, 5% formamide, and 10 mM EDTA.
  • Proteinase K lysis solution is 1 mg/ml proteinase K, 0.5% (w/v) SDS, and 5% N-lauroylsarcosine (sarcosyl) .
  • Lysis and hybridization solution is 3 M guanidinium thiocyanate (GuSCN), 50 mM Tris, pH 7.6, 2% sarcosyl, and 25 mM EDTA.
  • CAP buffer is 0.1 M sodium citrate, pH 6.5 and 0.2 M sodium phosphate.
  • the fluorescent substrate for alkaline phosphatase is 0.02 mM 4-methyl-umbelliferyl phosphate, 0.05 M Tris, pH 9.5, 1 mM MgCl 2 , and 0.5 mM ZnCl 2 .
  • probes below are preferred probes. Preferred are those probes that hybridize to regions of the ribosomal RNA with minimal secondary and tertiary interactions, such as those listed below.
  • the advantage of such probes is that the hybridization can be carried out without the additional step of heat denaturing the sample nucleic acid.
  • BB008 'TAC- GGT- CAC- GAA- CTT- CAG-GCA-CCC3 '
  • CT003 ⁇ ACC* ⁇ GTC- • TTC* TCT* TAT-TCC-CAA-GCG3 1
  • CT005 5'TCN-AGC-GGG-TAT-TAA-CCG-TCT-TCT3'
  • EC020 5'GTC-CCC-CTC-TTT-GGT-CTT-GCG-ACG-TTA-T3'
  • GV003 5'AGA-CGG-CTC-CAT-CCC-AAA-AGG-GTT3'
  • GV006 5'CAC-TCA-CCC-AAA-AGG-CTT-GCT-CCC3'
  • GVO08 5'GTC-CGA-NAC-AGA-ACC-CGT-GGA-ATG3'
  • GVO09 5'GGC-CCC-ACA-TCC-AGC-GTC-CAC-CGT3'
  • GV015 5'TAC-ACT-CAC-CCA-AAA-GGC-TTG-CTG-CCC3'
  • GV017 5'GTC-CGA-CAC-AGA-ACC-CGT-GGA-ATG3'
  • GV018 5'CCC-CAC-ATC-CAG-CGT-CCA-CCG3'
  • GV020 5'GGC-TTG-CTG-CCC-AAT-CAA-AAG-CGG-TTT-AC3'
  • MH001 5'GTG-ATT-CTC-CAC-CGA-CTA-ATG-ATC3'
  • MH002 5'CCG-ACA-AGG-TAC-CGT-CAG-TCT-GCA3'
  • MSP003 5'ACC-ATC-AAC-ACA-CCC-AAA-AGC-ATG-CCT-TT3'
  • MSP004 5 ⁇ CC-ATC-AAC-ACA-GCC-AAA-ACT-GTG-CCT-TT3'
  • NG001 5'CTC-CGT-CTC-CGG-AGG-ATT-CCG-CAC3*
  • NG003 5 ⁇ TA-TTG-GCA-ACA-GCC-TTT-TCT-TCC3'
  • NG004 5'GCC-GCC-GAT-ATT-GGC-AAC-AGC-CTT3'
  • NGO07 5'ATA-TTG-GCA-ACG-GCC-TTT-TCT-TCC3'
  • NG008 5'GCC-GCC-GAT-ATT-GGC-AAC-GGC-CTT3'
  • SA006 5'CCT-ACC-AAC-GTT-CTT-CTC-TAA-CAA-CAG-AGC3'
  • SA010 5'GGT-AGA-TTT-TCC-ACT-CCT-ACC-AAC-GTT-CTT-CTC3'
  • TRV012 5 ⁇ TC-CTN-AAA-GAC-CCG-AAG-CCT-GTC3'
  • TRV015 5'ATC-CTG-AAA-GAC-CCG-AAG-CCT-GTC3•
  • TRV017 5'GTC-ATA-AAA-AAC-ATC-TGG-TCC-TGG-TAA-G3'
  • UU003 5'ATT-TCC-TAT-CTT-AGC-GTT-TCT-TCC3'
  • UU004 5'CCA-CCT-GTC-ATA-TTG-TTA-ACC-TCA3'
  • sequences are A, C, G or T.
  • sequences can contain up to 5 "N” nucleotides at the 5' and/or the 3' end thereof.
  • Hybridization of oligonucleotide probe to a panel of nucleic acid from at least 70 organisms/cell culture lines Conventional slot blot (filter hybridization) methods using 32 P- labelled oligonucleotide probes were employed. Each slot contained 0. l-0.3 g of the panel nucleic acid. Hybridization was in 0.6M NaCl/30% formamide. Cross reaction by the panel nucleic acid was defined as a signal intensity equivalent to that observed for the complementaiy nucleic acid of oligonucleotide probe.
  • the target-specific oligonucleotide probe was attached to a nylon solid support (membrane or bead).
  • Target nucleic acid was hybridized to the capture oligonucleotide probe and detected using a streptavidin horse radish peroxidase signal system (see Example 1).
  • the oligonucleotide probe was determined to be functional in a sandwich assay if the equivalent of at least 10 8 organisms were detected.
  • Poly(ethyleneimine) may be purchased from Polysciences (Warrington, PA) .
  • Burnished or unpolished nylon beads may be purchased from Precision Ball Company (Chicago, IL) and The Hoover Group (Sault St. Marie, MI) .
  • Triethyloxonium tetrafluoroborate hexanediamine, phenylenediamine, succinic anhydride and N-methyl-pyrro ⁇ lidone
  • Cibacron Brilliant Red Cibacron Brilliant Yellow
  • Mordant Orange Cibacron Brilliant Yellow
  • Fast Blue BB Cibacron Brilliant Yellow
  • Reactive Blue 2 Mordant Brown 4, and Reactive Black
  • Reactive Black may be purchased from Aldrich Chemical (Milwaukee, WI) .
  • N-succinimidyl 4- (iodoacetamido) -benzoate (SLAB) and Tween ® 20 may be purchased from Pierce (Rockford, IL) .
  • Guanidinium thiocyanate (GuSCN) may be purchased from Kodak (Rochester, NY) .
  • Oligonucleotides complementary to conserved regions or hypervariable regions of the 16S ribosomal RNA of G. vaginalis. Trichomonas vaginalis. or Candida albicans are synthesized using phosphoramidite chemistry utilizing an ABI 380B, a Milligen 7500 automated DNA synthesizer, or a similar instrument.
  • the oligonucleotides are prepared using the standard phosphoramidite chemistry supplied by the vendor or H-phosph ⁇ nate chemistry. Appropriately blocked dA, dG, dC, and dT phosphoramidites are commercially available in these forms, and synthetic nucleosides may readily be converted to the appropriate form.
  • Oligonucleotides are purified by adaptations of standard methods. Oligonucleotides with 5'-trityl groups are chromatographed on HPLC using a 12 ⁇ m, 300 A Rainin (Woburn, MA) Dynamax C-8 4.2 x 250 mm reverse phase column using a gradient of 15% to 55% MeCN in 0.1 N Et 3 NH + 0Ac " , pH 7.0, over 20 minutes. When detritylation is performed, the oligonucleotides are further purified by gel exclusion chromatography. Analytical checks for the quality of the oligonucleotides are conducted with a Toso-Haas DEAE-NPR column at alkaline pH and by polyacrylamide gel electrophoresis (PAGE) .
  • PAGE polyacrylamide gel electrophoresis
  • 25,000 3/32 inch diameter unpolished nylon beads are placed in a flask containing 1800 ml of 100% anhydrous N-methyl-pyrrolidone and mixed for 5 minutes at ambient temperature. 200 ml of 1 molar triethyloxonium tetra- fluoroborate in dichloromethane are added and the mixture is stirred for 30 minutes at ambient temperature. The beads are then decanted and washed quickly with four 500 ml changes of 100% N-methyl-pyrrolidone.
  • the beads are then transferred to a solution consisting of 3% (w/v) 10,000 MW poly(ethyleneimine) , prepared from a 30% aqueous solution of poly(ethyleneimine) , in N-methyl-pyrrolidone and stirred for 12 to 24 hours at ambient temperature.
  • the beads are washed with 2000 ml N-methyl-pyrrolidone, 1000 ml SDS/FW and finally 10 x 2 liter distilled water.
  • the beads are then dried under high vacuum for 4 to 5 hours without the use of heat.
  • the amine content of the beads may be determined by reaction with picrylsulfonic acid.
  • cyanuric chloride-derived oligonucleotides 10 to 1000 ⁇ g of 5' -amine-linked oligonucleotide spiked with a small amount of the same oligonucleotide labeled at its 3' end with 32 P are treated with an excess of recrystallized cyanuric chloride in 10% (w/v) N-methyl- pyrrolidone in an alkaline buffer (pH 8.3 to 8.5, preferably) at ambient temperature for 30 to 120 minutes.
  • the final reaction conditions are 0.15 M sodium borate at pH 8.3, 2 mg/ml recrystallized cyanuric chloride and 500 ⁇ g/ml appropriate aminohexyl oligonucleotide.
  • the unreacted cyanuric chloride is removed by size exclusion chromatography on a G-50 SephadexTM column (Pharmacia, Uppsala, Sweden) .
  • Cyanuric chloride-derived oligonucleotides and poly(ethyleneimine) coated-nylon beads are placed in a volume of 0.1 M sodium borate, pH 8.3 equal to the volume of the beads at 4°C.
  • the purified cyanuric chloride-derived oligonucleotide is then added to the beads, and the mixture is vigorously agitated at ambient temperature for 60 minutes.
  • the beads are then washed twice with 0.1 M sodium borate (pH 8.3) .
  • Succinic anhydride is then added at a concentration of 10 mg/ml in 90% (w/v) N-methyl-pyrrolidone and 10% (w/v) 1 M sodium borate (pH 8.3) having a volume three times that of the volume of the beads.
  • the reaction is allowed to proceed for l hour at ambient temperature.
  • the beads are then washed 3 times with 250 ml of 100% (v/v) N-methyl- pyrrolidone, twice with distilled water, 5 times with 250 ml SDS/FW and then 4 times with 1 liter of distilled water.
  • Beads are stored dry or in 25 mM EDTA. Radio ⁇ activity per bead may be determined by liquid scintillation counting, allowing the amount of capture oligo-nucleotide per bead to be calculated. Lysis of bacteria and hybridization conditions:
  • Streptavidin/HRP conjugate is added to a final concentration of 1 ⁇ g/ml (based on streptavidin) in SDS/FW and incubated about 5 to 15 minutes at ambient temperature with mild agitation.
  • the beads are washed three times with SDS/FW and then once with CAP buffer.
  • the beads are combined with 0.3 ml of 4-methoxy-naphthol substrate solution (as described above) , and the reaction is allowed to proceed for 15 minutes at ambient temperature. At this stage of the procedure, the capture probe bead will become colored if GL. vaginalis nucleic acid is detected.
  • the beads are then quickly washed once with SDS/FW, once with distilled water and allowed to air dry in the dark.
  • Preferred lysis conditions for Candida spp. , G. vaginalis and IL. vaginalis involve lysis solution at pH 11 at 85°C for 10 minutes. Also, the preferred format is a dipstick designed for visual or image analysis of the colored beads.
  • the quantity of target nucleic acid captured is determined by fluorescence quenching.
  • the beads are dried for 15 to 30 minutes at ambient temperature and then individually placed in a round-bottom, opaque white microtiter plate (Dynatek Laboratories, Chantilly, VA) .
  • the beads are then read using a fluorometer (Fluoroskan II, Flow Laboratories, McLean, VA) or equivalent instrument, in which excitation is at 350 nm and emission is at 456 nm.
  • the beads possess an intrinsic fluorescence of about 800 RFUs, and the presence of the colorimetric substrate product effectively quenches the intrinsic fluorescence. Lower indicated fluorescences correlate with greater quantities of captured target nucleic acid.
  • quantitation may be accomplished by measuring light reflected off of the beads using an image analyzer or a reflectance spectrophotometer.
  • Example 1 describes the quantitation of signal in a typical sandwich assay format, in which a target nucleic acid is sequestered and then detected using a colorimetric insoluble enzymatic product obtained using a horseradish peroxidase system.
  • the colored product i.e., results
  • 1 mg/ml proteinase K lysis solution is used to lyse 1 x 10 8 GL. vaginalis cells in 100 ⁇ l volumes for 20 minutes at 65°C.
  • the lysate is adjusted to 3 M GuSCN by adding 1.5 volumes of 5 M GuSCN.
  • a biotinylated 24-mer oligonucleotide probe complementary to conserved regions of bacterial 16S rRNA (signal probe) is added to a final concentration.of 100 ng/ l.
  • 5-fold serial dilutions of the lysates are made using 3 M GuSCN hybridization solution containing the biotinylated signal oligonucleotides. Each dilution (200 ⁇ l) is then incubated for 30 minutes at ambient temperature with 3 white nylon beads having 0.1 ⁇ g of G. vaginalis-specific oligonucleotide probe (capture probe) covalently immobilized thereon.
  • the solid supports are washed twice with SDS/FW at ambient temperature and then incubated with 1-2 ⁇ g/ml of streptavidin/horseradish peroxidase (SA/HRP) conjugate in SDS/FW for 5 minutes at ambient temperature.
  • SA/HRP streptavidin/horseradish peroxidase
  • the solid supports are washed with SDS/FW, and then the presence of peroxidase is determined by incubating the beads for about 10-30 minutes with the HRP substrate solution (4MN) to form an insoluble blue product.
  • the beads are then washed once with SDS/FW, wicked dry, and placed in a white, round bottom 96-well microtiter plate (Dynatek Laboratories, Chantilly, VA) .
  • the beads are read using a fluorometer (Fluoroskan II, Flow Laboratories, McLean, VA) in which excitation is at 350 nm and emission is at 456 nm. Results of such testing will show a decrease in RFUs with an increase in bacterial cell number.
  • Example 2 describes the quantitation of signal in a typical sandwich assay format, in which a target nucleic acid is sequestered and then detected using a colorimetric insoluble enzymatic product obtained using an alkaline phosphatase system.
  • Proteinase K lysis solution is used to lyse 1 x 10 8 G. vaginalis cells in 250 ⁇ l volume at 65°C for 20 minutes. The lysate is adjusted to 3 M GuSCN by the addition of 1.5 volumes of 5 M GuSCN.
  • a biotinylated 24-mer oligonucleotide probe complementary to conserved regions of bacterial 16S rRNA (signal probe) is added to a final concentration of 100 ng/ml.
  • 5-fold serial dilutions of the lysates are made using 3 M GuSCN hybridization solution containing the biotinylated signal oligonucleotides. Each solution is then incubated for 30 minutes at ambient temperature with 3 nylon beads having 0.1 ⁇ g of GL. vaginalis-specific oligonucleotide probe (capture probe) covalently immobilized thereon.
  • the solid supports are then washed twice with SDS/FW at ambient temperature and incubated with 10 ng/ml of streptavidin/alkaline phosphatase (SA/AP) conjugate in APB buffer for 5 minutes at ambient temperature. The solid supports are washed with APB buffer.
  • alkaline phosphatase may be determined by incubating the beads with the TMNZ substrate solution for 1-4 hours to form an insoluble formazan product.
  • the beads are then washed once with SDS/FW, wicked dry, and placed in a white, round-bottom 96-well microtiter plate (Dynatek Laboratories, Chantilly, VA) .
  • the beads are then read using a fluorometer (Fluoroskan II, Flow Laboratories, McLean, VA) in which excitation is at 350 nm and emission is at 456 nm. Results of such testing will show a decrease in RFUs with an increase in bacterial cell number.
  • Example 3 demonstrates the use of nylon solid supports in a sandwich assay format, in which a target nucleic acid is sequestered and then detected using an assay format based on detecting a fluorescent product in the presence of beads in a microtiter well embodiment.
  • Proteinase K lysis solution is used to lyse 1 x 10 8 G. vaginalis cells in 100 ⁇ l volumes at 65°C for 20 minutes. The lysate is adjusted to 3 M GuSCN by the addition of 1.5 volumes of 5 M GuSCN.
  • a biotinylated 24-mer oligonucleotide probe complementary to conserved regions of bacterial 16S rRNA (signal probe) is added to a final concentration of 100 ng/ml.
  • 5-fold serial dilutions of the lysates are made using 3 M GuSCN hybridization solution containing the biotinylated signal oligonucleotides. Each solution is then incubated for 30 minutes at ambient temperature with 2 black nylon beads prepared by The Hoover Group (Sault St. Marie, MI) and 2 natural colored nylon beads, each having 0.1 ⁇ g of GL. vaginalis-specific oligonucleotide probe (capture probe) covalently immobilized thereon.
  • the solid supports are washed with SDS/FW at ambient temperature, followed by washing with 0.1% (v/v) Tween ® 20, 1 mM MgCl 2 , 0.01 M Tris-HCl, pH 8.0 (APB) and incubation with 0.4 ⁇ g/ml of streptavidin/alkaline phosphatase (SA/AP) conjugate in APB for 5 minutes at ambient temperature.
  • SA/AP streptavidin/alkaline phosphatase
  • the solid supports are then washed 5 times with APB, once with TMNZ, and then the presence of alkaline phosphatase may be determined by incubating the nylon beads individually with 150 ⁇ l of 0.5 mM 4-methyl- umbelliferyl phosphate (4-hydroxymethyl coumarin) in black microtiter well strips (Dynatek, Laboratories, Chantilly, VA) . Incubation is for 30 minutes at 37°C. The plates are then directly read using a Fluoroskan II fluorometer (Flow Laboratories, McLean, VA) using an excitation wavelength of 360 nm and an emission wavelength of 456 nm.
  • a Fluoroskan II fluorometer Flow Laboratories, McLean, VA
  • the black nylon beads which possess a decreased intrinsic fluorescence, will allow the sensitive detection of Gi. vaginalis 16S rRNA using a fluorescence-based signal system.
  • a control in which the natural colored bead is physically removed from the solution is read, and is expected to indicate the same level of detection of G. vaginalis as when the solution is read in the presence of the black bead.
  • Example 4 describes the coloring or dying of 3/32nd inch nylon beads with a multiplicity of dyes, and the resultant reduction of the intrinsic fluorescence of the nylon bead.
  • Mordant Red, Reactive Blue 2, Mordant Brown 4, Cibacron Brilliant Red, Cibacron Brilliant Yellow, Reactive Black, or Mordant Orange were dissolved in 50 ml of 50% (v/v) N-methyl-pyrrolidone and 0.2 M sodium borate (pH 8.3) and incubated with 1000 3/32nd inch nylon beads for 24 hours at ambient temperature and 1 hour at 65 ° C .
  • the beads were then washed with 10 changes of 50 ml of 100% N-methyl- pyrrolidone and 5 changes of 50 ml distilled water.
  • the beads were then dried under high vacuum for 25 hours. Eight beads from each color group were then placed in a round-bottomed, white microtiter plate.
  • Example 5 illustrates the correlation between the diagnostic criteria employed in the practice of the present invention and conventional BV diagnostic techniques.
  • Vaginal washes were collected from 43 women determined to be positive for BV by standard clinical criteria and from 70 BV-negative women. These samples were obtained from women visiting the Student Health Clinic at the University of Washington. The women were 92% Caucasian and 8% Asian, with a median age of 23.8 years. Eighty percent of the women tested were unmarried. None were pregnant. Women were determined to be positive for BV ' by employing the current gold standard diagnostic criteria for the disease. BV-negative women were negative for BV according to the gold standard criteria, and had no obvious signs or symptoms of vaginitis.
  • Vaginal pH was measured at the time of examination. 3 ml of sterile Hank's balanced salt solution (Flow Laboratories, McLean, VA) were injected into a patient's vagina and withdrawn to a sterile test tube. 0.25 ml of this vaginal wash were added to 0.5 ml of 5 M GuSCN.
  • the filters were then hybridized with 1 x 10 6 cpm/ml of 32 P-labeled GV003, an oligonucleotide specific for GL. vaginalis 16S rRNA (i.e., it hybridizes specifically with the 16S rRNA of GL. vaginalis when challenged with over 70 other potentially cross-reacting species of normal vaginal microflora) .
  • Hybridization was performed in hybridization/slot blot solution in Seal-a-Meal bags (Dazey) . Filters were washed three times with SDS/FW at 55°C and then were exposed to Kodak X-OMAT AR film, which was developed by standard procedures.
  • the amount of GL. vaginalis cells present in the sample was quantitated by comparing the signal intensities obtained from the standards on the filters and those obtained from patient samples. These comparative results could be expressed in terms of cell number, as a result of an additional slot blot experiment.
  • a serial dilution of the same 16S rRNA standard was loaded on a Nytran filter using a Minifold II slot blot template.
  • Serially diluted lysates from three different GL. vaginalis cultures having known cell numbers (measured by microbiological methods described in the references set forth above) were also loaded on the filter.
  • the slot blots were baked at 80°C for 2 hours and hybridized with a 32 P-labeled, G. vaginalis-specific probe, GV003.
  • the lower limit of detection for this slot blot analysis was approximately 1 x 10 7 GL. vaginalis cells, based on the signals obtained with the standards.
  • the results showed a strong correlation between the clinical diagnosis of BV and a concentration of GL. vaginalis cells greater than or equal to 2 x 10 7 cells/ml vaginal fluid in women with a vaginal pH greater than 4.5.
  • BV was detected with a sensitivity of 95.3% and a specificity of 98.6%. Women with trichomoniasis or cervicitis would be expected to exhibit a vaginal pH >4.5, but GL. vaginalis cell numbers ⁇ 2 x 10 7 (i.e., would be diagnosed as BV- negative) .
  • Example 6 describes simultaneous detection of Gardnerella vaginalis. Candida spp. and Trichomonas vaginalis in a complex biological sample, and in particular from a vaginal sample.
  • Hybridization I Solution is 83 mM Tris-Cl, pH 7.5; 17 mM EDTA; 8.35% (v/v) formamide; 5 M GuSCN; and UP041- polymer, 1.67 ⁇ g/ml.
  • Lysis Solution is 90 mM Tris-Cl, pH 8.0; 10 mM EDTA; 5% (w/v) N-lauroylsarcosine; 0.5% (w/v) SDS; and 0.1% ProClin ® (preservative) .
  • Substrate Solution B is 1% (w/v) 4-methoxy naphthol;
  • Hybridization II Solution is 3M GuSCN; 0.3M imidazole; 5% (v/v) formamide; 50 mM Tris-Cl, pH 8.5; 10 mM EDTA; and biotinylated probes capable of hybridizing with Gardnerella vaginalis.
  • Candida spp. and Trichomonas vaginalis (UP541 [complement of UP041] , 1000 ⁇ g/ml, Gv; procedural control probe, 1 ⁇ g/ml; UP053, 500 ⁇ g/ml, Ca; TRV017, 500 ⁇ g/ml, Tv) .
  • Assay Wash Solution is 9.1 mM Tris-Cl, pH 8.0; Na-EDTA; 1% (w/v) N-lauroylsarcosine; 1% (w/v) SDS; and 0.1% (w/v) ProClin ® (preservative).
  • Conjugate Solution is streptavidin-horse radish peroxidase conjugate, 1-3 ⁇ g SA/ml.
  • Substrate Solution I is 100 mM Na-H 2 P0 4 , pH 6.5; 12 mM citrate; and 1.8% (v/v) hydrogen peroxide.
  • 5'CACTCACCCAAAAGGCTTGCTCCC3• 5'GTCCGANACAGAACCCGTGGAATG3' ; 5'TACACTCACCCAAAAGGCTTGCTGCCC3• ;
  • Patient samples are collected from symptomatic females presenting with vaginal complaint.
  • the patients preferably have not been treated with anti-bacterial or anti-fungal medication within the week prior to sample collection, and preferably have not douched within 24 hours of sample collection.
  • a sterile dacron swab with a pre-scored handle was used to obtain vaginal fluid samples by twisting or rolling the swab against the vaginal wall two or three times, ensuring that the entire circumference of the swab touched the vaginal wall.
  • the swab was then placed in a sample collection tube, the pre-scored handle of the swab was broken, and the tube was capped.
  • the unlubricated speculum was removed from the patient, and the vaginal pH was determined by touching a pH indicator strip to the speculum.
  • the swab/sample was either: (1) transported at room temperature for immediate processing and analysis;
  • the swab contents were expressed by twirling the swab against the side of the tube.
  • the solution remaining in the tube was then processed on an semi-automated instrument.
  • the sample solution was filtered into the first well of a 7-well reagent cassette.
  • a dipstick containing five beads i.e, a procedural control, a negative control, Gardnerella vaginalis-specific capture probe GV009, Candida spp. -specific capture probe CAL015, and Trichomonas vaginalis-specific capture probe TRV015 was inserted into Well 1.
  • Substrate Solution B (0.06 ml) was added to Well 7 of the reagent cassette.
  • Well 2 Hybridization II Solution
  • Well 3 Assay Wash Solution
  • Well 4 Conjugate Solution
  • Wells 5 and 6 Assay Wash Solution
  • Well 7 Substrate Solution I.
  • the procedural control bead must turn blue and the negative control bead must remain colorless.
  • the intensity of the blue color on a bead was estimated using an image analyzer.
  • Example 7 describes a preferred method for simultaneous detection of Gardnerella vaginalis.
  • Hybridization I solution is 83 mM Tris-Cl, pH7.5; 17 mM EDTA; 8.35% (v/v) formamide; 5 M GnSCN;
  • Lysis Solution is 50 mM glycine, 10 mM EDTA, 5% (w/v) N-lauroylsarcosine, 0.5% (w/v) SDS, and 0.1% ProClin (preservative) , pH 11.
  • Substrate Solution B (now called Substrate Solution S) is the same as in Example 6.
  • Hybridization II Solution is 3 M GnSCN; 0.3 M imidazole; 5% (v/v) formamide; 50 mM Tris-Cl, pH 8.5; 10 mM EDTA; and biotinylated probes capable of hybridizing with Gardnerella vaginalis.
  • Candida spp.. and Trichomonas vaginalis (UP541 [complement of UP041] , 1000 ⁇ g/ml, Gv; procedural control probe, 0.3 ⁇ g/ml; UP553 [complement of UP053] , 1000 ⁇ g/ml, Ca; Trv017, 500 ⁇ g/ml, Tv) .
  • Assay Wash Solution, Conjugate Solution, and Substrate Solution I are the same as in Example 6.
  • UP553 (complement of UP053)
  • UP541 (complement of UP041)
  • Vaginal scrapings or pelleted vaginal washes can be used as alternatives to the vaginal swab sample.
  • Example 8 describes a preferred method for simultaneous detection of Gardnerella vaginalis. Trichomonas vaginalis. and Group B Streptococci in a complex biological sample, and in particular, from a vaginal sample. Materials:
  • Hybridization I solution is 83 mM Tris-Cl, pH 7.5; 17 mM EDTA; 8.35% (v/v) formamide; 5 M GnSCN; 2 N- lauroylsarcosine; UP041-polymer, 1.67 ⁇ g/ml; and UP056- polymer, 3.34 ⁇ g/ml.
  • Lysis Solution is 50 mM Tris-Cl, 10 mM EDTA, 2% (w/v) N-lauroylsarcosine, 0.5% (w/v) SDS, and 0.1% ProClin (preservative) , pH 7.5 Substrate Solution B (now called Substrate
  • Solution S is the same as in Example 6.
  • Hybridization II Solution is 3M GnSCN; 0.3M imidazole; 5% (v/v) formamide; 50 mM Tris-Cl, pH 8.5; 10 mM EDTA; and biotinylated probes capable of hybridizing with Gardnerella vaginalis. Trichomonas vaginalis. and Group B streptococci (UP541 [complement of UP041] ; 1 ⁇ g/ml; Procedural control probe, 0.3 ⁇ g/ml; Trv017, 500 ⁇ g/ml; and UP557 [complement of UP056] ; 1 ⁇ g/ml. Oligonucleotide Probes: GV009
  • UP541 (complement of UP041) Procedure: The same as in Example 6, except: 1) Vaginal scrapings or pelleted vaginal washes can be used as alternatives to the vaginal swab sample.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Procédés de diagnostic de troubles vaginaux associés à différents micro-organismes, pouvant être utilisés par un médecin dans son cabinet privé ou dans un environnement clinique plus structuré, tel qu'un hôpital, un laboratoire de microbiologie clinique commerciale et similaire. On décrit également des procédés permettant de détecter simultanément et sélectivement des bactéries Gram positif et au moins un autre organisme microbien qui n'est pas une espèce bactérienne Gram négatif.
EP93914227A 1992-05-29 1993-05-28 Procedes et trousses pharmaceutiques utilises pour detecter des micro-organismes associes aux infections vaginales. Withdrawn EP0672183A4 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US89609492A 1992-05-29 1992-05-29
US896094 1992-05-29
PCT/US1993/005085 WO1993024659A1 (fr) 1992-05-29 1993-05-28 Procedes et trousses pharmaceutiques utilises pour detecter des micro-organismes associes aux infections vaginales

Publications (2)

Publication Number Publication Date
EP0672183A1 true EP0672183A1 (fr) 1995-09-20
EP0672183A4 EP0672183A4 (fr) 1997-04-16

Family

ID=25405618

Family Applications (1)

Application Number Title Priority Date Filing Date
EP93914227A Withdrawn EP0672183A4 (fr) 1992-05-29 1993-05-28 Procedes et trousses pharmaceutiques utilises pour detecter des micro-organismes associes aux infections vaginales.

Country Status (3)

Country Link
EP (1) EP0672183A4 (fr)
AU (1) AU4396793A (fr)
WO (1) WO1993024659A1 (fr)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6093538A (en) * 1992-05-06 2000-07-25 Gen-Probe Incorporated Nucleic acid probes to ureaplasma
US5747252A (en) * 1995-06-07 1998-05-05 Gen-Probe Incorporated Nucleic acid probes and amplification oligonucleotides for Neisseria species
EP0957175A1 (fr) * 1998-04-20 1999-11-17 Academisch Ziekenhuis Groningen Procédé pour la détermination rapide de bactéries
GB0601302D0 (en) * 2006-01-23 2006-03-01 Semikhodskii Andrei Diagnostic methods and apparatus
WO2009085704A2 (fr) 2007-12-26 2009-07-09 Gen-Probe Incorporated Compositions et procédés permettant de détecter l'acide nucléique du candida albicans
CN114480694B (zh) * 2022-04-18 2022-06-17 北京起源聚禾生物科技有限公司 阴道微生态检测引物探针组合及试剂盒

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2733700B2 (ja) * 1988-01-11 1998-03-30 マイクロプローブ・コーポレーシヨン 歯周囲病原体検出用オリゴヌクレオチドプローブ

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
J UROL, 126 (5). 1981. 630-634., XP000650308 PFAU A ET AL: "THE BACTERIAL FLORA OF THE VAGINAL VESTIBULE URETHRA AND VAGINA IN PRE MENOPAUSAL WOMEN WITH RECURRENT URINARY TRACT INFECTIONS" *
OBSTET GYNECOL, 55 (3). 1980. 397-401., XP000650315 AUGER P ET AL: "MICROBIAL FLORA ASSOCIATED WITH CANDIDA-ALBICANS VULVO VAGINITIS" *
See also references of WO9324659A1 *

Also Published As

Publication number Publication date
EP0672183A4 (fr) 1997-04-16
WO1993024659A1 (fr) 1993-12-09
AU4396793A (en) 1993-12-30

Similar Documents

Publication Publication Date Title
US5700636A (en) Methods for selectively detecting microorganisms associated with vaginal infections in complex biological samples
US7867706B2 (en) Capture and detection of target nucleic acid in dipstick assays
US20140106347A1 (en) Binding interactions in dipstick assays
EP0554355B1 (fr) Procedes et kits pharmaceutiques utiles pour la detection de microorganismes associes a des infections vaginales
US20180171391A1 (en) Methods and Compositions For Sorting and/or Determining Organisms
AU2001267750B2 (en) Improved detection signal and capture in dipstick assays
WO1996004402A1 (fr) Detection de mycobacteries
JP2004502465A (ja) ディップスティック検査のための改良された捕捉及び検出形式多用性
KR102132965B1 (ko) 결핵 진단용 키트 및 이를 이용한 결핵의 진단방법
WO1993024659A1 (fr) Procedes et trousses pharmaceutiques utilises pour detecter des micro-organismes associes aux infections vaginales
WO2011115465A2 (fr) Méthode et kit pour la détection d'agent pathogène d'organes génitaux féminins faisant intervenir un système à réseau liquide multiplex
JP2013504319A (ja) ヘリコバクター・ピロリ及び/又はクラリスロマイシン抵抗性を検出するためのペプチド核酸プローブ、キット及び方法、及びその使用
KR102334343B1 (ko) 결핵균 및 비결핵항산균을 동시에 감별하여 검출할 수 있는 고감도 다중 등온증폭반응용 프라이머 세트
KR102274011B1 (ko) 결핵균 및 비결핵항산균을 동시에 감별하여 검출할 수 있는 고감도 다중 등온증폭반응용 프라이머 세트
EP0484385A4 (en) Quantification of bacteria using a nucleic acid hybridization assay
JP2000511777A (ja) クラミジア・ニューモニエ検出用核酸プライマーおよびプローブ
WO2002004122A2 (fr) Amelioration de la stabilite d'interactions d'hybridation dans des tests par bandelettes
JP2004525626A (ja) insituハイブリダイゼーションにより歯周病原性細菌を検出するためのオリゴヌクレオチド・プローブ
PT1516067E (pt) Detecção de algas tóxicas
Svendsen et al. A novel fluorescent in situ hybridization technique for detection of Rickettsia spp. in archival samples
WO2019031920A1 (fr) Kit pour le diagnostic de la tuberculose et procédé de diagnostic de la tuberculose l'utilisant
CN116426658A (zh) 泌尿生殖道病原体检测试剂盒及其引物探针组合物与应用
KR20230150077A (ko) 성 매개 감염증 유발 병원체 검출용 키트 및 이를 이용한 성 매개 감염증 유발 병원체의 검출방법
KR20020063069A (ko) 피시알에 의한 클라미디아 검출용 키트 및 그 검출방법

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19941220

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): BE DE ES FR GB IT NL SE

A4 Supplementary search report drawn up and despatched

Effective date: 19970228

AK Designated contracting states

Kind code of ref document: A4

Designated state(s): BE DE ES FR GB IT NL SE

17Q First examination report despatched

Effective date: 20010827

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20011201