EP0551308A1 - Nouveaux antigenes peptidiques et immunoanalyses, kits de test et vaccins utilisant ces antigenes - Google Patents

Nouveaux antigenes peptidiques et immunoanalyses, kits de test et vaccins utilisant ces antigenes

Info

Publication number
EP0551308A1
EP0551308A1 EP91916706A EP91916706A EP0551308A1 EP 0551308 A1 EP0551308 A1 EP 0551308A1 EP 91916706 A EP91916706 A EP 91916706A EP 91916706 A EP91916706 A EP 91916706A EP 0551308 A1 EP0551308 A1 EP 0551308A1
Authority
EP
European Patent Office
Prior art keywords
htlv
env
peptide
antibodies
gag
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP91916706A
Other languages
German (de)
English (en)
Other versions
EP0551308A4 (en
Inventor
Renu Bansal Lal
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
US Department of Health and Human Services
US Department of Commerce
Original Assignee
US Department of Health and Human Services
US Department of Commerce
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US07/574,352 external-priority patent/US5378805A/en
Application filed by US Department of Health and Human Services, US Department of Commerce filed Critical US Department of Health and Human Services
Publication of EP0551308A1 publication Critical patent/EP0551308A1/fr
Publication of EP0551308A4 publication Critical patent/EP0551308A4/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/14011—Deltaretrovirus, e.g. bovine leukeamia virus
    • C12N2740/14022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

  • the present invention relates to peptides derived from structural gene products of HTLV-I and HTLV-II selected from the group consisting of Env-1 (HTLV-I; amino acids (a.a.) 191-215), Env-2 (HTLV-II; a.a. 187-210), Env5 (HTLV-I; a.a. 242-257); Gagla (HTLV-I; a.a. 102-117), Pol- 3 (HTLV-I; a.a. 487-502), Env-20 (HTLV-II; a.a. 85-102), Env-23 (HTLV-II; a.a.
  • HTLV-I/II Gag-10
  • Ers endogenous retroviral seguence
  • immunoassays test kits and vaccines using these peptides.
  • HTLV Human T-cell lymphotropic viruses
  • HTLV-I is etio- logically associated with adult T-cell leukemia (ATL) and with a chronic neurologic disorder known as HTLV-I-associ- ated myelopathy/tropical spastic paraparesis (HAM/TSP; (Ehrlich GD, Poiesz BJ. Clinical and molecular parameters of HTLV-I infection. Clin Lab Med 1988;8:65-84).
  • HTLV-II which was first isolated from a patient with a variant of hairy cell' leukemia (Kalyanaraman VS, Sarngadharan MG, Robert-Guroff M, et al.
  • HTLV-II human T-cell leukemia virus
  • HTLV-II has been reported mainly in intra ⁇ venous drug users (Lee H, Swanson P, Shorty VS, Zack JA, Rosenblalt JD, Chen I. High rate of HTLV-II infection in seropositive IV drug abusers in New Jersey. Science 1989;244:471-5.)
  • Concern about transmission of HTLV-I/II infection from contaminated blood products has been intensified by serologic evidence of HTLV-I in volunteer blood donors (Williams AE, Fang CT, Slamon DJ, et al. Seroprevalence and epidemiological correlation of HTLV-I infection in U.S. blood donors. Science 1988;240:643-6; Anderson D.W.
  • HTLV- I human immunodeficiency virus
  • human lymphotropic virus type I or II human lymphotropic virus type I or II dual infections by polymerase chain reaction. Oncogene 1989;4:1533-5
  • a serologic assay that could distinguish the two infections is highly desirable. Such an assay would be very useful both for seroepidemiologic studies that have thus far been hampered by the inability to distinguish the two viruses and for the purpose of counseling blood donors and others who test seropositive (Chen I.S.Y., Rosenblat J.D., Black A.C., Arrigo S.J., Green P.L. 1990.
  • One object of the present invention is to define a major immunodominant epitope of the HTLV proteins that does not show cross-reactivity with serum specimens from HTLV-II-infected individuals.
  • one embodiment of the present invention relates to a peptide having specific immunoreactivity to antibodies to HTLV-I, HTLV-II, or combinations thereof comprising a peptide selected from the group consisting of: Env-1 (HTLV-I; a.a 191-215)LPHSNLDHILEPSIPWKSKLLTLV, Env-2 (HTLV-II; a.a 187-210)VHDSDLEHVLTPSTSWTTKILKFI, Env5 (HTLV-I; a.a 242-257)SPNVSVPSSSSTPLLY, Gagla (HTLV-I; a.a 102-117)PPSSPTHDPPDSDPQI, Pol-3 (HTLV-I; a.a 487-502)KQILSQRSFPLPPPHK, Env-20 (HTLV-II; a.a.
  • the invention is further directed to an immuno- assay method for the detection of antibodies to HTLV-I, HTLV-II or a combination thereof, a test kit for the detection of said antibodies, a peptide composition containing said peptides and a vaccine.
  • Figures IA and IB show the location of synthetic peptide in HTLV-1 genome upper panel and HTLV-II (lower panel) . The relative position of each peptide is shown by the box.
  • Figures 2A and 2B show antibodies to purified
  • HTLV-I protein (upper panel) or Env-5 peptide (lower panel) in patients with HTLV-I infection (HTLV-I) , with HTLV-I infections that have been confirmed by PCR (HTLV-I PCR) and with HTLV-II infection that have been PCR confirmed (HTLV-II PCR) .
  • the shaded area represents the mean + 3 SD of the responses of 21 normal persons.
  • Figure 3 shows the competition by Env-5 (•-•) , HTLV-I (O-o) or HTLV-II ( ⁇ - ⁇ ) purified proteins of anti- Env-5 antibodies in HTLV-I infected individuals.
  • Serial 1:2 dilutions of a 10 ug/ml peptide or HTLV proteins solution are mixed 1:1 with a 1:10 dilution of test serum.
  • the mixtures are allowed to incubate overnight at 4°C.
  • Each is then assayed for anti-Env-5 activity by ELISA.
  • the results are expressed as the mean percentage inhibi- tion of four HTLV-I infected sera.
  • Figures 4A and 4B show IgG antibodies to Gag la
  • HTLV-I infected group represents antibody responsiveness of the individuals with HAM/TSP or ATL.
  • Figures 5A and 5B show a computer prediction of the secondary structure of gag encoded protein of HTLV-I (Top) and HTLV-II (bottom) superimposed with the value for antigenic index.
  • the radius of a circle over a residue is proportional to the mean antigenic index as calculated for the residue plus the next five residues.
  • the parameters for hydrophilicity, flexibility and surface probability are averaged over five amino acid residues, with a limit of 0.7 for hydrophilicity, 1.04 for flexibility and 5.0 for surface probability.
  • Figure 6 shows the alignment of Env-20 85"102 , Env- 202 173 - 209 , and Env-203 219 ' 256 with corresponding HTLV-I sequences. Identical amino acid residues between HTLV-II and HTLV-I are in boxes. Amino acid residue numbering is from the N-terminus of each protein.
  • Figure 7 shows antibodies to Env-20 85 " 102 , Env- 202 173 " 209 , and Env-203 219"256 in serum specimens from blood donors infected with HTLV-II (HT-II) and HTLV-I (HT-I) . Shaded area represents means +2SD of the response of 22 healthy blood donors.
  • Figures 8A and 8B show seroreactivity of HTLV 05 and HTLV" 1 specimens with synthetic peptides from env(A) and gag (B) region of HTLV and an endogenous retroviral sequence (B) .
  • A % reactivity for synthetic HTLV-I specific Env-1 191"213 ( ⁇ ) and Env-5 242"256 (H) ; HTLV-II specific Env-2 187 ' 209 ( ) and Env-20 85 " 102 (D) ; B: % reactivity with HTLV-I specific Gag-la 102"117 ( ⁇ ) , HTLV-I/II specific Gag-10 364 " 385 (im.) , and an endogenous retroviral sequence RTVL*" 8 ( ⁇ ) .
  • Figure 9 shows the RTVL region contains two imperfect copies of a conserved sequence in a location similar to that found in other retroviruses.
  • the period in Figure 9 represents a gap in the sequence which has been added for sequence alignment.
  • the present invention relates to a highly sensi ⁇ tive method for the detection of antibodies to HTLV-I or HTLV-II in body fluids by the use of synthetic peptides.
  • the peptides are also useful as a vaccine by stimulating the production of antibodies of HTLV-I or HTLV-II to provide protection against infection by HTLV-I or HTLV-II in healthy mammals, including humans.
  • the peptides have amino acid sequences which correspond to segments on the envelope protein and are highly immunoreactive with antibodies in sera of patients infected with HTLV-I or HTLV-II.
  • the detection method includes an enzyme-linked im unosorbent assay (ELISA) , an immunoradiometric assay (IRMA) , and other forms of immunoassay procedures such as enzyme immuno blotting assay on nitrocellulose paper and hemagglutination assay using the peptides as the antigen.
  • ELISA enzyme-linked im unosorbent assay
  • IRMA immunoradiometric assay
  • other forms of immunoassay procedures such as enzyme immuno blotting assay on nitrocellulose paper and hemagglutination assay using the peptides as the antigen.
  • An immunoassay for HTLV needs to be developed that satisfy two main criteria.
  • a test must distinguish HTLV-I and HTLV-II in locales where both viruses are endemic.
  • Enzyme immuno assays (EIA) where whole virus lysates are used as a source of antigens cannot effectively distin ⁇ guish HTLV-I from HTLV-II due to the sequence homology in highly conserved regions of the core and the polymerase protein of these viruses.
  • Two i munoassays must be available to laboratories involved in blood screening that are highly sensitive and specific.
  • the inventor reports that synthetic peptides from immuno ⁇ reactive domains of HTLV-I and HTLV-II viral proteins offer an approach to design an immunoassay that will distinguish HTLV-I from HTLV-II.
  • the inventor also provides evidence that the synthetic peptide derived from the polymerase region of HTLV-I detects serum antibodies in most infected individuals.
  • peptides useful for the detection of antibodies to HTLV-I or HTLV- II are selected from the group consisting of:
  • Env-1 (HTLV-I; a.a 191-215)LPHSNLDHILEPSIPWKSKLLTLV
  • Env-2 (HTLV-II, a.a 187-210)VHDSDLEHVLTPSTSWTTKILKFI
  • Env5 (HTLV-I; a.a 242-257)SPNVSVPSSSSTPLLY, Gagla (HTLV-I; a.a 102-117)PPSSPTHDPPDSDPQI, Pol-3 (HTLV-I; a.a 487-502JKQILSQRSFPLPPPHK, Env-20 (HTLV-II; a.a.
  • peptides may comprise analogues or segments, i.e., a shorter or longer peptide chain by having more amino acids added to the terminal amino acids of the above sequence or having a few less of the terminal amino acids from either terminal. It is expected that as long as the three dimensional conformation recognizable by the domi ⁇ nant antibodies to HTLV-I or HTLV-II is preserved, ana ⁇ logues of the synthetic peptides may also comprise substi- tution and/or deletion of the recited amino acids of the above sequences.
  • the peptides may also be useful as a vaccine (e.g., for ATL and HAM/TSP) and as immunogens for the development of both monoclonal and polyclonal anti ⁇ bodies to HTLV-I and HTLV-II in mammals, including humans.
  • a vaccine e.g., for ATL and HAM/TSP
  • immunogens for the development of both monoclonal and polyclonal anti ⁇ bodies to HTLV-I and HTLV-II in mammals, including humans.
  • the peptides when coupled to a protein or a polymer carrier or when polymerized to homo or hetero dimers or high oligomers by cysteine oxidation, induced disulfide cross linking, or when polymerized to homo- or hetero- dimers or higher oligomers by use of homo- or hetero- functional multivalent cross linking reagents, can be introduced to normal subjects to stimulate production of antibodies to HTLV-I or HTLV-II and provide protection against infection in healthy mammals. Since the peptides according to the present invention are not derived bio ⁇ chemically from the virus, there is no danger of exposing the normal subjects who are to be vaccinated to the disease.
  • the advantages of using the peptides according to the present invention are man;
  • the peptides are chemically synthesized. This means that there is no involvement with the HTLV-I or HTLV-II virus at any time during the process of making the test reagent or the vaccine. During the preparation of the vaccine or the vaccination process, there is no risk of exposure of the production workers or individuals in the health profession to the HTLV-I or HTLV-II virus. Similarly, there is no risk or exposure to HTLV-I or HTLV-II in the use of these peptides or the development of monoclonal or polyclonal antibodies to HTLV-I or HTLV-II in mammals.
  • the test reagent is exposed to samples of sera or body fluid, there is no risk of exposure of the laboratory worker to the HTLV-I or HTLV-II virus. Any risk of exposure in this final step can be further avoided by taking the precautionary step of heating the serum samples, which are to be tested, at 60°C for half an hour, thereby deactivating the virus.
  • Another problem which is avoided by the present invention is the possibility of false positive results caused by the presence in antigenic materials from host cells co-purified with the HTLV-I or HTLV-II viral prepa ⁇ ration or E. coli derived proteins co-purified with expressed viral fragments.
  • Certain normal individuals have antibodies to E. coli or human leukocyte antigens, e.g., HLA, which are cross reactive with the antigenic materials from host cells.
  • Sera samples from these normal individuals even though they have not been exposed to HTLV-I or HTLV-II, may show a positive response in the ELISA or IRMA tests.
  • a diagnosis that a person may be infected with HTLV-I or HTLV-II based on this type of false positive response can bring severe anxiety to the person and his/her family. All of these problems can be avoided by using the peptides of the present invention as the test reagents.
  • HTLV-II or combinations thereof in body fluids comprises preparing at least one of the above-mentioned peptides, analogues, or a mixture thereof, and using about 0.1 mg to about 20 mg, preferably about 1.0 mg to about 10 mg per test in a buffer at a pH of about 7.5 to 10, preferably about 9.4 to 9.8, of at least one peptide as the antigen in an immunoassay procedure.
  • the peptide prepared in accordance with the present invention can be used to detect HTLV-I and HTLV-II infection by using it as the test reagent in any form of immunoassay such as an enzyme-linked immunoadsorbent assay (ELISA) , an enzyme immunodot assay, a hemagglutination assay, a radioimmunoradiometric assay (IRMA) , or any variety of competitive binding assays.
  • ELISA enzyme-linked immunoadsorbent assay
  • IRMA radioimmunoradiometric assay
  • the present invention is further directed to an immunoassay method for the detection of antibodies to HTLV-I, HTLV-II or combinations thereof which comprises: (i) coating a solid support or other labeling material with an effective amount of a peptide of the invention for reacting with antibodies to HTLV-I, HTLV-II or combin ⁇ ations thereof in an amount sufficient to produce an antibody-peptide complex to be detected, (ii) adding a test sera diluted with a buffer wherein the antibodies to HTLV-I or HTLV-II in the test sera form a peptide-antibody complex with said peptide, (iii) incubating the mixture, and (iv) detecting the presence of the peptide-antibody complex.
  • step (iv) a second known antibody labelled with an enzyme and a substrate is introduced which reacts with the enzyme to form a colored product. Also, in step (iv) , a second known antibody labelled with a radioactive element is introduced. Alternatively, in step (iv) , the peptide antibody complex may also be detected by aggluti- nation.
  • the solid support may be further coated with at least one of the peptides in the invention in a multidot array. The amount of the peptide is preferably in the range of 1 mg to 10 mg per dot.
  • the detection step (iv) may also be done competitively using labeled or unlabeled antigen or antibody to compete with the complex.
  • the antigen of step (i) need not be attached in any way provided that the antibody-antigen complex may be detected such as by polyethylene glycol precipitation or by a Coombs reagent.
  • the invention is also directed to a test kit for the detection of antibodies to HTLV-I, HTLV-II, or combin ⁇ ations thereof, which comprises: a solid support or other suitable labeling material having attached thereto; an immunoadsorbent comprising at least one peptide of the invention or simply said at least one peptide alone; a sample of normal serum as a negative control; a sample of serum containing antibodies of HTLV-I or HTLV-II as a positive control, and a buffer for diluting the serum samples.
  • the invention is directed to a peptide composition
  • a peptide composition comprising at least one of the pep ⁇ tides of the invention.
  • each is present in a ratio of 1:1 with respect to one another.
  • they are in a ratio of 1:1:1.
  • Each peptide may be preferably present in an amount of 0.5 mg to 5 mg.
  • An example of two more peptides to be mixed together includes a combination of Env-1 and Env-5. This mixture of peptides may provide for an increase in sensitivity for HTLV-I detection.
  • Env-2 and Env-20 may be combined in order to increase HTLV-II detection.
  • the peptides may be mixed in a suitable carrier such as saline or a mi>_schreib.re of phosphate buffer in saline.
  • the invention is also directed to a vaccine containing at least one of the peptides of the invention and is used to generate antibodies and other cells and products of the immune response.
  • Any of the peptides alone or in combination may be conjugated to conven ⁇ tionally known carrier proteins and animals may be immunized prior to infection with HTLV-I/II.
  • the peptides generating high immune response (both B- and T-cell responses) may be used to develop the vaccine in a conventional manner.
  • the envelope protein of HTLV-I is known to show variability for different viral isolates (Daenke S.,
  • Env-1 peptide (HTLV-I; amino acids 191-215) demonstrates a high sensitivity for HTLV-I infection (92%) , but a small percentage of HTLV-II infected subjects (8.6%) also reacts with this peptide, probably reflecting some degree of structural homology.
  • Env-2 (HTLV-II; amino acids 187-210) , on the other hand, reacts with both HTLV-I (94%) and HTLV-II (77%) serum samples.
  • the epitope is mimicked in such a way that it is recognized by antibodies in both HTLV-I and HTLV-II infected serum specimens and could be included in future peptide assays for serologic determination of HTLV-I/II infection.
  • Other investigators have used recombinant proteins
  • Wong-Staal F. Papas T.S.. Diagnostic potential for human malignancies of bacterially produced HTLV-I envelope protein. Science 1984; 226:1094-7; Tachibana N. , Miyoshi I., Papas T.S., Essex M. Antibody reactivity to different regions of human T-cell leukemia virus Type I gp61 in infected people. J. Virol. 1989;63:4952-7) or synthetic peptide technology to identify antigenic sites on the envelope (Palker T.J., Tanner M.E., Scearce R.M. , Streilein R.D., Clark M.E., Haynes B.F.
  • HTLV-I human T-cell leukemia virus Type I
  • gp46 and gp21 envelope glycoproteins with Env - encoded synthetic peptides and a monoclonal antibody to gp46.
  • Envelope proteins of human T- cell leukemia virus type-I characterization of antisera to synthetic peptides and identification of a natural epitope. J. Immunol. 1986;137:2945-51) proteins of HTLV- I.
  • one of our peptides overlaps with a region of gp46 (amino acids 190- 209) that contains both a T- and B-cell epitope (Palker T.J., Tanner M.E., Scearce R.M. , Streilein R.D., Clark M.E., Haynes B.F. Mapping of immunogenic regions of human T-cell leukemia virus Type I (HTLV-I) gp46 and gp21 envelope glycoproteins with Env - encoded synthetic peptides and a monoclonal antibody to gp46. J. Immunol.
  • a recombinant fusion protein (MTA-4; 42 amino acids) reactive with a human monoclonal has been shown to specifically react only with HTLV-I infected serum samples (Foung S.K.H., Lipka J.J., Bui K. Determination of a unique and immunodominant epitope of HTLV-I. Presented at the 3rd Annual Conference of Retrovirology, Hawaii, 1990. (Abs) ) .
  • the epitope of this monoclonal antibody has been mapped to amino acids 185-196 (Ralston S. , Hoeprich P., Akita R.
  • the Env-5 peptide-based assay provides a simplified, inexpensive, highly sensitive, and extremely specific test for discrimination of HTLV-I from HTLV-II infection, and could, therefore, easily replace the PCR procedure now used to distinguish the two viruses.
  • the findings that the inventor can achieve enhanced diagnostic specificity by a peptide-based ELISA is supported by earlier reports demonstrating serologic discrimination of HIV-1 and HIV-2 infection (Norrby E. , Biberfeld G. , Chiodi F. , et al. Discrimination between antibodies to HIV and to related retroviruses using site directed serology. Nature, 1987;329:248-50; Gnann J.W. , McCormick J.B., Mitchell S., Nelson J.A.
  • the proteins encoded by the gag, pol. and env gene of HTLV contributes to many of the pathological and func ⁇ tional properties of the virus which may be relevant during the course of the infection and the progression of the disease (Hopp T.P., Woods K.R. Prediction of protein antigenic determinants from amino acid sequences. Proc. Natl. Acad. Sci. , USA 1981;78:3824-8).
  • the present inventor Using a series of synthetic peptides with predicted antigenic epitopes from conserved amino-acid regions, the present inventor has tried to locate structural motifs within HTLV-I and HTLV-II for B-cell specific antibody recognition.
  • Gag-la defined from the C-terminal of pl9 protein (HTLV-I; aa 102-117) is the most immunodominant epitope and reacts with 90% of the HTLV-I infected sera subjects; a small percentage of HTLV-II infected sera also react with this peptide (11%) , reflecting some degree of antigenic homology within the HTLV-I and HTLV-II.
  • Gag la serum antibody reactivity against Gag la can be specifically inhibited with HTLV-I which repre ⁇ sents a conformationally "native" epitope present on the HTLV-I. Therefore, the Gag la peptide with amino acid sequence Pro Pro Ser Ser Pro Thr His Asp Pro Pro Asp Ser Asp Pro Gin lie represents an immunodominant domain of HTLV-I that is recognized by serum antibodies from most of HTLV-I infected persons. Moreover, the Gagla based immunoassay allows a serologic distinction between the closely related HTLV-I and HTLV-II infection.
  • the host In natural infection with a retrovirus, the host generally makes antibodies to the products of the gag or env gene or both (Schupbach, J. , Kalynaraman, J. , Sarngatiaran, G. , Blattner, W. , and Gallo, R. , 1983. Antibodies against three purified proteins of human types C retroviruses, human T-cell leukemia-lymphoma virus, in adult T-cell leukemia-lymphoma patients and healthy blacks from the Caribbean, Cancer Res 43. 886-891.; Gallo, D., Hoffman, M, N. , Lossen, C, K. , Diggs, J, L. , Hurst, J, W. , and Penning, L, M.
  • the sera includes 87 specimens from subjects who are seropositive to HTLV-I/II. With the exception of 32 specimens kindly provided by Dr. M. Osame, Kagoshima, Japan, all of the serum specimens are determined to be from HTLV-I or HTLV-II-positive persons by polymerase chain reaction (PCR) assays (De B., Srinivasan A. Detection of human immunodeficiency virus (HIV) and human lymphotropic virus type I or II dual infections by poly ⁇ merase chain reaction. Oncogene 1989; 4:1533-5), using peripheral blood lymphocytes from these same persons.
  • PCR polymerase chain reaction
  • HTLV-I antibodies with a commercial enzyme-linked immuno- sorbent assay (HTLV-I ELISA, Dupont, Wilmington, Del.), according to the manufacturer's recommendations. Speci ⁇ mens that are repeatedly reactive are further tested by Western blotting and radioimmunoprecipitation assay as described previously (Hartley T.M. , Khabbaz R.F., Cannon R.O., Kaplan J.E., Lairmore M.D. Characterization of antibody reactivity to human T-cell lymphotropic virus types I/II using immunoblot and radioimmunoprecipitation assays. J. Clin. Microbiol. 1990;28:646-50).
  • HTLV-I antigen MT-2 cell line, Miyoshi I., Kubonishi I. , Yoshimoto S. , et al. Type C virus particles in a cord T-cell line derived by co-cultivating normal human cord leukocytes and human leukemia T-cells. Nature 1981;296:770-3) obtained from Hillcrest Biologicals, Cypress, Calif. , is diluted in sodium dodecyl sulfate sample buffer (0.125 M Tris HCl, pH 6.8, 5% 2ME, 4% SDS), boiled for 3 min and electrophoresed in a 10% polyacrylamide gel with a 3% stacking gel. The separated proteins are electroblotted onto nitrocellulose paper.
  • sodium dodecyl sulfate sample buffer (0.125 M Tris HCl, pH 6.8, 5% 2ME, 4% SDS
  • MT-2 cell lines are metabo- lically labeled (200 mCi of each amino acid/ 10 7 cells/ ml) with [ 35 SJ cysteine and [ 35 S] methionine (New England Nuclear, Boston, Mass.).
  • the labeled cells are washed in phosphate-buffered saline (PBS) and extracted in PBS containing 0.1% SDS and 0.02% Triton X-100.
  • PBS phosphate-buffered saline
  • Triton X-100 Triton X-100.
  • the detergent solubilized proteins are reacted with serum specimens, immune complexes precipitated by Protein-A Sepharose (Sigma, St.
  • a serum specimen is determined to be HTLV-I/II-positive if antibody reactivity is detected to at least two different HTLV structural gene products (gag p24 and env gp46 and/or gp68) either by Western blotting or RIPA analysis. Serum specimens reacting with only gag or env gene products are considered indeterminate and are not included in this study.
  • the antibodies to HIV proteins are determined by both ELISA and Western blot (Dupont) , and only those specimens having antibodies to both gag and env proteins are included. Polymerase-Chain-Reaction Assays
  • PCR Polymerase chain reaction
  • Oligonu- cleotide primer pairs from pol and gag genes of HTLV-I and HTLV-II are used to amplify 1 mg total genomic DNA for each PCR amplification (De B, Srinivasan A. Detection of human immunodeficiency virus (HIV) and human lymphotropic virus type I or II dual infections by polymerase chain reaction.
  • HTLV-I and HTLV-II seguences in their envelope regions.
  • Four peptides are selected for synthesis by identifying regions in which HTLV-I and HTLV-II shows considerable amino acid differences (Fig 1) .
  • a cysteine residue is added to the N-terminus of each peptide to facilitate conjugation with proteins for studies not reported here.
  • Secondary structure characteristics of the envelope protein are predicted (Chou P.Y., Fasman G.D.
  • Synthetic peptides are made on the MilliGen 9050 Pepsynthesizer with 9-fluorenylmethyloxycarbonyl (Fmoc) chemistry, using the manufacturer's reagents and recom ⁇ mended chemistry cycles. Peptides are cleaved from the resin, precipitated, and extracted several times with anhydrous ether. Final purification is by preparative high performance liquid chromatography (HPLC) on a Waters C18 Delta-Pak (19 mm x 30 cm, 15u particle, 300u pore size), using 0.1% trifluoroacetic acid (TFA) in water as the starting solvent followed by a 0-50% acetonitrile gradient in 0.1% TFA. Amino acid composition, amino acid sequence analysis, and analytical reverse phase HPLC are performed to confirm peptide sequence and purity.
  • HPLC high performance liquid chromatography
  • Polyvinyl plates (Immulon II, Dynatech Laborato- ries, Inc., Alexandria, VA.) are coated with 50 ul of synthetic peptides (100 ug/ml) in 0.01M carbonate buffer, pH 9.6, and incubated overnight at 4°C
  • the plates are washed with PBS containing 0.05% Tween-20 (PBS-T) six times, and each well is incubated with 200 ml of 3% bovine serum albumin (BSA) in PBS-T for 1 h at 37°C to block excess reactive sites.
  • BSA bovine serum albumin
  • Inhibition of antibody binding to the synthetic peptide is carried out by adding increasing concentrations of synthetic peptide or purified HTLV-I or HTLV-II antigen (1-10 mg/ml) in the ELISA.
  • the serum is mixed with the inhibition antigen immediately before it is added to the Env-5 peptide-coated plate, followed by assay as described above. The results are expressed as the percentage inhibition of antibody binding.
  • Student's t-test is used for statistical evalua ⁇ tion as noted.
  • ELISA enzyme linked immunosorbent assay
  • Env-l demonstrates a high degree of reactivity (48/52; 92%) with serum specimens from HTLV-I infected persons and some cross-reaction (3/35; 8.6%) with speci ⁇ mens from HTLV-II-infected persons.
  • Env-2 although derived from HTLV-II sequence, reacts strongly with serum specimens from both HTLV-I (49/52; 94%) and HTLV-II (27/35; 77%) infected persons. Of the 21 serum specimens from normal controls and the 78 specimens from subjects with other infections, including HIV, none react with any of these peptides.
  • Gag. la One of the synthetic peptides termed Gag. la (HTLV-I; a.a. 102-117) derived from the Gag encoded protein of HTLV-I, demonstrates a high degree of reactivity (47/52;90%) with serum specimens from HTLV-I infected persons and some cross reaction (4/35;11%) with pecimens from HTLV-II infected persons (Table-2) .
  • pol-3 HTLV-I; a.a. 487-502
  • HTLV-I Specificity of antibodies detected by Env-5
  • the present inventors next perform a competitive inhi ⁇ bition experiment with serum specimens from four HTLV-I infected patients by preincubating the serum specimens with Env-5 peptide, and HTLV-I and HTLV-II antigen.
  • the antibody reactivity against Env-5 could be specifically inhibited by preincubating the serum specimen with Env-5 peptide or HTLV-I protein in a dose dependent manner, whereas incubation with a HTLV-II protein or unrelated peptide does not show any inhibition (Fig. 3) .
  • gag and pol protein of both HTLV-I and HTLV-II are analyzed by using computer algorithms developed by Chou and Fasman (Chou, P. Y., Fasman, G. D. , 1978. Prediction of the secondary structure of proteins from their amino acid sequence. Adv. Enzvmol.. 47, 47).
  • Figure 5 shows a secondary structure prediction for the gag region of HTLV- I and HTLV-II. Superimposed on the structural backbone are domains of high antigenic indices. The antigenic index is an algorithm designed by Jameson and Wolf to predict surface domains for combined values of flexibility, hydrophilicity and (Chou, P. Y., and Fasman, G. D., 1974. Prediction of Protein Confirmation.
  • One of the four regions with high antigenic indices lie within the Gag la domain.
  • the other three antigenic determinants are located near the C- terminus (amino acid nos. 337-342; 390-395 and 402-408).
  • the three highest antigen index domains within HTLV-II gag are located at the amino acid position 343-348; 403-408 and 405-411.
  • the absence of such a structural motif within the HTLV-II sequence (Figs. 5A and 5B) most likely is responsible for the lack of antibody responsiveness to this peptide in sera from individuals infected with HTLV- II.
  • 0.25% by weight of glutaraldehyde may be added in the coating buffer to facilitate better peptide binding on the plates or beads.
  • horseradish peroxidase conjugated mouse mono ⁇ clonal anti-human IgG antibody may be used in place of horseradish peroxidase conjugated goat anti human IgG (Fc) as the second antibody tracer.
  • gelatin used in these processes can include calf skin gelatin, pig skin gelatin, fish gelatin or any known available gelatin proteins or be replaced with albumin proteins.
  • Wells of 96-well plates are coated at 4°C over ⁇ night (or 3 hours at room temperature) , with at least one of the peptides of the invention at 1.5 mg per well of the mixture in 100 ml 10 mM NaHC0 3 buffer, pH 9.5. The wells are washed three times with phosphate buffered saline
  • test sera blood taken from a human patient or normal individual
  • 200 ml of the diluted sera are added to each well and allowed to react for 1 hour at 37°C
  • the wells are washed three times with 0.05% by volume Tween 20 in PBS in order to remove unbound antibodies.
  • Horseradish peroxi ⁇ dase conjugated goat anti-human IgG (Fc) is used as a second antibody tracer to bind with the HTLV-I or HTLV-II antibody-antigen complex formed in positive wells.
  • 100 ml of peroxidase labeled goat anti-human IgG at a dilution of 1:3000 in 1% by volume normal goat serum, 0.05% by volume Tween 20 in PBS is added to each well and incubated at 37°C for another 15 minutes.
  • the wells are washed five times with 0.05% by volume Tween 20 in PBS to remove unbound antibody and reacted with 100 ⁇ l of the substrate mixture containing 0.04% by weight orthophenylenediamine (OPD) and 0.012% by volume hydrogen peroxide in sodium citrate buffer, pH 5.0.
  • This substrate mixture is used to detect the peroxidase label by forming a colored product. Reactions are stopped by the addition of 100 ml of ⁇ .0M H 2 S0 4 and the absorbance measured using an ELISA reader at 492 nm (i.e., A,, ⁇ ) .
  • Example 3 The procedure of Example 2 is repeated using the same sera samples as in Example 2 except that the well plates are precoated with 1 mg per well heat inactivated NP40 solubilized HTLV-I.
  • PV flexible-polyvinylchloride
  • Wells of 96-well flexible-polyvinylchloride (PV) plates are coated at 4°C overnight (or 3 hours at room temperature) with at least one of the peptides of the invention at 1.5 mg per well in 100 ml lOmM NaHC0 3 buffer, pH 9.5.
  • the wells are washed three times with phosphate buffered saline (PBS) and then incubated with 250 ul of 3% by weight gelatin in PBS at 37°C for 1 hour to block the non-specific protein binding sites, followed by three or more washes with PBS containing 0.05% by volume Tween 20.
  • PBS phosphate buffered saline
  • test sera blood taken from a human patient or normal individual
  • PBS containing 20% by volume normal goat serum, 1% by weight gelatin and 0.05% by volume Tween 20 at dilutions of 1:20 and 1:2000 (volume to volume) respectively.
  • 200 ml of the diluted sera are added to each well and allowed to react for 1 hour at 37°C
  • the wells are then washed three times with 0.05% by volume Tween 20 in PBS in order to remove unbound antibodies.
  • 1-125 labeled affinity purified goat anti- human IgG(Fc) is used as a second antibody tracer that binds with the antibody-antigen complex formed in positive wells.
  • 100 ul of 1-125 labeled goat antihuman IgG of 50,000-200,000 cpm in 1% by volume normal goat serum, 0.05% by volume Tween 20 in PBS is added to each well and incubated at 37°C for another hour.
  • the wells are washed five times with 0.05% to volume Tween-20 in PBS to remove unbound second antibody and dried.
  • the wells are cut and counted by a gamma- scintillation counter.
  • Assays are performed in duplicate with a 1:20 dilution volume to volume. Normal sera sample as negative controls are also tested simultaneously. Cpm readings greater than the average reading of normal seira samples + 4SD (standard deviation) are taken as positive.
  • EXAMPLE 5 Detection of Antibodies to HTLV-I or HTLV-II by a Hemagglutination Assay using at least one of the peptides of the invention coated gelatin articles, Erythrocytes of different animal species or latex beads as the solid phase immunoadsorbent.
  • erythrocytes, gelatin particles, polystyrene latex beads are coated with at least one of the peptides of the invention at concentra ⁇ tions in the range of 5 mg/ml to 1 mg/ml.
  • the peptide mixture coated cells, particles or beads are then incu ⁇ bated with serially diluted serum samples in the wells of a 96-well U-shaped icroplate. After being left at room temperature for about an hour, the agglutination patterns on the bottom are read and the largest dilution showing a positive reaction is recorded.
  • a third test kit for detecting HTLV-I or HTLV-II antibodies using the hemagglutination assay comprises a compartmented enclosure containing multiple 96-well U-shaped microplates and materials or hemagglutination assay including (1) a bottle containing erythrocytes, gelatin particles or latex polystyrene beads coated with at least one of the peptides of the invention; (2) normal human serum (as a negative control) ; and (3) heat inactivated, seropositive HTLV-I or HTLV-II serum (as a positive control) .
  • the procedure described in Example 2 is to be followed.
  • a diagnostic test kit for HTLV-I or HTLV-II antibody detection can be constructed.
  • the test kit comprises a compartmented enclosure containing multiple 96-well plates coated prior to use with 1.5 m per well of at least one peptide of the present invention in 100 ml pH 9.5 lOmM NaHC0 3 buffer.
  • the kit further comprises materials for enzyme detection in separate sealed containers of: (1) normal human serum (as negative control); (2) heat inactivated HTLV-I or HTLV-II seropositive serum (as positive control) ; (3) normal goat serum; (4) peroxidase labeled-goat antihuman IgG; and (5) a color change indicator of orthophenylenediamine (OPD) and hydrogen peroxide in phosphate citrate buffer.
  • OPD orthophenylenediamine
  • 96-well plates precoated with the peptide of the present invention, can be replaced by polystyrene beads, or multiple mini-columns filled with controlled pore size glass beads, or nitrocellulose paper strip pre-coated with the peptides of the present inven ⁇ tion for use as the solid phase immunoadsorbent.
  • a second test kit for detecting antibodies using the immunoradiometric assay comprises a compart ⁇ mented enclosure containing multiple 96-well bendable polyvinylchloride (PVC) plates precoated with at least one peptide according to the present invention at a concentra ⁇ tion of 1.5 mg per well of the peptide in 100 ml of pH 9.5 lOmM NaHC0 3 buffer and materials for radioimmunoassay including: (1) normal human serum (as negative control) ; (2) heat inactivated, seropositive HTLV-I or HTLV-II serum (as positive control) ; (3) normal goat serum; and (4) 1-125 labeled goat anti human IgG.
  • the procedure described in Example 4 is to be followed.
  • 96-well PVC plates precoated with the peptides of the present invention can be replaced by polystyrene beads precoated with the peptide of the present invention for use as the solid phase immuno- adsorbent.
  • HTLV-I human T cell lymphotropic virus type I
  • HTLV-II type II
  • HTLV-II human T cell lymphotropic virus type I
  • ATL adult T cell leukemia
  • HAM HTLV-I-associated myelopathy
  • HTLV-II has not been conclusively associated with any specific disease (CDC, MMWR, 39, 915, 921-924, 1990; Hjelle et al. , J. Infect. Pis..
  • PCR polymerase chain reac- tion
  • HTLV-II infection has recently been shown to be endemic in Guaymi Indians in Panama (Lairmore et al, Proc. Natl. Acad. Sci. USA. 87:8840-8844, 1990; Heneien et al. , N. Engl. J.
  • peptides of various lengths were synthesized spanning the HTLV-II eov glycoprotein and identified linear antigenic determinants recognized by antibodies from patients infected with HTLV-II.
  • HTLV-II human T lympho ⁇ tropic virus type II
  • Env-20 85 " 102 and Env- 202 173 " 209 had minimal reactivity with sera from HTLV-I- infected individuals, whereas Env-203 219"256 reacted with 58% of HTLV-I specimens.
  • peptides Env-20 85 " 102 and Env-202 173 " 209 represent the type-specific immunodominant epitopes of HTLV-II external glycoprotein.
  • the 123 seropositive individuals had diverse geographic origins and risk factors, and included 58 blood donors, 30 IV drug users, and 35 American Indians (22 Guaymi Indians from Panama, 4 Se inole Indians from Florida, and 4 Navajo and 5 Pueblo Indians from New Mexico) . None of these specimens were from a person infected with both HTLV-I and HTLV-II. Polymerase Chain Reaction
  • HTLV-I- or HTLV-II-positive persons were confirmed to be from HTLV-I- or HTLV-II-positive persons by polymerase chain reaction (PCR) assays performed with DNA derived from peripheral blood lymphocytes from these individuals. Two gene regions from each patient were amplified using pol and tax/rex primers, and hybridized with 32 P end labeled oligoprobes from respective regions. The hybrid ⁇ ized products were electrophoresed and autoradiographed as described previously (Kwok et al., J. Infect. Pis.. 158, 1193-1197, 1989; Lee et al., Science. 244:471-475, 1989). Specimens were classified as HTLV-I or HTLV-II based on type-specific amplification of both pol and tax/rex regions. Reference HTLV Antibody Tests
  • Synthetic peptides were made on the MillGen 9050 Pepsynthesizer with 9-fluorenylmethyloxycarbonyl (Fmoc) chemistry according to recommended chemistry.
  • EIA enzyme immunoassay
  • Env-202 173 " 209 reacted with most of the specimens from HTLV-II-infected individuals: 91% of blood donors, 97% of IV drug users, 100% of Guaymi Indians, and 92% of North American Indians.
  • Env-2 187 " 209 also had similarly high rates of seroreactivity (data not shown) .
  • Env-20 85 - 102 located at the N-terminus of HTLV-II, reacted with 83% of specimens from HTLV-II-infected individuals. Surprisingly, a minimal reaction was observed with HTLV-I specimens despite significant homology of Env-20 with HTLV-I (Fig. 6) . Although fine mapping of Env-20 was not carried out, it is expected that the antibody-combining site probably consists of amino acids that are not conserved between Env-20 and the homologous region of HTLV-I. A peptide (a.a.
  • HTLV-I envelope contains an epitope that reacts with HTLV-I-positive sera (Horal et al., Human Retrovirology:HTLV (W.A. Blattner Ed.) p. 461- 467, Plenum Press, NY, 1990) and polyclonal antibodies raised to another peptide (SP2, a.a. 86-107) from this region neutralized HTLV-I in both a syncytium inhibition assay and HTLV-I pseudotype assay (Palker et al. , Presented at "Current Issues In Human Retrovirology: HTLV, Montego Bay, Jamaica, February 10-14, 1991).
  • Env-202 173 - 209 which reacted with 95% of HTLV-II infected specimens and had minimal reaction with HTLV-I specimens, was the most dominant and type-specific epitope of the HTLV-II external glycoprotein.
  • the immunodominance of the central region of the HTLV-II envelope has previ ⁇ ously been documented (Lai et al., J. Infect. Pis.. 163, 41-46, 1991; Chen et al., J. Virol.. 63, 4952-4957, 1990).
  • Env-2 a pep ⁇ tide, Env-2 (a.a. 187-209), reacts with the majority of HTLV-II sera, with some cross-section with HTLV-I speci ⁇ mens (Lai et al., J. Infect. Pis.. 163, 41-46, 1991).
  • the additional 13 amino acids at the N-terminus of Env-202 173"209 markedly increased the specificity of its reactivity as compared with Env-2.
  • Env-202 has recently been used successfully to develop an assay that can serologically discriminate between HTLV-I and HTLV-II (Viscidi et al., J. Acquir. Immune. Pefic. Syndr. (in press) .
  • the central region of HTLV-I glycoprotein also contains several dominant epitopes, as defined by either recombinant proteins such as MTA-4 (Lipka et al., J. Infect. Pis..
  • Env-203 219 " 256 reacted almost equally with HTLV-II and HTLV-I specimens. Since a smaller peptide (Env-204) with a.a. 232-255 had minimal reactivity with HTLV-infected specimens, the antibody- binding domain of Env-203 appears to be located toward the N-terminus. A type-specific immunodominant epitope of HTLV-I external glycoprotein was mapped to the C-termini of the envelope protein (Env-5 242*257 ) and has subsequently been shown to be exposed on the cell surface of HTLV-I infected cells (Lai et al., J. Infect. Pis.. 163, 41-46, 1991; J. Gen. Virol.. (in press)).
  • Env-25 369 " 384 represents the putative immunosuppressive domain that inhibits both lymphoproliferation (Ruegg et al., J. Virol.. 63, 3250-3256, 1989) and immunoglobulin secretion (Mitani et al., Proc. Natl.
  • HTLVTM 1 a group of low-risk blood donors within U.S. armed forces with isolated HTLV 8 " 8 reactivity was evaluated by a number of serologic assays containing whole viral antigens and the immunodominant epitopes of HTLV-I and HTLV-II.
  • Example 10 analysis of blood donors with HTLV"" 1 pattern demonstrated no evidence of HTLV-I or HTLV-II infection according to HTLV antibody enzyme immunoassay with synthetic antigens representing the immunodominant epitopes of HTLV-I and HTLV-II, and by PCR assays.
  • Env-2 187 - 209 , and Env-20 85"102 ) and gag protein (Gag-la 102 " 117 , and Gag-10 364 " 385 ) .
  • An endogenous retroviral seguence with structural homologies to the gag protein of HTLVs demonstrated antibodies not only in HTLV nd specimens, but also reacted with normal control subjects.
  • none of the 73 HTLV"" 1 specimens demonstrated presence of HTLV genome when amplified in the pol and ta /rex region. After 6 to 23 months from the time of the initial test, 23 subjects still gave similar WB patterns, and 9 of these repeat specimens were still negative for the presence of HTLV genome.
  • persons at low risk for HTLV infection who have HTLVTM 1 western blot reactivity are rarely, if ever, infected with HTLV-I and HTLV-II.
  • the criteria for seropositivity is that a serum specimen exhibiting reactivity to p24 8g and gp46 ⁇ v and/or gp61/68 env can be considered seropositive for HTLV-I/II and that a combination of Western blotting (WB) and radio ⁇ immunoprecipitation assays (RIPA) be used to visualize antibody reactivity to gag and env (Anderson et al. , Blood.
  • WB Western blotting
  • RIPA radio ⁇ immunoprecipitation assays
  • Serum specimens from all blood donors were ini- tially tested for HTLV-I/II antibodies with a licensed enzyme linked immunosorbent assay (HTLV-I ELISA, Pupont, Wilmington, PE) , according to the manufacturer's recommen ⁇ dations.
  • Specimens that were repeatedly reactive were further tested by WB incorporating purified recombinant HTLV-I envelope (r21) protein with a whole virus lysate derived from an HTLV-I infected cell line, HuT-102 (Cambridge Biotech, Rockville, MP) and RIPA using a lysate from the MT-2 cell line (Cambridge) .
  • a serum specimen was determined to be HTLV-positive if antibody reactivity was detected to at least two different HTLV structural gene products (gag p24 and env gp46 and/or gp68) .
  • a donor's assay results were considered to be indeterminant (HTLV"” 1 ) for HTLV-I/II, if the WB showed at least one band charac ⁇ teristic of HTLV-I/II (pl9, p24, or gp46) but did not meet the criteria for a positive result.
  • Specimens wiht HTLV"" 1 patterns were further analyzed on WB and RIPA containing HTLV-II antigens derived from an Mo-T cell line. Blood Donors
  • Env-1 191'213 HTLV-I, LPHSNLPHILEPSIPWKSKLLTLV
  • Env-2 187 " 209
  • HTLV-II, VHPSPLEHVLTPSTSWTTKILKF HTLV-I, SPNVSVPSSSSTPLLY
  • Env-20 85"102 HTLV-II, KKPNRQGLGYYSPSYNPP
  • Gag-la 102 ' 117 HTLV-I, PPSSPTHPPPPSPPQI
  • Gag-lO 364"385 HTLV-I/II, GHWSRPCTQPRPPPGPCPLCQPP
  • the optimal concen ⁇ trations determined were: dNTP's, 200 mM each; primers, 0.5 uM each; Tag polymerase, 1U; and MgCl 2 , 1.25 mM.
  • the amplification conditions followed were: denaturatoin of 94°C for 90 sec; annealing at 58°C for 2 min; extension at 72°C for 1 min, for 40 cycles.
  • Ten microiiters of PCR products were hybridized with 32 P end-labeled oligonucleo ⁇ tide probes in solution at 53°C and 45°C respectively.
  • HTLV-II GenBank accession no. M10060 sequences were as follows: SK110 (pol . HTLV-I 4757 " 4778 , HTLV-II 4735"4756 ) - CCCTACAATCCAACCAGCTCAG; SK111 (pol, HTLV-I 4942"4919 , HTLV-II 4920" 4897 )-GTGGTGAAGCTGCCATCGGGTTTT; SK112 fpol. HTLV-I 4825 " 840 )- GTACTTTACTGACAAACCCGACCTAC; SK188 (E°I, HTLV-II 48804998 )- TCATGAACCCCAGTGGTAA.
  • the hybridized products were elec ⁇ trophoresed on 10% polyacrylamide gels and autoradio- graphed.
  • the second amplification was performed in the tax/rex region as described previously. Briefly, fifty ml of the cell lysate was added to the 2xl0 6 cpm of 5' labelled primer, dNTPs (50mM) , Tag polymerase (2.5 U) and MgCl 2 (1.25mM) .
  • the primers used were Txl (ta /rex. HTLV- l 7336 - 7353 , HTLV-II 7248"7266 )-CGGATACCCAGTCTACGT; and Tx2 (tax/rex. HTLV-1 7494 " 7474 , HTLV-II 7406"7386 )- GAGCCGATAACGCGTCCATCG.
  • the amplification conditions were similar to as described above, except the annealing temperature was 55°C
  • the amplified products were digested with restriction enzymes Tag I and Sau 3A. and the products were electrophoresed on 8% polyacrylamide gels and autoradiographed.
  • a specimen was considered positive by PCR if HTLV sequences were detected by both primer parts. If a specimen was positive on one of the two amplifications, a third amplification was performed to determine positivity or negativity.
  • a specimen was considered to be HTLV-negative by PCR if there were no detectable HTLV sequences when cells were analyzed in duplicate for each of two primer pairs.
  • endogenous retroviral gene products may also provide an antigenic stimulus for production of antibodies that may be cross reactive with HTLV 8 * 8 proteins.
  • Peptides derived from an endogenous retroviral element were synthesized having a histidine tRNA primer binding site (RTVL-H) that has 60% homology with the C-terminus of HTLV-I and HTLV-II (RTVL 8 * 8 ) . While 88% of HTLVTM* specimens reacted with this peptide, 42% to 66% serum specimens from HTLV 1 TM 1 specimens also reacted with RTVL 8 " 8 . However, further analysis of HTLV 8 " 8 specimens demonstrated that 60% of these specimens also react with this peptide. Petection of HTLV PNA Seguences in Blood Ponors
  • peripheral blood lymphocytes were analyzed by PCR. Primer pairs were chosen from the pol and tax-rex region, both of which are highly conserved among HTLV-I and HTLV-II. Regions from gag and env were not amplified due to some seguence homology with endogenous retroviral seguences and varia ⁇ tion in different isolate sequences, respectively. In accordance with previous studies, both primers from the pol and tax/rex region were highly sensitive in identify ⁇ ing HTLV 0 * specimens (all of the 52 HTLV fK5 * gave a detect ⁇ able signal) .
  • HTLV indeterminant HTLV 1 TM 1
  • HTLV* HTLV indeterminant
  • pl9 8g may account for this reactivity (Lai et al., J. Med. Virol, in press). Indeed, 23% of the specimens with pl9 reactivity in WB assay demonstrated antibody responses to a synthetic Gag-la 102"117 epitope, that has previously been shown to represent a type specific immunodominant epitope of HTLV-I (Lai et al., J. Virol.. 65:1870-76, 1991). Furthermore, monoclonal antibodies to pl9* « s have been shown to react with antigens of normal thy us or human placenta (Haynes et al., J. Exp. Med. , 157:907-20, 1983; Suni et al.. Int. J. Cancer. 33:293-8, 1984) .
  • HTLV 8 * 8 representing the quasi-periodic primary structure has significant homologies with the amino-terminal segment of myelin basic protein (MBP) and may have potential for false positive antibodies (Liquori, J. Theor. Biol.. 148:279-81, 1991). Isolated gag reactivity in the absence of env reactivity could either be due to inability of current assays available for detection of env reactivity, or due to cross reactivity with closely related retrovirus or may represent early HTLV infection.
  • MBP myelin basic protein
  • gag antibodies are among the first antibod ⁇ ies to appear following sero-conversion (Manns et al., Blood. 77:896-905, 1991), the possibility that isolated core antibodies in HTLV"" 1 specimens may represent early sero-converters remains a possibility.
  • the antigenic mimicry of endogenous retroviral sequences with gag proteins of HTLV might be responsible for gag reactive antibodies (Abraham et al., Clin. Immunol. Immunopathol.. 56:1-8, 1990). Antibody response was found to a synthetic peptide derived from the endoge ⁇ nous retroviral sequence (RTVL 8 * 8 , Mager et al., J. Virol.. 61:4060-4066, 1987) both in HTLV 50 * and HTLV 1 TM 1 specimens.
  • the endogenous retroviral seguence has 60% homology with a 50 amino acid sequence at the C-terminus of gag.
  • the RTVL region contains two imperfect copies of this conserved sequence in a location very similar to that found in other retroviruses (Fig. 9) .
  • another ERS contains two open reading frames potentially encoding for 25kP and 15kP and show 32-39% homology with the gag protei. of HTLV-I/II (Perl et al., Nucleic Acids Res..
  • RTVL 8 * appears to be one of such epitopes that induce antibody response both in HTLV infected and uninfected persons.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Virology (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

L'invention se rapporte à un peptide, qui possède une immunoréactivité spécifique aux anticorps du virus HTLV-1, du virus HTLV-2 ou de combinaisons de ceux-ci et qui comprend un peptide choisi dans le groupe constitué de: Env-1 (HTLV-I; a.a 191-215)LPHSNLDHILEPSIPWKSKLLTLV, Env-2 (HTLV-II; a.a 187-210)VHDSDLEHVLTPSTSWTTKILKFI, Env5 (HTLV-I; a.a 242-257)SPNVSVPSSSSTPLLY, Gagla (HTLV-I; a.a 102-117)PPSSPTHDPPDSDPQI, Pol-3 (HTLV-I; a.a 487-502)KQILSQRSFPLPPPHK, Env-20 (HTLV-II; a.a. 85-102)KKPNRQGLGYYSPSYNDP, Env-23 (HTLV-I; a.a. 274-289)QPRLQAITTDNCNNSI, Gag-10 (HTLV-I/II; a.a. 364-385)GHWSRDCTQPRPPPGPCPLCQDP, Ers (séquence rétrovirale endogène) PRIPPKPCPICVCPNWKSDCPT, et à des analogues de ce peptide, dans lequel les acides aminés de la séquence peuvent être substitués pour autant que l'immunoréactivité aux anticorps des virus HTLV-1 ou HTLV-2 dérivés de la configuration tridimentionnelle des séquences soit dans l'ensemble conservée. Un procédé d'immunoanalyse et servant à la détection des anticorps du virus HTLV-1, du virus HTLV-2 ou d'une combinaison de ceux-ci, un kit de test servant à la détection de ces anticorps, une composition peptidique contenant ces peptides et un vaccin sont également décrits.
EP9191916706A 1990-08-29 1991-08-29 Novel peptide antigens and immunoassays, test kits and vaccines using the same Withdrawn EP0551308A4 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US07/574,352 US5378805A (en) 1990-08-29 1990-08-29 Immunoreactive HTLV-I/II ENV and POL peptides
US574352 1990-08-29
US73477791A 1991-07-23 1991-07-23
US734777 1991-07-23

Publications (2)

Publication Number Publication Date
EP0551308A1 true EP0551308A1 (fr) 1993-07-21
EP0551308A4 EP0551308A4 (en) 1994-09-14

Family

ID=27076368

Family Applications (1)

Application Number Title Priority Date Filing Date
EP9191916706A Withdrawn EP0551308A4 (en) 1990-08-29 1991-08-29 Novel peptide antigens and immunoassays, test kits and vaccines using the same

Country Status (5)

Country Link
EP (1) EP0551308A4 (fr)
JP (1) JPH07502483A (fr)
AU (1) AU641554B2 (fr)
CA (1) CA2090470A1 (fr)
WO (1) WO1992004046A1 (fr)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PT643835E (pt) * 1992-02-24 2001-10-30 Genelabs Tech Inc Ensaio e metodo para htlv-i/htlv-ii
US6406841B1 (en) * 1993-07-01 2002-06-18 Abbott Laboratories Methods for the detection of HTLV-II antibodies employing novel HTLV-II NRA envelope peptides
DE69938062T2 (de) 1998-12-31 2009-01-15 Novartis Vaccines and Diagnostics, Inc., Emeryville Modifizierte hiv env polypeptide
JP2003523721A (ja) 1998-12-31 2003-08-12 カイロン コーポレイション 抗原性ｈｉｖｃ型ポリペプチドをコードするポリヌクレオチド、ポリペプチド、およびそれらの使用
AU2002320314A1 (en) 2001-07-05 2003-01-21 Chiron, Corporation Polynucleotides encoding antigenic hiv type c polypeptides, polypeptides and uses thereof
US20030170614A1 (en) 2001-08-31 2003-09-11 Megede Jan Zur Polynucleotides encoding antigenic HIV type B polypeptides, polypeptides and uses thereof
EP2582850B1 (fr) * 2010-06-21 2016-11-09 Life Technologies Corporation Compositions, trousses et procédés pour la synthèse et/ou la détection d'acides nucléiques

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1990008162A1 (fr) * 1989-01-13 1990-07-26 United Biomedical Inc. Compositions de peptides synthetiques immunoreactifs par rapport a des anticorps de htlv-1
WO1990010231A1 (fr) * 1989-03-02 1990-09-07 Replico Medical Ab Discrimination entre des anticorps contre htlv-i, htlv-ii ou des retrovirus apparentes, des nouveaux peptides, detection d'anticorps et kits d'immunoanalyse
WO1990015820A1 (fr) * 1989-06-13 1990-12-27 Syntello Ab Peptides et anticorps derives de diagnostic et de therapie d'une infection provoquee par le htlv-1, et de vaccination contre celui-ci
EP0439077A2 (fr) * 1990-01-24 1991-07-31 United Biomedical Inc. Composition peptidique ayant une activité immunologique contre des anticorps contre HTLV

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH02209889A (ja) * 1988-02-08 1990-08-21 Univ Duke 合成親水性ペプチド
US5017687A (en) * 1988-03-10 1991-05-21 Virovahl, S.A. Peptides for the detection of HTLV-1 infection
JPH03107764A (ja) * 1989-09-21 1991-05-08 Nippon Sekijiyuujishiya 成人型ｔ細胞性白血病関連抗体の測定方法
JP2807287B2 (ja) * 1989-10-13 1998-10-08 株式会社医学生物学研究所 ペプチドおよびその用途
ES2072346T3 (es) * 1989-10-23 1995-07-16 Hoffmann La Roche Peptidos sinteticos de la cubierta del htlv-i.

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1990008162A1 (fr) * 1989-01-13 1990-07-26 United Biomedical Inc. Compositions de peptides synthetiques immunoreactifs par rapport a des anticorps de htlv-1
WO1990010231A1 (fr) * 1989-03-02 1990-09-07 Replico Medical Ab Discrimination entre des anticorps contre htlv-i, htlv-ii ou des retrovirus apparentes, des nouveaux peptides, detection d'anticorps et kits d'immunoanalyse
WO1990015820A1 (fr) * 1989-06-13 1990-12-27 Syntello Ab Peptides et anticorps derives de diagnostic et de therapie d'une infection provoquee par le htlv-1, et de vaccination contre celui-ci
EP0439077A2 (fr) * 1990-01-24 1991-07-31 United Biomedical Inc. Composition peptidique ayant une activité immunologique contre des anticorps contre HTLV

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of WO9204046A1 *

Also Published As

Publication number Publication date
CA2090470A1 (fr) 1992-03-01
EP0551308A4 (en) 1994-09-14
AU8610091A (en) 1992-03-30
JPH07502483A (ja) 1995-03-16
AU641554B2 (en) 1993-09-23
WO1992004046A1 (fr) 1992-03-19

Similar Documents

Publication Publication Date Title
CA1280363C (fr) Compose peptidique et methode pour la detection des anticorps contre htlv-iii
US5221610A (en) Diagnostic method and composition for early detection of HIV infection
JP2851278B2 (ja) Ｈｔｌｖ−ｉに対する抗体の検出のための抗原，ａｔｌのためのワクチンとしてのペプチド組成物およびそれを用いる方法
Palker et al. Mapping of homologous, amino-terminal neutralizing regions of human T-cell lymphotropic virus type I and II gp46 envelope glycoproteins
Lipka et al. Segregation of human T cell lymphotropic virus type I and II infections by antibody reactivity to unique viral epitopes
JPS6261996A (ja) 合成ペプチド、並びにそれを用いたエイズおよびプリ・エイズの検出方法
JPH0751598B2 (ja) Ｈｔｌｖ‐１感染検出用合成ペプチド抗原
US6531574B1 (en) T-lymphotrophic virus
JP3271666B2 (ja) Ｈｔｌｖ―ｉ、ｈｔｌｖ―ｉｉ又は関連レトロウイルスに対する抗体間の識別、新規ペプチド、抗体の検出及び免疫アッセイキット
JP2650217B2 (ja) Ｈｔｌｖ―１感染の診断、治療及び予防接種のためのペプチド
AU641554B2 (en) Novel peptide antigens and immunoassays, test kits and vaccines using the same
Lal et al. Characterization of immunodominant epitopes of gag and pol gene-encoded proteins of human T-cell lymphotropic virus type I
JP2643598B2 (ja) Ｈｔｌｖ‐▲ｉ▼抗体に対する免疫反応性を有する合成ペプチド組成物
EP0439077B1 (fr) Composition peptidique ayant une activité immunologique contre des anticorps contre HTLV
US5019510A (en) Isolation, molecular cloning and sequencing of an HIV-1 isolate from a Gabonese donor
US5378805A (en) Immunoreactive HTLV-I/II ENV and POL peptides
Yokota et al. The prevalence of antibody to p42 of HTLV‐1 among ATLL patients in comparison with healthy carriers in Japan
US5476765A (en) Synthetic peptide compositions with immunoreactivities to antibodies to HTLV and as vaccines
WO1993002102A1 (fr) Nouveaux antigenes de peptides et dosages, kits de tests et vaccins les utilisant
Lal et al. Differential antibody responsiveness to p19 gag results in serological discrimination between human T lymphotropic virus type I and type II
Lal et al. Identification of immunodominant epitopes in envelope glycoprotein of human T lymphotropic virus type II
Rudolph et al. Discrimination of human T-lymphotropic virus type-I and type-II infections by synthetic peptides representing structural epitopes from the envelope glycoproteins
US6541609B2 (en) HIV-2 peptides
US5681696A (en) Synthetic peptide compositions with immunoreactivities to antibodies to HTLV
US5882853A (en) Method of evaluating HTLV-I-specific T cell responses

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19930319

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IT LI LU NL SE

RHK1 Main classification (correction)

Ipc: C07K 7/10

A4 Supplementary search report drawn up and despatched

Effective date: 19940728

AK Designated contracting states

Kind code of ref document: A4

Designated state(s): AT BE CH DE DK ES FR GB GR IT LI LU NL SE

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Withdrawal date: 19951031