CZ9903054A3 - Gene agglomerate of acabose biosynthesis from actinoplanes sp. se 50/110 - Google Patents

Description

i-: < ??

The agarate of acarbose biosynthesis genes from Actinoplanes sp. SE 50/110

Technical field

The invention relates to the isolation of additional biosynthesis genes and metabolism of acarbose from Actinomycetes, in particular Actino-planes sp. SE 50/110 and its mutants, which are associated with the already known common gene agglomerate biosynthesis genes, the use of these genes for the production of acarbose and acarbose homologs by Actinoplanes sp. and other producers of acarbose related natural substances (pseudooligosaccharides), the use of these genes to optimize the method by biochemical-molecular biological engineering, as well as heterologous expression of these genes in other microorganisms.

BACKGROUND OF THE INVENTION It is an object of the earlier patent applications (for example DE 2 064 092, DE 2 209 834) that a number of Actinomycetes, especially Actinoplanacet, form inhibitors of glycoside hydrolases of the oligosaccharide type, preferably digestive enzymes. The most potent inhibitor of this group is the compound 0-4,6-dideoxy-4 - [[1S- (1S, 4R, 5S, 6S) -4,5,6-trihydroxy-3- (hydroxymethyl) -2- cyclohexen-1-yl] -amino] -α-D-glucopyranosyl- (1 ' > 4) -OaD-glucopyranosyl- (1 '-gt; 4) -D-glucopyranose, referred to as acarbose (DE 2 347 782) .

Acarbose is a potent inhibitor of? -Glucosiase, which is used under the brand name Glucobay. 2 · · · · · · · · · · · · · · · · · for the treatment of diabetes mellitus. Secondary metabolites of acarbose are produced by Actinoplanes sp. SE 50 (CBS No. 791.96) and by the natural variant of this strain SE 50/110 (CBS 793.96), as well as their selectants and mutants. In the aforementioned patent applications, for example in Examples 1 to 4 of German Patent Application P 22 09 834, obtaining such an α-glucosidase inhibitor is described.

By means of molecular biological methods, certain genes can be isolated from the non-characterized genome, using genosons, for example, P-labeled DNA fragments that specifically bind to the DNA sequence of interest. Furthermore, Aktinomycetes, especially Streptomycetes, are known to have chromosome-bound biosynthesis genes, rarely, a plasmid arranged side-by-side in an agglomerate [Hershberger, C. L., et al. (1989)]. In this way, adjacent, hitherto unknown biosynthetic genes can be isolated using genosides, the meaning of which can then be elucidated for the desired biosynthesis. Similarly, the corresponding biosynthesis genes in other microorganisms can be detected using genosonds.

From the acarbose structure, it is believed that the deoxyglucose part of the acarbose molecule is formed similarly to the biosynthesis of 6-deoxy-sugar residues of various antibiotics (e.g., aminoglycosides such as streptomycin and kasugamycin; macrolides such as erythromycin and tylosin; polyenes such as amphotericin A, Ba nystatin, anthracyclines such as dauno-rubricin, glycopeptides such as vancomycin). Therefore, the gene probe and heterologous pairs of PCR-primers are derived from highly conserved protein regions of known enzymes.

dTDP-glucose dehydratase.

With gene technology, certain genes can be isolated directly from the genome using, for example, gene probes that specifically bind to the DNA sequence. Thereby, the isolated gene can be obtained from a large number of unknown sequences. Furthermore, it is known in Actinomycetes, especially Streptomycetes, that biosynthesis genes are arranged side by side on a chromosome, rarely on a plasmid, in the " cluster " [J. J. F., J. Ind. Microbiol 9, 73-90 (1992); Khat K. F., Ciba Found. Symp., 171 (Secondary Metabolites: Their Function and Evolution) 144-162 (1992)]. This can isolate adjacent, hitherto unknown biosynthetic genes, whose importance for biosynthesis can then be elucidated by gene probe acquisition.

The acarbose structure suggests that the des-oxyglucose moiety of the acarbose molecule is formed similarly to the biosynthesis of 6-deoxy-sugar residues of various antibiotics (e.g., aminoglycosides such as streptomycin and kasugamycin; macrolides such as erythromycin and tylosin; polyenes such as amphotericin A Ba nystatin; anthracyclines such as dauno-rubricin; glycopeptides such as vancomycin). Therefore, genosonda and heterologous pairs of PCR-primers were derived from highly conserved protein regions of known dTDP-glucose-dehydratase enzymes.

The use of the techniques described has led to Actinoplanes sp. SE 50/110 first for the isolation and sequencing of the 2.2 kb BamHI-DNA fragment with the complete acbB DNA sequence (coded for dTDP-glucose dehydratase) as well as the acbA DNA-partial sequence (coded for dTDP-glucose) synthase) and acbC (coded for

4 • Cyclase [EP A 0 730 029 / DE 19 507 214]. As other enzymes involved in the biosynthesis of acarbose, acarviosyl transferase from Actinoplanes sp. SE 50/110 and its mutants (encoded by acbD) [DE 196 25 269.5], as well as acarbose-7-phosphotransferase (encoded by acbK) [Goecke K. et al. (1996); Drepper A. et al., (1996)]. The ability to exchange acarviosin-containing pseudooligosaccharides with the corresponding sugar moiety for another sugar has been described for acarviosyl transferase. Acarbose-7-phosphoryltransferase (acarbose-ki-nasa) may be involved in the production of the acarbose transport form from the cell. In addition, acarbose-7-phosphotransferase appears as part of a self-defense mechanism.

SUMMARY OF THE INVENTION In the present patent application, an agglomerate of biosynthesis genes as well as other acarbose gene exchange genes from Actinoplanes sp. SE 50/110 in the 18 kb region (see Figures 1-3). Surprisingly, the isolation of other acarbose gene exchange genes has shown that the already known acbACB biosynthesis genes [EP A 0 730 029 / DE 19507214] are in the society of the acarbose modification (acarviosyltransfer, phosphorylation, acbD, acbK) genes of extracellular or cytoplasmic metabolism of maltodextrin and glucose (α-amylase and 4-α-glucanotransferase, optionally amylomaltase) enzymes, and binding protein-dependent sugar (maltodextrin or disaccharide in the cytoplasm) transport present in the common gene agglomerate. This finding is particularly important for the biotechnological production of acarbose with respect to the method optimization, since this provides a new, broader view of the possibilities available in earlier patents, for the usefulness of important parts of the overall metabolism. · | Acarboses for biochemical-molecular-biological engineering methods. Thus, the presence of the α-1,4-glucan precursor present in starch / maltodextrin degradation, construction / degradation as well as the cytoplasmic conversion of the oligosaccharides to the maltose stage, the diversity of the production spectrum as well as the elimination of acarbose and, if possible, the elimination of acarbose, are also likely to influence acarbose synthesis. / or releasing it outside the cells of an important modification (e.g., acyrbose phosphorylation). It is therefore an object of the present invention to isolate other biosynthesis genes from Actinoplanes sp. SE 50/110 and their use for isolating flanking DNA regions to further elucidate the acarbose gene agglomerate.

Clarification of acarbose gene agglomeration with isolation and characterization of acarbose biosynthesis genes is the basis for targeted improvement of the production process, for example:

By enhancing acarbose synthesis performance in Actinoplanes by amplifying the " Bottleneck " -enzymes genes, using more efficient promoters, rejecting or amplifying regulatory mechanisms;

Improved recovery of precursors, especially from the metabolism of sugars with the optimization of transport mechanisms, such as substrate transport into cells and release of acarbose or modified compounds;

By limiting the production spectrum in Actinoplanes to the desired acarbose product by eliminating undesirable biosynthetic pathways to side components or by eliminating unwanted enzymatic degradation reactions;

Expression in heterologous host strains to increase production by improving yield per unit space per time, to simplify the processing process, to target production spectrum restriction;

Using single or multiple acarbose biosynthesis genes for in-vitro acarbose synthesis or compounds of this class when starting from synthetically or microbially produced precursors.

The invention therefore relates to:

Recombinant DNA molecules that contain acarbose biosynthesis genes and acarbose homologs that are arranged in the gene agglomerate of Figure 2.

The recombinant DNA molecules with the cleavage site arrangement of the restriction enzymes of Figure 1. The complete 18 kb DNA fragment sequence with the genes of Table 3 shown in Table 1, as well as the resulting amino acid sequences. - 7 • · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

Table 1

Properties of acb genes and acb gene products

Gene Product Gen. from -doa AS postulated function, related proteins acbA 8914-9838 307 dTDP-glucose synthase; 58.1% sequence identity in 217 AK overlap to RfbA from Shigella flexneri (L14842) acbB 8844-7818 341 dTBP-glucose-4,6-dehydratase; 63.0% sequence identity in 327 AK overlap to MtmE of Streptomyces argillaceus (Y10907) acbC 6628-7529 381 C7-Cycad sugar similar to 3-dehydrochinic acid synthase; 26.8% identity in 340 AK overlap to AroB from Mycobacterium tuberculosis (X59509) acbD 13373-15548 724 acarviosyltransferase, similar to other oligo- to polydextrin transferases or hydrolases, greater similarity to the cycloaltodextrin-glucanotransferase group; 41.1% identity in 734 AK overlap with Bacillus circu-lans CdgT protein (X68326)

acbE 12385-9320 1021 α-amylase; 45.0% identity in 897 AK overlap with α-amylase from Streptomyces lividans (X70255) acbF 17515-16537 325 MalF-like membrane protein on a lactose-dependent ABC-transcript binding protein; 29.9% identity in 251 AK overlap with LacF protein from Synechocytis sp. PCC6803 (D90905) acbG 16541-15119 252 MalG-like membrane protein on dependent ABC-transporter binding protein; 27.8% identity in 234 AK overlap with 0RF2 protein from thermophilic bacteria acbH (18482-17511) 322 MalE-like binding protein on dependent protein-dependent ABC-translator; 22.2% identity in 279 AK overlap with MsmE protein from Streptococcus mutans (M77351) acbK 1991-2894 300 sugar- and adenosine-kinase-like acarbose-7-kinase; 57.9% identity in 279 AK overlay with Urf2 protein from Steptomyces sp. (U08602), whose gene is adjacent to the sorbitan dehydrogenase-like oxidoreductase gene of acbL (3966-4988) 340; 26.6% identity in 214 AK overlap with HI0053 protein from Haemophus influenzae (L42023) acbM 2890-3970 359 unknown function (no significant - 9 - 9 • · ·

• · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · • · -5823) £ 25 > oxidoreductase acbQ 1-1960 527 maltodextrin glucotransferase; MalQ-like protein with 33.0% identity in 339 AK overlap to MalQ protein from Haemophilus influenzae (L45989) acbO 5819-6627 230 unknown function (no significant similarity) and position number referring to base pairs in BglII-Sstl- fragment at Fig. 3. In parentheses, information that is not yet complete or indicates an uncertain reading to the incremental insertion number in the bank is given in the brackets of the AK amino acid. In this case, the acbA and acbB genes are most likely to encode acarbose biosynthesis enzymes since they have a high sequence identity of AcbA or AcbB to known bacterial dTDP-glucose synthases or dTDP-glucose dehydratases. The similarity of protein sequences to the corresponding closest known representatives of both groups of enzymes (see Figure 3) lies far beyond any other pairs of functionally identical proteins from both groups. Amazingly, AcbA has its closest relatives in streptomyces proteins, while AcbB is most closely related to various RfbB-proteins of gram-negative bacteria. However, this phenomenon is also shown in other corresponding strep-tomycet proteins, for example TylA1 and TylA2 from tylosin producers Streptomyces fradiae [Merson-Davies and Cundliffe (1994)], which are also encoded by adjacent genes in the common gene agglomerate.

The acbC gene encodes the likely acarbose biosynthesis enzyme, since AcbC is related to AroB proteins, dehydrochinic synthetase, and, after overexpression in Streptomyces lividans, exhibits enzyme activity that, as expected, is reacted with heptulosophosphates (e.g. 7-phosphate) to products having similar properties to valienone and valionone (possible precursors of acarbose biosynthesis) but not identical to these compounds.

The acbK (acarbose-7-kinase), acbL (ketocucr- or alcoholic sugar-oxidoreductase) and acbM (unknown function) genes, as well as the acbN gene (a direct compound with the acbL and acbC frameworks indicated by the overlapping start-/ stop codon) encode probably acarbose biosynthesis enzymes, since they all together with acbC and possibly acbQ form a probable operon (transcription unit) and are likely to be translationally coupled. Also, the specific cytoplasmic localized acarbose kinase (AcbK) and possible dehydrogenase (AcbL) functions suggest direct involvement in the intracellular metabolism of acarbose; AcbL sugar dehydrogenase could participate in the synthesis of the precursor C-7 of cycllitol or 6-desoxyhexose, or condensation thereof.

Both acbD genes (Acarviosyl transferase) [DE 196 25 269.5; Goeke, K. et al., (1996; Drepper, A. et al., (1996)] and acbE (α-amylase), which lie against each other with the common promoter region in the agglomerate of Actinoplanes sp. · · · · · · · · · · · · · · · · ·

50/110, which both code for the amylase enzymes, suggests that there is a close link between starch degradation and acarbose production. This is confirmed by the finding that both enzymes in Actinoplanes sp. extracellular proteins in the Actinoplanes sp culture liquid are most strongly expressed in growth on starch as a carbon source. This applies to acbE-expression under the control of a suitable promoter even in Streptomyces lividans (see examples).

The acbHFG genes probably encode the extracellular sugar-binding protein, acbH, and two typically membrane components of AcbF and AcbG, a bacterial sugar-transporter of the ABC-importer type. They are likely to be involved in the acarbose metabolism by the uptake of oligo-maltodextrins or recycle acarbose as a transport vehicle for short oligo-a-1,4-glucans (higher acarbose homologs) by cell uptake. The amylomaltase-like gene product (AcbQ) of the acbQ gene can also participate in such a process. Further, the invention relates to:

A method for the isolation of acarbose biosynthesis genes from Actino-mycet, especially Actinoplanes, by using a gene probe derived from a 2.2 kb BamHI fragment. The 2.2-kb BamHI fragment, which has been derived from the highly conserved protein regions of known dTDP-glucosodehydratase enzymes using the gene probe obtained by the PCR primer, is described in EP-A-0 730 029 / DE 19507214.

A method for the isolation of biosynthesis genes of acarbose related natural substances in Actinomycetes (e.g., validamycin, oligostatine / trestatin), adiposine). - 12 • · · · ··· · ··· · · · · · · · · · ·

A method of enhancing acarbose synthesis performance in Actinoplanes by increasing the rate of the biosynthesis enzyme-determining rate by effective promoters for the biosynthesis enzyme-determining rate and eliminating unwanted regulatory steps.

A method for enhancing acarbose synthesis performance in Actinoplanes by constructing a protein in biosynthetic steps that limit acarbose synthesis or to eliminate degradation products that arise from adverse biosynthetic enzyme side reactions.

A method of limiting the spectrum of Actinoplanes products to the desired major product by eliminating undesirable side-component biosynthesis pathways or by removing unwanted enzymatic degradation reactions, for example by inactivating the acbD gene.

A method of altering transport mechanisms with respect to improved substrate transport to cells or more efficiently emerging acarbose from cells and

The method of expression in heterologous host strains (e.g., in pseoudo-oligosaccharides-forming Streptomyces, as well as in other Streptomycetes, in fast-growing bacteria such as Escherichia coli, or in yeast and fungi) to improve spatial yield per unit time to - - 13 «· · · · · · · · · · · · · · · · · · · · · · · • 4 lo · ·· reached an increase in production, found a simplified processing method and achieved targeted product spectrum limitations and.

Use of acarbose biosynthesis genes for in-vitro synthesis of acarbose or compounds of this class, using synthetically or microbially produced precursors. The present invention is described in more detail below. All gene technology methods are performed, unless otherwise indicated, by J. Sambrook et al. (Molecular Cloning; A laboratory manual; 2nd edition, 1989; Cold Spring Harbor Laboratory Press, N.Y., USA).

Three different gene probes are used for screening. They are isolated from the plasmids pAS2, pAS5 / 7.3 and pAS6 / 3. Plasmid pAS2 was prepared from E. coli DH5α using " Boiling-Met-hr " or alkaline lysis and hydrolysis with BamHI restriction endonuclease. The resulting 2.2 kb BamHI fragment was generated

O is isolated and marked as " Nick-translation " P-labeled acyl (3966-4988) sorbitan dehydrogenase-like oxidoreductase; 26.6% identity in 214 AK overlap with HI0053 protein from Haemo-philus influenzae (L42023) acbM 2890-3970 359 unknown function (no significant similarity) - 14 • * • · • ·· • (acbN) (5049-5823 258 oxidoreductase

acbQ 1-1960 527 maltodextrin glucotransferase; MalQ-like protein with 33.0% identity in 339 AK overlap to MalQ protein from Haemophilus influenzae (L45989) acbO 5819-6627 230 unknown function (no significant similarity) and position number referring to base pairs in BglII-SstI-fragment at Fig. 3. In parentheses, information that is not yet complete or indicates an uncertain reading to the incremental insertion number in the bank is given in the brackets of the AK amino acid. In this case, the acbA and acbB genes are most likely to encode acarbose biosynthesis enzymes since they have a high sequence identity of AcbA or AcbB to known bacterial dTDP-glucose synthases or dTDP-glucose dehydratases. The similarity of protein sequences to the corresponding closest known representatives of both groups of enzymes (see Figure 3) lies far beyond any other pairs of functionally identical proteins from both groups. Amazingly, AcbA has its closest relatives in streptomyces proteins, while AcbB is most closely related to various RfbB-proteins of gram-negative bacteria. However, this phenomenon is also shown in other corresponding streptomycet proteins, for example TylA1 and TylA2 from tylosin producers Streptomyces fradiae [Merson-Davies and Cundliffe (1994)], which are also encoded by adjacent genes in the common gene agglomerate.

The acbC gene encodes the likely acarbose biosynthesis enzyme, since AcbC is related to AroB proteins, dehydrochinic synthetase, and, after overexpression in Streptomyces lividans, exhibits enzyme activity that, as expected, is reacted with heptulosophosphates (e.g. 7-phosphate) to products having similar properties to valienone and valionone (possible precursors of acarbose biosynthesis) but not identical to these compounds.

The acbK (acarbose-7-kinase), acbL (ketocucr- or alcoholic sugar-oxidoreductase) and acbM (unknown function) genes, as well as the acbN gene (a direct compound with the acbL and acbC frameworks indicated by the overlapping start-/ stop codon) encode probably acarbose biosynthesis enzymes, since they all together with acbC and possibly acbQ form a probable operon (transcription unit) and are likely to be translationally coupled. Also, the specific cytoplasmic localized acarbose kinase (AcbK) and possible dehydrogenase (AcbL) functions suggest direct involvement in the intracellular metabolism of acarbose; AcbL sugar dehydrogenase could participate in the synthesis of the precursor C-7 of cycllitol or 6-desoxyhexose, or condensation thereof.

Both acbD genes (Acarviosyl transferase) [DE 196 25 269.5; Goeke, K. et al., (1996; Drepper, A. et al., (1996)] and acbE (α-amylase), which lie against each other with the common promoter region in the agglomerate of Actinoplanes sp. and which both encode for the amylase enzymes, suggests that there is a close link between the degradation regulation and the ♦ · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

starch and acarbose production. This is confirmed by the finding that both enzymes in Actinoplanes sp. extracellular proteins in the Actinoplanes sp culture liquid are most strongly expressed in growth on starch as a carbon source. This applies to acbE-expression under the control of a suitable promoter even in Streptomyces lividans (see examples).

The acbHFG genes probably encode the extracellular sugar-binding protein, acbH, and two typically membrane components of AcbF and AcbG, a bacterial sugar-transporter of the ABC-importer type. They are likely to be involved in the acarbose metabolism by the uptake of oligo-maltodextrins or recycle acarbose as a transport vehicle with a short 1.4 kb BamHI fragment pAS5 / 3.1 = 0.35 kb SphI / FspI fragment from pAS5 / 3 pAS5 / 3.2 = 0.85 kb SphI / BamHI fragment from pAS5 / 3 pAS5 / 3.3 = 0.55 kb SphI / BamHI fragment from pAS5 / 3 pAS5 / 4 pAS5 / 5 pAS5 / 7 pAS5 / 7.1 pAS5 / 7.2 pAS5 / 7.3 pAS5 / 11 pAS5 / 12 pAS5 / 13 pAS5 / 16 1.2 kb BamHI fragment from plasmid pAS5 0.48 kb SstI / BamHI fragment from plasmid pAS5 1.2 kb PstI / SstI fragment from plasmid pAS5 0.64 kb PvuII / AccI fragment from plasmid pAS5 / 7 0.54 kb PstI / SphI fragment from plasmid pAS5 / 7 0.67 kb SphI / Sstl fragment from plasmid pAS5 / 7 0.68 kb BglI / HindIII fragment from plasmid pAS5 0.63 kb BglII / PstI fragment from plasmid pAS5 4.8 kb BamHI / Sstl fragment from plasmid pAS5 0.5 kb BamHI fragment from plasmid pAS5

Plasmids designed for DNA sequence determination contain DNA fragments with acarbose biosynthesis genes Actinoplanes sp. from plasmid pAS6 (see Example 6). DNA, cloned 17 • · • · ··

The plasmid pAS6 has a 6.2 kb BglII / SstI fragment containing acarbose synthesis genes with the plasmid pAS5 common. The following recombinant plasmids were constructed in the pUC18 vector for sequencing the 5.9 kb BglII / Sstl fragment that was attached to the plasmid pAS5 (FIG. 1). pMJ6 / 6 5.9 kb BglII / Sstl fragment from plasmid pAS6 pMJ 6 / 4.2 pMJ6 / 4.1 pMJ 6 / 6.2.2 pMJ 6 / 6.2.3 pMJ 6 / 6.2.4 pMJ 6 / 6.2.5 pMJ 6 / 6.2. 6 pMJ 6 / 6.2.7 pMJ 6 / 6.2.8 pMJ 6/6 / 8.1 pMJ 6/6/10 0.5 kb Bam ΗΙ / PstI fragment from plasmid pMJ6 / 6 0.36 kb Bam ΗΙ / PstI fragment from plasmid pMJ 6/6 0.5 kb Hall religand 3.3 kb Hall fragment 1.2 kb Hall fragment 1.0 kb Hall fragment 0.7 kb Hall fragment 0.14 kb Hall fragment 0.13 kb Hall fragment 1.1 kb Clal / BamHI fragment 1.5 kb PstI / SalI fragment of pAS6 / 3 2.8 kb BamHI fragment from plasmid pAS6 pAS6 / 3.1 1.1 kb HincII fragment from plasmid pAS6 / 3 pAS6 / 3.2 1.2 kb SalI fragment from plasmid pAS6 / 3 pAS6 / 3.3 1.45 kb PstI fragment from plasmid pAS6 / 3

To determine the DNA sequence of the 2.8 kb PstI fragment (pMJ1) of Actinoplanes sp. the following plasmids are constructed and the insert-DNA sequence is analyzed: • · · 18 · · · 18 · · · · · · · · · · · · · · · · · pMJl / 1 pMJ1 / 2 pMJ1 / 3 pMJ1 / 4.1 0.6 kb SphI / PstI religand after Sphl 1.2 kb Sall / PstI religand after SalI 1.4 kb SstI / PstI religand after SstI 0.9 kb Sall / Smal fragment of hydrolysis fragment from a hydrolysis fragment from a hydrolysis fragment from plasmid pMJ1 of plasmid pMJ1 of plasmid pMJ1 of plasmid pMJ1

For DNA sequencing, the method of F. Sanger et al. (1977) or a method derived therefrom. Work is carried out with the Toread Sequencing Kit (Pharmacia, Freiburg, BRD) in conjunction with Automated Laser Fluoreszens (ALF) DNA sequencing apparatus (Pharmacia, Freiburg, BRD). Suitable fluorescein-labeled pUC reverse sequencing and sequencing primer may be commercially available (Pharmacia, Freiburg, BRD). The sequence of the approximately 18.0 kb BglII-PstI fragment is shown in Figure 3. Table 1 lists the properties of the acb genes and their encoded products. - 19 Table 2

····················· · ·

Primer sequences for PCR and sequencing reactions

PCR primer: plasmid pAS5 / 17 primer designation acbD / E1 acbD / E2 sequence 5'GGCGGCGATTCGGCCTGCGCGG 3 '5'GCGGCGATGGCATGCCTGGCG 3' plasmid pAS5 / 18: acbD3 acbD4 sequence 5 ' 19: primer designation acbD5 acbDo sequence 5'ACCGGCTCGAACGGGCTGGCACC 3 '5'CCCTCGACGGTGACGGTGGCG 3'

Primers for acbC-gene amplification:

The sequence regions by which the recognition sites for the restriction endonucleases NdeI or EcoRI have been constructed are underlined. AS 7 AS 8 AS 9 ’AS-d AS-C2 sequence 5’GGAAGCTCATATGAGTGGTGTCG 3’ 5’CGAGACGGTACATATGCACGCGGATG 3 ’5’CCGTCTCGCCCACCCGCATCACC 3’ 5’GGTATCGCGCCAAGAATTCCTGGTGGACTG 3 ’20

· # · · «• • · · · · · · · · ·

Primers for sequencing reaction: sequence 5’GTAAAACGACGGCCAGT 3 ’5’GAAACAGCTATGACCATG 3’. primer primer universal primer reverse primer designation N-terminal sequence analysis of AcbE-protein was performed using Applied Biosystems Gasphasenprotein Sequencer 473A (Forster Clear, CA, USA) using the standard Fastblott protein sequencing program. Pro-sequencing, various programs, degradation cycles as well as the PTH-identification system are described in Handbuch des Sequeners (Model 473A (1989; Applied Biosystems Forster City, CA 94404, USA). Applied Biosystems RP-18 column (220mm x 2mm, 5µ material) PTH-amino acids are identified and quantified using 50 µMol standard, and processed with Applied Biosystems Sequenzdatensystem 610A. for proteinsequenzer are from Applied Biosystems - 21 • · · ···· ··· · · · · · · · · · · · · · · EXAMPLES Example 1

Cultivation of E. coli strains. Preparation of plasmid-DNA and isolation of DNA fragments

Escherichia coli DH5α was grown in LB-medium at 37 ° C. The bacterium-bearing plasmid is maintained under selection pressure (ampicillin, 100 gg / ml). Cultivation is performed on a rotary shaker at 270 rpm. An overnight culture (PN) is a batch that is cultured for at least 16 hours.

For plasmid-DNA preparation, cells from 1.5 ml were used under selection pressure of cultured PN culture. Plasma isolation is performed by the alkaline SDS-lysis method (Birnboim & Doly 1979).

Finally, exclusively restriction endonucleases are used for targeted vector-DNA hydrolysis according to the manufacturer's instructions (Gibco BRL, Eggenstein, BRD). For restriction of 10 µg of plasmid-DNA, 5 U of the corresponding restriction endonuclease was used and incubated for 2 hours at 37 ° C.

To ensure complete hydrolysis, the same amount of restriction endonuclease is added a second time and incubated again for at least one hour.

The digested DNA is separated electrophoretically, depending on the size of the DNA fragments, on a 0.5% to 1.2% horisontal agarose gel. For elution, a piece of gel containing the DNA fragment is cut with a sterile scalpel and weighed. The elution of the DNA fragment from the agarose is carried out according to the regulation with - 22 ·· · 0 · · · · * · · · · · · 9 · 4 4 • JETsorb-Kit (Genomed, Bad Oeynhausen, BRD). Example 2

Cultivation of Actinoplanes sp. SE50 / 110, preparation, cleavage of chromosomal DNA and electrophoretic separation

Actinoplanes sp. SE50 / 110 is cultured on a rotary shaker at 30 ° C in TBS-medium for three days. The preculture (5 ml) was cultured in culture tubes at 240 rpm and the main culture (50 ml) in 500 ml flasks at 100 rpm. The cells are sedimented by centrifugation after culture and washed twice with TE buffer.

The preparation of total DNA is performed with 1.5 to 2 mg of cells (wet cell weight) using the phenol / chloroform extraction method (D. A. Hopwood et al. 1985).

Hydrolysis of 20 gg of chromosomal DNA is performed with 10 U of the corresponding restriction enzyme (Gibco BRL, Eggenstein, BRD) for 2 hours at 37 ° C in the corresponding buffer. To ensure complete hydrolysis, the same amount of restriction endonuclease is added a second time and incubated again for at least one hour.

The digested DNA is electrophoretically separated on a 0.7% horizontal agarose gel.

The elution of the DNA fragments from the agarose is again carried out using JETsorb-Kit (Genomed, Bad Oeynhausen, BRD) (see Example 1). 23 23 ·· · 4 * · · · · ·

Example 3 • • · · · · · · · · · · · · · · · · · · · · ·

Production of acb-gene probe-II, acb-gene probe-III and acb-probe probe-IV

Fragments of pAS2 (DE 19507214), pAS5 / 7.3 and pAS6 / 3, prepared according to Example 1, were used with " Nick Translation System " manufacturer Gibco BRL, Eggenstein, BRD, radiolabelled according to manufacturer's instructions. 0.5-1.0 gg of DNA fragment is used. [Α] 2 DCTP (3000 Ci / mol; Amersham, Braunschweig, BRD) was used. The batch is then boiled for 10 minutes (denaturation) and immediately added to the hybridization solution (Example 4). Example 4 DNA-transfer to membranes, DNA-hybridization (Southern hybridization and autoradiography) Transfer of DNA fragments from agarose gel to membranes is performed according to the " Southern-Transfer " (Southern E.M., 1975). The agarose gel obtained in Example 2 was shaken for 20 minutes in 0.25 M hydrochloric acid. The gel was placed on 3 layers of Vhatman 3MM absorbent paper (Vhatman, Maidstone, GB) and covered with Hybond ™ - N + Membrane (Amersham Buchler, Braunschweig, BRD) without bubbles. Multiple layers of absorbent paper are placed thereon, and about 1 kg of heavy weight is placed on this layer. DNA transfer was performed by dissolving 0.4 M NaOH. After at least 12 hours of transfer time, the nylon filter is washed for 5 minutes with 2xSSC and air dried.

The nylon filter is then used for at least 2 hours at - 24 9 · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

Shake at 68 ° C in 50 to 100 ml of prehybridization solution in a water bath. The solution is exchanged at least twice. Hybridization takes place in the hybridization cabinet for at least 12 hours. Use 15 ml of the hybridization solution containing the acb probe (Ex. 3).

The nylon filter is then washed for 15 minutes with 6 times Postwasch and 1 x Postwash. The nylon filter is then covered in a still wet state to prevent the film from drying out. Autoradiography is performed with Hyperfilm-MP (Amersham, Braunschweig, BRD) in a light-tight cassette with an amplification film at -80 ° C for at least 16 hours. Example 5

Isolation and cloning of BglII-, Pst1- and Sstl-fragments from total Actinoplanes sp.

Chromosomal DNA from Actinoplanes sp. completely hydrolysed with BglII, PstI and SstI, then the individual grafts were separated by agarose electrophoresis and 9.0 to 12 kb SstI fragments, 11 to 13 kb BglII fragments and PstI fragments of length were eluted from the agarose. 2.5 to 3.5 kb (see Example 1). The eluted SstI-fragments and PstI-fragments were hydrolyzed with the vector-plasmid pUC18, prepared from E. coli DH5α. The vector plasmids are first treated with alkaline phosphatase (Boehringer, Mannheim, BRD) according to the manufacturer's instructions. The ligation is carried out in a volume of 20 μΐ, with a fragment to vector ratio of 3: 1 with 0.01 to 0.1 μg of DNA in the batch. Use 1 U of T4-DNA ligase with appropriate buffer (Gibco BRL, Eggenstein, BRD). The eluted BglII-fragments were ligated to BamHI-hydro-? The lysed vector plasmid pBluescript II KS. Ligation is performed as for SstI- and PstI-fragments.

Transformations of competent E. coli DH5α cells are transformed with a complete ligation charge (according to Hanahan, D. (1983)). Ampicillin resistant transformants are transferred to LB-Amp selective plates (100 µg / ml). Example 6

Identification of clones containing a 10.7 kb SstI-fragment, a 12 kb BglII-fragment, a 2.8 kb Pstl-fragment and a 6.3 kb Sstl-fragment from the acarbose biosynthesis agglomerate

Ampicillin-resistant transformants were assayed for the presence of the 10.7 kb SstI-fragment and the 12 kb BglII-fragment hybridized with the acb-probe-II. Ten of these clones are coated onto a selective plate, cultured overnight, and washed with 3 ml of LB-medium per plate. Then, plasmid DNA was isolated from 20 such ten-membered sets (according to Birnboim & Doly, 1979). To remove cloned

Sstl-fragments from the polylinker, 20 different plasmid preparations were hydrolyzed with restriction endonucleases EcoRI and HindIII, optionally SstI and HindIII. The restriction batches are then electrophoresed on a 0.6% agarose gel and transferred to a nylon filter using Southern-Agarose gel transfer (see Example 4). Hybridization is again carried out with the acb-probe-II (see Example 4). One of the sets that reacts positively with the acb probe-II is divided into ten individual clones. Its plasmids are also isolated and subjected to the above procedure. Hybridized plasmids are designated pAS5 and pAS6, respectively. They contain - 26

10.7 kb SstI-fragment (pASS) or 12 kb BglII-fragment (pAS6).

The recombined 10/3 phage is hydrolyzed with PstI, the DNA on the horisontal agarose gel and the 2.8 kb PstI-fragment eluted from the matrix (see Example 1) and ligated into the pUC18 vector. The recombinant plasmid is designated pMJ1 and transformed in E. coli DH5ct.

The recombinant phage 5/4 is hydrolyzed with SstI, the DNA is separated on a horisontal agarose gel and the 6.3 kb SstI-fragment eluted from the matrix (see Example 1) and ligated into the pUC18 vector. The recombinant plasmid is designated pMJ9 and transformed in E. coli DH5α. Example 7

Production of GEM12-Gene Bank and Isolation of Recombinant Phages Containing Acarbose Biosynthesis Genes and Phage DNA Preparation

Chromosomal DNA from Actinoplanes sp. is partially hydrolyzed with Sau3AI and 50 gg of chromosomal Actinoplanes-DNA with 0.015 U of Sau3Al for 30 minutes at 37 ° C are incubated for this purpose. The enzyme reaction is terminated by extraction with phenol and chloroform and precipitation with ethanol [Sambrook et al. (1989)]. Further processing of the DNA fragments and ligation with the phage vector GEM12 is carried out as indicated by the manufacturer (Promega, Heidelberg). The in-vitro treatment of the ligation charge is performed by " DNA packaging kit " Boehringer Mannheim. Phages are propagated in E. coli LE392 according to the method described by Sambrook et al. (1989). Bio-27 Phage Phages - acarbose syntheses are identified by plaque hybridization (according to Sambrook et al. 1989) with acb-III and acb-IV genosides. Phage DNA containing acarbose biosynthesis genes is passed through phages that have been propagated to E. coli LE392, according to Sambrook et al. (1989). Example 8

The polymerase chain reaction PCR serves in vitro propagation of the DNA regions of interest [Mullis, K., B. and F. A. Falloon (1987)]. Taq-DNA polymerase according to the manufacturer's specifications (Gibco BRL, Eggenstein) was used for all reactions in 25 reaction cycles. Batches contain 5% formamide to suppress possible secondary structures in GC-rich DNA. The volume is 100 μΐ, using 50 pmol primer and 200 μΜ dNTP ’. After the DNA was denatured for 5 minutes at 95 ° C, 2.5 U of thermostable DNA polymerase was added to the batches by " hot-start ". Primer elongation is performed at 72 ° C and DNA denaturation at the start of each cycle occurs at 95 ° C for one minute. The reactions were carried out in a Biometra Thermocycler (Gottingen). 28

Table 3

PCR protocols to amplify DNA fragments from the acarbose agglomerate.

Indications of recombinant plasmids containing the corresponding fragments are provided.

Primer Fragment Storage Size Primer Extension Recombinant Plasmid 0.46 kb 72 ° C, 20 sec 72 ° C, 20 sec pAS5 / 17 0.26 kb 68 ° C, 20 sec 72 ° C, 20 sec pAS5 / 18 0.27 kb 68 ° C, 20 s 72 ° C, 20 s pAS5 / 19 Example 9 Subcloning of plasmids pAS5

Starting from the plasmids pAS5, multiple sub-clones are made to elucidate the double stranded DNA sequences. pAS5 / 6

Plasmid pAS5 was hydrolyzed with the restriction enzyme PstI and the restriction batch was separated on a 0.7% agarose gel. From the agarose gel, the 5.4 kb PstI-fragment generated by hydrolysis was eluted and cloned in pUC18 (hydrolyzed PstI) in E. coli DH5α. pAS5 / 3; pAS5 / 4; pAS5 / 13; pAS5 / 16

Plasmid pAS5 was hydrolyzed with BamHI and separated by gel electrophoresis. Fragments have the following sizes. 1.4 kb BamHI fragment 1.2 kb BamHI fragment 2.3 kb BamHI fragment 0.5 kb BamHI fragment 0.45 kb BamHI fragment 7.5 kb BamHI fragment (= 4.8 kb BamHI SstI fragment from Actinoplanes DNA ligated pUC18)

The 1.4 kb and 0.5 kb subcloning fragments are eluted from the gel (see Example 1). For cloning, the pUC18 vector was prepared with a BamHI restriction enzyme as described in Example 1. ligation is performed as described in Example 5. The 0.5 kb fragment was ligated into the prepared pUC18 to create a pAS5 / 16 subclone. The pAS5 / 3 subclone is generated after ligation of the 1.4 kb fragment with the prepared pUC18. The pAS5 / 4 subclone is generated after ligation of the 1.2 kb fragment with the pUC18 vector. The pAS5 / 13 subclone results from religation of the 7.5 kb BamHI fragment. pAS5 / 5; pAS5 / 7; pAS5 / II; pAS5 / 12

Plasmid pAS5 was hydrolyzed with BamHI and SstI, PstI and SstI, BglII and PstI as well as BglII and HindIII. The restriction batches were separated in a 1.2% agarose gel. The corresponding fragments were eluted from the agarose gel and cloned in pUC18 (hydrolyzed with BamHI and SstI, PstI and SstI, BamHI and PstI or BamHI and HindIII) in E. coli DH5α. The pAS5 / 5 subclone contains 0.4 µ kb SstI BamHI fragment, subclone pAS5 / 12 0.63 kb Bg / II / PstI fragment and subclone pAS5 / l1 0.68 - 30

Kb Bg / II / HindIII fragment. pAS5 / 15.11; pAS5 / 15.12

Plasmid pAS5 / 15 was hydrolyzed with restriction endonucleases Ncoll and KpnI. The resulting 0.9 kb NcoI / KpnI and 1.1 kb NcoI / KpnI fragments are eluted from a 1.2% agarose gel (see Example 1) and cloned in the pUCBM21 (Boehringer, Mannheim) (hydrolyzed NcoI / KpnI) vector E. coli DH5α, yielding subclones pAS5 / 15.12 (0.9 kb fragment) and pAS5 / 15.11 (1.1 kb fragment). Example 10

Subcloning of plasmids pAS6, pMJ6 / 6 and phage 5/4 pMJ6 / 6

Plasmid pAS6 was hydrolyzed with restriction endonuclease SstI (using restriction cleavage sites of the vector) and the 5.9 kb SstI fragment eluted from the agarose gel and ligated with plasmid pUC18. E. coli DH5α was transformed with the recombinant plasmid. pMJ 6 / 4.1 and pMJ 6 / 4.2

Plasmid pMJ6 / 6 was hydrolyzed with BamHI and PstI restriction endonucleases and the 0.36 kb BamHI / PstI fragment as well as the 0.5 kb BamHI / PstI fragment eluted from the agarose gel and ligated with pUC18. E. coli DH5α is transformed with recombinant plasmids. - 31 • ·

pMJ6 / 6.2.2, pMJ6 / 6.2.3, pMJ6 / 6.2.4, pMJ6 / 6.2.5, pMJ6 / 6.2.6, pMJ6 / 6.2.7, pMJ6 / 6.2.8

Plasmid pMJ6 / 6 was hydrolyzed with a SalI restriction endonuclease and a 3.3 kb fragment was eluted from the agarose gel, a 1.2 kb fragment, a 1.0 kb fragment, a 0.7 kb fragment, a 0.14 kb fragment and a 0.13 kb fragment. fragment and ligated with plasmid pUC18. E. coli DH5α is transformed with recombinant plasmids. Plasmid pMJ6 / 6.2.2 was obtained by hydrolysis and subsequent religation. pMJ 6 / 8.1

Plasmid pMJ6 / 6 was hydrolyzed with ClaI and BamHI and the 1.1 kb fragment eluted from the agarose gel and ligated with the plasmid pBluescript II KS. E. coli DH5α was transformed with the recombinant plasmid. pMJ 6/10

Plasmid pMJ6 / 6 was hydrolyzed with PstI and SalI, and a 1.5 kb fragment was eluted from the agarose gel and ligated with pUC18. E. coli DH5α was transformed with the recombinant plasmid. pAS6 / 3

The plasmid pAS6 was hydrolyzed with BamHI restriction endonuclease and the 2.8 kb BamHI fragment eluted from the agarose gel, ligated with plasmid pUC18 and transformed in E. coli DH5α.

• · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

Plasmid pAS6 / 3 was hydrolyzed with the restriction endonuclease HincII and the 1.1 kb HincII fragment eluted from the agarose gel and ligated with plasmid pUC18 and cloned in E. coli DH5α. pAS6 / 3.2

Plasmid pAS6 / 3 was hydrolyzed with a SalI restriction endonuclease, the 1.2 kb SalI fragment ligated with pUC18 and cloned in E. coli DH5α. pAS6 / 3.3

Plasmid pAS6 was hydrolyzed by restriction endonuclease PstI, a 1.45 kb PstI fragment was ligated with pUC18 and cloned in E. coli DH5α. Example 11

Subcloning of plasmid pMJ1 pMJ1 / 1

Plasmid pMJ1 is hydrolyzed with restriction endonuclease SphI, the 3.3 kb SphI fragment (0.6 kb SphI / PstI fragment ligated with pUC18) is eluted from the agarose gel, religated and cloned in E. coli DH5α. pMJ1 / 2

Plasmid pMJ1 was hydrolyzed with a SalI restriction endonuclease, a 3.9 kb SalI fragment (1.2 kb SalI / PstI fragment ligated with pUC18) was eluted from the agarose gel, religated and cloned in E. coli DH5α. pMJ1 / 3

Plasmid pMJ1 was hydrolyzed with a SalI restriction endonuclease, the 4.1 kb SstI / PstI fragment (1.4 kb SstI / PstI fragment ligated with pUC18) was eluted from the agarose gel, religated and cloned in E. coli DH5α. pMJl / 4.1

The plasmid pMJ1 was hydrolyzed with a SalI restriction endonuclease, the 0.9 kb SalI / SmaI fragment eluted from the agarose gel, ligated with pUC18, and the recombinant plasmid transformed in E. coli DH5α. Example 12 Production of subclones from pAS5 / 6 The production of pAS5 / 6-subclones is performed by " double-stranded Nested Deletion Kit " (Pharmacia, Freiburg, BRD). 10 g of pAS5 / 6 DNA was prepared as described in Example 1 and hydrolyzed with 10 U of XhoI and SstI. Subsequent incubation with endonuclease III is carried out for a total of 20 minutes according to the manufacturer's instructions. In 5 min increments, partial amounts were withdrawn from the reaction batch corresponding to a DNA amount of about 2.5 gg. Treatment with S-nuclease for the preparation of non-covering DNA ends is carried out for 30 minutes at 20 ° C according to the manufacturer's instructions. These DNA molecules are religated with T4-ligase and cloned in E. coli DH5α. - 13 ·· ·· ·· · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · «« · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · acarbose from Actinoplanes sp.

The plasmids described in Examples 8-11 are sequenced.

In the sequencing reaction, 6-8 µg of plasmid DNA from the preparation is used (see Example 1). The sequencing reaction is run with Auto-Read-Sequenzing-Kit (Pharmacia, Freiburg, BRD). The standard dsDNA sequencing protocol is used. To allow the nucleotide sequence to be evaluated by A.L.F. (automated Laser Fluorescens- (DNA)-Sequenzierer), fluorescein-labeled universal and reverse sequencing primers are used as starter molecules for sequencing reaction (see Table 2). To make the gel, 8 ml of Hydro Link Long Ranger (Serva, Heidelberg, BRD), 33.6 g of urea, 8 ml of 10x TBE buffer are mixed and made up to 80 ml with water, filtered sterile and degassed for one minute. . The polymerization is started by adding 350 μ 350 of 10% (w / v) ammonium persulfate and 40 μΐ Ν, Ν, Ν ', N'-tetramethylenediamine. The solution is poured into a gel mold (50x50x0.05 cm). The electrophoresis is carried out at 38 V and at a constant temperature of 45 ° C. 1 x TBE buffer is used as the mobile buffer. The processing of the measured fluorescence on the DNA sequence is carried out via an attached computer (Compaq 386 / 20e), which also serves to control electrophoresis (for A.L.F. Manager 2.5; Pharmacia, Freiburg). Example 14

Transformation of S. lividans

Protoplasting and transforming S. lividans TK23 and 1326-35-35

• · · · · · · · · · · · · · · · · · · ·

The method is performed by the method of Babcock and Kendrick (1988), the cells being listed in TSB-PEG 8000. Example 15

AcbC 15.1 Overexpression of AcbC in E. coli

The DNA sequence of the acbC gene shows two possible translational start points for AcbC. Although starting point 1 based on a significant ribosome binding site represents a likely start of AcbC, both possible AcbC proteins were overexpressed. To this end, the plasmids pETlla and pET10b (Novagen, Heidelberg) were used for expression in E. coli. To ensure optimal translation start for expression, the ATG start codon should be used with appropriate separation to E. coli-like RBS, pET-vectors. To do this, it is necessary to construct an NdeI-recognition sequence at the acbC start codon. Oligonucleotides AS7 (Sequence Position 6617) and AS8 (Sequence Position 6638) are placed on both possible start codons to synthesize the NdeI recognition site. AS9 oligonucleotide binds 66 bp upstream of the BamHI recognition sequence to the 6877 sequence position on DNA. Using the PCR method (see Example 8), two DNA fragments are amplified and used to express both possible AcbC proteins. Primer attachment takes place for 40 s at 45 ° C and primer extension occurs in 30 s. Both amplified DNA fragments were hydrolyzed with restriction endonucleases NdeI and BamHI and ligated accordingly into the pET1a1 and pET1b5 vectors. From the recombinant plasmid pAS2 [EP A 0 730 029 / DE 19507214], a 2.2 kb BamHI fragment is isolated and fused through a BamHI recognition site - 36-36 ♦ · ··· • · · · · · · · · · · · ·

with cloned PCR fragments. After examining the orientation of the 2.2 kb BamHI fragment, the complete acbC gene is introduced into expression vectors. Expression vectors are designated pAS8 / l to pAS8 / 4 (FIG. 4). Additionally, the full acbC reading frame (in opposite orientation) and the acbA gene origin on the cloned DNA in expression vectors are found. In IPTG-induced E. coli BL21pLys-cultures, additionally expressed protein can be identified. The size of the overexpressed AcbC proteins is shown in Table 4. However, all proteins are formed in the form of insoluble " inclusion bodies ".

Table 4

Structure of AcbC-expression vectors for expression in E. coli

Recombinant plasmid starting point vector-plasmid recombinant protein pAS8 / l1 pETlla 42 kDa pAS8 / 3 2 pETlla 41 kDa pAS8 / 2 1 pETlbb 44.5 kDa pAS8 / 4 2 pET16b 43.5 kDa 15.2 AcbC overexpression in S. lividans 1326

AcbC protein is expressed in S. lividans 1326 using the plasmid pIJ6021 [Takano, E. et al. (1995)]. Using the PCR method [Mullis and Falloona (1987)], a fragment of chromosomal DNA is amplified which exclusively comprises the cbc coding blast. Oligonucleotides are used for PCR - 37 ·· ·· · i · i · t

AS-C1 and AS-C2, wherein the NdeI deletion sequence at the start codon 2 of the acbC gene is constructed using the AS-C1 primer (sequence position 6089). The AS-C2 oligonucleotide binds to sequence position 7882 and is used to construct an EcoRI-recognition sequence. Primer insertion is carried out for 20 s at 50 ° C and the primer is extended for 40 s. The acbC DNA fragment thus obtained is first blunt-end " cloned in the pUC18 vector and the correct DNA sequence is checked by PCR. This recombinant plasmid with the cloned acbC-gene has the designation pAS8 / 5.1. Plasmid pAS8 / 5.1 was hydrolyzed with NdeI and EcoRI restriction endonucleases, the DNA was separated on an agarose gel and eluted from the matrix. The acbC fragment thus prepared was ligated into the vector pIJ6021. The recombinant expression plasmid is designated pAS8 / 7.2 (FIG. 5). S. lividans 1326 protoplasts were transformed with plasmid pAS8 / 7.2. With the thus obtained clone, the AcbC protein in thiostrepton-induced culture can be overexpressed in soluble form (Fig. 6). Example 16

AcbE overexpression in S. lividans TK23

The acbE gene can be obtained from plasmid pAS5 / 6.9-6 by hydrolysis with the restriction endonucleases EcorI and HindIII. After separation of the DNA on an agarose gel and elution of the 3.8 kb EcoRI / HindIII fragment from the matrix, this acbE fragment is ligated accordingly into the vector pUVL219 [J. Veh-meier, U.F. (1995)]. For later expression of AcbE in S. lividans, a possible 200 bp promoter-sequence " upstream " region (see Table 5) should be used in this vector. The recombinant plasmid is designated pAS11 (FIG. 7). - 38 • · · · t · · · ·

Table 5

Intercistronic region between acbE and acbD genes.

The inverted repeat (IR) and direct repeat (DR) sequences that may be involved in regulation are underlined.

< - CGT GGA CCC TCT CTC GCG GC GGG

GC GC GC CGC GCC GCC

GC GC GC GC GC GC GC GC GC GC GC GC GC GC GC GC GC GC GC GC GC GC GC GC GC GC AGA GCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG ATG TAC GC GCGG GCGG GCGG GCGG GCGG GCGG GCGG GCGG GCGG GCGG GCGG GCGG GCG GCGG GCG GCGG GCG GCGG TAG ·· 39 • · ·· ·· •

• · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

GTC ATC CCT TCA CAA GGA GAA GCT C CAG TAG GGA AGT GTT CCT CTT CGA G - >

S. lividans TK23 protoplasts are transformed with the plasmid pAS11. In MD 50 -culture fluid, both S. lividans TK23 / pAS11 and Actinoplanes sp. 110 kDa extracellular protein (FIG. 8).

This size corresponds to the molecular weight of the acbE derived protein. The identity of these proteins was demonstrated by the corresponding enzyme assay (see Example 19.2) and by sequencing the N-terminal amino acids (see Example 18). No corresponding protein could be detected in the control culture of S. lividans TK23 / pUVL219 control medium in MD 50 medium.

Therefore, it is likely that possible promoter sequences (Table 5) " upstream " from the acebE gene are responsible for the expression of AcbE in S. lividans / pAS11 cultures in MD 50 media. Example 17 Preparation of proteins by gel electrophoresis

Denaturing of protein separation in SDS-polyacrylamide gels and their Coomassie-dye staining is performed according to the Lugtenberg method (1975). Depending on the batch, gels of 8% or 11% are used. The basic composition of the 11% gel is as follows - 40 • · Φ · • · gel · gel · gel · gel · · gel · gel · gel · gel · gel · gel · ící · gel · gel · · gel · · ♦ · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

Solution A * 8.0 solution B * 0.64 APS (2 mg / ml) 0.8 0.15 10% (w / w) SDS 0.64 0.064 0.75 M Tris / HCl pH 8.8 16 0 25 M Tris / HCl pH 6.8 3.2 dist. water 6,56 TEMED 25 μΐ 10 μΐ see section buffers and solutions

The electrophoresis is carried out either in a SERVA Blue-Vertical 100 / C apparatus (80 x 100 x 0.75 mm gel shape) or in a Renner-Twin-Vertical apparatus (180 x 170 x 1 mm gel shape).

Protein Assay (BioRad, München) was used to determine the protein concentration of the analyzed samples, and calibration was set directly with BSA. As a standard for the molecular weights of the divided proteins, " VIIL Dalton-Marker " (14.2 kDa to 66 kDa) and " High Molecular Veight Standard " (29 kDa to 210 kDa) from Sigma (Deisen-hofen). Example 18

Determination of the N-terminal amino acid sequence

N-terminal amino acid sequence determined - 41 ··

AcbE protein when compared to Actinoplanes sp and S. lividans TK23 / pAS11 clone. For this, 50 ml of culture in MD 50 medium is grown for 3 days. The cells are then removed by centrifugation and the culture liquid is maintained for 12 hours

dialysed at 4 ° C against buffer (5 mM Tris / HCl pH 7.5; 1 mM CaCl 2), then lyophilized for 48 hours and taken up in 1.5 ml sample buffer. The culture liquid thus prepared is separated in SDS-PAGE with a Renner-Twin-Vertical apparatus (180 x 170 x 3 mm gel shape). A gradient gel (5% > 10%) was used to ensure as good a separation as possible of the AcbE protein from other extracellular proteins. Transfer of proteins from SDS-polyacrylamide gel to polyvinyl fluoride (PVDF) membrane (Amersham Buchler, Braunschweig) is carried out by a semi-dry electrophoresis procedure with a Fast-Blott B33 apparatus (Biometra, Gottingen) according to the manufacturer's specification. Transfer takes 45 minutes at 250 mA. The transfer buffer used is a mobile buffer (see buffers and solutions section) diluted 1: 2. The membranes are stained for 30 minutes and decolorized with a bleach solution (see buffers and solutions section). To determine the N-terminal amino acid sequence, a piece of gel is washed twice with 100 µl of 50% methyl alcohol each time before sequencing to remove excess salts. After drying, a sequence analysis is performed for which a fast blot cycle is used. The results are shown in Table 6. 42 • * ·· * «• · · · · · · · · · · · · · · ·

Table 6 Results of sequencing the N-terminal amino acid sequence of the AcbE protein from Actinoplanes sp. and S. lividans TK23 / pAS11 clone

Organism

Actinoplanes sp. determined N-terminal AK-sequence

Sequence 1: ESPPDRPSHAEQLYL

Sequence 2: SPPDRPSHAEQLYL

S. lividans TK23 / pAS11 sequence 1: ESPPDRPSHAEQLYL

Sequence 2: SPPDRPSHAEQLYL Example 19

Determination of enzymatic activities 19.1 Determination of valiolone synthase activity

For overexpression of AcbC, 10 ml of YEME-medium (50 µl / π ι 1 Km) is seeded with a spore suspension of S. lividans 1326 / pAS8.7.2. After a one to two day culture, cultures are found in the early logarithmic growth phase. At this point, the cultures are induced with 7.5 μ§ / ιη1 thiostrepton. The culture is terminated 20 hours after induction. The sedimenting cells are taken up in 1.5 ml cold decomposition buffer (see buffers and solutions section) and sonicated. After centrifugation at 15000 g for 30 min and 4 ° C, cell debris was removed and dialyzed for 12 hours against 2.5 L of decomposition buffer at 4 ° C to produce AcbC-extract required for enzyme assay. This extract can be stored for two months at -20 ° C without markedly reduced activity. The protein content of the extract is determined by Protein Assay (BioRad, München) and 15 µg is analyzed by SDS-PAGE (Fig. 6). The enzyme assay is performed in 20 mM P-buffer (pH 7.5) with 40 µl cobalt chloride for two hours. In the enzyme assay, 20 gg of total protein from AcbC-extract and 8 mM sedoheptulos-7-phosphate were used. Additionally, the reaction batch contains 2 mM sodium fluoride to inhibit non-specific phosphatases in the extract. The reaction volume is 100 μΐ. The evaluation is carried out with DC on silica gel using butanol / ethylene / water (9: 7: 4) as the mobile phase, analyzing 25 μΐ of the reaction charge. Spraying the DC-foil with a cerium reagent (see buffers and solutions section) and incubating for 15 minutes at 90 ° C in an oven will make the organic compounds visible. The reference substance used is a mixture of valienone and valiolone (Prof. H.G. Floss, Seattle).

AcbC protein expressed by S. lividans can specifically react with sedoheptulos-7-phosphate (Fig. 9). However, the reaction product shows a slightly different DC course than the valienone / valiolone standard. Reducing the progress of the reaction product to the silica gel film by the reaction buffer can be avoided (Fig. 9, track 5). 19.2 Determination of α-Amylase Activity

S. lividans TK23 / pAS11 cultures were cultured in TBS-meth and MD 50-medium in the presence of 25 µg / ml thiostrepton for 3-4 days at which time the culture was terminated. Centrifugation (3500 g) at 4 ° C for 10 minutes, the cells are removed and the culture fluid is dialysed for 12 hours at room temperature.

4 [deg.] C., buffer (25 mM Tris / HCl pH 7.5; 1 mM CaCl2). From the liquid thus prepared, 500 μΐ in vacuum is dried, taken up in sample buffer (see buffers and solutions section) and the proteins are separated on SDS-PAGE (Fig. 8). A culture liquid from the cultivation of Actinoplanes sp., Which was treated in an identical manner, serves as a reference sample. Α-Amylase activity is determined by measuring the turbidity loss of 1% starch suspension. For measurement, 100 μΐ of dialysed culture fluid is mixed with 900 μΐ of starch suspension and the loss of extinction at 300 nm versus time is recorded [Virolle, M. J. et al. (1990)]. For comparison, an appropriate experiment with α-amylase from Bacillus sp. (Sigma, Deisenhofen). The results are shown in Figure 10. AcbE activity in MD 50-cultures of Actinoplanes sp. and S. lividans TK23 / pAS11 cannot be inhibited by 1 mM acarbose in the assay. In contrast, background activity in MD 50-cultures of S. lividans TK23 / pUVL219 0.1 mM acarbose can be inhibited in the assay. α-Amylase from Bacillus sp. 0.1 mM acarbose is also inhibited (FIG. 10).

Buffers and solutions:

Media for growing LB-Medium: trypton 10 g

NaCl 10 g yeast extract 5 g

to 1000 ml pH is adjusted to 7.5 with 4 M NaOH

MD 50-medium solution I 45

starch hydrolysate MD (NH4) 2SO4 yeast extract H2O

solution II k2hpo4 kh2po4

Tri-sodium citrate to 400 ml H20 solution III MgCl2.6H2O FeCl3.6H2O CaCl2.2H2O to 200 ml H20 solutions after mixing 70 g 5 g 2 g to 400 ml 1 g 1 g 5 g 1 g 0.25 g 2 g filter and. TSB medium 30 g to 1000 ml tryptone soybean broth (oxoid) H2O TSB-PEG 8000 [Babcock et al. (1988)]

Trypton.soy broth (oxoid) 30 g / l PEG 8000 50 g / l after autoclaving glycine (20%) 25 ml

MgCl 2 (2.5 M) 2 mL YEME [Hopwood, D.A. et al. (1985)] 3 g / 1 5 g / 1 3 g / 1 yeast extract peptone malt extract - 46 - 46 10 g / 1340 g / l 2 ml glucose sucrose after autoclaving MgCl2 (2.5 M)

Plasmid DNA Standard Preparation (Birnboim & Dolya, 1979)

Mix I: 50 mM glucose 50 mM Tris-HCl (pH 8.0) 10 mM EDTA (pH 8.0) 5 mg / ml lysozyme

Mix II: 200 mM NaOH 1% (w / v) SDS (sodium dodecyl sulfate)

Mix III: 3 M potassium acetate 1.8 M formate. TE buffer (pH 8.0)

Tris-HCl 10 mM

Na2-EDTA 1 mM. DNA-DNA hybridization 20 x SSC: 3 M NaCl 0.3 M sodium citrate pH 7.2.

Prehybridization Solution 47 ···· 6 x SSC: 0.01 M sodium phosphate buffer pH 6.8

1 mM EDTA 0.5% SDS 0.1% non-fat milk powder

Hybridization Solution:

An acb probe is added to the 15 ml prehybridization solution after the labeling reaction

6 x Postwash: 6 x SSC 0.5% SDS. DNA-sequencing TBE buffer (pH 8.0): 1 M Tris-base 0.83 M boric acid 10 mM EDTA.

Denaturing polyacrylamide-gel electrophoresis of proteins

Sample buffer 5 x: glycerol 25 ml SDS 5 g BPB 2.5 mg 2-mercaptoethanol 12.5 ml to 50 ml 0.625 M Tris / Hcl (pH 6.8)

Electrode buffer: Tris / HCl (pH 8.3) 25 mM

glycine 190 mM SDS (w / v) 0.1%

pH adjustment before SDS addition • 48 • · • ·

Solution A acrylamide N, N-methylene bisacrylamide water to 100 ml Solution B acrylamide N, N-methylene bisacrylamide water up to 100 ml SERVA-Blau R-250 (w / v) methanol (v / v) acetic acid solution ( v / v) Decolorizing solution methanol (v / v) acetic acid (v / v) Moving buffer AcbC KH2PO4 / K2HP04 (pH 7.5) NAD DTT 44 g 0.8 g 30 g 0.8 g 0.15% 50 % 10% 25% 10%

20 mM 0.2 mM 0.5 mM

Phosphate buffer for α-amylase assay KH2PO4 / K2HPO4 (pH 6.8) KC1 Cerium reagent Molybdic phosphoric acid Cerium sulfate

50 mM 50 mM 1,25 g 0,5 g • · · · · · Sulfuric acid 3 ml water up to 50 ml

Literature

Babcock, M.J., Kendrick, K.E. (1988)

Cloning of DNA involved in sporulation of Streptomyces griseus.

Birnboim H. C. & Doly J. (1979) A rapid alkine extract procedure for re-

combinant plasmid DNA

Nucleid Acids Res .; 7, 1513-1523.

Drepper, A., Pape, H. (1996)

Acarbose 7-phosphotransferase from Actonoplanes sp .: purification, properties, and possible physiological function J. Antibiot., 49,664-669

Goeke, K., Drepper, A., Pape, H. (1996)

Formation of acarbose phosphate by cell-free extract from acarbose producer Actonopláns sp. J. Antibiot., 49, 661-663

Hanahan D. (1983)

Studies on Transformation of Escherichia coli vith plasmids J. Mol. Biol., 166, 557-580

Hershberger, C.I., et al. (1989)

Genetics of Molecular Biology of Industrial Microorganisms Amer. Soc. Microbiol., S. 35-39, S. 58, · · · · · ···· · · · · · · · · ·

S. 61-67, pp. 147-155.

Hopwood D. A. et al., (1985)

Genetic manipulation of Streptomyces A laboratory m, anual; The John Innes Foundation, Norway, England

Lugtenberg, B., et al. (1975)

Electrophoretic resolution of " major " Outer membrane protein of Escherichio coli into four bands. FEBS Lett. 58, 254-258.

Merson-Dyvies, L.A., Cundliffe, E. (1994)

Analysis of five tylosin biosynthetic genes from the tylIBA region of the Streptomyces fradiae genome.

Mol. Microbiol., 13, 349-355.

Mullis, K.B., Falloona, F.A. (1987)

Specific synthesis of DNA in vitro via a polymerase catalyzed chain reaction.

Methods Enzymol.m, 155-350.

Sambrook, J., et al. (1989)

Molecular clonning; a laboratory manual, 2nd ed.

Cold Spring Harbor Laboratory Press, N.Y., USA.

Sanger, F., Nicklen, S., and Coulson, A.R. (1977) DNA sequencing with chain-terminating inhibitors. Nati. Acad. Sci. USA, 74, 5463-5467

Southern E.M. (1975)

Detection of specific sequences among DNA Fragments separated by gel electrophoresis - 51 • · • · · ···· J. Mol. Biol., 98, 503-521.

Takano, E., et al (1995)

Construction of thiostrepton-high-copy-expression vectors for use in Streptomyces spp.

Gene, 166, 133-137.

Virolle, M.J., Morris, V.J., Bibb, M.J. (1990) A simple and reliable turbidimetric and kinetic assay for alpha-amylase that is really applied to culture supernatants and cell extracts of J. Indrustrial Microbiol., 5, 295-302.

Vehmeier, U.F. (1995)

New multifunctional Escherichia coli-Streptomyces shuttle vectors allowing blue-white screening on XGal plates.

Gene, 165, 149-150.

Explanation of the drawings

Fig. 1 shows a restriction card of about 18.6 kb of section from the genome of Actinoplanes sp. SE50 / 110 (see Table 2). The black section shows the area claimed in the previous patent, which in part covers the acbCBA genes (shown from left to right). Under the restriction card, the four most important primary isolated DNA fragments are cloned in pAS5 and pAS6 and lambda GEM12-bacteriophage 5/4 and 10/3 plasmids (overlapping segments of the inserted DNA are shown). • ·· «· 52 ····« ·· «· ···· ·· · ···

FIG. 2 depicts a gene card of the known acarbose biosynthetic genes of Actinoplanes sp.

Figure 3 shows the DNA sequence from the agarate of acarbose biosynthesis genes.

Figure 4 shows the recombinant plasmids that were constructed for the expression of AcbC in E. coli, starting from the plasmids pET11 and pET10b.

Figure 5 shows the recombinant plasmid pAS8 / 7.2 which was constructed for expression of AcbC in S. lividans 1326 starting from the plasmids pIJ6021.

Figure 6 shows gel electrophoresis of cell lysates (see Example 15.2). Expression of AcbC (42 kDa) in thio-strepton-induced culture of S. lividans 1326 / pAS8 / 7 is shown in Track 3.

Figure 7 shows the recombinant plasmid that was constructed for expression of AcbE in S. lividans TK23 starting from the plasmids pUVL219.

FIG. 8 shows gel electrophoresis of protein separation from culture liquid (see Example 16). Expression of AcbE (110 kDa) is evident in track 2, 5 and 6.

Figure 9 shows the evidence of AsbC-enzyme activity by thin layer chromatography on silica gel 1) extract of Actinoplanes sp. 2) S. lividans extract 1326 / pJ6021 3) S. lividans extract 1326 / pAS8 / 7.2 (extract stored for 2 months at -20 ° C) • · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · S. lividans 1326 / pAS8 / 7.2 (boiled) 5) S. lividans extract 1326 / pAS8 / 7.2 (valienone instead of seductive-7-phosphate as substrate) 6) valiolone / valienone as standard 7) sedoheptulose 8) seheptulose-7- phosphate 9) S. lividans 1326 / pAS8 / 7.2 extract (freshly prepared.

Figure 10 shows the results of α-amylase activity determination in culture liquids. Cultivation was performed on MD 50-medium. No activity was measured with the boiled culture liquid. The test time was 6 minutes. For comparison, 2.8 mU of commercial α-amylase from Bacillus sp. (1/7 '

Claims (3)

• I · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · 1. The agglomerate of acarbose biosynthesis genes comprising the DNA of FIG. 2. The acarbose genes containing the DNA of FIG. 3. V i I;