MXPA99007728A - Acarbose (acb) cluster from actinoplanes - Google Patents

Abstract

The invention concerns biosynthesis genes from the acarbose gene cluster from Actinoplanes sp. SE 50/110, their isolation from Actinoplanes sp. or from producers of pseudooligosaccharides, a process for isolating these biosynthesis genes, the proteins coded by said genes, the expression of the proteins in heterologous host strains, and the use of the acarbose biosynthesis genes for optimizing the process.

Description

GRUPO DE GENES DE ACARBOSA (ACB) OF Act ± noplanes $ p? SE 50/110 The present invention relates to the isolation of other genes of the biosynthesis and metabolism of the acarbose of Actinomycetes, predominantly of Actinoplanes sp. SE 50/110 and its mutants, which with the already known biosynthetic genes are grouped in a group of genes, to the use of these genes for the production of acarbose and acarbose homologs with Actinoplanes sp. and other producers of natural products related to acarbose (pseudo-oligosaccharides), to the use of these genes for the optimization of the process by molecular "biochemical-biological" engineering methods as well as to the heterologous expression of these genes in other microorganisms.

It is the object of earlier patent applications (for example DE 20 64 092, DE 22 09 834) to know that a series of actinomycetes, especially actinoplanáceos, form inhibitors of oligosaccharide type of glycosidhydrolases, preferably enzymes of the digestive tract dissociators of carbohydrates. As the most potent inhibitor of this group, REF .: 30961 described (DE 23 47 782) the compound 0-4, 6-dideoxy-4 - [[1S- (1S, 4R, 5S, 6S) -4,5,6-trihydroxy-3- (hydroxymethyl) -2-cyclohexen -1-yl] -amino] -aD-glucopyranosyl- (1- >) -OaD-glucopyranosyl- (1- > 4) -D-glucopyranose such as acarbose.

Acarbose is a potent inhibitor of a-glucosidase that is used as an oral antidiabetic agent under the brand name Glucobay® for the therapy of Diabetes mellitus. Formation of the secondary metabolite acarbose is carried out by Actinoplanes sp. SE 50 (CBS-No. 791.96) and by a natural variant of this strain, SE 50/110 (CBS 793.96) [DE 22 09 834], as well as its selection and mutants. In the patent applications indicated, for example in Examples 1 to 4 of the said German patent application P 22 09 834, the preparation of a similar a-glucosidase inhibitor is described.

Molecular biology methods can isolate certain genes directly from an uncharaized genome, using gene probes - for example 32p-labeled DNA fragments - that specifically bind to the DNA sequence sought.

In addition, it is known in actinomycetes - above all in Streptomycetes - that in producers up to now investigated for secondary metabolite biosynthetic genes are arranged in the chromosome, rarely in a plasmid, in a cluster of genes [Hershberger, C.L., et al., (1989)]. In this way biosynthetic genes hitherto unknown can be isolated using nearby gene probes whose meaning for the desired biosynthesis can then be clarified. Likewise, the corresponding biosynthetic genes in other microorganisms can be dete with the aid of gene probes.

Due to the structure of the acarbose, it was presumable that the deoxyglucose part of the acarbose molecule was formed in accordance with the biosynthesis of 6-deoxysugar moieties of various antibiotics (for example aminoglycosides, such as streptomycin, kasugamycin, macrolides, such as erythromycin, tylosin, polyenes, such as amphotericin A and B, nystatin, anthracyclines, such as daunorubicin, glycopeptides, such as vancomycin). Accordingly, a gene probe and pairs of insertable PCR primers homologous to highly conserved proteinic regions of known dTDP-glucose dehydratase enzymes were obtained.

The use of the techniques described led to Actinoplanes sp. SE 50/110 firstly to the isolation and sequencing of a 2.2 kb BamHI DNA fragment with the complete DNA sequence of acbB (encoding dTDP-glucose dehydratase) as well as the DNA partial sequences of acbA (encoding dTDP-glucose synthase) and acbC (encoding a cyclase ) [EP A 0 730 029 / DE 19507214]. As other enzymes that are involved in the biosintes of acarbose, the acarviosyl transferase of Actinoplanes sp. SE 50/110 and mutants (encoded by acbD) [DE 196 25 269.5] as well as acarbose 7-phosphotransferase (encoded by acbK) [Goeke, K., et al. (nineteen ninety six); Drepper, A., et al. (nineteen ninety six)]. For acarviosyl transferase the ability to exchange in the pseudo-oligosaccharides containing acarviosine the respective sugar moiety for other sugars has been described. Acarbose-7-phosphotransferase (acarbose kinase) could be involved in the production of a form of acarbose transport of cells. In addition, acarbose-7-phosphotransferase has been seen as part of a self-protection mechanism: The acarbose strongly inhibits the cytoplasmic a-glucosidase of the producing strain, which does not happen on the contrary by the phosphorylated compound acarbose-7-phosphotransferase, so that the metabolism of the substrate proper of the cell. Such protective mechanisms have been described for many producers of aminociclitol antibiotics.

In the present patent application, the group of biosynthetic genes as well as other metabolism genes of the acarbose of Actinoplanes sp. SE 50/110 in a segment of 18 kb (see Figures 1-3). Isolation of other acarbose metabolism genes surprisingly demonstrated that the known biosynthetic genes, acbABC [EP A 0 730 029 / DE 19507214], are grouped with acarbose modification genes (acarviosyl transfer, phosphorylation, acbD genes, acbK), extracellular or cytoplasmic metabolism of maltodextrin and glucose (enzymes from the families of α-amylases and 4-α-glucanotransferases or amylomaltases) and the transport of sugars dependent on binding proteins (absorption of maltodextrin or disaccharides in the cytoplasm) in a common gene group. This discovery is of remarkable significance for the biotechnical production of acarbose with regard to the chosen optimization of the procedure. Thus, in this way it is provided as a new point of view that broadens the possibilities indicated in previous patents the availability of important parts of the complete metabolism of acarbose for the methods of "engineering" molecular biochemical-biological Thus, the arrangement of a-1, 4-glucan intermediates manifestly important for the synthesis of acarbose through starch / maltodextrin degradation, absorption / secretion as well as the cytoplasmic transformation of oligosaccharides to the maltose step, expanding the spectrum of the product as well as the exclusion of acarbose to the greatest extent possible and / or the extracellular release of important modifications (for example the phosphorylation of acarbose).

It is therefore an object of the invention to isolate other genes of Actinoplanes sp. SE 50/110 and its use for the isolation of boundary DNA regions for the supplemental resolution of the acarbose gene group.

The resolution of the acarbose gene group with the isolation and characterization of the biosynthetic genes of acarbose is essential for a chosen improvement of the production process, for example by - Increase in the yield of acarbose synthesis in Actínoplanes by gene amplification of "bottle corner" enzymes, more effective use of promoters, disconnection or reinforcement of regulatory events.

- Improved provision of precursors, especially the metabolism of sugars with optimization of transport mechanisms, such as transport of substrates in the cell and exclusion of acarbose or modified compounds.

Delimitation of the spectrum of products in Actinoplanes to the desired acarbose main product by disconnecting the unwanted biosthetic routes to subcomponents or by disconnecting unwanted enzymatic degradation reactions.

Expression in heterologous host strains for the increase of the production by means of an improved space-time yield, for the simplification of the processing procedure, for the chosen delimitation of the product spectrum.

- Use of one or several acarbose biosthetic genes for the synthesis of acarbose m vi or compounds of this class of substance starting from precursors prepared synthetically or microbially.

The invention therefore discloses: A recombinant DNA molecule containing genes for the biosynthesis of acarbose and of acarbose homologs that are arranged in the group of genes according to Figure 2.

A recombinant DNA molecule with a pattern of cleavage sites by restriction enzymes according to Figure 1.

The complete DNA sequence of the 18 kb fragment with the genes exposed according to Fig. 3, as well as the amino acid sequences resulting therefrom.

Table 1: Properties of acb genes and Acb gene products the position numbers refer to the base pairs in the Bglll-Sstl fragment in the Fig 3. In parentheses sequence information that is either incomplete or indicates unsafe reading phases; the data bank seat access n are indicated in parentheses; AA = amino acids In this respect, acbA and acbB genes encode enzymes of acarbose biosynthesis with high likelihood, since they have a high sequence identity of AcbA or AcbB with respect to known bacterial dTDP-glucose synthases or dTDP-glucose 4,6-dehydratases. The similarity of the sequences of the proteins with respect to the respective closest representatives of both families of enzymes (see Fig. 3) is vastly greater than those of those other discretionary pairs of proteins with identical function of both groups. In this respect, it is surprising that AcbA has its closest relatives among Streptomycete proteins, whereas AcbB is more closely related to various proteins RfbB of gram-negative bacteria. This phenomenon, however, is also shown in other corresponding Streptomycete proteins, for example TylAl and TylA2 from the producers of the tilosma Streptomyces fradiae [Merson-Davies and Cundliffe (1994)] which are also encoded by close genes in a common gene group.

The acbC gene encodes a probable enzyme for the synthesis of acarbose, since the AcbC enzyme is related to proteins AroB, dehydrochemical acid smtasas, and shows after overexpression in Streptomyces lividans an enzymatic activity that - as expected - transforms heptulose phosphates (by example sedoheptulose-7-phosphate) in products that have properties similar to those of valienon and valonon (possible precursors of acarbose biosynthesis), but which are not however identical to these.

The genes acbK (acarbose-7-kinase), acbL (keto sugar or sugar oxidoreductase) and acbM (unknown function) as well as the acbN gene (direct linkage with the acbL and acbC reading phases is indicated by overlapping start / stop codons) probably encode acarbose biosynthesis enzymes, since they form together with acbC and eventually also with acbQ a probable operon (unit of transcription) and are read probably coupled in translation. Also the function of a cytoplasmically localized acarbose kinase (AcbK) and a possible dehydrogenase (AcbL) suggests a direct participation in the intracellular metabolism of acarbose; AcbL sugar dehydrogenase could participate here in the synthesis of precursors of C-7 cilitol or 6-deoxyhexose or their condensations.

Both genes, acbD (acarviosyl transferase) [DE 196 25 269.5; Goeke, K., et al. (1966); Drepper, A., et al. (1996)] and acbE (α-amylase), which are mutually opposed with a common promoter region in the gene group of Actinoplanes sp. SE 50/110 and that they encode both enzymes of the family of amylases, indicate in this respect that there is an intimate relationship between the regulation of starch degradation and the production of acarbose. This is confirmed by the finding that both enzymes in Actinoplanes sp. , when grown on starch as the source of C, are the extracellular proteins expressed most intensely in the supernatant of the Actinoplanes sp culture. This is valid for the expression of acbE of the promoter itself even in Streptomyces li vidans (see Examples).

The acbHFG genes encode a probably extracellular sugar binding protein, AcbH, and two typical membrane components, AcbF and AcbG, of a bacterial sugar transporter of the ABC importer type. They are probably involved in the metabolism of acarbose by absorption of oligo-maltodextrins or recycle acarbose as transport vehicle for shorter oligo-a-1,4-glucans (homologues of the acarbose) by absorption in the cell. In a similar process, the gene product similar to amylo- maltose (AcbQ) of the acbQ gene could also be involved.

In addition, the invention discloses: A method for the isolation of biosynthetic genes from the acarbose of Actinomycetes, above all Actinoplanes, characterized in that gene probes derived from a 2.2 kb BamHI fragment are used. The 2.2 kb BamHI fragment obtained by a gene probe, obtained by PCR primer, from very well conserved protein regions of the known enzyme dTDP-glucose dehydratase is described in the patent application [EP A 0 730 029 / DE 19507214] .

A procedure for the isolation of biosynthetic genes from related natural products with acarbose in actinomycetes (for example for validamycin, oligostatin (trestatin), adiposine).

Procedure for the increase of the yield of acarbose synthesis in Actínoplanes by high gene dosage for velocity-determining biosynthetic enzymes, more effective promoters for speed-determining biosynthetic enzymes, disconnection of undesired regulatory steps.

A method for increasing the yield of acarbose synthesis in Actinoplanes by protein engineering in which the biosynthetic steps limit the synthesis of acarbose or to avoid degradation products that are formed by unwanted backreactions of biosynthetic enzymes.

A procedure for delimiting the spectrum of products in Actinoplanes to the desired main product by disconnecting unwanted biosynthetic routes to subcomponents or by disconnecting unwanted enzymatic degradation reactions, such as example by inactivation of the acbD gene.

A procedure for the modification of transport mechanisms with regard to an improved transport of substrates in the cell or a more effective exclusion of acarbose from the cell.

A method for expression in heterologous host strains (for example in Streptomycetes that form pseudo-oligosaccharides as well as in others Streptomycetes such as Streptomyces li vidans, in rapidly growing bacteria such as E. coli or in yeast and fungi), to achieve an increase in production through improved space-time performance, to simplify the processing procedure, - for the chosen delineation of the spectrum of products.

A procedure for the use of acarbose biosynthetic genes for in vi tro synthesis acarbose or compounds of this class of substances, starting from precursors produced synthetically or microbially.

The invention is described below in detail.

In addition, the invention is determined by the content of the claims.

All genetic engineering methods were performed, unless otherwise stated, as in Sambrook et al. (1989).

For the selection, three different gene probes were used. They were isolated from plasmids pAS2, pAS5 / 7.3 and pAS6 / 3. Plasmid pAS2 was prepared from E. coli using the "boiling-method" or by alkaline lysis and hydrolyzed by the restriction endonuclease BamHI. The 2.2 kb BamHI fragment was isolated and by nick-translation the deoxynucleotides were labeled with 3iP. This radioactively labeled fragment was used as a gene probe for the isolation of acarbose biosynthetic genes and is referred to herein as acb-probe-II. The second gene probe was isolated from plasmid pAS5 / 7.3. The Sphl-Sstl fragment was isolated and radioactively labeled as previously described. In what follows this probe is called acb-probe-III. The third gene probe was isolated from plasmid pAS6 / 3. The BamHI fragment was isolated and radioactively labeled as described above. This probe was named acb-probe-IV.

The biosynthetic genes of acarbose were isolated in two ways as follows. 1) Actinoplanes sp. Chromosomal DNA was hydrolyzed. with the restriction enzymes Ssfl, Bgl II and PstI, was separated by gel chromatography and screened by "Southern" hybridization with the probe-probe-II (hydrolysis with SstI and Bgl II) or the acb-probe-III probe (hydrolysis with PstI) in search of a DNA homologous sequence. The SstI fragment that hybridizes with the gene probe has a size of 10.7 kb and the Bgl II fragment of 10.2 kb. The 10.7 kb SstI fragment and the 12 kb Bgl II fragment were eluted from the gel, ligated into the vector pUC18 or pBluescript II KS and cloned into E. coli DH5a. The resulting plasmids were designated pAS5 (SstI fragment) and pAS6 (BglII fragment). A 2.8 kb PstI fragment overlapping the SstI fragment, which hybridized with the acb-probe-III gene probe, was cloned into the pUC18 vector and named pMJ1. 2) A genomic DNA library of phages GEM12 from Actinaplanes sp. Was screened by hybridization on plate with probes acb-probe-III and acb-probe-IV. In total, 15 phages were isolated with the acb-probe-III probe, with two probe phage-IV probe, containing a total of approx. 38.5 kb of Actinoplanes sp colineal DNA with the biosynthetic genes of acarbose. The phages, which were characterized in more detail, received the denomination 10/3 and 5/4. From phage 10/3 plasmid pMJl was obtained by hydrolysis with the restriction enzyme PstI and cloning of a 2.8 kb PstI DNA fragment in the pUCld plasmid. From phage 5/4 the plasmid pMJ9 was obtained (fragment of 6.3 kb N) by hydrolysis with restriction enzymes SstI and subsequent cloning in pUC18 (hydrolyzed with SstI).

For the determination of the DNA sequence of the 10.7 kb SstI fragment (pAS5) of Actinoplanes sp. the following recombinant plasmids were constructed, starting from the pUCld vector, and the sequence of the inserted DNA was analyzed: pAS5 10.7 kb SstI fragment of chromosomal DNA from Actinoplanes pAS2 2.2 kb BamHI fragment of Actinoplanes chromosomal DNA (see patent application DE 195 07214) pAS5 / 15 3.8 kb HindIII / SstI fragment from pAS5 (see patent application DE 196 25 269.5) pAS5 / 15.1 = 2.6 kb Hindl II / Pstl fragment from paS5 pAS5 / 15.2 = 0.75 kb Exit fragment pAS5 / 15.1 pAS5 / 15.3 = fragment I left 0.5 kb from pAS5 / 15.1 pAS5 / 15.4 = fragment I left 0.4 kb from pAS5 / 15.1 pAS5 / 15.5 = fragment I left 0.5 kb from pAS5 / 15.1 pAS5 / 15.6 = fragment PvuII from 1.25 kb from pAS5 / 15.1 pAS5 / 15.7 = 0.7 kb PvuII / i lin fragment from pAS5 / 15.1 pAS5 / 15.9 = 0.1 kb Pvul l fragment from pAS5 / 15.1 pAS5 / 15.11 = 1.1 kb Kpnl / Ncol fragment from pAS5 / 15 pAS5 / 15.12 = 0.9 kb Kpnl / Ncol fragment from pAS5 / 15 With the PCR method three DNA regions were amplified and the corresponding fragments were donated and sequenced: pAS5 / 17 = 0.46 kb PCR fragment pAS5 / 18 - 0.26 kb PCR fragment pAS5 / 19 = 0.27 kb PCR fragment pAS5 / 6 PstI fragment of plasmid pAS5 Clones that can be constructed by the enzymes exanuclease III and nuclease SI starting from the plasmid pAS5 / 6 after hydrolysis with Xhol and Sstl: pAS5 / 6.3-15 = 5.1 kb DNA insert pAS5 / 6.12-4 = 4.7 kb DNA insert pAS5 / 6.3-18 = 4.3 kb DNA insert pAS5 / 6.6-3 = 4.2 kb DNA insert pAS5 / 6.9-2 - 3.6 kb DNA insert pAS5 / 6.9-6 = 3.8 kb DNA insert pAS5 / 6.12-6 = 3.2 kb DNA insert PAS5 / 6.3-6 = 3.0 kb DNA insert pAS5 / 6.15- l = 2.8 kb DNA insert PAS5 / 6.3-16 = 2.3 kb DNA insert pAS5 / 6.9-l - 1.8 kb DNA insert pAS5 / 6.9-3 = 1.2 kb DNA insert PAS5 / 6.6-1 = 0.9 kb DNA insert pAS5 / 6.12-3 = 0.47 kb DNA insert pAS5 / 6.12-2 = 0.17 kb DNA insert pAS5 / 3 BamH fragment? of 1.4 kb of plasmid pAS5 pAS5 / 3.1 = Sphl / Fspl fragment of 0.35 kb of pAS5 / 3 pAS5 / 3.2 = fragment Sphl / BamHl of 0.85 kb pAS5 / 3 pAS5 / 3.3 = 0.55 kb Sphl / BamHl fragment from pAS5 / 3 pAS5 / 4 1.2 kb BamHl fragment from plasmid pAS5 pAS5 / 5 0.48 kb Sstl / BamHl fragment from plasmid pAS5 pAS5 / 7 Pstl / Sstl fragment from 1.2 kb of plasmid pAS5 pAS5 / 7.1 fragment Pvul l / Accl of 0.64 kb of plasmid pAS5 / 7 pAS5 / 7.2 fragment Pstl / Sphl of 0.54 kb of plasmid pAS5 / 7 pAS5 / 7.3 fragment Sphl / Sstl of 0.67 kb of plasmid pAS5 / 7 PAS5 / 11 fragment Bgl l / Hindl ll of 0.68 kb of plasmid pAS5 pAS5 / 12 fragment Bgl II / PstI of 0.63 kb of plasmid pAS5 pAS5 / 13 fragment BamHl / Sstl of 4.8 kb of plasmid pAS5 pAS5 / 16 fragment BamHl of 0.5 kb of the pAS5 plasmid For the determination of the DNA sequence of constructed ies containing the fragments of DNA with acarbose biosynthetic genes of Actinopianes sp. of plasmid pAS6 (see Example 6). The DNA cloned in the plasmid pAS6 has a biosynthetic acarbose gene of 6.2 kb containing a Bgl II / SstI fragment with the pAS5 plasmid. For the sequencing of the 5.9 kb Bgl II / SstI fragment, which binds to plasmid pAS5 (Fig. 1), the following recombinant plasmids were constructed in the pUCld vector. pMJ 6/6 fragment Bgll l / Sstl of 5.9 kb of plasmid pMJ 6/6 pMJ 6 / 4.2 fragment JBaipFÍI / PstI of 0.5 kb of plasmid pMJ 6/6 pMJ 6 / 4.1 fragment BamHl / Sstl of 0.36 kb of plasmid pMJ 6 / 6 p J6 / 6.2.2 referencing I left 0.5 kb pMJ6 / 6.2.3 fragment I left 3.3 kb p J6 / 6.2.4 fragment I left 1.2 kb pMJ6 / 6.2.5 fragment I left 1.0 kb pMJ6 / 6.2.6 fragment I left 0.7 kb pMJ6 / 6.2.7 fragment I left 0.14 kb pMJ6 / 6.2.8 fragment I left 0.13 kb pMJ6 / 8.1 fragment Clal / BamHl 1.1 kb pMJ6 / 10 fragment Pstl / Sall 1.5 kb pAS6 / 3 fragment BamHl 2.8 kb of the plasmid pAS6 pAS6 / 3.1 fragment Hincl l of 1.1 kb of the plasmid pAS6 / 3 pAS6 / 3.2 fragment I left 1.2 kb of plasmid pAS6 / 3 pAS6 / 3.3 fragment PstI of 1.45 kb of plasmid pAS6 / 3 For the determination of the DNA sequence of the 2.8 kb PstI fragment (pMJl) of Actinapl anes sp. the following plasmids were constructed and the sequence of the inserted DNA was analyzed. pMJl / 1 0.6 kb Sphl / Pstl fragment of plasmid pMJl, religated after hydrolysis with Sphl pMJl / 2 Sphl / Ps ti fragment of 1.2 kb of plasmid pMJl, religando after hydrolysis with Saly pMJl / 3 fragment Sphl / Ps ti of 1.4 kb of plasmid pMJl, religated after hydrolysis with Sstl pMJl / 4.1 subclone Sal l / Smal 0.9 kb of plasmid pMJl The method of Sanger et al. Was used for DNA sequencing. (1977) or a procedure derived from it. We worked with the Autoread Sequencing kit (Pharmacia, Freiburg, Germany) together with the Automated Laser Fluoreszens (ALF) DNA sequencing device (Pharmacia, Freiburg, Germany). Suitable sequencing and pUC reverse sequencing primers labeled with fluorescein were commercially purchased (Pharmacia, Freiburg, Germany). The sequence of the Pg II-PstI fragment of approximately 18.0 kb is represented in Figure 3. Table 1 summarizes the properties of the acb genes and the products encoded by them.

Table 2 Sequences of the primers for PCR and sequencing reaction Primers for PCR Plasmid pAS5 / 17: Name of the primer Sequence acbD / The 5 'GGCGGCGATTCGGCCTGCGCGG 3' acbD / E2 5 'GCGGCGGATGGCATGCCTGGCG 3' Plasmid pAS5 / 18: Name of the primer Sequence acbD3 5 'ACCAGGCCGAGGACGGCGCCC 3' acbD4 5 'AGCGGCCATGTGCTTGACGGCG 3' Plasmid pAS5 / 19: Name of the primer Sequence acbD5 5 'ACCGGCTCGAACGGGCTGGCACC 3' acbDd 5 'CCCTCGACGGTGACGGTGGCG 3' Primer for acjC gene amplification The sequence regions with which recognition sites were constructed for the restriction endonucleases Ndel or EcoRI are underlined.

Sequencing of the primer Sequence AS7 5 'GGAAGCTCATATGAGTGGTGTCG3 AS8 5' CGAGACGGTACATATGCACGCGGATG3 ' AS9 '5' CCGTCTCGCCCACCCGCATCACC3 AS-C1 '5' AGGGAAGCTCATATGAGTGGTGTCGAG3 AS-C2 5 'GGTATCGCGCCAAGAATTCCTGGTGGACTG3 Primer for the sequencing reaction Primer name Primer sequence universal 5 'GTAAAAACGACGGCCAGT 3' reverse primer 5 'GAAACAGCTATGACCATG 3' The analysis of the? -terminal sequence of the AcbE protein was performed with the 473A gas phase protein sequencer from Applied Biosystems (Forster City, CA., USA). The standard Fastblott protein sequencing program was used. The sequence of proteins, the different programs, the degradation cycles as well as the PTH identification system are described in the sequencer manual (User's manual protein sequenzing system model 473A (1989), Applied Biosystems Forster City, CA 94404, (USA) .

The detection of PTH amino acids was carried out on-line with a RP-18 column (220 mm x 2 mm, 5 μ material) from Applied Biosystems. The PTH amino acids were identified and quantified with a 50 p ol pattern. the data was processed with the 610A sequencer data system from Applied Biosystems.

All reagents used in the protein sequencer were from Applied Biosystems.

Examples 1. Culture of E. coli strains, preparation of plasmid DNA and isolation of DNA fragments E. coli DH5a was incubated in LB medium at 37 ° C. Bacteria carrying the plasmid were maintained under selective pressure (ampicillin, 100 μg / ml). The cultivation was carried out in an orbital shaker at 270 rpm. As overnight culture (CN), preparations are designated that were incubated in the oven for 16 hours.

For the preparation of the plasmid DNA, 1.5 ml cells incubated from a CN were incubated under selective pressure. Isolation of the plasmids was carried out according to the alkaline lysis method with SDS [Birnboin, H.C., and J. Doly (1979)].

For the selective hydrolysis of the vector DNA, restriction endonucleases were used exclusively as specified by the manufacturer (Gibco BRL, Eggenstein, Germany). For the restriction of 10 μg of plasmid DNA, 5 U of the respective restriction endonuclease were used and incubated for 2 hours at 37 ° C. To ensure complete hydrolysis, the same amount of restriction endonuclease was added a second time and incubated again for at least 1 hour.

The cut DNA was separated by electrophoresis in horizontal agarose gels at 0.5-1.2%, according to the size of the DNA fragments. For the elution, the fragment of the gel containing the gel was cut with a sterilized scalpel. fragment and weighed. The elution of the DNA fragment from the agarose was carried out according to what was specified with the JETsorb kit (Genomed, Bad Oeynhausen, Germany). 2. Cultivation of Actinoplanes sp. SE50 / 110, preparation, cutting of chromosomal DNA and separation by gel electrophoresis Actinoplanes sp. SE50 / 110 in TSB medium at 30 ° in an orbital shaker for 3 days. The preculture (5 ml) was carried out at 240 rpm in culture tubes, the main culture (50 ml) in septated 500 ml flasks at 100 rpm. The cells of the culture were pelleted by centrifugation and washed twice in TE buffer.

The preparation of the complete DNA was carried out with 1.5-2 mg of cells (fresh weight) according to the phenol / chloroform extraction method [Hopwood, D.A., et al. (1985)].

Hydrolysis of 20 μg of chromosomal DNA was performed with 10 U of the corresponding restriction enzyme (Gibco BRL, Eggenstein, Germany) for 2 hours at 37 ° C in the corresponding buffer. To ensure complete hydrolysis, the same amount of restriction endonuclease a second time and incubated again for at least 1 hour.

The cut DNA was separated by electrophoresis in 0.6% horizontal agarose gels.

The elution of the DNA fragments was carried out again with the JRTsorb kit (see Example 1). 3. Preparation of probes acb-gene probe-II, acb-gene probe-III and acb-gene probe-IV The fragments of pAS2 (see DE 195 07214), pAS5 / 7.3 and pAS6 / 3 prepared according to Example 1 were radiolabelled according to the "Nick Translation System" of the manufacturer Gibco BRL, Eggensyein, Germany, according to their indications. For this, DNA fragments of 0.5-1.0 μg were used. We used [a 32P] dCTP (3,000 Ci / M, Amersham Buchler, Braunschweig). The preparation was then boiled for 10 minutes (denaturation) and immediately brought to the hybridization solution (see Example 4). 4. Transfer of DNA on membranes, DNA hybridization (Southern hybridization and autoradiography) The transfer of DNA fragments from the agarose gel to membranes was carried out according to the Southern blot method [Southern, E.M. (1975)]. The agarose gels obtained according to Example 2 were stirred for 20 minutes in 0.25 M HCl. The gels were placed on 3 layers of Whatmann 3MM absorbent paper (Whatmann, Maidstone, GB) and a Hybond ™ -N + Membran membrane was superimposed ( Amersham Buchler, Braunschweig) free of air bubbles. On this several layers of absorbent paper were arranged. A weight of approximately 1 kg was placed on the filter stack. The DNA transfer was carried out by sucking 0.4M NaOH through it. After at least 12 hours of transfer time, the nylon filters were washed with 2x SSC for 5 minutes and air dried.

The nylon filters were then stirred for 2 hours at 68 ° C in 50-100 ml of prehybridization solution in a water bath. In this regard the solution was changed at least twice. Hybridization took place in a hybridization chamber for at least 12 hours. 15 ml of hybridization solution containing the acb-probe-II was used (see Example 3).

The nylon filters were then washed for 15 minutes with Postwash 6x and Postwash lx. The nylon filters were then covered, still in the wet state, with preservation sheets. Autoradiography was performed with Hyperfil-MP (Amersham Buchler, Braunschweig) in a dark chamber with reinforcing plates at -80 ° C for at least 16 hours.

. Isolation and cloning of the Bg II, PstI and Sstl fragments of the complete DNA of Actinoplanes sp.

Actinoplanes sp. Chromosomal DNA was completely hydrolyzed. with BglII, PstI and Sstl, was separated by agarose gel electrophoresis and the Sstl fragment of 9.0-12 kb in length, the BglII fragment of 11-13 kb in length and the PstI fragment of 2.5-3.5 were eluted from the agarose. kb in length (see Example 1). Sstl fragments and eluted PstI fragments were ligated with plasmid vector pUCld, prepared from E. coli, hydrolyzed with Sstl or PstI. Plasmid vectors were first treated with alkaline phosphatase (Boehringer, Mannheim) as specified by the manufacturer. The ligation was performed in a volume of 20 μl, ascending the ratio of fragment to vector to 3: 1 with 0.01-0.1 μg of DNA in the mixture. 1 U of T4 DNA ligase was used with the corresponding buffer (Gibco BRL, Eggenstein, Germany). The eluted Bg II fragments were ligated into the pBluescript II KS vector plasmid hydrolyzed with BaHI. The ligation was carried out as with the Sstl and PstI fragments.

Competent transformation cells of E. coli DH5a were transformed with complete ligation mixtures [according to Hanahan, D. (1983)]. The ampicillin resistant transformants were transferred to selective plates (100 μg / ml) LB-Amp. 6. Identification of clones containing the 10.7 kb Sstl fragment, the 12 kb BglII fragment, the 2.8 kb PstI fragment and the 6.3 kb Sstl fragment from the acarbose biosynthetic gene cluster Ampicillin-resistant transformants containing the 10.7 kb Sstl fragment and the 12 kb Bg II fragment, which hybridized with the acb-probe-II probe, were screened. Ten of these clones were applied respectively on a selective plate, incubated overnight and washed from the plate with 3 ml of medium LB. Plasmid DNA [according to: Birnboin, H.C., and J. Boly (1979)] was then isolated from such groups of tens. To remove the cloned Sstl fragments from the polylinker, the different plasmid preparations were hydrolysed with the restriction endonucleases EccRI and HindIII, or Sstl and HindIII. The restriction preparations were then separated by electrophoresis on a 0.6% agarose gel and the DNAs were transferred by Southern blotting of the agarose gel to a nylon filter (see Example 4). Hybridization was performed again with the probe-probe-II (see Example 4). Each of the groupings reacted positively with the probe-probe-II and was divided into the ten individual clones. Their plasmids were also isolated and subjected to the process described above. The plasmids that hybridized were designated pAS5 or pAS6. They contained a 10.7 kb Sstl fragment (pAS5) or a 12 kb Bgl II fragment (pAS6).

The recombined phage 10/3 was hydrolyzed with PstI, the DNA was separated on a horizontal agarose gel and the 2.8 kb PstI fragment was eluted from the matrix (see Example 1) and ligated into the pUCld vector. The recombinant plasmid was designated pMJ1 and transformed into E. coli DH5a.

Recombinant phage 5/4 was hydrolyzed with Sstl, DNA was separated on a horizontal agarose gel and the 6.3 kb SstJ fragment was eluted from the matrix (see Example 1) and ligated into the pUCld vector. The recombinant plasmid was designated pMJ9 and transformed into E. coli DH5a. 7. Production of the GEM12 library and isolation of recombinant phages containing biosynthetic acarbose genes and preparation of phage DNAs Partially hydrolyzed DNA of Actinoplanes sp. with Sau3AI :. To this end, 50 μg of chromosomal DNA of Actínoplanes sp. with 0.015 U of Sau3AI for 30 min at 37 ° C. The enzymatic reaction was stopped by extraction with phenol, chloroform and ethanol precipitation [according to: Sambrook et al. (1989)]. The subsequent treatment of the DNA fragments and the binding with the phage vector GEM12 was carried out according to the manufacturer's instructions (Promega, Heidelberg). The packaging in vi tro of the ligation preparation was carried out with the "DNA packaging kit" of Boehringer (Mannheim). The lakes were reproduced in E. coli LE392 according to the methods described in Sambrook et al. (1989). Phages with acarbose biosynthetic genes are identified by plaque hybridization (according to Sambrook et al 1989) with the acb-III and acb-IV gene probes. Phage DNA containing acarbose biosynthetic genes was prepared according to Sambrook et al. (1989) from phage reproduced in E. coli LE392. 8. Chain reaction with polymerase PCR serves for the reproduction within selected regions of DNA [Mullis, K.B., and F.A. Falloona (1987)]. Taq-DNA polymerase was used for all reactions according to the manufacturer's instructions (Gibco BRL, Eggenstein) in 25 reaction cycles. The preparations contained for the suppression of possible secondary structures with DNA richer in 5% formamide GC. The volume was 100 μl using 50 pmol of the respective primer and 200 μM dNTP. After a preliminary denaturation of the five minute DNA at 95 ° C, 2.5 U of the temperature-stable DNA polymerase was added to the preparations in a "hot-start". The elongation of the primer was carried out at 72 ° C and the DNA denaturation at the beginning of each cycle was carried out at 95 ° C for 1 min. The reactions were carried out in a Thermocycler Biometra (Gottingen).

Table 3. Protocols for PCR to amplify DNA fragments of the acarbose gene group The name of the recombinant plasmids containing the corresponding fragments is set forth Subcloning of plasmid pAS5 Starting from the plasmid pAS5 several subclones were prepared to resolve the double-stranded DNA sequence. pAS5 / 6 The pAS5 plasmid was hydrolyzed with the restriction enzyme PstI, separated by gel electrophoresis (0.7% agarose gel), the PstI fragment was eluted from the . 4 kb and was cloned into pUC18 (hydrolyzed with PstI) in E. coli DH5a. pAS5 / 3; pAS5 / 4; pAS5 / 13; pAS5 / 16 The hydrolyzed pAS5 plasmid with the restriction enzyme BamHI and separated by gel electrophoresis. The fragments had the following sizes: 1.4 kb BamHl fragment 1.2 kb BamHl fragment 2.3 kb Fragment 0.5 kb BamHl fragment 0.45 kb BamHl fragment 7.5 kb fragment (= 4.8 kb BamHI / Sstl fragment) of Actinoplanes linked with pUCld) The fragments predicted for subcloning with the sizes of 1.4 kb and 0.5 kb were eluted from the gel (see Example 1). For cloning, the pUCld vector was prepared by the restriction enzyme BamH1 as described in Example 1. Ligations were performed as described in Example 5. The 0.5 kb fragment was ligated into the prepared pUCld and the subclone was formed. pAS5 / 16. Subclone pAS5 / 3 was formed by ligation of the 1.4 kb fragment with the pUC18 prepared. Subclone pAS5 / 4 was formed by ligation of the 1.4 kb fragment with the pUCld prepared. Subclone pAS5 / 13 was formed by religation of the 7.5 kb BamHl fragment. pA55 / 5; pAS5 / 7; pAS5 / ll; pAS5 / 12 The hydrolyzed pAS5 plasmid with the restriction enzymes BamHl and Sstl, PstI and Sstl, Bgl I I and PstI as well as BglII and HindIII. The restriction preparations were separated in a 1.2% agarose gel. The corresponding fragments were eluted from the agarose gel and donated in pUC18 (hydrolyzed with BamHl and SStI, PstI and Sstl, BamHl PstI or BamHl and HindIII) in E. coli DH5a. Subclone pAS5 / 5 contained the 0.48 kb Sstl / BamHI fragment, pAS5 / 12 subclone the 0.63 kb BglII / PstI fragment and pAS5 / ll subclone the 0.68 kb BglII / HindlII fragment.

PAS5 / 15.11; pAS5 / 15.12 The plasmid pAS5 / 15 was hydrolyzed with the restriction endonucleases Ncol and Kpnl. The fragments thus formed Ncol / Kpnl of 0.9 kb and Ncol / Kpnl of 1.1 kb were eluted from an agarose gel at 1. 2% (see Example 1) and cloned into vector pUCBM21 (Boehriger, Mannheim) (hydrolysed with Ncol / Kpnl) in E. coli DH5a, and subclones pAS5 / 15.12 were formed (0.9 kb fragment) and pAS5 / 15.11 (1.1 kb fragment).

. Subcloning of plasmids pAS6, pMJ6 / 6 and phage 5/4 pMJ6 / 6: The pAS6 plasmid was hydrolyzed with the restriction endonuclease Sstl (taking advantage of the sites restriction vector) and a 5.9 kb Sstl fragment was eluted from the agarose gel and ligated with the pUC18 plasmid. E. coli DH5a was transformed with the recombinant plasmid. pMJ6 / 4.1 and pMJ6 / 4.2 Plasmid pMJ6 / 6 was hydrolyzed with the restriction endonucleases BamHl and PstI and a 0.36 kb BamHl / Ps tI fragment was eluted from the agarose gel as well as a 0.5 kb BamHl / PstI fragment and ligated with the pUCld plasmid. E. coli DH5a was transformed with the recombinant plasmids.

PMJ6 / 6.2.2, pMJ6 / 6.2.3, pMJ6 / 6.2.4, pMJ6 / 6.2.5, PMJ6 / 6.2.6, pMJ6 / 6.2.7, pMJ6 / 6.2.8: Plasmid pMJ6 / 6 was hydrolyzed with restriction endonuclease Sa J and a 3.3 kb fragment, a 1.2 kb fragment, a 1.0 kb fragment, a 0.7 kb fragment, a 0.14 kb fragment and a 0.13 kb fragment were eluted from the agarose gel and ligated with the pUCld plasmid. E. coli DH5a was transformed with the recombinant plasmids. The plasmid pMJ6 / 6.2.2 was obtained by hydrolysis and subsequent religation. pMJ6 / 8.1: Plasmid pMJ6 / 6 was hydrolysed with the restriction enzymes Clal and BamHl and a 0.9 kb fragment was eluted from an agarose gel and ligated with the plasmid pBluescript II KS. E. coli DH5a was transformed with the recombinant plasmids. pMJ6 / 10: Plasmid pMJ6 / 6 was hydrolyzed with the restriction enzymes PstI and SalI and a 1.5 kb fragment was eluted from an agarose gel and ligated with the pUCld plasmid. E. coli DH5a was transformed with the recombinant plasmids. pAS6 / 3 The plasmid pAS6 was hydrolyzed with the restriction endonuclease BamHl and a 2.8 kb BamHl fragment was eluted from the agarose gel, ligated with the pUCld plasmid and transformed into E. coli DH5a. pAS6 / 3.1: Plasmid pAS6 / 3 was hydrolyzed with the restriction endonuclease HincI I and a 1.1 kb fragment was ligated into pUCld, hydrolyzed with HincI I, and cloned into E. coli DH5a. pAS6 / 3.2 Plasmid pAS6 / 3 was hydrolyzed with restriction endonuclease SalI, a 1.2 kb fragment was ligated into pUCld, hydrolyzed with Sali, and cloned into E. coli DH5a. pAS6 / 3.3 Plasmid pAS6 was hydrolyzed with restriction endonuclease PstI, a 1.45 kb fragment was eluted from the agarose gel and ligated with pUCld. E. coli DH5a was transformed with the recombinant plasmid. 11. Subcloning of plasmid pMJl pMJl / 1 Plasmid pMJl was hydrolyzed with the restriction endonuclease Sphl and a 3.3 kb Sphl fragment Sali / PstI 0.6 kb fragment ligated with pUCld) was eluted from the agarose gel. This fragment was religated and cloned into JE coli DH5a. pMJl / 2 The plasmid pMJl was hydrolyzed with the restriction endonuclease SalI and a Sali fragment of 3.9 kb (1.2 kb Sphl / Ps ti fragment ligated with pUCld) was eluted from the agarose gel. This fragment was religated and cloned in E. coli DH5a. pMJl / 3 The plasmid pMJl was hydrolyzed with the restriction endonuclease SalI and a 4.1 kb Sstl / Pstl fragment (1.4 kb Sstl / Pstl fragment ligated with pUCld) was eluted from the agarose gel. This fragment was religated and cloned in E. coli DH5a. pMJl / 4.1 Plasmid pMJl was hydrolyzed with the restriction endonuclease Sali and a 0.9 kb Sall / Smal fragment was eluted from the agarose gel and ligated with the pUCld plasmid. The recombinant plasmid was transformed into E. coli DH5a. 12. Preparation of subclones of pAS5 / 6 The preparation of subclones pAS5 / 6 was carried out with the "double-stranded Nested Deletion Kit" (Pharmacia, Freiburg, Germany). 10 μg of pAS5 / 6 DNA was prepared as described in Example 1 and hydrolyzed with each 10 U of Xhol and Sstl. Subsequent incubation with exonuclease III was performed according to the manufacturer's instructions for a total of 20 min. Partial amounts corresponding to an amount of DNA of approximately 2.5 μg of DNA were taken at 5 min intervals. The treatment with nuclease SI to obtain non-overlapping DNA ends was carried out for 30 min at 20 ° C according to the manufacturer's instructions. These DNA molecules were religated with T4 ligase and cloned into E. coli DH5a. 13. DNA sequencing of acarbose biosynthetic genes of Actinoplanes sp.

The plasmids described in Examples 8 to 11 were sequenced. In the sequencing reaction, 6-8 μg of plasmid DNA from a preparation was used (see Example 1). The sequencing reaction was performed with the Auto-Read-Sequenzing kit (Pharmacia, Freiburg, Germany). In this regard, the standard protocol for the sequencing of dsDNA can be used. To make possible the evaluation of the nucleotide sequence with the A.L.F. (sequencer (DNA) automated by laser fluorescence) the universal and reverse sequencing primers labeled with fluorescein were used as starter molecules for the sequencing reaction (see Table 2). For the preparation of the gel, 8 ml of Hydro Link Long Ranger (Serva, Heidelberg), 33.6 g of urea, 8 ml of TBE lOx buffer and mixed with H20 up to 80 ml were used, filtered to sterilize and the gases were eliminated for 1 minute. Polymerization was started by adding 350 μl of 10% ammonium persulphate (w / v) and 40 μl of N, N, N ', N', tetramethylethylenediamine. The solution was poured into a gel mold (50 x 50 x 0.05 cm). Electrophoresis was performed at 38 W and at a constant temperature of 45 ° C. TBE lx buffer was used as development buffer. The fluorescence processing measured to obtain a DNA sequence was performed by a computer coupled (Compaq 386 / 20e), which also served to control the unit electrophoresis (program A.L.F. Manager 2.5, Pharmacia, Freiburg). 14. Transformation of S. li vidans The protoplastación and transformation of S. lividans TK23 and 1326 was carried out according to the method of Babcock and Kendrick (1966) fixing the cells in TSB-PEG.

. Overexpression of AcbC . 1 Overexpression of AcbC in E. coli The DNA sequence of the acbC gene presents two possible translation start points for AcbC. Although starting point 1 represents the most likely start due to a more significant ribosome binding site, the two possible AcbC proteins were overexpressed. For this, plasmids pETlla and pET16b (Novagen, Heidelberg) were used for expression in E. coli. To guarantee an optimal translation start for the expression, the codon of started ATG, at a sufficient distance from a similar RBS of E. coli, from the pET vectors had to be used. For this it is necessary to build an Ndel recognition sequence in the start codon of acbC. HE used the oligonucleotides AS7 (sequence position 6091) and ASd (sequence position 6112) for the synthesis of an Ndel recognition site in the two possible start codons. Oligonucleotide AS9 binds 66 bp downstream of a BamHI recognition sequence at position 6361 to AD ?. With the PCR method (see Example 8) two fragments of AD were amplified. which were used for an expression of the two possible AcbC proteins. The addition of the primer was carried out in 40 sec. at 45 ° C, and the elongation of the primer took place in 30 sec. The two fragments of AD? The amplified ones were hydrolysed with the restriction endonucleases NdeJ and Ba Hl and ligated correspondingly into the pETlla and pETldb vectors. From the recombinant plasmid pAS2 [EP A 0 730 029 / DE 19507214] the 2.2 kb BamH1 fragment was isolated and fused through the BamHI recognition site with the cloned PCR fragments. After this, the orientation of the 2.2 kb BamH1 fragment was checked, with the complete acbC gene in the expression vectors. The expression vectors were designated pASß / l-pASS / 4 (Fig. 4) . In addition there is the reading phase ac¿) C complete (with inverted orientation) and the start of the gene ac £) C in the AD? cloned in the expression vectors. In cultures of E. coli BL21pLys induced with IPTG could be identified a respective protein expressed additionally. The size of the overexpressed AcbC proteins is represented in Table 4. However, all the proteins were formed in the form of insoluble "inclusion bodies".

Table 4 Structure of AcbC expression vectors for expression in E. coli . 2 Overexpression of AcbC in S. li vians 1326 The AcbC protein was expressed in S. li vidans 1326 by the plasmid vector pIJ6021 [Takano, e., Et al. (nineteen ninety five)]. A fragment of chromosomal DNA comprising exclusively the coding region of the acbC gene was amplified by the PCR method [Mullis and Falloona, (1987)]. For the PCR the oligonucleotides AS-C1 and AS-C2 were used, building with the help of the primer AS-C1 (position of sequence 6089) a recognition site Ndel in start codon 2 of the acbC gene. Oligonucleotide AS-C2 binds at position 7682 and was used to construct a JECORI recognition sequence. The addition of the primer was carried out in 20 sec. at 50 ° C, and the primers were lengthened by 40 sec. The acbC DNA fragment thus obtained was first cloned into the "blunt end" pUCld vector and the DNA sequence conformance was checked by PCR. This recombinant plasmid with the cloned acbC gene was designated pAS8 / 5.1. Plasmid pASd / 5.1 was hydrolyzed with the restriction endonucleases Ndel and EcoRI, the DNA was separated on an agarose gel and eluted from the matrix. The ajcC fragment thus prepared was ligated into the vector pIJ6021. The recombinant expression plasmid was designated pASd / 7.2 (Fig. 5). Protoplasts S. li vidans 1326 were transformed with plasmid pAS8 / 7.2. With the clone thus obtained, the AcbC protein could be overexpressed in soluble form in cultures induced with thiostrepton (Fig. 6). 16. Overexpression of AcbE in S. li vidans TK23 The acbE gene could be obtained from the plasmid pAS5 / 6.9-6 by hydrolysis with the restriction endonucleases EcoRI and ífindlll. After separating the DNA in an agarose gel and elute the EcoRI / HindIII fragment of 3.8 kb from the matrix this acbE fragment was ligated correspondingly into the vector pUWL219 [J. Wehmeier, U.F. 81995)]. For a later expression of AcbE in S. li vidans a possible promoter sequence in the "upstream" region of 200 bp in size should be used in these vectors (see Table 5). The recombinant plasmid was named pASll (Fig. 7).

Table 5 The intercistronic region between the acbE and actD genes. The reverse repetition (IR) and direct repeat (DR) sequences that may be involved in a regulation are underlined ? bE OOlCCTOX »A < G? QCTCT? OCG? CeCTGCO? TC8 IR 1 OA? CO? C ???? TGCTTCTTCAAAOTCTTOO XT8 Fled R2 TACTTAAAOCTCTCK? OOAjMaC lAOOGTTOAAsT8 ATO AAT TTC OAO ACO CCT TOO A? T CCC AAC TTC ACC OCC ACT ACOTAOOTAOTOACATAC »3 DRI • C8ATCTOA ATO A8TCT TCT CICA AnTTCTTOCi? COsrcTO OCO TAO ACT TAC TOC ASA AOA COTTC? AOA ACÓ TCO CCA OAO OCC CCO OAG OOO ?? OOAG OTC ATC CiaLlJCACAAGOAOAA CCTC Ac D CAOTAOaOAAOTOTTCCT CTT COAO? Protoplasts of S. li vidans TK23 were transformed with the pASll plasmid. In the supernatants of the cultures in MD 50 was observed, both in the preparations of S. li vidans TK23 / pASll as well as those of Actinoplanes sp. , an extracellular protein of 110 kDa in size (Fig. 8). This size corresponds to the molecular weight of the protein derived from acbE. The identity of this protein was confirmed by the corresponding enzymatic assay (see Example 19.2) and the sequencing of the N-terminal amino acids (see Example 18). In the supernatant of the control culture of S. lividans TK23 / pUWL219 in MD 50 medium, no corresponding protein could be detected. Therefore, it is plausible that the possible promoter sequence (Table 5) "upstream" of the acbE gene is responsible for the expression of AcbE in the cultures of S. li vi dans / pAS11 in MD 50 medium. 17. Protein isolation by gel electrophoresis The denaturing separation of proteins in polyacrylamide gels with SDS and their coloration with Coomassie dye was carried out according to the method of Lugtenberg (1975). Depending on the preparation, 8% or 11% gels were used.

Gel composition (11% gel) * see buffers and solutions Electrophoresis was performed either with the SERVA Blue-Vertical 100 / C device (gel mold, 80 x 100 x 0.75 mm) or with the Renner-Twin-Vertical device (gel mold, 180 x 170 x 1 mm).

The determination of the protein concentration of the samples to be analyzed was carried out with Protein-Assay (BioRad, Munich), constructing a calibration line with BSA. As a pattern for the molecular weight of the Separated proteins will be used the "VIIL Dalton Marker" (14.2 kDa - 66 kDa) and the "High Molecular Weight Standard" (29 kDa - 210 kDa) from Sigma (Deisenhofen). 18. Determination of the amino acid sequence N-terminal The N-terminal amino acid sequence of the AcbE protein was determined by comparing that of Actinoplanes sp. and the clone of S. li vidans TK23 / pASll. To this end, 50 ml of cultures were incubated in MD 50 medium for three days. The cells were separated by centrifugation and the supernatants were dialyzed at 4 ° C for 12 hours against buffer (5 mM Tris / HCl, pH 7.5, 1 mM CaCl 2). The supernatants were then lyophilized in 48 hours and suspended in 1.5 ml of assay buffer. The culture supernatants thus prepared were separated on an SDS-PAGE with the Renner-Twin-Vertical apparatus (gel mold, 180 x 170 x 3 mm). To ensure the best possible separation of the AcbE protein from other extracellular proteins, a gradient gel (5% -> 10%) was used. The transfer of the proteins of the polyacrylamide gel with SDS to a polyvinyl fluoride (PVDF) membrane (Amersham Buchler, Braunschweig) was carried out in a semi-dry electrophoretic method with an apparatus Fast-Blott B-33 (Biometra, Gdttmgen) as specified by the manufacturer. The transfer was carried out for 45 min with 250 mA. Dilution buffer diluted 1: 2 was used as transfer buffer (see buffers and solutions). The membranes were colored in 30 min and decolorized with decolorizing solution (see buffers and solutions). To determine the N-terminal amino acid sequences, the transfer piece was washed twice with 100 μl of 50% methanol to remove the excess salts. After drying, the sequence analysis was carried out by means of a transfer cartridge as well as a filter pretreated with Polybren. The Fastblott cycle was used for the sequence analysis. The result is represented in Table 6.

Table 6 Sequencing results of the N-terminal amino acid sequence of the AcbE protein of Actinoplanes sp. and the clone of S. li vi dans TK23 / pASll 19. Determination of enzymatic activities 19. 1 Determination of the valiolon synthase activity For overexpression of AcbC, 10 ml of YEME medium (50 μg / ml Km) were inoculated with a spore suspension of S. lividans 1326 / pASd .7.2. After a culture of one to two days the cultures were found in the early phase of logarithmic growth. At that time cultures were induced with 7.5 μg / ml thiostrepton. The cultures were harvested 20 hours after induction. The pelleted cells were suspended in 1.5 ml of cold termination buffer (see buffers and solutions) and carefully disintegrated with ultrasound. By centrifugation for 30 minutes at . 000 g and 4 ° C the cellular debris was removed. By dialysis (12 hours) against 2.5 liters of disintegration buffer the AcbC extract necessary for the enzymatic assay was obtained. This extract could be stored for two months at -20 ° C without apparent loss of activity. The protein content of the extract was determined with Protein-Assay (BioRad, Munich) and 15 μg were analyzed on an SDS-PAGE (Fig. 6). The enzymatic assay was performed in a 20 nM P buffer (pH 7.5) with 40 μM CoCl at RT for 2 hours. In the enzymatic assay 20 μg of total protein of AcbC extract and 8 mM sedoheptulose-7-phosphate will be used. In addition, the reaction mixture contained 2 mM NaF to inhibit nonspecific phosphatases in the extract. The reaction volume was 100 μl. The evaluation was carried out by means of a TLC on sheets of silica gel with butanol / ethanol / H20 (9: 7: 4) as eluent, analyzing 25 μl of a reaction mixture. By spraying the TLC sheets with Cer's reagent (see buffers and solutions) and then incubating them for 15 minutes at 90 ° C in a drying oven, the organic compounds could be visualized. A mixture of valienon and valiolon (Prof. E.G. Floss, Seattle) was used as a reference substance.

With the AcbC protein expressed in S. li vidans Sedoheptulose-7-phosphate could be specifically reacted (Fig. 9). However, the reaction product showed a progressing behavior in the TLC slightly different than that of the valienon / valiolon standard. A decrease in the advance path of the reaction product in the silica gel sheet could be excluded by the reaction buffer (Fig. 9, lane 5). 19. 2 Determination of a-amylase activity Cultures of S. li vidans TK23 / pASll were grown in TSB medium and MD 50 medium in the presence of 25 μg / ml thiostrepton. After an incubation of 3-4 days the cultures were harvested. The cells were removed by centrifugation (3,500 g) at 4 ° C for 10 min. The supernatants were dialysed for 12 hours at 4 ° C against buffer (Tris / HCl pH 7.5 25 mM, CaCl21 mM). Of the supernatants thus prepared, 500 μl were dried under vacuum and suspended in assay buffer (see buffers and solutions); the supernatant proteins were separated on an SDS-PAGE (Fig. 8). For reference, supernatants from Actinoplanes sp. that had been cultivated under identical conditions. The a-amylase activity was determined by measuring the turbidity decrease of a 1% starch suspension.

For one measurement, 100 μl of dialyzed culture supernatant was mixed with 900 μl of starch suspension and the decrease in extinction at 300 nm was recorded as a function of time [Virolle, M.J., et al. (1990)]. For comparison, corresponding assays were performed with an a-amylase from Bacillus sp. (Sigma, Deisenhofen). The results are represented in Fig. 10. The activity of AcbE in cultures of Actinoplanes sp. in MD 50 and cultures of S. lividans TK23 / pASll in MD 50 was not inhibited in the assay by adding 1 mM acarbose. In contrast, the background activity was inhibited in the assay in S. li vidans cultures TK23 / pUWL219 in MD 50 with 0.1 mM acarbose. The a-amylase from Bacill us sp. it was also inhibited with 0.1 mM acarbose (Fig. 10).

Tampons and solutions: Means for the cultivation of bacteria Medium LB: Tryptone 10 g NaCl 10 g Yeast extract 5 g H20 to 1,000 ml A pH value of 7.5 was adjusted with 4 M NaOH Medium MD 50 Solution I Starch hydrolyzate MD 50 70 g (NH4) 2S04 5 g Yeast extract 2 g up to 400 ml with H20 Solution II K2HP04 1 g KH2P04 1 g Trisodium citrate 5 g to 400 ml with H20 Adjust pH to 7.0 with 1 M NaOH Solution III MgCl2-6H20 1 g FeCl3'6H20 0.25 g CaCl2-2H20 2 g up to 200 ml with H20 The solutions after the mixture were sterilized. Medium TSB Tryptone-soy broth (Oxoid) 30 g H20 to 1,000 ml TSB-PEG 8000 [see Babcock et al. 1988)] Tryptone-Soy broth (Oxoid) 30 g / i PEG 8000 50 g / i after autoclaving: Glycine (20%) 25 ml MgCl2 (2.5 M) 2 ml YEME [Hopwood, D.A., et al. (1985) Yeast extract 3 g / 1 Peptone 5 g / 1 Malt extract 3 g / 1 Glucose 10 g / 1 Sucrose 340 g / 1 after autoclaving: MgCl2 (2.5 M) 2 ml Conventional preparation of plasmid DNA [modified according to: Birnboin and Doly (1979)] Mixture 1 50 mM Glucose 50 MM Tris / HCl (pH 8.0) 10 mM EDTA (pH d.0) Lysozyme 5 mg / ml Mixture II 200 mM NaOH SDS (sodium dodecyl sulfate) 1% (w / v) Mixture III Potassium acetate 3 M Formam 1.8 M TA Buffer (pH 8.0) 10 mM Tris-HCl Na2-EDTA 1 mM Hybridization DNA-DNA SSC 20x NaCl 3 M Sodium citrate 0.3 M Prehybridization solution SSC 6x 0.01 M sodium phosphate buffer pH 6.8 EDTA 1 mM SDS 0.5% Skimmed milk powder 0.1% Hybridization solution After the prehybridization reaction were added to the acb probe in 15 ml of prehybridization solution Postwash 6x SSC 6x SDS 0.5% DNA Sequencing TBE Buffer (pH 8.0) Tris-base 1M Boric acid 0.83 M EDTA 10 mM Denaturing protein electrophoresis in polyacrylamide gel 5x test buffer Glycerin 25 ml SDS 5 g BPD 2.5 mg 2-Mercaptoethanol 12.5 ml Tris / HCl 0.625 M (pH 6.8) up to 50 ml Tris / HCl electrode buffer (pH 8.3) 25 M Glycine 190 mM SDS (w / v) 0.1% pH adjustment before addition of SDS Solution A Acrylamide 44 g N, N-methylene-bisacrylamide 0.8 g H20 to 100 ml Solution B Acrylamide 30 g N, N-methylene-bisacrylamide 0.8 g H20 to 100 ml Color solution SERVA R-250 (w / v) 0.15% Methanol (v / v) 50% Acetic acid (v / v) 10% Decolorizing solution Methanol (v / v) 25 l Acetic acid (v / v) 10% AcbC Disintegration Buffer K2HPO4 / KH2PO4 (pH 7.5) 20 mM NAD 0.2 mM 0.5 mM DTT A-Amylase Assay Phosphate Buffer K2HPO4 / KH2PO4 (PH 6.8) 50 mM KCl 50 mM Reagent of Ceric acid molibdatof osf orico 1.25 g Cer-4-sulfate 0.5 g H20 up to 50 ml fifteen twenty Bibliography Babcock, M.J., Kendrick, K.E. (1988) Cloning of DNA involved in sporulation of Streptomyces griseus J. Bacteriol. 170, 2802-2606. Birnboin, HC, Doly, J. (1979) A rapid alkaline extraction procedure for screening recombinant plasmid DNA Nucleic Acid Res.: 7, 1513-1523 Drepper, A., Pape, H. (1996) Acarbose 7-phosphotransferase from Actinoplanes sp . : Purification, properties, and possible physiological function J. Antibíot., 49, 664-669 Goeke, K., Drepper, A., Pape, H. (1996) Formation of acarbose phosphate by a cell-free extract from the acarbose producer Actinoplanes sp. J. Antibiot., 49, 661-663 Hanahan, D. (1983) Studies on transformation of Escherichia coli with Plasmids J. Mol. Biol .: 166, 557-580 Hershberger, C.L., et al. (1989) Genetics of Molecular Biology of Industrial Microorganisms Amer. Soc. Microbiol., Pgs. 35-39, p. 58, pgs. 61-67, pgs. 147-155 Hopwood, D.A., et al. (1985) Genetic manipulation of Streptomyces; A laboratory manual; The John Innes Foundation, Norwich, England Lugtenberg, B., et al. (1975) Electrophoretic resolution of the "major" outer membrane protein of Escherichia coli into four bands FEBS Lett. 58, 254-258 Merson-Davies, L.A., Cundliffe, E. (1994) Analysis of five tylosin biosynthetic genes from the tylIBA region of the Streptomyces fradiae genome Mol. Microbiol., 13, 349-355 Mullis, KB, Falloona, FA (1987) Specific synthesis of DNA in vi tro via a polymerase catalyzed chain reaction Methods Enzymol., 155, 335-350 Sanbrook, J., et al (1989) Molecular cloning; a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, N.Y., USA Sanger F .; Nicklan S .; Caulson A.R. (1997) DNA sequencing with chain determining inhibitors Proc. Nati Acad. Sci. USA, 74, 5463-5467 Southern E.M., (1975) Detection of specific sequences among DNA Fragments generated by gel electrophoresis J. Mol. Biol., 98, 503-521 Takano, E., et al. (1995) Construction of thiostrepton-inducible, high-copy-number expression vectors for use in Streptomyces spp.

Gene, 166, 133-137 Virolle, M.J., Morris, V.J., Bibb, M.J. (1990) A simple and reliable turbidimetric and kinetic assay for alpha-amylase that is really applied to culture supernatants and cell extracts J. Industrial Microbiol., 5,295-302 Wehmeier, U.F. (1995) New multifunctional Escherichia coli -Strepto yces shuttle vectors allowing blue-white screening on XGal plates Gene, 165, 149-150 Legends Fig. 1 Restriction map of the sequenced fragment of approx. 18 kb of the genome of Actinoplanes sp. SE50 / 110 (see Fig. 2). The black bars indicate the region claimed in the original patent that partially overlaps the acbCBA genes (sequence as indicated from left to right).

Fig. 2 Gene map of the biosynthetic gene group of acarbose.

Fig. 3 DNA sequences of the biosynthetic gene group of acarbose.

Fig. 4 The recombinant plasmids starting from plasmids pETlla and pET16b - were constructed for the expression of AcbC in E. coli.

Fig. 5 The recombinant plasmid pAS8 / 7.2 which - starting from the plasmid pIJ6021 - was constructed for the expression of AcbC in S. li vidans 1326.

Fig. 6 Electrophoretic separation in gel from cell phones (see Example 15.2). The expression of AcbcC (42 kDa) in the culture of S. li vidans 1326 / pAS8 / 7 is represented in lane 3.

Fig. 7 The recombinant pASll plasmid, starting from the plasmid pUWL219, was constructed for the expression of AcbE in S. li vidans TK 23.

Fig. 8 Electrophoretic gel separation of proteins from culture supernatants (see Example 16). The expression of AcbE (110 kDa) can be observed in lane 2, lane 5 and lane 6.

Fig. 9 Verification of AcbC enzymatic activity by thin-layer chromatography on silica gel sheets (see Example 19.1) 1) Extract of Actinoplanes sp. 2) Extract of S. li vidans 1326 / pJ6021 3) Extract of S. li vidasns 1326 / pAS8 / 7.2 (extract stored 2 months at -20 ° C) 4) Extract of S. li vidans 1326 / pAS8 / 7.2 (boiled ) ) Extract of S. li vidans 1326 / pAS8 / 7.2 (valienon instead of sedoheptulose-7-phosphate as substrate) 6) Pattern of valiolon / valienón 7) Sedoheptulosa 8) Sedoheptulose-7-phosphate 9) Extract of S. li vidans 1326 / pAS8 / 7.2 (fresh extract) Fig. 10 Determination of a-amylase activity in culture supernatants. The culture of the bacteria was carried out in MD 50 medium. With boiled culture supernatants, no activity could be measured. The duration of the trial was 6 min. To compare in the 9-11 preparations, 2.8 mU of commercial α-amylase was used.

It is noted that in relation to this date, the best method known to the applicant, to implement said invention is that which is clear from the manufacture of the objects to which it refers.

Having described the invention as above, the content of the following is claimed as property.

Claims (2)

1. The DNA of Figure 3, characterized in that it contains the group of biosynthetic genes of acarbose.

2. The DNA of Figure 3, characterized in that it contains acarbose genes.