MXPA97002141A - Procedure for the production as well as for the use of acarviosil-transferase in the transformation of homologos of acarbose in acarbose, for the production of acarb homologos - Google Patents

Abstract

The invention relates to the acarviosyl transferase of Actinomycetes, mainly Actinoplanetes SE 50/110 and its mutants, to a method for the isolation, purification and characterization of the enzyme, for the isolation and characterization of the acbD gene coding for acarviosil -transferase, to the expression of acarviosyltransferase in a heterologous host organism, to the use of acarviosyltransferase for the transformation of acarbose-derived components into acarbose or for the production of acarbose homologs, to the use of acarviosil -transferase in the purification of acarbose, as well as obtaining productive mutants with formation of reduced derivative components by inactivation of the acarviosil-transfera gene

Description

Process for the production as well as for the use of acarviosyltransferase in the transformation of acarbose homologs in acarbose, for the production of acarbose homologs. DESCRIPTION OF THE INVENTION The invention relates to the acarviosyltransferase (AT) of Actinomycetes, mainly of Actinoplanetes species SE 50/13 or SE 50/110 and its mutants, to a procedure for the isolation, purification and characterization of the enzyme, for the isolation and characterization of the acbD gene coding for acarviosyltransferase, for the expression of the acarviosyltransferase in a heterologous host organism, the use of acarviosyl transferase for the transformation of acarbose-derived components into acarbose or for the production of acarbose homologs, the use of acarviosyltransferase in the purification of acarbose, as well as to obtain productive mutants with formation of reduced derivative components by inactivation of the acarviosil-transferase. It is object of previous patent applications (for example, DE 2064 092, DE 22 09834) the knowledge that a series of Actinomycetes, especially the Actinoplanáceos, synthesize inhibitors of oligosaccharide nature of glucosidic hydrolases, preferably of the enzymes of the degradation of carbohydrates of the digestive tract.

REF: 24179 The inhibitors are composed of a acarviosyl unit that is linked to malto-oligosaccharides or other sugars by α-1,4-glycosidic linkages. The acarviosyl nucleus can be bound on both sides with different numbers of glucose units. The number of glucose residues on the nucleus determines the specific activity of the inhibitor. The shorter molecules (components with 1-5 glucose units) act predominantly on disaccharidases, whereas with an increasing number of glucopyranose the action on a-amylases becomes more effective. As the most potent inhibitor of this group of -glucosidase is the compound 0-4, 6-dideoxy-4- [[1S- (1S, 4R, 5S, 6S) -4,5,6-trihydroxy-3- (hydroxymethyl) ) -2-cyclohexen-l-yl] -amino] -D-glucopyranosyl- (14) -OD-glucopyranosyl (14) -D-glucopyranose, described as acarbose (DE 23 47 782). Acarbose is used in medicine to fight diabetes mellitus. The synthesis of the secondary metabolite acarbose is carried out through Actinoplanetes SE 50 species (CBS-na 961.70) and through a natural variant of this strain, SE 50/110 (CBS 674.73) or, also, SE 50/13 (CBS 614.71 ) (DE 22 09 83), as well as through its selectants and mutants. In the above-mentioned patent applications, for example in Examples 1 to 4 of the aforementioned German patent application P 20 09 834, the production of such an sucrase inhibitor is described. Along with acarbose as the main product appear in this compounds containing acarviosilo with different residues of malto-oligosaccharides and disaccharides as derivative components. Acarbose is composed of a acarviosyl residue that, according to the current state of knowledge, is the first one formed in biosynthesis, to then join with a maltosyl residue. In the course of work for. the clarification of acarbose biosynthesis was described by Goeke 1986 (Goeke, K., enzymatic investigations of sugar metabolism and the biosynthesis of the α-glucosidase inhibitor acarbose in Actinoplanetes species, Doctoral Thesis, University of Münster) an enzymatic exchange of the rest of acarbose maltose (acarviosil-maltose) with radiolabeled maltose: with the use of [U-I4C] maltose, a acarbose originated radioactively in the maltose residue. The enzyme involved, acarviosyltransferase (AT), was first designated as pseudodisacaridyl (PDS) -transferase. From the fact that after cell disintegration and differential centrifugation, the activity of the sediment fraction was higher in the acarbose-high exchange reaction than in the fraction of the supernatant in the factor 3.25, the conclusion was drawn that the PDS-transferase is attached to the membrane. Schaper, 1991, (Schaper, B., biochemical and physiological studies of the biosynthesis of the α-glucosidase inhibitor acarbose; Doctoral Thesis, University of Münster) confirmed this finding and elaborated a detailed process of purification of the enzyme bound to the membrane. For the partially purified enzyme, an optimum pH of 4.5 was indicated for an optimum temperature of 302C and Mn2 + as a cofactor. Surprisingly, it was now found that acarviosyl transferase with the ability to exchange the maltose residue of acarbose is not bound to the membrane, but rather that the AT is found mainly in the culture filtrate, increasing the enzymatic activity in parallel with the growth cell phone. The enzyme could be isolated with greater purity from the cell supernatant. For this, the enzyme was precipitated from the culture supernatant with ammonium sulfate. After centrifugation, the pellet was dissolved in buffer (containing glycerin and Cl 2 Ca), recentrifuged and the resulting supernatant was applied on an anion exchange column. The eluate contained acarviosyltransferase. From this solution, by means of dialysis, the TA could be obtained in the form of a partially enriched preparation or purified by chromatography on DEAE-Fractogel®, double precipitation with sedimentable starch and desorption with acarbose or maltose. The purified acarviosyltransferase had a MW of 76 kDa (DSS-PAGE) and an optimum temperature of 20-402C.

The enzyme is resistant to temperature up to about 40 ° C. An optimum pH of 6.2-6.9 was determined, as well as a dependence on Ca2 + ions. The purified enzyme was sequenced. The originated sequence of bases showed, surprisingly, a good coincidence with the corresponding DNA sequence of the acbD gene of the acarbose gene group of the organism producing species Actinoplanetes SE 50/110. It is surprising, furthermore, that acarviosyltransferase can exchange the maltosyl residue of acarbose with other sugar moieties, with synthesis of acarbose homologs or is capable, by exchange of the sugar moieties in the acarbose-like derivative components formed in the course of the fermentation with a maltose residue, of the synthesis of acarbose. Therefore, acarviosyl transferase catalyzes the general reaction: Acarviosil-X +? Acarviosil-Y + X (X = glucose, maltose, malto-oligosaccharides, among other sugars, Y = glucose, maltose, malto-oligosaccharides, among other sugars). The invention reveals, therefore: The complete procedure for the isolation and purification of acarviosyl transferase from cultures of Actinoplanetes SE 50/110 species or their mutants. The characterization of purified acarviosyltransferase.

The amino acid sequence that, after tryptic dissociation of the enzyme, was determined in more than 100 amino acids. The sequence of bases that emerges from it shows a good match with the base sequence of the acbD gene. A process for the production of acarbose from acarbose-derived components by exchange of the respective sugar moieties with maltose. A process for the production of acarbose homologs with modified pharmacological properties by exchange of the maltosyl residue of acarbose with other suitable sugar moieties. The use of acarviosyltransferase or immobilized AT for the isolation of acarbose from the culture broth (affinity chromatography) with simultaneous transformation of acarbose homologs into acarbose. Isolation and characterization of the acbD gene coding for acarviosyltransferase. The production by genetic engineering of acarviosyltransferase in a heterologous host system. The obtaining of improved productive mutants, achieving a limitation of the spectrum of products in Actinoplanetes to acarbose as the desired main product of biosynthesis by exclusion of unwanted synthesis of components derived by inactivation of the acbD gene. The invention is described in detail below. In addition, the invention is determined by the content of the claims. The invention is described in detail below. I. Purification of the enzyme Filtration of the culture of a two-phase incubation of Actinoplanetes species SE 50/110 or its mutants: Pre-culture: Defatted soybean meal 2% Glycerin 2% C03Ca 0.2% Tap water pH 7.2; adjustment with NaOH 1000 ml Erlenmeyer flask; volume occupied: 125 ml Inoculum: 5 ml of permanent culture (72 hours of previous culture, storage at 202C) Incubation: 72 hours at 302C, 260 rpm.

Main culture: defatted soybean meal 1% Starch 3% COjCa 0.2% Tap water Erlenmeyer flask of 1,000 ml; volume occupied: 125 ml Inoculum: 5 ml of previous culture Incubation: 96-144 hours at 302C, 260 rpm. After a culture time of 120 hours, the maximum activity of AT is reached with 2.6 ncat / ml filtered from the culture. With this, the AT is the predominant protein in terms of quantity in the culture filtrate. The purification scheme is represented in table 1. Table 1 Purification scheme of acarviosyltransferase The following buffers were used: Buffer 1: 25 mM Tris / CIH, pH 8.5 + 10% glycerin + 1 mM Cl2Ca. Buffer 2: Tris / CIH 25 mM, pH 7.5 + 1 mM Cl2Ca. Buffer 3: Tris / 10 mM CIH, pH 7.5 + 1 mM Cl2Ca. Buffer 4: 0.1 mM Tris / CIH, pH 7.2 + 0.01 mM Cl2Ca. Starch ': Boiled soluble starch, 12 hours at 42 ° C ("cold precipitation"), 60 minutes of centrifugation at 40,000 x g; the sediment is used.

I grow soy flour-starch 3,000 x g; 10 minutes Culture filtration Fractional precipitation with S04 (NH4) 2 (20-40% saturation) 25,000 x g; 30 minutes (2x) Sediment Solubilization in buffer 1 25,000 x g; 30 minutes Supernatant Anion exchange column-DEAE; ClNa 0-1M Eluuaate Dialysis (12 hours), buffer 1 Retained Anion exchange column-DEAE; ClNa 0-1M Fractions with CINa or, 15 - ?, 35M Incubation with starch * (12 h) 40,000 x g; 60 minutes Sediment (in buffer 2) Supernatant isi iss (3 x 6 h) with buffer 3 Incubation with starch * (12 h); 40. 000 x g; 60 minutes Sediment (in buffer 3) Incubation with maltose (250 M, 12 h) 40,000 x g; 60 minutes Supernatant I Dialysis (3 x 6 h) with purified 4 AT buffer The balance of the purification is extracted from table 2.

Table 2: Purification of acarviosyltransferase, balance (for the designation of samples, see purification scheme, table 1) The purification of the TA yields an enrichment of 17.8 times with a yield of 24%. II. Determination of the activity of acarviosyltransferase 1. Radioactivity assay a) They were incubated at 302C, acarbose or acarbose homologs with [14C] maltose in a Tris-aleate buffer (pH 6.3) in the presence of preparations containing acarviosil - transferase. The acarbose was then separated from the maltose by a cation exchange resin. The level of the radioactivity of [14 C] in the acarbose fraction in relation to the total radioactivity gives the exchange rate, which correlates with the AT activity. acarviosil- (a-1, 4) -sugar + [l4C] maltose? acarviosil- (a-1, 4) - [l4C] maltose + sugar b) [I4C] acarbose (labeled in the maltose unit) was incubated with malto-oligosaccharides or other sugars in the presence of AT, as in a). The mixture was treated and evaluated as indicated in a). acarviosil- (a-1, 4) - [14C] maltose + sugar? acarviosil- sugar + [14C] maltose 2. Thin layer chromatography Acarbose or acarbose homologues were incubated with maltose, malto-oligosaccharides or other sugars, as indicated in a). The reaction mixture contained: 10 μl of AT preparation (AT in 0.1 mM Tris / CIH, pH 7.2 + 0.01 mM Cl2Ca, 4.5 ncat / ml). 10 μl of acarbose (70 mM original solution) or acarbose homologue (about 30 mM). 10 μl substrate (70 M original solution) or maltose (600 M) Sample preparation 30 μl reaction mixture Addition of 70 μl of ethanol 5 min. centrifugation at 7,000 g Extraction of 80 μl of supernatant - 5 μl for CCF 75 μl concentrator under vacuum Sample for HPLC CCF: Silica gel 60 DC-Alu-Folien (Merck), eluent: butanol: ethanol: water (50: 30:20); staining: Cer spray reagent; revealed at 1102C. 3. HPLC assay Acarbose or acarbose homologues were incubated with maltose, malto-oligosaccharides or other sugars, as indicated in 2. After the precipitation of the proteins the chemical composition of the residual solution was analyzed by HPLC-ECD or Well HPLC-UV. III. Properties of acarviosil-transferase Molecular weight 76 kDa (DSS-PAGE) Optimum pH 6.2 - 6.9 Optimum temperature 302C (20 - 402C) Temperature resistance up to about 40 C Dependence on trace elements: Ca2 + Due to specificity of acceptor related below, the following general formula can be deduced for the acceptor molecule R1 H, CH2OH, CH3 R2 H, (CH2) mCH3, m = 0-10 pyranose [a (l-> 2), (l-> 3), (l-> 4), (l- > 6), ß (l-> 2), (l-> 3), (l-> 4)] furanoses [a (l-> 6) glycite, phenyl, nitrophenyl, and so on. R3 O, S, CHOH Acceptor specificity: Cellobiose Deoxy-D-glucose D-gluconolactone D-glucose Isomaltose Isomaltotriose Laminaribiose (3-0-β-D-glucopyranosyl-D-glucose) Maltose Maltotriose Maltothetrosa Maltopentosa Maltohexosa Maltoheptosa Meti1-D- Glucopyranoside Palatinose Panose (6-a-glucosyl-maltose) Soforose (2-0-β-D-glucopyranosyl-aD-glucose) Xylobiose L-xylose D-xylose Nigerose L (-) -glucose 5-thio-D-glucose myo-inositol Maltitol Amigdaline Amylopectin Dextrin aD (+) - maltose-1-phosphate 4-nitropheni1-QE-D-glucopyranoside 4-nitrophenyl-ß-D -xylopyranósido D (-) -salicina Fenil-aD-glucopyranoside Octil-D-glucopyranoside Noni1-ß-D-glucopyranoside Oc il-ß-D-maltopyranoside Deci1-ß-D-maltopyranoside Donor specificity: Acarbose Component derived from acarbose 2 Component derived from acarbose 4A Component derived from acarbose 4B Component derived from acarbose 4C Component derived from acarbose B Pseudoacarbose IV. Protein sequencing Analysis of the N-terminal sequence of acarviosyltransferase fragments was carried out with the 473A gas-liquid-solid phase protein sequencer from Applied Biosystems (Foster City), CAUSE) . For this, the standard sequencing program was used.

The apparatus, the programs used as well as the PTH separator system are detailed in the corresponding User Manual (User's manual protein sequencing system model 473A (1989), Applied Biosystems, Foster City, CA 94404, USES) . The amino acid separation of PTH was carried out in-line, with a RP-18 column (220 mm x 2 mm, 5 μ material) from Applied Biosystems. The identification and quantitative determination of the PTH amino acids was carried out with the aid of a 50 pM standard of all the PTH amino acids. The Data System 610A sequencer from Applied Biosystems was used to evaluate the data. The chemicals used in the protein sequencer were purchased from Applied Biosystems.

For the separation of tryptic peptides, the S-art system of the Pharmacia firm (D-Freiburg) was used. The HPLC column (2.1 mm x 100 mm; 5 μm material) for the separation of tryptic peptides was purchased from Pharmacia (D-Freiburg), trypsin (sequence grade) at Boehringer Mannheim, the rest of the products Chemicals in Merck (D-Darmstadt) or Sigma (D-Deisenhofen). V. Isolation and sequencing of the acbD gene (AcbD protein = AT). All genetic engineering methods were carried out, unless otherwise indicated as in Sambrook et al. (Molecular Cloning; A laboratory manual ("Molecular Cloning; A Laboratory Manual"), 2nd Edition, 1989, Cold Spring Harbor Laboratory Press, N.Y., USA). The gene probe used for the selective search was isolated from the pAS2 plasmid (DE 195 07 214). The pAS2 plasmid was prepared from E. coli DH5a with the aid of the boiling method or by alkaline lysate and hydrolyzed with the restriction endonuclease BamHI. The resulting 2.2 kb BamHI fragment was isolated and radioactively labeled by "nick translation" with 32 P-labeled deoxynucleotides. This labeled fragment was used as a gene probe for the isolation of the acarbose biosynthesis genes (DE 195 07 214) and is hereinafter referred to as an acb-II probe. The acarbose biosynthesis genes were isolated as follows: Chromosomal DNA of Actinoplanetes SE 50/110 species was hydrolysed with the restriction enzyme SstI, separated by gel chromatography and by "Southern" hybridization was investigated with the ac probing probe. II the presence of a DNA homologous sequence. The SstI fragment hybridized with the gene probe had a size of 11 kb. The 11 kb SstI fragment was eluted from it, ligated into the pUC18 vector and cloned into E. coli DH5a1. The resulting plasmid was designated pAS5. Plasmid pAS5 was hydrolyzed with the restriction enzymes PstI and HindIII. The fragments originated with this had the following size: 1.4 kb: 5.4 kb PstI fragment: 0.05 kb PstI fragment: 2.6 kb PstI / HindIII fragment: 3.8 kb HindIII / PstI fragment: PstI fragment ( 1.1 kb Pstl / Sstl fragment ligated with vector pUC18). The 2.6 kb HindIII / PstI fragment was eluted from the gel, ligated into the pUCld vector and cloned into E. coli DH5a. The resulting plasmid (pAS5 / 15.1) was subjected to hydrolysis with different restriction endonucleases and the originated DNA fragments were subcloned into pUC18 in E. coli DH5a and sequenced. To examine the DNA sequence of the fragments originated from pAS5 / l5.1 DNA fragments of chromosomal DNA of Actinoplanetes species were additionally amplified by the PCR method, ligated into pUC18, cloned into E. coli DH5a and , then, they were sequenced. The DNA sequences of the PCR primer were derived from DNA sequences of the subcloned pAS5 / 15.1 fragments (see below). For the determination of the DNA sequence of the HindIII / PstI fragment of 2.6 kb of Actinoplanetes species, the following plasmids were constructed and the sequence of the DNA respectively inserted was determined: pAS5 / 15.1 = 2.6 kb: HindIII / PstI fragment of pAS5 pAS5 / 15.2 = 0, 75 kb fragment I left pAS5 / 15.1 pAS5 / 15.3 = 0.5 kb fragment I left pAS5 / 15.1 pAS5 / 15.4 = 0.4 kb fragment I left pAS5 / 15.1 pAS5 / 15.5 = 0.35 kb fragment I left pAS5 / 15.1 pAS5 / 15.6 = 1.25 kb PvuII fragment from pAS5 / 15.1 pAS5 / 15.7 = 0.7 kb PvuII / HindlII fragment from pAS5 / 15.1 pAS5 / 15.9 = 0.1 kb PvuII fragment from pAS5 / 15.1 pAS5 / 15.12 = 0 , 9 kb Kpnl / Ncol fragment from pAS5 / 15.1 pAS5 / 18 = 0.3 kb: PCR fragment (Initiator: see tab.3) pAS5 / 19 = 0.3 kb: PCR fragment (Initiator: see tab.3) For the sequencing of DNA, the method of Sanger et al. (1977) or a procedure derived from it. It was operated with the Autoread Sequencing Kit (automatic reading sequencing equipment) (Pharmacia, D-Freiburg) in conjunction with the automated laser fluorescence DNA (ALF) sequencing apparatus (Pharmacia, D-Freiburg). The appropriate sequencer and sequencer primer from pUC labeled with fluorescein were purchased commercially (Pharmacia, D-Freiburg). Table 3 Sequences of the primers for the PCR and the sequencing reaction. Primers for PCR: Plasmid pAS5 / 18: Designation of the primer Sequence acbD3 5ACCAGGCCGAGGACGGCGCCC 3 'acbD4 5'AGCGGCATGTGCTTGACGGCG 3% Plasmid pAS5 / 19: Primer designation acbDS sequence 5ACCGGCTCGAACGGGCTGGCACC 3 * acbD6 5XCCTCGACGGTGACGGTGGCG 3' Primer for the sequencing reaction: Primer designation Sequence Universal primer: 5GTAAAACGACGGCCAGT 3 'Reverse primer: 5'GAAACAGCTATGACCATG 3' Examples 1. Preparation, purification and characterization of acarviosyltransferase The wild strain of the species Actinoplanetes 50/110 a mutant derived from it, after a pre-culture in soy flour-glycerin medium, it was fermented in production culture on half soy flour-starch at 30 c on rotary shaker, with a stirring frequency of 260 rpm. After an incubation time of about 120 hours, the cell mass was separated. The enzyme was precipitated from the culture supernatant with ammonium sulfate (20-40% saturation). After centrifugation, the pellet was dissolved in buffer (25 mM Tris / CIH, pH 8.5, containing glycerin and Cl 2 Ca) and centrifuged again. The resulting supernatant was applied on an anionic exchange column of DEAE. The eluate contained acarviosyltransferase. From this solution, the TA could be obtained by dialysis in the form of a partially enriched preparation or purified by chromatography on DEAE-Fractogel®, double precipitation with starch and desorption with acarbose or maltose (see table 1). A yield of 24% corresponded to an enrichment factor of 17.8. The activity of acarviosyltransferase was measured by transferring the acarviosyl residue of acarbose (donor) onto maltose (acceptor). The size of the enzyme was determined with DSS-PAGE at 76,000 Da, with an optimum pH in the range of pH 6.2-6.9 and an optimum temperature between 20-402C. 2. Sequencing of acarviosyl transferase For the determination of the internal amino acid sequence, acarviosyltransferase was digested with trypsin. Trypsin cleaves proteins behind amino acids lysine and arginine. Tryptic dissociation of AT: About 1 mg of AT was dissolved in 1,000 μl of 6M guanidinium chloride / 0.5 M Tris- (hydroxymethyl) -aminomethane, pH 8.6. After addition of 30 μl of dithiothreite (DDT) Í M the sample was subjected to reduction at 54 ° C overnight. After the addition of 60 μl of 2M sodium iodoacetate solution, the sample was incubated in the dark for 30 minutes. This was followed by dialysis against 0.5 M urea / 0.1 M ammonium bicarbonate (complete buffer exchange after 3 hours and overnight, dialysis casing with 25 kD exclusion). The sample thus pretreated was digested at 372C for 18 hours with addition of 20 μg of trypsin (degree for sequence). The sample was concentrated to about 100 μl by drying in the centrifuge. HPLC separation of tryptic peptides: One third of the sample was applied to a RP-18 column (2.1 mm x 100 mm, 5 μ material) and separated using a Smart system (0.1% solution A) of ATF, solution B 0.1% ATF / 60% ACN, detection 215 nm, flow 0.15 ml / min, room temperature, gradient: 7 min 0% B, 52 minutes 70%, 54 minutes 100 % B). Due to the high molecular weight of the AT, a very complex mixture results in the digestion with trypsin. Therefore, rechromatography of individual fractions is a prerequisite for obtaining purer peptides for subsequent sequencing. Recromatography of separated fractions: The fractions containing the peptides were combined and concentrated by drying in the centrifuge. The concentrates were rechromatographed on a RP-18 column (2.1 mm x 100 mm; 5μ material) (solution A AcNH40.025 M, solution B AcNH4 0.025 M / 60% ACN, pH 6, detection 215 nm, flow 0y15 ml / min., room temperature; gradient: 0 minutes 0% B, 33 minutes 60%, 38 minutes 100% B). After the rechromatography of fractions 28 + 29 (Smar 4003) or fraction 30 (Smar 4002) of the first separation, using different chromatography conditions, the purity of the peptides obtained was sufficient for the sequencing of the N-terminal succession. Sequencing of the N-terminal sequence: Evaporated by drying in the centrifuge fraction 32, for example, from the chromatography (Smar 4002). The peptide was dissolved in ATF and, for sequencing, was carried on glass fiber filters that had been previously treated with BioBrene®. The peptide was sequenced using the "fast normal" sequencing cycle. The PTH amino acids were identified and determined quantitatively with the help of the 50 pmol PTH standard. The result of the analysis of the N-terminal sequence is represented in table 4. From eight triptyptic peptides of the AT a total of 133 amino acids were analyzed. Table 4: N-terminal sequences of tryptic peptides of acarviosyl transferase 1.1 Rechromatography of fraction 28 + 29 (Smar 4003) 1.2 Fraction 35 of rechromatography 1 Asn-Leu-Gly-Val-GIy-Ala-De-Trp-IIe-Ser-Pro-His-Val-Asp-Asn-Ile-A-sn-Vd-Pro- 22 23 Ala-Ala-GIy- ( Gly) ... 2. 1 Rechromatography of fraction 30 (Smar 4002) 2.2 Fraction 32 of rechromatography 1 Tbr-GIy-Lys-Pro-Val.Pro-Val-Gln-Phe.Thr-Val-GIn-Asn-Pro-Pro-A] a- "p? R-Ala-Pro- 21 Gly-Glu .. . 2. 3 Rechromatography of fraction 25 (Smar 4004) 2.3.1 Fraction 31 of rechromatography 1 18 Ser-Thr-Val-Ala-Pro-Val-Leu-Gly-AIa-Gly-Gln-Va] -Ala-Val-Trp.Ser-Tyr-Arg 2. 3.2 Fraction 25 + 26 of the chromatography 1 Tyr-Gln-Asp-Gln-Tyr-Tyr-Ser-Leu-Ala-Asp-De-Ala-A-sp-Leu-A-sp-Gin-Gln-Asn- 20 Pro- (Arg) 2. 4 Rechromatography of fraction 21 (Smar 4005) 2.4.1 Fraction 23 of rechromatography 1 12 Trp-Of-Asn-Asp-Asp-Val-Tyr-Val-Tyr-Glu-Arg-Leu ... 2. 5 Rechromatography of fractions 31 + 32 (Smar 4001) 2.5.1 Fraction 30 of the chromatography 1 .18 Asp-Tyr-Leu-Tyr-Glu-Gln-Asp-eu-De-Thr-Phe-Leu-Asp-Asn-Gln-Asp-Thr-Arg 2. 6 Rechromatography of fractions 16 + 17 (Smar 4007) 2. 6.1 Fraction 17 of the rechromatography 1 •••• 9 A-sp-Asp-Ala-Asn-Tyr-Trp-Met-Asp-Arg 2. 7 Rechromatography of fraction 20 (Smar 4007) 2.7.1 Fraction 11 of rechromatography 1 12 AJa-Val-Leu-Thr-Gly-Asn-Thr-Val-Tyr-Asp-Trp-Lys 3. Transformation of acarbose homologs in acarbose In the investigations on the donor specificity of the TA, acarbose homologue-like preparations were mixed into acarbose-derived components 2, 4A, 4B, 4C, B components and pseudocarbose. with maltose, in the presence of acarviosil-transferase. After a reaction time of 24 hours at 30 ° C, the preparations were analyzed by HPLC on amino phase with UV detection. The evaluation (table 5) shows that the content of derivative components decreases, while the acarbose content increases, that is, a transfer of the acarviosyl unit from the acarbose 2, 4A, 4B and 4C derived components to maltose takes place. Table 5: Transformation of the acarbose 2, 4A, 4B and 4C derivatives in acarbose by AT With component B and pseudoacarbose traces of a transformation are found. 4. Obtaining superior acarbose homologues from acarbose In investigations on acceptor specificity of AT, acarbose was transformed by acarviosyl transferase into test preparations in the presence of sufficiently high concentrations of malto-oligosaccharides among other sugars. After a reaction time of 18 hours at 30 ° C, the preparations were analyzed by HPLC on amino phase with UV detection. The evaluation (table 6) shows that newly synthesized saccharides are identified, at the same time releasing maltose. abla_6 Transfer of the acarviosyl residue of acarbose to various sugars as acceptors (Fl surface percentage, TR = retention time) In the determination of the activity of the AT in the radioactivity test, an exchange with dextrin was observed: Olisosaccharide Relative activity (%) Maltose 100 Maltotriose 27 Maltothetrosa 40 Maltoheptose 49 Cellobiose 15 Dextrin 45 5. Procedure for the purification by AT of modified acarbose: The reaction catalyzed by TA can also allow, in principle, the enrichment in acarbose of culture solutions with simultaneous transformation of acarbose homologues in acarbose, according to the following principle: 1) Transformation of acarbose or acarbose homologues [acarviosyl- (G) n] with high molecular weight dextrins or starch [(G) m] in the presence of acarviosyltransferase acarviosyl- (G) n + (G) m - acarviosyl- (G) m + (G) n and separation of accompanying low molecular weight substances by dialysis or precipitation of the polysaccharide; then 2) Transformation with maltose, with release of acarbose acarviosyl- (G) m + maltose-acarbose + (G) m The same effect can also be achieved by means of a reactor (for example column) with starch and immobilized AT: Filtration of the crude acarbose solution through a starch column / AT Washing for the separation of accompanying substances - Elution of acarbose with maltose In the reaction scheme above, G represents glucose and m and n, respectively, an integer between 1 and 20, where m and n are different. 6. Culture of E. coli strains, preparation of the plasmid DMA and isolation of DMA fragments E. coli DH5a was incubated in LB medium at 372C. The plasmid-carrying bacteria were kept under selective pressure (ampicillin, 100 μg / ml). The cultivation was carried out on a rotary shaker table at 270 rpm. As an overnight culture (CN), preparations were designated that were incubated for at least 16 hours. For the preparation of the plasmid DNA, 1.5 ml cells of a CN incubated under selective pressure were used. The isolation of the plasmids was carried out according to the method of the alkaline used with DSS (Birnboi and Doly, 1979).

For the selective hydrolysis of the vector DNA, restriction endonucleases were exclusively used according to the manufacturer's prescription (Gibco BRL, Eggenstein, Deutschland). For the restriction of 10 μg of plasmid DNA, 5U of the respective restriction endonucleases were used and incubated at 37 ° C for 2 hours. To ensure complete hydrolysis, the same amount of restriction endonuclease was added a second time and incubated again for at least 1 hour. The dissociated DNA was separated by size from the DNA fragments electrophoretically, on horizontal agarose gels at 0.5 -1.2%. For the elution the piece of gel containing the DNA fragment was cut with a sterile scalpel and weighed. The elution of the agarose DNA fragments was carried out with the JETsorb equipment following the manufacturer's recipe (Genomed, Bad Oeynhausen, Deutschland). 7. Cultivation of the Actinoplanetes SE 50/110 species, preparation, chromosomal DNA dissociation and gel electrophoretic separation. Actinoplanetes 50/110 was incubated for 3 days in a rotary shaker at 302C in TSB medium. The preculture (5 ml) was carried out at 240 rpm in culture tubes, the main culture (50 ml) in 500 ml stoppered flasks, at 100 rpm. After cultivation the cells were pelleted by centrifugation, and washed twice with TE buffer. The preparation of all the DNA was carried out with 1.5-2 mg of cells (fresh weight) according to the phenol / chloroform extraction method (Hopwood et al., 1985). The hydrolysis of 20 μg of chromosomal DNA was carried out with 10 U of the corresponding restriction enzymes (Gibco BRL, Eggenstein, Deutschland) and incubated at 372C for 2 hours in the respective buffer. To ensure complete hydrolysis, the same amount of restriction endonuclease was added a second time and incubated again for at least 1 hour. The dissociated DNA was electrophoretically separated on horizontal 0.6% agarose gels. The elution of the DNA fragments was carried out again with the JETsorb unit (see example 6). 8. Obtaining the acb-II gene probe The fragment of pAS2 prepared according to example 6 was radioactively labeled with the nick translation system of the manufacturer Gibco BRL, Eggenstein, Deutschland, following its indications. For this, DNA fragments of 0.5-1.0 μg were used. [A32P] dCTP was used (3,000 Ci / mM; Amersham, Braunsch eig, Deutschland). The preparation was then boiled for 10 minutes (denaturation) and added immediately to the hybridization solution (see example 9). 9. Transfer of DNA onto membranes, DNA hybridization (Southern hybridization) and autoradiography The transfer of DNA fragments from agarose gels onto membranes was carried out according to the Southern-Transfer method (Southern, 1975). The agarose gels obtained according to example 7 were stirred for 20 minutes in 0.25M C1H. The gels were placed on three layers of Whatman 3MM paper (Whatman, Maidstone, England) and a Hybond ™ membrane -N + Membran (Amersham, Braunschweig, Deutschland) was superimposed, excluding air bubbles. On this several layers of absorbent paper were placed. A weight of approximately 1 kg was placed on the filter stack. The DNA transfer was effected by absorption of 0.4M NaOH. After a transfer time of at least 12 hours, the nylon filters were rinsed for 5 minutes with 2x SSC and air dried. The nylon filters were then stirred in 50-100 ml of prehybridization solution in a water bath at 682C for at least 2 hours. For this the solution was changed 2 times, at least. Hybridization took place in a hybridization cabinet for at least 12 hours. 15 ml of hybridization solution containing the acb-II probe was used (see example 8). The nylon filters were then washed for 15 minutes respectively with 6x Post ash and with lx Postwash. Nylon filters, still in a moist state, were then covered with leaves for fresh conservation. The autoradiography was performed with Hyperfilm-MP (Amersham, Braunschweig, Deutschland) in a light-opaque case with reinforcing films at -802c for at least 16 hours. 10. Isolation and cloning of Sstl fragments of the complete DNA of Actinoplanetes SE 50/110. Chromosomal DNA of Actinoplanetes species was completely hydrolyzed with Sstl, separated by agarose gel electrophoresis and DNA fragments of length 9.0-12 kb were eluted from the agarose (see Example 6). The pUC18 plasmid vector of E. coli DH5a was prepared, hydrolyzed with Sstl and treated with alkaline phosphatase (Boehringer, Mannheim, Deutschland) according to the manufacturer's recipe. The ligation took place in a volume of 20 μl, whereby the ratio of fragments to vector amounted to 3: 1 with 0.01-0.1 μg of DNA in the mixture. 1U of the T4-DNA ligase was used with the corresponding buffer (Gibco BRL, Eggenstein, Deutschland). The E. coli DH5a cells competent for transformation were transformed with complete ligation preparations (according to Hanahan 1983). The ampicillin-resistant transformants were transferred onto LB-Amp selection plates (100 μg / ml ampicillin). 11. Identification of plasmids containing the 11 kb Sstl fragment from the acarbose biosynthesis cluster In the ampicillin resistant transformants the presence of the 11 kb Sstl fragment was investigated, which hybridizes with the acb-II probe. Ten of these clones were seeded on striae, respectively, on a selection plate, incubated overnight and eluted from the plate with 3 ml of LB medium. The plasmid DNA was then isolated from 20 of these tens (according to Birnboim and Doly, 1979). To separate the cloned fragments of Sstl from the polylinker (multiple engarze) the 20 different plasmid preparations were hydrolysed with the endonucleases. of restriction EcoRI and HindIII. The restriction mixtures were then separated by electrophoresis on a 0.6% agarose gel and the DNA was transferred from the agarose gel to a nylon filter by Southern blotting (see Example 9). Hybridization was carried out again with the acb-II probe (see example 9). One of the groups reacted positively with the acb-II probe and separated into the ten individual clones. Their plasmids were also isolated and subjected to the method described above. The plasmid that hybrid was designated as pAS5. It contains a 10.65 kb Sstl fragment. 12. Cloning of the 2.6 kb HindIII / PstI fragment In order to identify other reading frames several HindIII / PstI subclones were obtained from the pAS5 plasmid. For this the plasmid pAS5 was hydrolyzed with the restriction endonucleases HindIII and PstI.

The following fragments originated: 1.4 kb: 5.4 kb PstI fragment: 0.05 kb PstI fragment: 2.6 kb PstI / HindIII fragment: 3.8 kb HindIII / PstI fragment: PstI fragment (Pstl / Sstl fragment) 1.1 kb ligated with the vector pUC18). the originated DNA fragments were separated by agarose gel electrophoresis and eluted from the gel (see example 6). The plasmid vector pUC18 of E. coli DH5a was prepared, hydrolyzed with HindIII and PstI and treated with alkaline phosphatase (Boehringer, Mannheim, Deutschland) according to the manufacturer's recipe. The 2.6 kb HindIII / PstI fragment was cloned. The ligation and transformation were carried out as described in example 10. The plasmid with the HindIII / PstI fragment of 2.6 kb was designated pAS5 / 15.1. 13. Amplification and cloning of two 0.3 kb DNA fragments of chromosomal DNA of Actinoplanetes species To sequence the DNA region overlapping between the DNA slices cloned in plasmids pAS5 / 15.5 and pAS5 / 15.6, two primers were synthesized (acbD3 and acbD4) from the known DNA sequences of these plasmids (see example 14). With the help of these primers, a DNA fragment of 0.3 kb of somatic DNa crom of Actinoplanetes species was amplified. The denaturation temperature amounted to 95 C (1 minute). The annealing temperature was 68 c (20 seconds) and the primer extension was carried out at 72 C (20 seconds). 25 cycles of amplification were carried out. Taq polymerase was used according to the manufacturer's instructions (Gibco BRL, Eggenstein, Deutschland). The PCR mixture contained 5% formamide. For the PCR reaction, Personal-Cycler from BIOMETRA (Góttingen, Deutschland) was used. The PCR mixture was precipitated in ethanol, then ligated into pUC18 (hydrolyzed with HindIII) and cloned into E. coli DH5a. To sequence the region of DNA that overlapped between plasmids pAS5 / 15.4 and pAS5 / 15.2, another DNA fragment of 0.3 kb was amplified and cloned with primers acbD5 and acbD6 with the same assay mixture. pAS5 / 15.18, pAS5 / 15.19. The PCR fragment that was amplified with the primers acbD3 and acbD4 provided, after cloning, subclone pAS5 / 15.18. The PCR fragment that was amplified with primers acbD5 and acbD6 provided, after cloning, subclone pAS5 / 15.19. 14. Subcloning fragments of plasmid pAS5 Several fragments were subcloned from plasmid pAS5 to elucidate the sequence of double-stranded DNA (illustration 1). pAS5 / 15.l: Plasmid pAS5 was hydrolyzed with the restriction enzymes HindIII and PStI. Of the five originated fragments (see example 12) the 2.6 kb HindIII / PstI fragment was cloned. For this, the restriction mixture was separated on a 0.7% agarose gel, the 2.6 kb HindIII / PstI fragment was eluted from the gel (see example 6), ligated into pUC18 (hydrolyzed with HindIII / PstI). ) and cloned in E. coli DH5a. PAS5 / 15.2; pAS5 / 15.3; pAS5 / 15.4; pAS5 / 15.5: Plasmid pAS5 / 15.1 was hydrolysed with the restriction enzyme SalI. The 6 fragments originated with this were separated on a 1% agarose gel. The fragments had the following sizes: 0.75 kb, 0.5 kb, 0.4 kb, 0.35 kb, 0.05 kb and 3.2 kb (0.5 kb fragment ligated with pUC18). The fragments intended for subcloning were eluted from the gel (see Example 6). For cloning, the pUC18 vector was prepared by the restriction enzyme SalI, as described in example 6. The ligations were carried out as described in example 10. The 0.75 kb fragment was ligated into the prepared pUC18. and originated the plasmid pAS5 / 15.2. The plasmid pAS5 / 15.3 originated after ligation of the 0.5 kb fragment with the pUC18 prepared. The pAS5 / l5.4 plasmid contained the 0.4 kb fragment and the 0.35 kb fragment is a component part of the pAS5 / 15.5 plasmid. pAS5 / 15.6; pAS5 / 15.7; pAS5 / 15.9: Plasmid pAS5 / 15.1 was hydrolysed with the restriction enzyme PvuII. The 5 fragments originated with this were separated on a 1.2% agarose gel. The fragments had the following sizes: 1.25 kb: 0.15 kb PvuII fragment: 0.8 kb PvuII fragment: PvuII fragment (0.7 kb PvuII / HindlII fragment ligated with a HindIII / PvulI fragment of pUC18 of 0, 1 kb) 0.66 kb: PvuII fragment (PvuII fragment / Pstl 0.5 kb ligated with a Pstl / PvuII fragment of pUC18 0.16 kb) 2.4 kb: PvuII fragment (the rest of the vector pUC18) 1.25 kb fragment was ligated into pUC18 (hydrolyzed with HincII) and cloned into E. coli DH5a and plasmid pAS5 / 15.6 originated. Plasmid pAS5 / 15.7 originated after cloning of the 0.8 kb fragment in the plasmid vector pUCl8 hydrolyzed with HincII. Plasmid pAS5 / 15.9 contained the 0.15 kb fragment. pAS5 / 15.12: The plasmid pAS5 / 15.1 was hydrolyzed with the restriction endonucleases Ncol and Kpnl. The 0.9 kb Ncol / Kpnl fragment originated therewith was eluted on a 1.2% agarose gel (see Example 6) and ligated into the vector pUCBM21 (hydrolysed with Ncol / Kpnl) and cloned into E. DH5a coli; the plasmid pAS5 / 15.12 originated.

. DNA sequencing of the 2.6 kb HindIII / PstI fragment of Actinoplanetes species The plasmids described in Examples 13 and 14 were sequenced. In the sequencing reaction, 6-8 μg of plasmid DNA from a preparation was used (see example 6) . The sequencing reaction was carried out with the Auto-Read-Sequenzing-Kit ("automatic reading sequencing kit") (Pharmacia, Freiburg, Deutschland). For this, the standard protocol for double-stranded DNA sequencing was applied. To make possible the evaluation of the nucleotide sequence with the A.L.F. Universal and inverse sequencing primers labeled with fluorescein were used as primer molecules for the sequencing reaction (see Table 3). To obtain the gel, 8 ml of Hydro Link Long Ranger (Serva, Heidelberg, Deutschland), 33.6 g of urea, 8 ml of lOx TBE buffer, mixed with H20 to 80 ml were mixed, sterilized by filtration and degassed. for 1 minute. Polymerization was initiated by the addition of 350 μl of 10% ammonium persulphate (w / v) and 40 μl of N, N, N ', N'-tetramethylethylenediamine. The solution was poured into a gel mold (50 x 50 x 0.05 cm). The electrophoresis was carried out at 38 W and at a constant temperature of 452C. Eluent buffer served as Ix TBE buffer. The processing of the fluorescence measured to a DNA sequence was carried out by means of a coupled computer (Compaq 386 / 20e) which also served for the control of the electrophoretic unit (program A.L. F.Manager 2.5, Pharmacia). 16. Overexpression of acarviosyltransferase in S. lividans The acarviosyltransferase (acbD) gene of Actinoplanetes species was expressed in Streptomyces lividans TK21 in shuttle vector pUWL201 (U. Wehier, unpublished, illustration 2) . The plasmid (6.4 kb) is composed of the vector pUWL199 (Wehmeier, 1995) in which the 2.0 kb Kpnl / Xbal fragment was replaced by a Kpnl / Xbal fragment composed of the ermE'p promoter (Bipp et al., 1994) and the HincII / Clal part of pBLUESCRIPT multiengarze (Stratagene). For the cloning of the acbD gene in E. coli DH5a and Streptomyces lividans TK21, the plasmid pAS5 / 15.1 (see example 12) was hydrolyzed with the restriction endonucleases HindIII and PstI. The 2.6 kb HindIII / PstI fragment with this originated was ligated into vector pUWL201 (hydrolyzed with HindIII and PstI) and cloned into E. coli DH5. The resulting plasmid received the designation pAS9. Plasmid pAS9 was prepared by alkaline lysate of E. coli DH5a and cloned in S. lividans TK21 with the protoplast transformation method (Hopwood et al., 1985). The acbD gene remains in this clone under the control of the constitutive promoter ermE'p (M. Bibb, Norwich, England, personal communication). After cultivation of S. lividans TK21 / pAS9 in TSB medium (25 μg / ml Thiostrepton), a significant band of an additional 75 kDa protein could be identified in the supernatant on a DSS-polyacrylamide gel (Lugtenberg et al., 1975). 17. Inactivation of acarviosyltransferase by altering the gene The acarviosyltransferase (acbD) gene of Actinoplanetes species is inactivated by the gene alteration method. To this end, the acbD chromosomal gene was partially replaced in Actinoplanetes species by an antibiotic resistance gene. Antibiotic resistance genes were introduced by homologous recombination. In previous trials it could be shown that Actinoplanetes are sensitive to the antibiotics erythromycin, streptomycin, apramycin, neomycin and kanamycin. That is why the antibiotic resistance genes er E, aphDl, aaC4 and aph were used for mutagenesis. In a first example, the erythromycin resistance gene (ermE) of the pUGTl vector (Ingha et al., 1995) was used for the inactivation of acbD. For this, the resistance gene was separated on an agarose gel on a 1.5 kb Kpnl fragment after hydrolysis of pUGTl with Kpnl and isolated from the gel. Plasmid pAS5 / 15.1 (see Example 12) was linearized with the restriction endonuclease Ncol. The Ncol recognition sequence is on the cloned chromosomal fragment of 2.6 kb, at 1050 bp. The hydrolyzed ends of the plasmid pAS5 / 15.1 and the fragment prepared Kpnl of 1.5 kb were transformed with the Klenow fragment of the DNA polymerase I according to manufacturer's instructions (Gibco BRL, Eggenstein, Deutschland) in flat double-stranded DNA. The erythromycin resistance gene, which is on the 1.5 kb Kpnl fragment, in the acbD gene on plasmid pAS5 / 15.1 in E. coli DH5a was cloned by the subsequent ligation. This plasmid was linearized and introduced by usual methods (transformation of protoplasts). The recombinant plasmid can also be transferred by conjugation with E. coli S17-1 and Actinoplanetes species. An additional possibility for the transfer of the plasmid is the electroporation method. By homologous recombination the chromosomal acbD gene was exchanged with the altered acbD gene with the erythromycin resistance gene of the constructed plasmid. By means of double cross-linking, an acbD mutant of Actinoplanetes SE 50/110 resistant to erythromycin was originated. For the recombination of alternative resistance genes in Actinoplanetes species the following methods can also be applied: (1) electroporation, (2) transformation of protoplasts (Hopwood et al., 1985), (3) transformation of mycelium (Madon and Hutter, 1991 ) and (4) conjugation (Mazodier et al., 1989).

Buffers and solutions: Media for bacterial culture Medium LB: Trypton 10 g Cinch 10 g Yeast extract 5 g H20 up to 1,000 ml A pH value of 7.5 was adjusted with 4M NaOH. TSB medium: Tryptone-soybean broth (Oxoid) 30 g H20 to 1,000 ml TE buffer (pH 8.0) 10 mM Tris-CIH Na2-1 mM EDTA Standard preparation of plasmid DNA (modified according to Birnboim and Doly, 1979) Mixture I 50 mM Glucose 50 mM Tris-CIH (pH 8.0) 10 mM AEDT (pH 8.0) Lysozyme 5 mg / ml Mixture II NaOH 200 mM 1% (w / v) of DSS (sodium dodecyl sulfate) Mixture III Potassium acetate 3M Formate 1.8M DNA-DNA hybridization 20X SSC: 3M CIN 3M sodium citrate Prehybridization solution: 6x SSC: Phosphate buffer sodium 0.01M, pH 6.8 AEDT 1 mM DSS 0.5% Skimmed milk 0.1% Hybridization solution: To 15 ml of prehybridization solution the acb probe is added after the labeling reaction. 6x Postwash 6x SSC 0.5% DSS DNA Sequencing TBE Buffer (pH 8.0) Tris-base ÍM Boric acid 0.83M 10 mM AEDT Bibliography 1) Bibb, M.J. et al. (1994) The mRNA for the 23S rRNA methylase encoded by the ermE gene of Saccharopolyspora erythraea is translated in the absence of a conventional ribosome binding site ("The mRNA for the 23S rRNA methylase encoded by the ermE gene of Saccharopolyspora erythraea is translated in the absence of a conventional chromosome binding site "). Mol. Microbiol. 14, 533-545. 2) Birnboim H.C., J. Doly (1979) A rapid alkaline extraction procedure for screening recombinant plasmid DNA ("A rapid alkaline extraction procedure for the selective screening of recombinant plasmid DNA"). Nucleic Acids Res. 7, 1513-1523. 3) Hanahan D. (1983) Studies on transfusion of Escherichia coli with plas ids. ("Studies on transformation of Escherichia coli with plasmids"). J. Mol. Biol .: 166, 557-580. 4) Hopwood D.A. et al., (1985) Genetic manipulation of Streptomyces ("genetic manipulation of Streptomyces"). A laboratory manual; The John Innes Foundation, Norwich, England.

) Ingham, C.J. et al. (1995) Rho-independent terminators without 3 • poly-U tails from the early region of actinophage phi C31 ("independent terminators of rho without queues 3 'poly-U of the early region of the actinophagus phi C31"). Nucleic Acids Res. 23, 370-373. ) Lugtenberg, B. et al. (1975) Electrophoretic resolution of the major outer membrane protein of Escherichia coli into four bands ("electrophoretic resolution of the main membrane protein of Escherichia coli in four bands"). FEBS Lett. 58, 254-258. ) Madon, J., R. Hütter (1991) Transformation System for Amycolatopsis (Nocardia) mediterranei; direct transformation of mycelium with plasmid DNA ("transformation system for Amycolatopsis (Nocardia) mediterranei; direct transformation of mycelium with plasmid DNA"). J. Bacteriol. 173, 6325-6331. ) Mazodier, P. et al. (1989) Intergenic conjugation between Escherichia coli and Streptomyces Species ("intergenic conjugation between Escherichia coli and Streptomyces species"). J. Bacteriol. 171, 3583-3585. 9) Sanger F. et al. (1977) DNA sequencing with chain terminating inhibitors. ("DNA sequencing with chain termination inhibitors"). Proc. Natl. Acad. Sci. USA, 74, 5463-5467. 10) Southern E.M. , (1975) Detection of specific sequences among DNA fragments separated by gel electrophoresis. ("Detection of specific sequences between DNA fragments separated by gel electrophoresis"). J. Mol. Biol., 98, 503-521. 11) Wehmeier, U.F. (1995) New functional Escherichia coli-Streptomyces shuttle vectors allowing blue-white screening on Xgal plates ("new functional shuttle vectors Escherichia coli Streptomyces that allow selective blue-white screening on Xgal plates"). Gene 165, 149-150. It is noted that, in relation to this date, the best method known to the applicant to carry out the aforementioned invention is that which is clear from the present description of the invention. Having described the invention as above, property is claimed as contained in the following:

Claims (5)

1. CLAIMS 1. Acarviosil-transferase.
2. 2. Acarviosyl transferase of Actinoplanetes species SE50 or SE50 / 13 or SE50 / 110 and mutants
3. 3. Essentially pure Acarviosyltransferase.
4. 4. Acarviosyl transferase with the amino acid sequence of Figure 3 and its functional derivatives. 5. DNA sequence of illustration 4, which encodes acarviosyltransferase and its functional derivatives. 6. Procedure for the transformation of acarbose-derived components into acarbose acarviosyl- (G) n + maltose? acarbose + (G) n where Gn represents glucose, disaccharides and malto-oligosaccharides, characterized in that the reaction is catalysed by a acarviosi1-transferase. 7. Use of acarviosyl transferase in the transformation of other pseudo-oligosaccharides such as, for example, trestatin or amylostatin or other glucosidase inhibitors in acarbose. 8. Use of acarviosyl transferase for enrichment in acarbose of culture supernatants with simultaneous transformation of acarbose homologs into acarbose by transformation with high molecular weight dextrins or starch, in the presence of acarviosyltransferase acarviosyl- (G) n + ( G) ", - acarviosyl- (G) m + (G)" wherein G represents glucose and m and n mean an integer between 1 and 20, with respectively m and n respectively, and separation of the accompanying low molecular weight substances by dialysis, osmosis inverse or by precipitation of the polysaccharide and subsequent transformation with maltose, with release of acarbose acarviosil- (G) m + maltose? acarbose + (G) m in the presence of sufficiently high concentrations of maltose, by acarviosyltransferase. Gene production of acarviosyltransferase in a heterologous host organism. Vector containing the DNA according to claim
5. 5.