CA2282735A1 - Acarbose (acb) cluster from actinoplanes sp. se 50/110 - Google Patents

Abstract

The invention concerns biosynthesis genes from the acarbose gene cluster from Actinoplanes sp. SE 50/110, their isolation from Actinoplanes sp. or from producers of pseudooligosaccharides, a process for isolating these biosynthesis genes, the proteins coded by said genes, the expression of the proteins in heterologous host strains, and the use of the acarbose biosynthesis genes for optimizing the process.

Description

Le .~ 32 ~ 19-Foreign CountriesiBu/klu/S-P
Acarbose acb cluster Isolation of further acarbose biosynthesis and acarbose metabolism genes from Actino~lanes sp. SE 50/110, and their use.
The present invention relates to the isolation of further acarbose biosynthesis and metabolism genes from actinomycetes, mainly from Actilloplulle.s sp. SE ~0/l10 and its mutants, which genes are found together with the previously known bio-synthesis genes in a common ~~ene cluster, to the use of these genes for preparing;
acarbose and acarbose homologues using .=lctrrloplalle.s sp. and other producers of acarbose-related natural substances (pseudooli~osaccharides), to the use of these genes for optimizing the process with the aid of biochemicallmolecular biolo;;ical en~,gineerin~, methods, and to the heterologous expression of these genes in other microorganisms.
1 ~ The reco~~nition that a number of actinomycetes, in particular the Actinoplanaceae, form oli~Josaccharide-like inhibitors of glycoside hydrolases, especially carbo-hydrate-cleavin~ enzymes of the digestive tract, forms part of the subject-matter of previous patent applications (e.~. DE 20 64 092 and DE ?? 09 S34). The com-pound O-=I,6-dideoxy-4-[[1S-(lS,4R,5S,6S)-4,5,6-trihydroxy-3-(hydroxymethyl)-2-~0 cvclohexen-t-ylJ-aminoJ-a-D-~;lucopyranosyl-(1-~4)-O-a-D-~Jlucopyranosyl-(1~4)-D-'glucopyranose, known as acarbose, is reported to be the most potent inhibitor of this '=roup [DE 23 47 7S2J.
.acarbose is a potent inhibitor of a-y~lucosidase and is employed, under the trade name Glucobay~, as an oral antidiabetic agent for the therapy of diabetes mellitus.
The secondary metabolite acarbose is formed by Actrlloplalle.s sp. SE ~0 (CBS
No.
791.96) and by a natural variant of this strain, SE ~0/I10 (CBS 793.96) [DE 22 S34], as well as by their selectants and mutants. The said Patent Applications describe, for example in Examples 1 to 4 of the said German Patent Application P ?? 09 S3-I, the isolation of an a-glucosidase inhibitor of this type.
30 Llolecular biological methods can be used to isolate particular 'genes directly from an uncharacterized ~enome using ',ene probes, for example 'rP-labelled DNA
fra~;-ments, which bind specifically to the sought-after DNA sequence.
It has furthermore been disclosed that, in actinomycetes, in particular strepto-mycetes, the biosynthesis genes are arranged side by side in a cluster on the Le :-~ :2 319-Forei~,n Countries chromosome, less frequently on a plasmid, in the secondary metabolite producers which have so far been investigated [Hershberger C.L., et al. ( 1989)]. Gene probes can therefore be used to isolate adjacent, previously unknown biosynthesis genes whose importance for the desired biosynthesis can then be elucidated. The gene probes can likewise be used to detect the corresponding biosynthesis genes in other microorganisms.
From the structure of acarbose, it was to be presumed that the deoxy'~lucose moiety of the acarbose molecule is formed in accordance with the biosynthesis of the 6-deoxy sugar residues of various antibiotics (for example amino'~lycosides.
l0 such as streptomycin and kasugamycin; macrolides, such as erythromycin and tvlosin; polyenes, such as amphotericin A, and B, and nystatin;
anthracyclines, such as daunorubicin; and glycopeptides, such as vancomycin). For this reason, a <,ene probe, and PCR primer pairs which it was possible to employ heterologously, were derived from highly conserved regions of known dTDP-~,~lucose dehydratase 1 ~ enzyme proteins.
In the case of Ac~tirrnplane.o sp. SE 50/1 10, use of the above-described techniques led initially to the isolation and sequencing of a 2.2 kb I~czruHI DNA
fragment containing the complete DNA sequence of achB (encoding dTDP-glucose de-hydratase) and the partial DNA sequences of acbA (encodin~~ dTDP-glucose 20 synthase) and crchC' (encoding a cyclase) [EP A 0 730 0291DE 19507214].
Other enzymes which have been reported to be involved in acarbose biosynthesis are acarv~iosvl transferase from ACllirOlJlClrlE'.1' sp. SE 50/110 and its mutants (encoded by crchl~) [DE 196 26 269.5] and acarbose 7-phosphotransferase (encoded by crchl~~ [Goeke, K. et al. ( 1996); Drepper, A., et al. ( 1996)]. Acarviosyl transferase 25 has been reported to have the ability to replace the acarviosyl bound sugar re-sidues with other sugars in pseudooligosaccharides which contain this particular acarviosin residue. It is possible that acarbose 7-phosphotransferase (acarbose hinase) is involved in preparing a form of acarbose which enables it to be trans-ported out of the cell. In addition to this, acarbose 7-phosphotransferase is re-30 ';arded as being part of a self-defence mechanism:
while acarbose strongly inhibits the cytoplasmic a.-glucosidase of the production strain, the compound which has been phosphorylated by acarbose 7-phosphotrans-ferase does not, and as a consequence the cell-specific substrate metabolism is not Le .-~ s? s 19-Forei<_n Countries _;_ disn.~pted. Many producers of aminocyclitol antibiotics have been reported to possess protective mechanisms of this nature.
The present patent application describes the cluster of the biosynthesis ~~enes and other genes of acarbose metabolism in an 18 kb segment in Ac~irmplcr~re~.,~
sp. SE
s0/1l0 (see Figs. 1-3). The isolation of further genes of acarbose metabolism demonstrated, surprisingly, that the previously known biosynthesis genes, achAB(:' [EP .A 0 730 029/DE 19507214), are located in a common yzene cluster toy~ether with ,genes of acarbose modification (acarviosyl transfer and phosphorylation, i.e.
=enes crchl~ and crchl~~, of extracellular and cytoplasmic maltodextrin and '=lucose metabolism (enzymes of the a.-amylase and 4-a.-glucanotransferase and amylo-maltase families, respectively) and of binding protein-dependent sugar transport (uptake of maltodextrin or disaccharide into the cytoplasm). This tindin<, is of sub-stantial importance for the biotechnological production of acarbose with re~,ard to optimizing the process in a targeted manner. The reason for this is that this finding l ~ makes available important parts of acarbose metabolism in its entirety for the methods of biochemical/molecular biological engineering ~~ivin~ a novel viewpoint which widens the possibilities which were highliUhted in previous patents.
Thus, it is now also possible to influence the provision, which is evidently important for acarbose synthesis, of oe-l,4-glucan precursors by way of starch/maltodextrin degradation, the uptake/release, and also the cytoplasmic alteration, of oligo-saccharides up to the maltose stage, the multiplicity of the product spectrum and the modifications (e.g. acarbose phosphorylation) which are possibly of importance for secretin;J acarbose and/or liberatin~T it outside the cell.
The invention consequently relates to the isolation of further biosynthesis ~~enes ~s from Actinoplcrrre.s sp. SE 50/l 10, and to their use for isolating the adjoininvr DNA
re~_ions, for the purpose of further elucidating the acarbose gene cluster.
Elucidation of the acarbose gene cluster, involving isolation and characterization of the acarbose biosynthesis genes, is essential for improving,; the production pro-cess in a targeted manner, for example by - Increasing the ability of Actinopla~rc.~.s to synthesise acarbose by amplifying the genes for bottleneck enzymes, using more effective promotors, and abolishing or amplifying regulatory events.

Le .-~ ,? 319-Forei~Tn Countries - Improving the provision of precursors, especially from sugar metabolism, to-gether with optimizing the transport mechanisms such as the transport of substrates into the cell and the secretion of acarbose or modified compounds.
Restricting the product spectrum in AC'lljlopJaylL'.1' to the desired main product acarbose by switchin<l off unwanted pathways for biosynthesizinj minor components or by switching off umvanted enzymic degradation reactions.
- Expressing in heterologous host strains for the purpose of increasing production by means of an improved space/time yield, for the purpose of simplifying the working-up procedure, and for the purpose of restricting the product spectrum in a specific manner.
- Usin,T individual acarbose biosynthesis genes, or several acarbose bio-synthesis genes, for synthesizing acarbose, or compounds of this substance t ~ class, in nijro using precursors which have been prepared synthetically or microbially.
The invention therefore discloses:
A recombinant DNA molecule which comprises genes for the biosynthesis of acarbose and acarbose homologues, which genes are arranged in the gene cluster ?0 depicted in Figure 2.
A recombinant DNA molecule which has the restriction enzyme cleavage pattern depicted in Figure 1.
The complete DNA sequence of the l8 kb fragment containing the genes listed in Tab. l, as depicted in Fig. 3, and the amino acid sequences resulting therefrom.

Le A ,? 319-Forei<,n Countries _j_ Tab. I : Properties of the «ch genes and the Acb gene products Gene Gene products' Designationfrom-to'' AA postulated function, related proteins crc~h.A 8914-9838 307 dTDP-';lucose synthase; 58.1%
sequence identity in 217 AA overlap with .flri~,rellcr fl~.YilC'J'l RfbA (L14842) chB S844-7818 341 dTDP-glucose 4,6-dehydratase;
6 3,r sequence identity in 327 AA overlap with .frrcptorrrace.v rgillceu.s l~~ltmE (Y 10907) crchC' 6628-7529 381 C7-sugar cyclase, similar to 3-dehydroquinic acid syntheses; 26.8% identity in 340 AA

overlap with ~LTycohaclenirrm Illhe'f'C'IIIU.S'!.1' AroB (X59509) crc~hD 13373-15548724 Acaryiosyl transferase, similar to other oligodextrin to polydertrin transferases or hvdrolases; ~~reatest similarity to the cyclomaltodextrin glucano transferase family;

41.1% identity in 734 AA overlap with Bcillrr.c circtrlrr.r CdgT protein (X68326) crc~hl:~ 12385-9320 1021 oe-amylase; 45.0~o identity in 897 AA overlap with an a.-amylase from .~~ll'C'/)lOllrl'c't'.1' Ill'lC~ll.S' (X70255) crchF 17515-16537325 MaIF-like membrane protein of a binding protein-dependent ABC transporter for lactose; 29.9,o identity in 251 AA overlap with Sywc.chocv.sn.s sp. PCC6803 LacF protein (D90905 ) l0 chG 16541-IS119252 MIaIG-like membrane protein of a binding protein-dependent ABC transporter;
27.8%

identity in 234 AA overlap with protein from the thermophilic bacterium RT8.B4 (L18965) Le .-~ 32 319-Forei~~n Countries _6_ Gene Gene product' Designationfrom-to'' AA postulated function, related proteins crchH ( 18482-1751322 MaIE-like binding protein of a 1 ) binding protein-dependent ABC transporter;
22.2, a identity in 279 AA overlap with ,S'treptncoccrr.~~ nrrrtcrrzs MIs~~IE protein (M77 35 ( ) crchK 1991-2S94 300 Acarbose 7-kinase, similar to sugar kinases and adenosine kinases; 57.9% identity in 297 AA overlap with Streptnrnvcc.s sp. Urf2 protein, (U08602) whose gene is located adjacent to a gene for an c~-amylase crchl. (3966-4988)340 Oxidoreductase, similar to sorbitol dehydrogenases; 26.6% identity in 2l4 AA

overlap with Hcrcnrophifrr.s irrflrrorr_ac protein L 42023 crchnf 2890-3970 359 Unknown function (no si';niticant similarity) crchlV' (5049-582.>)258 Oxidoreductase crchp 1-1960 527 Maltodextrin glucotransferase;
M'IaIQ-like protein having 33.0% identity in 339 AA

overlap with Hercnrophilrr.,~
ijrfluerr~cre i\IaIQ

protein (L45989) i crch0 5819-6627 230 Unknown function (no si~Tnificant similarity) '' the position numbers relate to the base pairs in the B~,III-SstI fra~,ment in Fi'l. 3. Sequence information which is either still incomplete or relates to uncertain reading frames is placed in brackets;
the accession Nos. of the database entries are indicated in brackets;
AA = amino acids;
In this context, the genes crch.4 and crchB very probably encode enzymes of acarbose biosynthesis, since their encoded proteins AcbA and AcbB, respectively.

I_e .-~ s? s 19-Forei<,n Countries _7_ exhibit a high degree of sequence identity with known bacterial dTDP-glucose syntheses and dTDP-glucose 4,6-dehydratases, respectively. The similarity of the protein sequences to the representative of the two enzyme families which is the nearest known representative in each case (cf. Fig. 3) is much y~reater than that of other arbitrary pairs of functionally identical proteins from the two groups.
In this context, it is surprising that while the nearest relatives of AcbA are to be found among streptomycetes proteins, AcbB is more closely related to various RtbB
pro-teins in Gram-ne~,~ative bacteria. However, this phenomenon is also demonstrated by other corresponding streptomycetes proteins, for example TylAl and TylA2 from the tylosin producer .Strep~omvce.s fr~adicre [Merson-Davies and Cundliffe ( 1994)], which are likewise encoded by adjacent v.:enes in a common gene cluster.
The gene crchC' encodes an enzyme which is probably involved in acarbose bio-synthesis since the enzyme AcbC is related to AroB proteins, i.e.
dehydroquinic acid syntheses, and, following; overexpression in Sh~eptomyce.s linic~crrr.o, exhibits an 1 ~ enzyme activity which, as to be expected, converts heptulose phosphates (e.~,.
sedoheptulose-7-phosphate) into products which possess similar properties to those of valienone and valiolone (possible precursors of acarbose biosynthesis) but which are not identical to these compounds.
The genes achK (acarbose 7-kinase), crchG (ketosugar or sugar alcohol oxidoreduc-?0 tase) and crchM (unknown function), and also the crchN-gene (direct link to the crchl. and crchC: reading frames is indicated by overlapping start/stop codons) prob-abf encode enzymes of acarbose biosynthesis since they all, together with crch(' and possibly acb0 as well, form a probable operon (transcription unit) and are probably read in a translationally linked manner. The functions of a specific, cyto-plasmically located acarbose kinase (AcbK) and of a possible dehydrogenase (..~cbL) also provide support for direct involvement in acarbose metabolism within the cell; in this context, the sugar dehydrogenase, AcbL, might be involved in the synthesis of the C-7 cyclitol or 6-deoxyhexose precursors, or their condensation.
The two ~,enes crchD (acarviosyl transferase) [DE 196 ?5 269.x; Goeke, K.. et al.
30 ( 1996); Drepper, A., et al. ( 1996)] and crchl: (a.-amylase), which lie in opposite ~

Le A ~? 319-Forei~~n Countries _g_ directions with a common promoter region in the Acrirmplcrue.s sp. SE 50/l10 cluster and which both encode enzymes of the amylase family, suvgest that the regulation of starch degradation and the production of acarbose are closely inter-related. This is confirmed by the finding that, when Acairloplcum.s sp. is grown on starch as the C source, the two enzymes are the most strongly expressed ex-tracellular proteins in the culture supernatant. This also applies to the expression of crchl: under the control of its own promoter even in Slrcyornvcc~.s liniclau.s (see Examples).
The genes crchH, F and G encode what is probably an extracellular sugar-binding protein, AcbH, and two typical membrane components AcbF and AcbG, of a bacterial sugar transporter of the ABC importer type. They probably participate in the metabolism of acarbose by taking up oligo-maltodextrins or recycle acarbose.
as transport vehicles for short olio-a-1,4-glucans (higher homologues of acar-bose), by taking it up into the cell. The amylomaltase-like gene product (AcbQ) of the ach0 gene could also be involved in a process of this nature.
The invention furthermore discloses:
A process for isolatin<, acarbose biosynthesis genes from actinomycetes, in parti-cular from Actirroplcrue.s, characterized in that ~,;ene probes are used which are derived from a 2.2 kb BamHI fragment. The 2.2 kb BamHI fragment, which was derived from highly conserved regions of known dTDP-';lucose dehydratase enzyme proteins with the aid of a gene probe which was isolated using PCR
primers, is described in Patent Application [EP A 0 730 029/DE 1907214].
:~ process for isolatin; ~.:enes for biosynthesizing acarbose-related natural sub-stances in actinomycetes (e.v;. for validamycin, oligostatins (trestatin) and adiposins).
:~ process for increasing the ability of Aclmoplcrlle.s to synthesize acarbose by means of Le .-~ s'_' s 19-Forei~,n Countries - increasin~,~ the dosave of ~~enes for velocity-determining biosynthetic enzymes, - more effective promoters for velocity-determinin'.: biosynthetic enzymes, and s - eliminating undesirable regulatory steps.
A process for increasing the ability of Aciif~oplarre.o to synthesize acarbose by means of protein engineering in association with the biosynthetic steps which limit acarbose synthesis, or for avoiding degradation products which arise due to un-desirable reverse reactions of biosynthetic enzymes.
~ process for restricting the product spectrum in Actifrnplam.,~ to the desired main product by means of eliminating unwanted pathways for biosynthesizin<, minor components or by means of eliminating unwanted enzymic de,=radation reactions.
for example by means of inactivating the achD gene.
.~ process for alterin;; transport mechanisms with a view to improvin~, the trans-port of substrates into the cell or more effectively secreting acarbose out of the cell.
.~ process for carrying out expression in heterolo~,~ous host strains (e.~~.
pseudo-oli~,=osaccharide-forming streptomycetes and in other streptomycetes such as .~'~repmmvce.o linicla~~.s, in rapidly growing bacteria such as G.coli, or in yeasts and ?0 fun';i), in order to increase production by improving the space/time yield, - in order to simplify the working-up procedure, and - in order to restrict the product spectrum in a targeted manner.
.-~ process for using the acarbose biosynthesis genes for the in-W rn synthesis of 2> acarbose or compounds of this substance class, proceeding,; from precursors which are prepared synthetically or microbially.

Le .-~ 32 319-Forei<_1n Countries The invention is described in detail below. In addition, the invention is defined by the content of the claims.
Unless otherwise indicated, all the genetic manipulation methods were carried out as described in Sambrook et al. ( 1989).
Three different s:ene probes were used for the screening. They were isolated from plasrnids pAS2, pAS~/7.3 and pAS6/3. Plasmid pAS2 was prepared from L~.cwli DHScc by means of the "boiling method" or by means of alkaline lysis and hydro-Ivsed with the restriction endonuclease BanrHI. The resulting '.~ kb BcunHI
fra~~-ment was isolated and labelled with ''P-labelled deoYynucleotides by means of so-called nick translation. This radioactively labelled fragment was employed as a gene probe for isolating acarbose biosynthesis genes and is desivJnated acb probe II below. The second gene probe was isolated from plasmid pASS/7.3. The .~phI-.5:,~1I fragment was isolated and radioactively labelled as described above.
This v~ene probe is designated acb probe III below. The third gene probe was isolated 1 ~ from plasmid pAS6/3. The BcunHI fragment was isolated and radioactivelv labelled as described above. This probe was given the designation acb probe IV.
Acarbose biosynthesis ~,enes were isolated in two different ways, as follows:
1 ) Chromosomal DNA from Actiiroplcrtles sp. was hydrolysed with the re-striction enzymes S.sfI, BgIII and f'.slI, and the restriction fray.:ments were separated by gel chromatography and screened for a homologous DNA
sequence by means of Southern hybridization using acb probe II (.~:vl and B~~III hydrolysis) or acb probe III (I'.slI hydrolysis). The S.slI fragment which hybridized with the gene probe had a size of appro~:. 10.7 kb and the BgIII
fragTment had a size of approx. 10.2 kb. The 10.7 kb .S.nI fragment and the 12 kb B~,JIII fragment were eluted from the yel and liy~ated into the vectors pUC l8 and pBluescript II KS, respectively, and cloned into l.~.cnli DH~a.
The resultin'; plasmids were given the designations pAS~ ( S:,nI fragment) and pAS6 (B~,IIII fragment). .A 2.8 kb P.slI fragment, which overlapped with the .S.,uI fragment and which hybridized with the acb probe III gene probe, Le A ,'_ _s 19-Forei<,n Countries was cloned into the pUC 18 vector, with the recombinant plasmid being desiV~nated pMJI.
2) A GEM12 page library of Actilroplarre.s~ sp. genomic DNA was screened with probes acb probe III and acb probe IV by means of plaque hybridization. In all, t S phages were isolated using acb probe III and two phages were isolated using acb probe IV, which phages comprise a total of approx. 38.5 kb of colinear Ac~irroplcrlre.c sp. DNA containiny.~ the acarbose biosynthesis genes. The phages which were characterized in more detail carry the designations 10/3 and S/4. Plasmid pMJI was obtained from phay~e l0 10/3 by hydrolysing with the restriction enzyme P.stI and clonin'; a 2.8 kb /'.~nl DNA fragment into plasmid pUC 18. Plasmid pI~IJ9 (6.3 kb fra<~ment) was obtained from phage S/4 by means of hydrolysis with the restriction enzyme S.,vI and subsequent cloninv= into pUC 18 (S.stI-hydrolysed).
In order to determine the DNA sequence of the Actrrrnplalrc~.s sp. 10.7 kb .S'.,nI fra~l-ment (pASS), the followin~, recombinant plasmids were constructed, proceeding, from the pUC 18 vector, and the sequences of the inserted DNA fragments were analysed:
pASS 10.7 kb .S.~~II fragment from Actirroplarre~.s chromosomal DNA
pAS2 2.2 kb BcrrnHI fragment from Actirrnplalres chromosomal DNA
(see Patent Application DE 19S 07214) pASS/lS 3.8 kb HirrdIIIlSstI fragment from pASS
(see Patent Application DE 196 2S 269.5) pASS/15.1 =2.6kb HirrdIIIlf'.s~I fragment from p.ASS
pASS/15.2 =0.75 kb SalI fragment from pASS/lS.l pASS/15.3 =O.S kb SaII fragment from pASS/lS.l pASS/15.4 =0.4 kb SaII fragment from p.ASS/15.1 pASS/15.5 =0.35 kb SaII fragment from pASS/15.1 pASS/IS.6 =1.25 kb l'arrII fragment from pASS/IS.I
pASS/1 S.7 =0.7 kb !'wrII/HilrdIII fragment from pASS/1 S. l pASS/15.9 =0.1 kb I'~~rrII fragment from pASS/IS_I

Le A 3? 319-Forei<_ln Countries - I? -pASS/IS.I l =1.1 kb KrrpIll~'coI fragment from pASS/15 pASS/15.12 =0.9 kb KpnIlNcoI fra~,ment from pASS/15 Three DNA re~~ions were amplified using the PCR method and the corresponding=
fragments were cloned and sequenced:
pASS/17 =0.46 kb PCR fragment pASS/l8 =0.?6 kb PCR fra~Tment pASS/19 =0.27 kb PCR fragment pASS/6 5.4 kb I'.stI fragment from plasmid pASS

Clones which were prepared using the enzymes eronuclease III

and S l nuclease, proceeding from plasmid pASS/6 and following hydrolysis wit h ~Y7~oI and SstI:

pASS/6.3-IS = 5.1 kb of insert DNA

pAS5/6.12-4 = 4.7 kb of insert DNA

pASS/6.3-18 = 4.3 kb of insert DNA

1 > pASS/6.6-3 = 4.2 kb of insert DNA

pASS/6.9-2 = 3.8 kb of insert DNA

pASS/6.9-6 = 3.8 kb of insert DNA

p.ASS/6.12-6 = 3.2 kb of insert DNA

pASS/6.3-6 = 3.0 kb of insert DNA

pASS/6.15-1 = 2.8 kb of insert DNA

pASS/6.3-l6 = 2.3 kb of insert DNA

pASS/6.9-1 = 1.8 kb of insert DNA

pASS/6.9-3 = l.? kb of insert DNA

pASS/6.6-1 = 0.9 kb of insert DNA

pASS/6.12-3 = 0.47 kb of insert DNA

p.ASS/6.12-2 = 0.17 kb of insert DNA

pASS/3 1.4 kb BamHI fragment from plasmid pASS
pASS/3.1 = 0.35 kb SphIll:yI fragment from pASS/3 pASS/3.2 = 0.85 kb SphIlBarnHI fragment from pASS/3 Le A s2 319-Forei~,n Countries 13 _ pASS/3.3 = 0.55 kb .SphIlBamHI fragment from pASS/3 pASS/4 1.2 kb BamHI fragment from plasmid pASS
pASS/5 0.45 kb .S.otIlBan rHI fragment from plasmid pASS
pASS/7 1.2 kb I'.~~tIIS.~~tI fravment from plasmid pASS
pASS/7.l 0.64 kb PonIIlAccI fragment from plasmid pASS/7 pASS/7.2 0.54 kb P.stIl.SphI fragment from plasmid pASS/7 pASS/7.3 0.67 kb ,SphIlSstI fragment from plasmid pASS/7 pASS/l l 0.68 kb B~IIIIHincIIII fragment from plasmid pASS
pASS/12 0.63 kb BgIIIlI'.stI fragment from plasmid pASS
pASS/13 4.8 kb BcrmHI/S.wI fragment from plasmid pASS
pASS/16 0.5 kb BcrnrHI fragment from plasmid pASS
Plasmids which were constructed for determining the DNA sequence and which contain DNA fragments containing Actinoplarre.s sp. acarbose biosynthesis ';enes from plasmid pAS6 (cf. Example 6). The DNA cloned in plasmid pAS6 possesses l5 a ~.? kh B~TIIII.f.slI fragment, containing acarbose biosynthesis genes, which is also possessed by plasmid PASS. The following recombinant plasmids were con-structed in the pUC 18 vector for the purpose of sequencing the 5.9 kb Bg/II/.S.stl fra';ment which adjoins plasmid PASS (Fig. 1).
p~IJ6/6 5.9 kb B~~/II/fslI fragment from plasmid pAS6 pMIJ6/4.2 0.5 kb BamHIlI'.nI fragment from plasmid pMIJ6/6 pNIJ6/4.1 0.36 kb BamHIlP.stI fragment from plasmid pMIJ6/6 pMJ6/6.2.2 0.5 kb Scrll religand pI~~IJ6/6.2.3 3.3 kb Scz/I fragment pNIJ6/6.2.4 1.2 kb ScrlI fragment ~S pWJ6/6.2.5 l.0 kb fall fragment pMJ6/6.2.6 0.7 kb Scrll fragment pMIJ6/6.2.7 0.14 kb .SaII fragment pVIJ6/6.2.8 0.13 kb ScrII fragment pMJ6/8.1 1. l kb ClcrIlBcrrnHl fragment pMIJ6/10 I.5 kb I'.stllSall fragment Le .-~ 3? 319-Forei~_Tn Countries - l4-p:~S6/3 2.8 kb BcrmHI fra<,ment from plasmid pAS6 pAS6/3.1 l.1 kb HijrcII fra~,;ment from plasmid pAS6/3 pAS6/3.2 1.2 kb SaII fragment from plasmid pAS6/3 pAS6/3.3 1.4s kb P.slI fragment from plasmid pAS6/3 The followin;,_ plasmids were constructed, and the sequences of the DNA
inserts analysed, in order to determine the DNA sequence of the Ac'llilnplclilC'.1' sp 2.8 kb /'.vI frav~ment (pMJ 1 ).
pVIJI/1 0.6 kb S'pl~Ill'.,uI fragment from plasmid pNIJI, relivTand following fphI hydrolysis, pMJI/2 1.2 kb SaIIlP.slI fragment from plasmid piVlJl, relivand following S'crll hydrolysis, pNIJI/3 l.4 kb .S.stl/I'.slI fragment from plasmid pMIJI, religand following S.sll hydrolysis, pMJ 1 /4.1 0.9 kb ,fcrlIlSfnaI fragment from plasmid pIVIJ I .
1 ~ The method of San<~er et al. ( 1977), or a method derived from this, was employed for the DNA sequencing. Use was made of the Autoread sequencing kit (Pharma-cia, Freiburg, Germany) in combination with the Automated Laser Fluorescence CALF) DNA sequencer (Pharmacia, Freibur;T, Germnay). Suitable fluorescein-labelled pClC reverse-sequencing and sequencin;; primers were obtained commer-?0 ciallv (Pharmacia, Freibur~=, Germany). The sequence of the approx. 15.0 kb f3~,TlIIII'.~~ll fragment is depicted in Fi;T. 3. Tab. 1 provides an overview of the properties of the ach genes and the products which they encode.
Tab. 2. Sequences of the primers for the PCR and the sequencing reaction.

Le A ~? ~ 19-Forei~,n Countries lj _ Primers for the PCR:
Plasmid pAS~/17:
Primer designation Sequence PI~~>AS~/18: S~ GGCGGCGATTCGGCCTGCGCGG 3' Prarrbe~~e~siy~nation ~p~~GATGGCATGCCTGGCG 3' acbD3 5' ACCAGGCCGAGGACGGCGCCC ~
Plasmid pASS/19:
acbD4 5' AGCGGCATGTGCTTGACGGCG 3 Primer designation Sequence acbDS 5' ACCGGCTCGAACGGGCTGGCACC 3' acbD6 5' CCCTCGACGGTGACGGTGGCG ~

Le :~, s? 319-Forei<~n Countries Primers for amplifvin~~ the crchC' ~~ene:
The sequence regions which were used to construct recognition sites for the re-striction endonucleases NcleI and EcoRI are underlined.
Primer designation Sequence s AS7 ~'GGAAGCTCATATGAGTGGTGTCG3' AS8 5'CGAGACGGTACATATGCACGCGGATG3' AS9' S'CCGTCTCGCCCACCCGCATCACC3' AS-C l' S'AGGGAAGCTCATATGAGTGGTGTCGAG3' AS-C2 5'GG1'ATCGCGCCAAGAATTCCTGGTGGACTG3' l0 Primers for the seduencin~ reaction:
Primer designation Sequence universal primer ~'GTAAAACGACGGCCAGT3' reverse primer S'GAAACAGCTATGACCATG3' The N-terminal sequence of the AcbE protein was analysed usinv~ a 473 A ~,;as-15 phase protein sequences from Applied Biosystems (Forster City, CA, USA) and the standard Fastblott protein sequencing programme. The protein sequences, the different programmes, the breakdown cycles and the PTH identification system, are all described in the sequencer's manual (User's manual; protein sequencin~l system model 473A (1989); Applied Biosystems, Forster City, CA 94404, USA).
20 The PTH amino acids were detected on-line using an Applied Biosystems RP 18 column (220 mm X 2 mm, 5 p material). The PTH amino acids were identified and quantified with the aid of a 50 pmol standard. The data were processed usin~,T
an Applied Biosystems 610A sequences data system.
-~Il the chemicals used for the protein sequences were supplied by Applied Bio-systems.

Le .~ s? ,19-Foreign Countries E~camples:
t. Culture of the E.coli strains, preparation of the plasmid DNA and isolation of DNA fragments l;.cwli DH~a, was incubated at 37°C in LB medium. Plasmid-harbourins:
bacteria were maintained under selection pressure (ampicillin, 100 p<~!ml). The bacteria were cultured on an orbital shaker at 270 rpm. Samples which had been incubated for at least 16 h were designated overnight cultures (OC).
Cells from 1.5 ml of an OC which had been incubated under selection pressure were used for preparing plasmid DNA. The plasmids were isolated by the alkaline l0 SDS Ivsis method [Birnboim, H.C., and J. Doly (1979)].
Restriction endonucleases were used exclusively, in accordance with the in-stmctions of the producer (Gibco BRL, Eggenstein, Germany), for specifically hydrolysing vector DNA. ~ U of the relevant restriction endonuclease were used for restricting; l0 pg of plasmid DNA, with the incubation bein~~ carried out at 1 s s7°C for 2 h. In order to ensure complete hydrolysis, the same quantity of re-striction endonuclease was added once again and the mixture was incubated for at least a further 1 h.
The cleaved DNA was separated electrophoretically on horizontal agarose gels whose concentration varied from 0.5 to l.2% depending on the size of the DNA
20 fra';ments. For elution, the gel piece containing the DNA fra~__=ment was excised with a sterile scalpel and weighed. The DNA fragments were eluted from the a';arose using the JETsorb kit (Genomed, Bad Oeynhausen, Germany) as in-stmcted.
2. Culture of Actinoplanes sp. SE~O/110, preparation and cleavage of the 25 chromosomal DNA, and separation of the fragments by gel electrophoresis :~Ic.nirmplcm~~.s sp. SE50/I10 was incubated at 30°C in TSB medium for ~ d on an orbital shaker. Seed culture (5 ml) was carried out at 240 rpm in culture tubes, while the main culture (50 ml) was carried out at 100 rpm in s00 ml baffled Le .~ s? , 19-Foreign Countries -18_ flasks. After culturing, the cells were sedimented by centrifu~~ation and washed twice in TE buffer.
1.5-? mg of cells (fresh wei,lht) were used to prepare the total DNA by the phenol/chloroform extraction method (Hopwood, D.A., et al. ( 1985)].
20 ug of chromosomal DNA were hydrolysed with 10 U of the relevant restriction enzyme (Gibco BRL, Eggenstein, Germany) at 37°C for 2 h in the appropriate buffer. In order to ensure complete hydrolysis, the same quantity of restriction endonuclease was added once again and the mixture was incubated for at least a further I h.
The cleaved DNA was separated electrophoretically on 0.6% horizontal a~;arose <.els The DNA fragments were once again eluted using the .fETsorb kit (see Example 1 ).

3. Preparation of :lcb gene probe II, acb gene probe III and acb gene 1 ~ probe I~' The fragments which were prepared from pAS2 (see DE 195 07214), p.ASS/7.3 and pAS6/3 as described in Example 1 were labelled radioactively with the nick translation system supplied by Gibco BRL, Ev~genstein, Germany, in accordance with the tatter's instructions. 0.5 - 1.0 Itg of DNA fragment was employed for this ~0 procedure, as was [a.-'~P]dCTP (3000 Ci/mM; Amersham Buckler, Braunschweig).
The mixture was then boiled for 10 minutes (denaturation) and immediately added to the hybridization solution (see Example 4).
DhIA transfer to membranes and DNA hybridization (Southern hybridization and autoradiography) The Southern transfer method [Southern, E.M. (1975)] was used to transfer DNA
fra<~ments from agarose gels onto membranes. The a;~arose gels which were ob-tained as described in Example 2 were tilted for 20 minutes in 0.25 M HC1. The gels were laid on 3 layers of absorbent Whatman 3 MNI paper (Whatman, Le .-~ 3? s 19-Forei~,n Countries Maidstone, GB), and a Hybond~rM-N- membrane (Amersham Buckler, Braun-schwei'~) was laid on top while excluding air bubbles. Several layers of absorbent paper were then laid on a membrane. A weight of approx. 1 k~~ was placed on top of the filter stack. The DNA was transferred by suckin~~ through 0.4 i~I NaOH.
After a transfer time of at least 12 h, the nylon filters were rinsed for s minutes with 2~SSC and then dried in air.
The nylon filters were then shaken in a water bath at 68°C for at least ? h in ~0-100 ml of prehybridization solution. During this period, the solution was chan~~ed at least twice. The hybridization was carried out for at least 12 h in a hvbrid-ization cabinet. 1 s ml of hybridization solution, containin;, acb probe II
(see Ex-ample 3), were employed.
The nylon filters were then washed for 15 minutes in each case with 6 ~
postwash and I x postwash. They were then covered with clin~film while still moist.
Auto-radio<,raphy was carried out at -80°C for at least 16 h usin<, Hypertilm-MP
l5 (Amersham Buckler, Braunschwei~,;) in a light-proof cassette provided with intensi fyin'; screens.
~. Isolation and cloning of the B~TIII, P.stl and .Sctl fragments from Actinnplanes sp. total DNA
:-Iwinupl~rnc~.,~ sp. chromosomal DNA was completely hydrolysed with f3,s,J/Il, I'.,~I
~0 and .fwI and the hydrolysates were separated by a~arose gel electrophoresis: the .S'.wI frayJments of 9.0-12 kb in length, the B~~/II fra;ments of 1 l-13 kb in length and the P.wI fravments of 2.5-3.5 kb in length were then eluted from the a~arose (see Example l ). The eluted S'.otI fragments and PslI fragments were li~ated to vector plasmid pUC 18, which had been prepared from IJ~.c.wli DH~a, and hydro-~s Ivsed with S.slI and P.stI, respectively. The vector plasmids had been treated pre-viously with alkaline phosphatase (Boehrin';er, Mannheim) in accordance with the manufacturer's instructions. The li~~ation was carried out in a volume of ?0 yl.
with the ratio of fragment to vector being 3:1 and with from O.OI-0.1 p<~ of DNA
being, present in the mixture. I U of T4 DNA lipase and the corresponding buffer s0 (Gibco BRL, Eg~enstein, Germany) were employed. The eluted BgIII fragments were li~ated into the vector plasmid pBluescript II KS, which had been hydrolysed Le .-~ 32 319-Foreign Countries with BcuoHI. The li~~ation was carried out as in the case of the .f.,U and P.wf fra<s-menu.
Transformation-competent l~'.coli DH~a cells were transformed with complete libation mixtures [as described by Hanahan, D. (1983)]. Ampicillin-resistant trans-formants were transferred to LB-Amp selection plates ( l00 pg/ml).
G. Identification of clones which harbour the 10.7 kb .Sstl fragment, the 12 kb I3~lII fragment, the 2.8 kb P.ctl fragment and the G.3 kb .Sstl fragment from the acarbose biosynthesis cluster Ampicillin-resistant transformants were examined for the presence of the 10.7 kb l0 .fslI fra~,ment and the 12 kb BglII fra~,ment which hybridizes with acb probe II.
Ten of each of these clones were streaked out on a selection plate, incubated over-niv=ht and then washed from the plate with 3 ml of LB medium. The plasmid DNA
was then isolated from 20 such pools of ten [using the method of Birnboim.
H.C., and J. Dolt' ( 1979)]. In order to remove the cloned S.stI fragments from the poly-I S linker, the 20 different plasmid preparations were hydrolysed with the restriction endonucleases EcWRI and Hiucir(II, and S'.stI and Hirrc~III, respectively. The re-striction mixtures were then separated electrophoretically on a 0.6°,~o a~_=arose gel and the DNA transferred by Southern transfer from the agarose '_el to a nylon titter (see Example 4). Hybridization was once a~,ain carried out using acb probe 20 II (see Example 4). One of the pools in each case reacted positively with acb probe II and was subdivided into the ten individual clones. Their piasmids were isolated likewise and subjected to the above-described procedure. The hybridizin~_=
plasmids were designated pASS and pAS6, respectively. They contained a 10 7 kb S.,nI fragment (PASS) and a 12 kb BgIII fragment (pAS6), respectively The recombinant pha';e 10/3 was hydrolysed with I'.stl, after which the DNA
was separated on a horizontal a~arose gel; the 2.8 kb l'.,ul fragment was then eluted from the matrix (see Example 1 ) and li~,ated into the pUC 18 vector. The recom-binant plasmid was designated pMJI and transformed into E.cnli DHSa.
The recombinant phase 5/4 was hydrolysed with S'.nI and the DNA was separated 30 on a horizontal avarose gel; the 6.3 kb S.,uI fragment was then eluted from the Le .a 32 319-Forei~,n Countries matrix (see Example 1 ) and ligated into the pUC 18 vector. The recombinant plas-mid was designated pMJ9 and transformed into E.cnli DHSa.
7. Preparation of the GE1V112 library and isolation of recombinant phages which harbour the acarbose biosynthesis genes, and preparation of the phage DNA.
.actirmplcrJJe.s sp. chromosomal DNA was partially hydrolysed with SaJJ3AI.
For this, s0 pg Of AC'IJIIO~IQiIL'.S' chromosomal DNA were incubated at 37°C for 30 min with 0.01 > U of Sarr3AI. The enzyme reaction was stopped by phenol extraction.
chloroform and ethanol precipitation [as described by Sambrook et al. ( 1989)]. The subsequent treatment of the DNA fragments, and ligation to pha~,;e vector GEM
12, were carried out in accordance with the instructions of the manufacturer (Prome~a, Heidelberg). The JiJ l'llJ'O packaging of the ligation mixture was carried out usinv_=
the DNA-packaging kit supplied by Boehringer (Mannheim). The pha~ es were multiplied in E.coli LE392 using the method described in Sambrook et al. ( 1959).
1 s The pha~_es harbouring acarbose biosynthesis genes were identified by means of plaque hybridization (as described by Sambrook et al. 1989) using the acb III
and icb IV ~~ene probes. The phaye DNA comprising the acarbose biosynthesis genes was prepared, as described by Sambrook et al. ( 1989), from phages which had been multiplied on E.coli LE392.
g. Polymerise chain reaction PCR is used to amplify chosen DNA regions in ~~i~ro [Mullis. K.B., and F.A.
Falloona ( 1987)]. For all the reactions, Taq DNA polymerise was employed, in accordance with the producer's (Gibco BRL, Eggenstein) instructions, in 2~ re-action cycles. In order to suppress possible secondary structures in the case of GC-s rich DNA, the mixtures contained 5% formamide. The volume was 100 ul, with ~0 pmol of each primer and 200 pM dNTP's being employed. After an initial 5-minute denaturation of the DNA at 9>°C, 2.~ U of the temperature-stable DNA
polymerise were added to the mixtures in a hot start. Primer elongation took place at 72°C, and the DNA was denatured at the be~innin~ of each cycle at 9~°C for 1 min. The reactions were carried out in a Biometra Thermocycler (Gottinv~en).

Le .-~ s? , 19-Forei~_n Countries Tab. 3 Protocols for the PCR for amplifying DNA fragments from the acarbose cl aster.
The table lists the designations of the recombinant plasmids which contain the corresponding fragments.
s Fra~,ment Primer annealingPrimer extensionRecombinant plasmid size 0.46 kb 72C in 20 sec. 72C in 20 sec. pASS/17 0 26 kb 68C in 20 sec. 72C in 20 sec. pAS>/18 0.27 I:b 68C in 20 sec. 72C in 20 sec. pAS~i 19 9. Subcloning of plasmid pAS~
Several subclones were prepared from plasmid pAS~ in order to elucidate the se-quence of the double-stranded DNA.
Ap S~/6 Plasmid pAS~ was hydrolysed with the restriction enzyme I'.~~tl and the hydrolysate was fractionated by gel electrophoresis (0.7% agarose gel); the 5.=I kb I'.stl fra'_=ment was eluted from the gel and cloned into pUC l8 (hydrolysed with 1 ~ !'.stl), and the recombinant plasmid was transformed into G.coli DH~a..
pASS!3;~AS~/4~ pASS/13 and pASS/16 Plasmid pASS was hydrolysed with the restriction enzyme BarnHI and the hydrolysate was fractionated by gel electro-phoresis. The fragments were of the following sizes:
1.4 kb BarnHI fragment ?0 1.2 kb BarnHI fra~,ment 2.3 l:b BcrnrHI fragment 0. > kb BcrrrrHI fragment 0.4s kb &rrnHI fragment 7.~ kb l~crrnHI fragment (= 4.8 kb Actirroplarre.s DNA BanrHIlS.stl fragment li;Tated to pUC 18).
The fragments which were envisaged for the subcloning, and which were of 1.4 kb and O.S kb in size, were eluted from the gel (see Example I ). The pUC l8 vector was prepared for the cloning using the restriction enzyme BcrmHI as described in Le .-~ ~? _,19-Foreign Countries Example 1. The legations were carried out as described in Example S. Li~,ation of the 0.5 kb fragment into the prepared pUClB resulted in subclone pASS/16. Sub-clone pASS/3 resulted from legating the 1.4 kb fragment to the prepared pUC l 8.
Subclone pASS/4 resulted from legating the 1.2 kb fragment to the pUC 18 vector.
Subclone pASS/l3 resulted from relegating the 7.5 kb BanrHI fragment.
pASS/~;~ASS/7; pAS~/11 and pASS/l2 Plasmid pAS~ was hydrolysed with the restriction enzymes BamHI and SslI, P.slI and S.olI, Bg/II and I'.sll, and also 8,~~/II
and Hij~dIII. The restriction mixtures were separated in a 1.2% a~,Tarose ;;el. The corresponding fragments were eluted from the agarose gel and cloned into pUCIS
(hydrolysed with BanrHI and S.vtl, I'.r!I and S.slI, BamHI and l'.nI or BmnHI
and HindIII), with the recombinant plasmids being transformed into L.w~li DH>a.
Subclone pAS>/~ contains the 0.48 kb S.slI/BannHI fragment, subclone pAS~/1?
the 0.63 kb BgIIIlPstI fragment and subclone pASS/11 the 0.68 kb BgIII/Nij~dIII
fra~,ment.
I s pAS>/1 ~.l l and pASS/15.12 Plasmid pASS/l5 was hydrolysed with the restriction endonucleases V'coI and Kp~rI. The resulting 0.9 kb NcoIlKpyrl and 1.1 kb ,V'wU/KpnI fragments were eluted from a 1.2% agarose gel (see Example 1 ) and cloned into vector pUCBM21 (Boehriny~er, Mannheim) (hydrolysed with ;~'coIlIvpuI) with the recombinant plasmids being transformed into L.coli DH~a, ~0 resultin'; in the subclones pASS/15.12 (0.9 kb fray~ment) and pASS/l~.ll (l.l kb fragment).
10. Subcloning of plasmids pASG and pNIJ6/6 and of phage ~/4 Wl IJ6/6: Plasmid pAS6 was hydrolysed with the restriction endonuclease S.sil (usinyl the restriction cleavage site of the vector) and a ~.9 kb S.slI
fragment was eluted from the agarose ~.~el and legated to plasmid pUC l8. lJ.cwli DHSa, was trans-formed with the recombinant plasmid.
pVlJ6/4.1 and pMJ6/4.2 Plasmid pMJ6/6 was hydrolysed with the restriction endo-nucleases BamHI and P.slI, and a 0.36 kb BajnHIlf'.vI fra~,~ment, and also an 0.5 kb /3crmHI//'.sll fra~,;ment, were eluted from the a~;arose '~el and li~Tated to plasmid 30 pUC l8. l~.coli DHSce was transformed with the recombinant plasmids.

Le .-~ ,? 319-Forei<,n Countries _2,~_ pVIJ6/6.2.2, pMJ6/6.2.3, pMJ6/6.2.4, pMJ6/6.2.5, pMJ6/6.2.6, pMJ6/6.2.7 and pVIJ6/6.2.8: Plasmid pM'IJ6/6 was hydrolysed with the restriction endonuclease ,fcrlI, and a 3.3 kb fragment, a 1.2 kb fragment, a 1.0 kb fragment, a 0.7 kb fra~,-ment, a 0.14 kb fragment and a 0.13 kb fragment were eluted from the ayarose gel and ligated to plasmid pUC 18. E.coli DHSa was transformed with the recombinant plasmids. Plasmid pMJ6/6.2.2 was obtained by hydrolysis and subsequent re) igati on.
pl~IJ6/8.1: Plasmid pMJ6/6 evas hydrolysed with the restriction enzymes C'lcrl and l3currHI, and a 1.1 kb fragment was eluted from an agarose ';el and ligated to plasmid pBluescript II KS. G.coli DHSa was transformed with the recombinant plasmid.
~MIJ6/10: Plasmid pNIJ6/6 was hydrolysed with the restriction enzymes I'.nI
and ,ferlI, and a 1.5 kb fragment was eluted from an agarose gel and ligated to plasmid pUC 1 S. l:.coli DHSa was transformed with the recombinant plasmid.
Ap S6/3 P(asmid pAS6 was hydrolysed with the restriction endonuclease BnrnHI, and a 2.8 kb BcrnrHI fragment was eluted from the agarose gel and li~~ated to plasmid pUC 18; the recombinant plasmid was then transformed into L;.coli DHSa.
pAS6/3.1: Plasmid pAS6/3 was hydrolysed with the restriction endonuclease HirrcIl, and a 1.1 kb fragment was ligated into pUC 18, which had been hydrolysed with HincII, and the recombinant plasmid was cloned into E.coli DHSa.
pAS6/3.2 Plasmid pAS6/3 was hydrolysed with the restriction endonuclease S'alI, and a l .2 kb fragment was ligated into pUC 18, which had been hydrolysed with ,fcrlI, and the recombinant plasmid was cloned into E.coli DHSa.
pAS6/3.3 Plasmid pAS6 was hydrolysed with the restriction endonuclease I'.stl, and a 1.45 kb fragment was eluted from the ~,el and ligated to pUC 1 S.
l:.cwli DHSa was transformed with the recombinant plasmid.

Le A s? ~ 19-Forei~,n Countries _ 2j _ 11. Subcloning of ptasmid pNldl Mp IJl/l Plasmid pMJI was hydrolysed with the restriction endonuclease ,S~WI, and a ,.3 ~b Sphl fragment (0.6 kb SphIlP.sII fragment ligated to pUC 18) was eluted from the a'~arose gel. This fragment was religated and the recombinant plasmid was cloned into E.coli DHSa.
l~'p IJ 1 /2 Plasmid pMJ 1 was hydrolysed with the restriction endonuclease .S'crlI, and a 3 9 kb .S'a/I fragment ( l .2 kb ScrlIlP.sII fragment ligated to pUC 18) was eluted from the agarose gel. This fragment was religated and the recombinant plasmid was cloned into L.coli DHSa..
WJl/3 Plasmid ph'IJl was hydrolysed with the restriction endonuclease SaII.
and a 4. l kb S'.sll/P.sII fragment ( I .4 kb S.rtI/P.r~I fragment ligated to pUC
18) was eluted from the a~arose gel. This fragment was religated and the recombinant plas-mid was cloned into G.coli DHSa..
~VIJI/4.1 Plasmid pMJI was hydrolysed with the restriction endonuclease .fcr/I.
I ~ and a 0.9 kb SaIIlSnrcrI fragment was eluted from the a~;arose ~Jel and 1 i ~,ated to plasmid pUCl8. The recombinant plasmid was transformed into l::coli DHSoc l2. Preparation of snbclones from pASS/6 The pASS/6 subclones were prepared using a double-stranded Nested Deletion Kit (Pharmacie, Freiburg, Germany). 10 Itg of pASS/6 DNA were prepared as des-cribed in Example I and hydrolysed with 10 U each of ,~~7nI and f.~uI. The sub-sequent incubation with exonuclease III was carried out in accordance with the producer's instructions for a total of 20 min. Aliquots corresponding to a quantity of approx. 2.5 yg of DNA were removed from the reaction mixture at intervals of min. The aliquots were treated with Sl nuclease at 20°C for 30 min, in ac-cordance with the producer's instructions, in order to prepare non-protruding DNA
ends. These DNA molecules were then religated with T4 li~,;ase and cloned into l::c«li DHScc.

Le .a 32 3 19-Forei~ n Countries -26_ 13. Sequencing the DhIA of Actinnplanes sp. acarbose biosynthesis genes The plasmids described in Examples 8 to 11 were sequenced. From 6 to 8 p'; of plasmid DNA from a preparation (see Example 1) were employed in the se-quencin~ reaction. The sequencing reaction was carried out using the Auto-read sequencin;; kit (Pharmacia, Freiburg, Germany). The standard protocol for sequencing dsDNA was used. In order to make it possible to use the A.L.F.
(automated laser fluorescence (DNA) sequencer) to analyse the nucleotide sequence, the fluorescein-labelled universal and reversed sequencing primers were used as starter molecules for the sequencing reaction (see Tab. ?). For preparin~, the ~,;el, 8 ml of Hydro Link Long Ranger (Serva, Heidelberg), 33.6 '; of urea, S
ml of l0~ TBE buffer and H,O to make up to 80 ml were mined, sterilized by filtration and degassed for 1 minute. The polymerization was initiated by adding 3 ~0 pl of 10% (w/v) ammonium persulphate and 40 ul of N,N,N',N'-tetramethyl-eth5~lenediamine. The solution was poured into a ~,;el mould (SO~ SOx0.0~ cm).
I ~ Electrophoresis was carried out at 3S W and a constant temperature of 45°C. 1 X
TBE buffer was used as the running buffer. A linked-in computer (Compaq 3S6/20e) was used to process the measured fluorescence into a DNA sequence, with the computer also serving to control the electrophoresis unit (A.L.F.
l~1anager 2. ~ program; Pharmacia, Freibury~).
l:l. Transformation of .S. lividans ,~'. liniclcrn.o TK23 and 1326 were protoplasted and transformed usin<: the method of Babcock and Kendrick ( 1988), with the cells being ~,~rown in TSB-PEG S000.
1~. Overexpression of AcbC
l~.l Overexpression of AcbC in E.coli ~S The DNA sequence of the crchC gene shows two possible translation start points for AcbC. Although start point l represents the probable start of AcbC due to a more si~niticant ribosome binding site, both possible AcbC proteins were overet-pressed. For this, plasmids pETI la and pETl6b (Nova~en, Heidelber~) were used for expressing in l~.cnli. In order to ensure an optimal translation start for the ex-pression, the ATG start codon of the pET vectors, which is at a suitable distance Le .-~ 32 31~-Forei~,n Countries from an l:.cwli-like RBS, should be used. In order to do this, it is necessary to construct an ~elc~I recognition sequence at the start codon of crchC_'. The oliyo-nucleotides AS7 (sequence position 6617) and AS8 (sequence position 6638) were employed for synthesizing, an NcleI reco~,Tnition site at the two possible start codons. The oligonucleotide AS9 binds to the DNA 66 by downstream of a f3crrrrHI recovnition sequence at sequence position 6887. Usin~~ the PCR
method (see Example 8), two DNA fragments were amplified which were used for ex-pressin~, the two possible AcbC proteins. The primers were annealed at 45°C for ~40 sec, and primer elon~,~ation took place in 30 sec. The two amplified DNA
fra~_-menu were hydrolysed with the restriction endonucleases ,~'c/c~I and BcrrrrHI
and correspondingly ligated into vectors pETI la and pETl6b. The 2.2 kb BcrrrrHI
fra'T-ment was isolated from recombinant plasmid pAS2 [EP A 0 730 029/DE 19507214] and fused to the cloned PCR fra<,ments by way of the f3crmHI recognition site. After the orientation of the 2.2 kb BamHI
fra';ment I5 had been checked, the complete crchC' ~~ene was present in the expression vectors.
The expression vectors were yTiven the designations pAS8/1 - pAS8/~I (Fiyl.
~1) In addition, the complete ochB reading frame (in the opposite orientation) and the be-vinnin~, of the crchA gene are present on the cloned DNA in the expression vectors. For each of the vectors, it was posisble to identify an additional protein which was expressed in IPTG-induced L~~.coli BL2lpLys cultures. The sizes of the overexpressed AcbC proteins are viven in Tab. 4. However, all the proteins were synthesized in the form of insoluble inclusion bodies.
Tab. ~: The structures of the AcbC expression vectors for expression in E.ouli Recombinant Start point Vector plasmid Recombinant plasmid protein pASB/1 1 pETI la 42 kDa pAS8/3 2 pETlla 41 kDa pAS8/2 1 pETl6b 4-~.5 kDa pASB/4 2 pETl6b 43.5 kDa Le .-~ 32 319-Forei~_Tn Countries -2s-15.2 Overerpression of AcbC in .S liaiclans 1326 The AcbC protein was expressed in S. Imdcal.s 1326 using the plasmid vector pIJG02l [Takano, E., et al. (1995)]. A fragment encompassin~l only the coding region of the achC gene was amplified from chromosomal DNA using the PCR
S method [M'Iullis and Falloona, (1987)]. The oligonucleotide AS-C1 and AS-C2 were employed for the PCR, with the AS-C 1 primer (sequence position 6089) being used to construct an NcleI recognition sequence at start codon 2 of the crchC' gene. Oligonucleotide AS-C2 binds to sequence position 7882 and was used to construct an GcnRI recognition sequence. The primers were annealed in 20 sec at SO°C, and the primers were extended in 40 sec. The resultinv~ crchC DNA
fragment was first of all blunt-end cloned into the pUC 18 vector and the DNA sequence was checked for correctness following the PCR. This recombinant plasmid.
containing the cloned achC' gene, was given the designation pASB/s.l. Plasmid p.ASB/~.I was hydrolysed with the restriction endonucleases NcIc~I and EcnRI
and the DNA was separated on an agarose gel and then eluted from the matrix. The uchC fragment which had been prepared in this way was ligated into Vector pIJG021. The recombinant expression plasmid was given the desiv~nation pASB/7.2 (Fig. S). Protoplasts of .S. Irorclau.s 1326 were transformed with plasmid pASB/7.2.
The resulting clone was used to overexpress the AcbC protein in soluble form in thiostrepton-induced cultures (Fig. 6).
1G. Overexpression of AcbE in .S. liviclans TK23 The achE gene was isolated from plasmid pASS/G.9-6 by hydrolysinv~ the plasmid with restriction endonucleases EcoRI and HindIII. After the DNA had been separated on an agarose gel, and the 3.8 kb EcoRIlHindIII fragment had been eluted from the matrix, this crchE fragment was appropriately ligated into vector pC.'u'L219 [J. Wehmeier, U.F. ( 1995)]. The intention was to use a possible promoter sequence on the 200 by upstream region in these vectors for sub-sequently expressing AcbE in S. lir~iclau.r (see Tab. 5). The recombinant plasmid was given the designation pAS 1 1 (Fig. 7).

Le .-~ s2 s 19-Foreis:n Countries Tab. ~ The intercistronic region between genes achE and achD. Inverted repeat (IR) and direct repeat (DR) sequences which could be involved in regulation are underlined.
CGT GGA CCC TCT CTC GCG .4TC GCT GGG ACG CTA GCC CGG CGG GAG ACG TGC CCG CAA
GAA
AcbE GCA CCT GGG .-1GA G 1G CGC TAG CGA CCC TGC GAT CGG GCC GCC CTC TGC ACG
GGC GTT CTT
IR I
CTT GCT GTT TT.-~ GC A .4GA AGT TTC AGA ACC GGG ACG GCA CGC TGT AGC CC.~a GAT
CAT AGA
GAA CGA CAA AAT GCT TCT TCA AAG TCT TGG CCC TGC CGT GCG ACA TCG GGT CTA GTA
TCT
Hind III IR 2 TAC TTA .4AG CTC TGC GCA AGC TTA GGG TTG AAG TGG CGG TGA TGC ATC CAT CAC TGT
ATG
ATG AAT TTC GAG ACG CGT TCG AAT CCC AAC TTC ACC GCC ACT ACG TAG GT.~, GTG ACA
TAC

CGC ATC TGA ATG ACG TC'I' TCT GCA AGT TCT TGC AGC GGT CTC CGG GCC CTG CCC TTC
CTC
GCG TAG ACT TAC TGC AGA AGA CGT TCA AGA ACG TCG CCA GAG GCC CGG GAG GGCr A.-1G
GAG
GTC ATC CCT TCA CAA GGA GAA GCT C AcbD
CAG TAG GGA AGT GTT CCT CTT CGA G
s Protoplasts of S. liviclans TK23 were transformed with plasmid pAS 1 1. Both in the case of the S. liaiclan.r TK23/pAS 1 1 samples and in the case of the Ac~ij~uplcurc~., sp. samples, it was possible to detect an extracellular protein of I 10 kDa in size in the supernatants from M1D 50 cultures (Fig. 8). This size corresponds to the mole-cular wei~,ht of the protein derived from crchlJ. The identities of these proteins were demonstrated by appropriate enzyme tests (see Example 19.2) and by se-quencing the N-terminal amino acids (see Example 18). It was not possible to detect any corresponding protein in the supernatant from the control S.
liaiclcrj~., TK23/pUWL219 culture in MD 50 medium. For this reason it is probable that the possible promoter sequence (Tab. ~) upstream of the achE gene is responsible for expressing AcbE in the S. liaidar~.slpAS l 1 cultures in MD 50 medium.

Le A 32 319-Forei~,n Countries 17. Gel-electrophoretic preparation of proteins Proteins were separated in denaturing SDS polyacrylamide gels, and were stained with Coomassie dye, in accordance with the method of Lugtenberg ( 1975). 8% or 1 1°i° gels were used depending on the sample.
Gel composition (l l% gel) Resolving gel I Stacking gel Solution A* 8.0 ml Solution B* 0.64 ml APS (2 mg/ml) 0.8 ml O.15 ml l0% (w/w) SDS 0.64 ml 0.064 ml l0 0.75M tris/HC1, pH 8.8 16 ml 0.25M tris/HC1, pH 6.8 3.2 ml Distilled water 6.56 ml TEVIED 25 pl 10 pl * see buffers and solutions 1 s The electrophoresis was carried out using either a SERVA blue vertical l00/C ap-paratus (gel dimensions, 80 X 100 X 0.75 mm) or using a Renner twin vertical ap-paratus (gel dimensions, 180 X 170 X 1 mm).
The protein concentrations of the samples to be analysed were determined by means of the BioRad, Munich, protein assay, with BSA being used to construct a ~0 calibration curve. The VIIL Dalton marker ( 14.2 kDa - 66 kDa) and the high molecular wei~,ht standard (29 kDa - 210 kDa) supplied by Si~,ma (Deisenhofen) were used as standards for the molecular weights of the separated proteins.
18. Determination of the N-terminal amino acid sequence The N-terminal amino acid sequences of the AcbE protein derived from 2~ Actirmplafre.s sp. and the S. liviclan.o TK23/p.AS 1 I clone were determined for comparison. For this, 50 ml cultures were incubated in W 50 medium for 3 days.
The cells were removed by centrifugation and the culture supernatants were di-alysed at 4°C for 12 h against buffer (5 mM tris/HCI, pH 7.5, 1 mM CaCI-). The supernatants were subsequently freeze-dried for 48 h and the freeze-dried residues Le A 3? s 19-Forei~~n Countries then taken up in 1.5 ml of sample buffer. The culture supernatants which had been prepared in this way were separated by SDS-PAGE using the Renner twin vertical apparatus (gel dimensions, 180 %~ 170 X 3 mm). A gradient gel (5% -~ 10%) was employed in order to ensure the best possible separation of the AcbE protein from s other extrace(lular proteins. The proteins were transferred from the SDS
polyacryl-amide s:el to a polyvinyl fluoride (PVDF) membrane (Amersham Buckler. Braun-schweig) in a semi-dry electrophoretic procedure using a Fast Blot B33 apparatus (Biometra, Gottin~;en) in accordance with the manufacturer's instructions. The transfer was carried out at 2~0 mA for 45 min. Running buffer diluted l:? (see Buffers and Solutions) was used as the transfer buffer. The membranes were stained for 30 min and then destained with destaining solution (see Buffers and Solutions). In order to determine the N-terminal amino acid sequence, the blot specimen was washed twice with on each occasion 100 ~l of 50°'o methanol prior to the sequencing in order to remove excess salts. After drying, the sequence I > analysis was carried out using a blot cartridve and a filter which had been pre-treated with polybrene. The fast blot cycle was used for the sequence analysis.
The result is shown in Tab. 6.
Tab. 6: The results of sequencing the N-terminal amino acid sequence of the AcbE protein from Acti~roplcrrte.s~ sp. and the S.liniclar~.s TK23/pAS 1 l ?0 clone Organism N-terminal amino acid sequence determined AC'/lill)f7IClilP.1 Sp. Sequence l: ESPPDRPSHAEQLYL

Sequence 2: SPPDRPSHAEQLYL

S.luiclajt.s TK 23/pASI Sequence 1: ESPPDRPSHAEQLYL
l Sequence 2: SPPDRPSHAEQLYL

Le .-~ s? s 19-Forei=n Countries - j2 _ 19. Determination of enzyme activities 19.1. Determination of valiolone synthase activity For overexpressing AcbC, l0 ml of YEME medium (~0 Irg/ml Km) were inocu-lated with a suspension of S. llvldan.s 1326/pAS8.7.2 spores. After culturin<, for from 1 to 2 days, the cultures were in the early logarithmic phase of ylrowrth. At this time, the cultures were induced with 7.5 ~rg/ml thiostrepton. The cultures were then harvested at 20 h after the induction. The sedimented cells were taken up in I.5 ml of cold disruption buffer (see Buffers and Solutions) and carefully disnrp-ted by means of ultrasonication. The cell debris were removed by centrifu~~ing at 15,000 g for 30 minutes at 4°C. The AcbC extract reduired for the enzyme test was prepared by dialysing ( 12 h) at 4°C against 2.5 litres of disruption buffer. It was possible to store this extract at -20°C for two months without any noticeable loss of activity. The protein content of the extract was determined using the Bio-rad, Munich, protein assay and 15 erg were analysed in an SDS-PAGE r~rn (Fibs.
6). The enzyme test was carried out, at RT for 2 h, in a 20 mM P buffer (pH
7.5) containing 40 ~rM CoCI,. 20 erg of total protein from the AcbC extract and 8 mM
sedoheptulose 7-phosphate were employed in the enzyme test. In addition. the re-action mixture contained 2 mM NaF in order to inhibit unspecific phosphatases in the extract. The reaction volume was l00 lrl. The results of the test were deter-mined by analysing 25 lrl from a reaction mixture by TLC on silica gel films usin« butanol/ethanol/H,O (9:7:4) as the mobile phase. The organic compounds were visualized by spraying the TLC films with cerium reagent (see Buffers and Solutions) and then incubating the films at 90°C for 15 minutes in a drying, oven.
A mixture of valienone and valiolone (Prof. H.G. Floss, Seattle) was used as the reference substance.
The AcbC protein expressed in S. linic~alzs specifically converted sedoheptulose 7- -phosphate (Fig. 9). However, the reaction product exhibited a rni,Traton~
be-haviour in the TLC which differed to a minor extent from that of the valienone/valiolone standard. The possibility that the reaction buffer had decreased the distance mivrated by the reaction product on the silica gel film could be ex-cluded (Fig. 9, Track 5).

Le A 3? 319-Forei~,n Countries _33-19.2. Determination of a-amylase activity The cultures of S. linidarrs TK23/pAS 1 1 were grown in TSB medium and MD SO
medium in the presence of 25 pg/ml thiostrepton. The cultures were harvested after having been incubated for 3-4 days. The cells were removed by centrifu;ing S (; 500 g) for 10 min at 4°C. The supernatants were dialysed at 4°C for 12 h a'lainst buffer (2S mM tris/HCI, pH 7.5, 1 mM CaCI,). S00 pl volumes from the supernatants which had been prepared in this way were dried in vacuo and the dried residues were taken up in sample buffer (see buffers and solutions); the pro-teins in the supernatants were separated in an SDS-PAGE run (Fib. 8). Super-natants from Actirrnplcrrre.c sp. cultures which had been grown under identical conditions were used as references. The a-amylase activity was determined by measuring the decrease in the turbidity of a l% starch suspension. In order to carry out a measurement, 100 pl of dialysed culture supernatant were mixed with 900 pl of starch suspension and the decrease in the extinction at 300 nm with time IS was recorded [Virolle, NLJ., et al. (1990)]. Corresponding investigations using a f3crcillrr.o sp. a-amylase (Si~,ma, Deisenhofen) were carried out for comparison. The results are presented in (Fig. 10). In the test, it was not possible to inhibit the AcbE activity in Aclirroplarre.s sp. MD SO cultures and in S. liuiclarr.s TK23/pAS 1 l M1D 50 cultures with 1 mMI acarbose. On the other hand, the background activity ~0 in .~. liuiclcrrr.s TK23/pUWL219 MDSO cultures was inhibited by 0.1 mM
acarbose.
The l3ncilhr.s sp. a-amylase was also inhibited by 0.1 mNI acarbose (Fi;. l0).
Buffers and Solutions:
Media for ~~rowin~ bacteria LB medium:

5 Tryptone 10 g NaCI 10 g Feast extract S g H,O to 1000 ml The pH was adjusted to 7.S with 4M NaOH

Le A s? s 19-Forei<,n Countries _34_ MD SO medium Solution I

VIDSO starch hydrolysate 70 g ( NH,~ ), S O,~ S

Yeast extract 2 g H,O to 400 ml Solution II

K=HPO~ 1 g KH,PO~ l g Trisodium citrate S

H,O to 400 ml pH adjusted to 7.0 with 1M NaOH

Solution III

MIv;CI,~6H,0 I g 1 S FeClw6H,0 0.25 CaCl,~2H~0 2 g H,O to 200 ml After mixing, the solutions are ized by filtration.
steril TSB medium:
?0 Tryptone-soya broth (Oxoid) 30 H,O to 1000 ml TSB PEG 8000 [see Babcock et al. (1988)]:
Tryptone soya broth (Oxoid) 30 g/1 PEG 8000 SO g/1 S after autoclaving:
Glycine (20%) 2S ml MI~CI, (2.SM) 2 ml Le :-~ s2 s 19-Forei«n Countries YEW [Hopwood, D.A., et al. ( 1985)]

Yeast extract 3 g/l Peptone S
g/1 l~~Ialt extract 3 g/1 Glucose 10 g/I

Sucrose 340 y>/I

after autoclaving MgCI, (2.SM) 2 ml Standard preparation of plasmid DNA [modified from Birnboim and Doly ( 1979)]
Nlix I SO mM glucose SO mM tris/HCl (pH 8.0) 10 mM EDTA (pH 8.0) S mg/ml lysozyme Mix II 200 mM NaOH

1 S 1 % (w/v) SDS (Sodium dodecyl sulphate) i~~Iix III 3M potassium acetate 1.8M formate TE buffer (pH 8.0) Tris/HCl 10 mM
Na, EDTA 1 mM
DNA-DNA hybridization 20-~ SSC
3M NaCI
0.3 M Na citrate ~S Preh~bridization solution:

6 ° SSC
O.OIM sodium phosphate buffer, pH 6.8 1 mM EDTA
O.S% SDS
0.1% skimmed milk powder Le .~ _p2 ~ 19-Forei<,n Countries Hybridization solution:
.After the labelling reaction, the acb probe is added to 15 ml of prehybridization solution.
6X Postwash s GX SSC
0.5% SDS
DNA sequencin;:
TBE buffer (pH 8.0) lM Tris base 0.831VI Boric acid 10 mVl EDTA
Denaturing, polvacrvlamide gel electrophoresis of proteins 5 X sample buffer Glycerol 25 ml I s SDS S y;
BPB 2.5 mg 2-Mercaptoethanol 12.5 ml 0.625M Tris/HCl (pH 6.8) to 50 ml Electrode buffer Tris/HCl (pH 8.3) 25 mM
Glycine 190 mM
SDS (w/v) 0.1%
pH adjusted before adding SDS
Solution A
2s :~crylamide 44 g N,N-methylene-bisacrylamide 0.8 H.O to l00 ml Le .~ , 2 3 1 ~-Forei ~~n Countries _ J7 _ SOllltlOn B
Acrylamide 30 g N,N-methylene-bisacrylamide 0.8 g s H,O to 100 ml Dve solution SERVA blue 0.15%
R-2~0 (w/v) Methanol (v/v) 50%
.acetic acid (v/v) 10%
Destainin~ solution Mlethanol (v/v) 25°~0 .Acetic acid (v/v) 10%
AcbC disruption buffer l ~ K,HPO~/KH,PO~ (pH 7.5) 20 mM
NAD 0.2 mM
DTT 0.5 mM
oc-Amylase test phosphate buffer K,HPO~/KH,PO;~ (pH 6.8) 50 mM
KCl 50 mM
Cerium rea~,ent Mlolybdophosphoric acid 1.25 Cerium(IV) sulphate 0.5 H,SO~ 3 ml H,O to SO ml Le .~ ,? 319-Forei~=n Countries _ Js _ Literature:
Babcock, MLJ., Kendrick, K.E. ( 1988) Cloning of DNA involved in sporulation of Streptomyce.s yisc~u.o.
J. Bacteriol. 170, 2802-2808.
Birnboim, H.C., Doly, J (1979) A rapid alkaline extraction procedure for screening recombinant plasmid DNA
Nucleic Acids Res.: 7, 1513-1523 Drepper, A., Pape, H. ( 1996) l0 Acarbose 7-phosphotransferase from Aclinopla~le.s sp.: purification, properties, and possible physiological function J. Antibiot., 49. 664-669 Goeke, K., Drepper, A., Pape, H. ( 1996) Formation of acarbose phosphate by a cell-free extract from the acarbose 1 ~ producer Aclirropla~re.s sp.
J. Antibiot., 49, 661-663 Hanahan, D. ( 1983 ) Studies on transformation of Esc6ierichia coli with plasmids J. Nlol. Biol.: 166, 557-580 20 Hershber~,er, C.L., et al., ( 1989) Genetics of Molecular Biology of Industrial Microorganisms Amer. Soc. Microbiol., p. 35-39, p. 58, p. 61-67, p. 147-155.
Hopwood, D.A., et al., ( 1985) Genetic manipulation of Streptonayce.o;
~5 A laboratory manual; The John Innes Foundation, Nor<vich, England Lugtenberg, B., et al. ( 1975) Electrophoretic resolution of the "major" outer membrane protein of I:,~cherichia coli into four bands.
FEBS Lett. 58, 254-258.
,0 Vlerson-Davies, L.A., Cundliffe, E. (1994) Analysis of five tylosin biosynthetic genes from the tvIIBA region of the .Streplomyce.s,fi~adiae genome.
i~'Iol. Nlicrobiol., 13, 349-355.
Mlullis, K.B., Falloona, F.A. (1987) 3S Specific synthesis of DNA irt vitro via a polymerase catalysed chain rection.

Le .~ ~? 319-Forei~Tn Countries Methods Enzvmol., 155, 335-350.
Sambrook, J., et al. ( 1989) Mlolecular cloning a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, N.Y., USA.
Saner F.; Nicklan S.; Coulson A.R. ( 1977) DNA sequencing with chain determining inhibitors Proc. Natl. Acad. Sci. USA, 74, 5463-5467 Southern E.MI., ( 1975) Detection of specific sequences amon~~ DNA fray~ments separated by gel electrophoresis J. Mlol. Biol., 98. 503-521.
Takano, E., et al . ( l 995 ) Construction of thiostrepton-inducible, high-copy-number expression vectors for use in Sl~~eploy~cc~.r spp.
Gene, 166, 133-137.
Virolle, M.J., Morris, V.J., Bibb, M.J. (1990) A simple and reliable turbidimetric and kinetic assay for alpha-amylase that is readily applied to culture supernatants and cell extracts.
J. Industrial Microbiol., 5, 295-302.
Wehmeier, U.F. ( 1995) ~0 New multifunctional E.sche'~ichia coli-Slneptomyco.s shuttle vectors allowing, blue-white screening on XGaI plates.
Gene, 165, 149- l 50_ Le A 32 ~ l9-Forei~~n Countries Figure legends Fib. I Restriction map of the approx. 18 kb sequenced segment from the genome of :-~G'llil0~)ICTiIC'.1' sp. SE50/1 l0 (cf. Fi;. 2). The thick black line indicates the region claimed in the original patent, which region partially overlaps s the achCBA genes (order as indicated from left to right).
Fiy,. 2 Gene map of the acarbose biosynthesis clusters.
Fig. ~ DNA sequences from the acarbose biosynthesis cluster.
Fig. 4 The recombinant plasmids which were constructed from plasmids pETI la and pETl6b for expressing AcbC in E.coli.
l0 Fib. 5 The recombinant plasmid pASB/7.2 which was constructed from plasmid pIJ6021 for expressing AcbC in S. Ilvrdczrzs 1326.
Fi;,. 6 Gel-electrophoretic separation of cell lysates (see Example 15.2). The expression of AcbC (42 kDa) in the thiostrepton-induced S. liuiclcrll.s 1326/pASB/7 culture is shown in track 3.
I ~ Fib. 7 The recombinant plasmid pAS l l which was constructed from plasmid pU~VL219 - for expressing AcbE in S. lioiclalr.s TK ?3.
Fib. 8 Gel-electrophoretic separation of proteins from culture supernatants (see Example 16). The expression of AcbE (l10 kDa) can be seen in track 2, track ~ and track 6.
20 Fig. 9 Detection of AcbC enzyme activity by means of thin layer chromatoylraphy on silica gel films (see Example 19.1 ).
1 ) Extract from Aciilloplalle.s sp.
2) Extract from S. liviclarl.s 1326/pJ6021 ;) Extract from .S. llnlclall.s 1326/pASB/7.2 (extract stored at -20°C
for 2, 2 months) 4) Extract from S. lividalls 1326/pASB/7.2 (boiled) Le A 3? 319-Foreign Countries s) Extract from S. liuiclcrn.s l3?6/pASB/7.2 (valienone instead of sedoheptulose 7-phosphate as the substrate) 6) Valiolone/valienone standard 7) Sedoheptulose 8) Sedoheptulose 7-phosphate 9) Extract from S. lividafrs 1326/pASB/7.?
(extract freshly prepared) Fib,. 10 Determination of the a-amylase activity in culture supernatants. The bacteria are grown in MD50 medium. No activity was measured with boiled culture supernatants. The duration of the test was 6 min. For comparison, 2.8 mU of purchased a-amylase were used in each of samples 9-11.

Claims (2)

Patent claims

1. Acarbose biosynthesis gene cluster comprising DNA from Fig. 3.

2. Acarbose genes comprising DNA from Fig. 3