EP0968294A1 - ACARBOSE (ACB) CLUSTER FROM $i(ACTINOPLANES) SP. SE 50/110 - Google Patents

ACARBOSE (ACB) CLUSTER FROM $i(ACTINOPLANES) SP. SE 50/110

Info

Publication number
EP0968294A1
EP0968294A1 EP98906953A EP98906953A EP0968294A1 EP 0968294 A1 EP0968294 A1 EP 0968294A1 EP 98906953 A EP98906953 A EP 98906953A EP 98906953 A EP98906953 A EP 98906953A EP 0968294 A1 EP0968294 A1 EP 0968294A1
Authority
EP
European Patent Office
Prior art keywords
fragment
dna
pas5
plasmid
acarbose
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP98906953A
Other languages
German (de)
French (fr)
Inventor
Anneliese Crueger
Heiner Apeler
Werner Schröder
Hermann Pape
Klaus Goeke
Wolfgang Piepersberg
Jürgen Distler
Paz Marta Diaz-Guardamino Uribe
Martin Jarling
Ansgar Stratmann
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Bayer AG
Original Assignee
Bayer AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bayer AG filed Critical Bayer AG
Publication of EP0968294A1 publication Critical patent/EP0968294A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/26—Preparation of nitrogen-containing carbohydrates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/365—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Actinoplanes (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/76—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Actinomyces; for Streptomyces

Definitions

  • the present invention relates to the isolation of further genes of the
  • the most potent inhibitor of this group is the compound O-4,6-ddedeoxy-4 - [[IS- ( l S, 4R, 5S, 6S) -4,5,6-t ⁇ hydroxy-l- (hydroxymethyl) -2-cyclohexen-l-yl] -arruno] - ⁇ -D-glucopyranosyl- (l - »4) -O - ⁇ -D-glucopyranosyl- (l ⁇ 4) -D-glucopyranose described as acarbose [DE 23 47 782]
  • Acarbose is a potent ⁇ -glucosidase inhibitor which is used as an oral antidiabetic under the brand name Glucobay ® for the therapy of diabetes melhtus.
  • the secondary metabohten acarbose is formed by Actinoplanes sp SE 50
  • the deoxyglucose part of the acarbose molecule is formed in accordance with the biosynthesis of 6-deoxy sugar residues from various antibiotics (eg aminoglycosides such as streptomycin, kasugamycin, macrolides such as erythromycin, tylosin, polyenes such as amphote ⁇ cin A, B, nystatin, anthracycles, such as daunorubicin, glycopeptides, such as vancomycin) Therefore, a gene probe and heterologous PCR polymer pairs were derived from highly conserved protein regions of known dTDP-glucose-dehydratase enzymes
  • antibiotics eg aminoglycosides such as streptomycin, kasugamycin, macrolides such as erythromycin, tylosin, polyenes such as amphote ⁇ cin A, B, nystatin, anthracycles, such as daunorubicin, glycopeptides,
  • Acarbose 7-phosphotransferase (acarbose kinase) could be involved in producing a form of transport of acarbose from the cell.
  • acarbose 7-phosphotransferase is seen as part of a self-protection mechanism
  • Acarbose strongly inhibits the cytoplasmic ⁇ -glucosidase of the production strain, but the compound phorphorylated by acarbose 7-phosphotransferase does not, so that the cell's own substrate metabolism is not disturbed.
  • Such protective mechanisms have been described for many producers of aminocychtol antibiotics
  • the cluster of the biosynthesis genes and other genes of the metabolism of acarbose from Actinoplanes sp SE 50/1 10 is described in a section of 18 kb (see FIGS. 1-3).
  • This finding is for the biotechnological production of
  • Acarbose biosynthesis genes are essential for a targeted improvement of the production process e.g.
  • a recombinant DNA molecule that contains genes for the biosynthesis of acarbose and acarbose hsmologists, which are arranged in the gene cluster according to Figure 2.
  • genes acbA and acbB with high probability encode enzymes of acarbose biosynthesis, since they have high sequence identity of AcbA and AcbB to be knew bacterial dTDP-glucose synthases or dTDP-glucose 4,6-dehydratases.
  • the similarity of the protein sequences to the next known representative of the two enzyme families is far above that of any other pairs of functionally identical proteins from both groups. It is surprising that AcbA has its closest relatives among Streptomycete proteins, while AcbB is more closely related to various RfbB proteins of Gram-negative bacteria.
  • the acbC gene encodes a probable enzyme of acarbose biosynthesis, since the enzyme AcbC is related to AroB proteins, dehydroquinic acid synthases and, after overexpression in Streptomyces lividans, shows an enzyme activity which - as expected - heptulose phosphates (e.g. sedoheptulose-7 -phosphate) to products which have properties similar to those of Va enon and Va olon (possible precursors of acarbose biosynthesis), but not identical to these compounds
  • genes acbK (acarbose-7-K ⁇ nase), acbL (keto sugar or sugar alcohol oxidoreductase) and acbM (unknown function) as well as the acbN gene (direct connection to the reading frame acbL and acbC is indicated by overlapping start / stop codons) probably encode enzymes Acarbose biosynthesis, since they all form a probable operon (transcription unit) together with acbC and possibly also acbQ and are likely to be read translationally coupled.
  • the acbHFG genes encode a probably extracellular sugar-binding protein, AcbH, and two typical membrane components, AcbF and AcbG, a bacterial sugar transporter of the ABC-Importer type. They are probably involved in or metabolize the metabolism of acarbose by ingestion of oligo-maltodextins
  • Acarbose as a transport vehicle for short ohgo- ⁇ -1,4-glucans (higher homologues of acarbose) by being taken into the cell
  • the amylomaltase-like gene product (AcbQ) of the acbO gene could also be involved in such a process
  • the invention further discloses
  • the 2.2 kb Ba Hl fragment which by means of A gene probe, which was obtained by PCR polymer and was derived from highly conserved protein regions of known dTDP-glucose dehydratase enzymes, is described in the patent application [EP A 0 730 029 / DE 19507214]
  • a method for isolating biosynthetic genes from acarbose-related natural substances in actinomycetes e.g. for vahdamycin, ohgostatine (trestatin), adipo- Process for increasing the acarbose synthesis performance in actinoplanes by increasing the gene dose for rate-determining biosynthetic enzymes, more effective promoters for rate-determining biosynthetic enzymes,
  • a method for changing transport mechanisms with a view to an improved transport of substrates into the cell or a more effective removal of acarbose from the cell is described.
  • a method for expression in heterologous host strains eg pseudo-oligosaccharide-forming Streptomycetes as well as in other Streptomycetes such as Streptomyces lividans, in fast-growing bacteria such as E. coli or in yeasts and fungi
  • heterologous host strains eg pseudo-oligosaccharide-forming Streptomycetes as well as in other Streptomycetes such as Streptomyces lividans, in fast-growing bacteria such as E. coli or in yeasts and fungi
  • the plasmid pAS2 was prepared from E coli DH5 ⁇ using the "boiling method" or by alkaline lysis and using the BamHl residual endonuclease hydrolyzed The resulting 2.2 kb Ba HI fragment was isolated and labeled with j2 P-labeled deoxynucleotides by so-called "nick translation”.
  • This radioactively labeled fragment was used as a gene probe for the isolation of acarbose biosynthesis genes and is hereinafter referred to as acb -Sonde-II designated
  • the second gene probe was isolated from the plasmid p AS 5/7 3
  • the Sphl-Sstl fragment was isolated and radioactively labeled as described above.
  • this gene probe is referred to as acb-Probe-III isolated from plasmid pAS6 / 3.
  • the BamHl fragment was isolated and radioactively labeled as described above. This probe was given the name acb-probe-I V
  • Acarbose biosynthesis genes were isolated in two ways as follows 1) Chromosomal DNA from Actinoplanes sp was hydrolyzed with the restriction enzymes Ssf, Bglll and Pstl, separated by gel chromatography and by "Southern" hybridization with acb probe II (Sstl and BgHl hydrolysis) and acb probe III (P hydrolysis) after a homologous DNA sequence.
  • the S tl fragment hybridizing with the gene probe has a size of approx. 10.7 kb and the 5 g // I fragment of approx. 10 2 kb.
  • the 10.7 kb Etl fragment and the 12 kb .Sg ZI fragment were eluted from the gel, ligated into the vector pUC18 or pBluescript II KS and cloned into E.co/i DH5 ⁇ .
  • the resulting plasmids were given the names pAS5 (SstI fragment) and pAS6 (5g / I fragment) one with the Etl fragment overlapping 2.8 kb Rs II fragment, which hybridized with the gene probe acb probe III, was cloned into the vector pUC18 and designated pMJl
  • a GEM 12 phage gene bank of genomic DNA from Actinoplanes sp was screened with the probes acb probe III and acb probe IV by means of plaque hybridization. A total of 15 phages were isolated with the acb probe III, two phages with the acb probe IV, which total approx. 38 5 kb colinear Actinoplanes sp. Containing DNA with acarbose biosynthesis genes. The phages that were characterized in more detail bear the designations 10/3 and 5/4
  • pAS5 / l 7 0.46 kb PCR fragment
  • pAS5 / 18 0.26 kb PCR fragment
  • pAS5 / 19 0.27 kb PCR fragment
  • Plasmids constructed for the determination of the DNA sequence which contain DNA fragments with acarbose biosynthesis genes from Actinoplanes sp from plasmid pAS6 (cf. Example 6).
  • the DNA cloned in plasmid pAS6 has a 6.2 kb acarbose biosynthesis gene contained ßg / II / SstI fragment together with the plasmid pAS5
  • the following recombinant plasmids were constructed in the vector pUC 18.
  • pAS6 / 3 2.8 kb BamHl fragment from the plasmid pAS6 pAS6 / 3.1 1, 1 kb Hincll fragment from the plasmid pAS6 / pAS6 / 3.2 1, 2 kb SalI fragment from the plasmid pAS6 / 3 pAS6 / 3.3 1.45 kb Pstl Fragment from the plasmid pAS6 / 3
  • Plasmid pAS5 / l 7 Primer name sequence acbD / El 5 'GGCGGCGATTCGGCCTGCGCGG 3 1 acbD / E2 5' GCGGCGATGGCATGCCTGGCG 3 '
  • Plasmid pAS5 / l 8 primer name sequence acbD3 5 'ACCAGGCCGAGGACGGCGCCC 3 1 acbD4 5' AGCGGCATGTGCTTGACGGCG 3 '
  • Plasmid pAS5 / 19 Primer name sequence acbD5 5 'ACCGGCTCGAACGGGCTGGCACC 3' acbD6 5 'CCCTCGACGGTGACGGTGGCG 3' Primer for the amplification of the acbC gene:
  • Primer for the sequence reaction Primer name sequence universal primer 5 1 GTAAAACGACGGCCAGT 3 'reverse primer 5' GAAACAGCTATGACCATG 3 '
  • the N-terminal sequence analysis of the Acb ⁇ protein was carried out using the gas phase protein sequencer 473 A from Applied Biosystems (Forster City, CA., USA). The standard Fastblott protein sequencing program was used. The protein sequencer, the various programs, the breakdown cycles and the
  • PTH identification systems are described in the manual of the sequencer (User's manual protein sequencing system model 473 A (1989); Applied Biosystems Forster City, CA 94404, USA).
  • the detection of the PTH amino acids was carried out on-line with an RP-18 column (220 mm x 2 mm, 5 ⁇ material) from Applied Biosystems.
  • the PTH amino acids were identified and quantified using a 50 pmol standard.
  • the data was processed with Applied Biosystems 610A sequencer data system.
  • E coli DH5 ⁇ was incubated in LB medium at 37 ° C. Plasmid-bearing bacteria were kept under selection pressure (ampicillin, 100 ⁇ g / ml). The cultivation was carried out on a rotary duster at 270 rpm. Approaches were described as overnight culture (UK) which incubated for at least 16 h were
  • plasmid DNA For the preparation of plasmid DNA, the cells from 1.5 ml of a UK incubated under selection pressure were used. The plasmids were isolated by the alkaline SDS lysis method [Birnboim, HC, and J Doly (1979)]
  • restriction endonucleases Only restriction endonucleases according to the manufacturer's instructions (Gibco BRL, Eggenstein, Germany) were used for the targeted hydrolysis of vector DNA. 5 U of the respective restriction endonuclease were used for the restriction of 10 ⁇ g plasmid DNA and incubated at 37 ° C. for 2 hours To ensure complete hydrolysis, the same amount of residual endonuclease was added a second time and incubated again for at least 1 h
  • the cleaved DNA was electrophoretically separated on 0.5-1.2% horizontal agarose gels.
  • the gel piece which contained the DNA fragment, was cut out with a sterile scalpel and weighed DNA fragments from the agarose were carried out according to the instructions with the ETsorb kit (Genomed, Bad Oeynhausen, Germany) 2.
  • Actinoplanes sp SE50 / 1 10 was incubated at 30 ° C. in TSB medium on a rotary debris for 3 d.
  • the preculture (5 ml) was carried out at 240 rpm in culture tubes
  • the total DNA was prepared with 1.5-2 mg cells (fresh weight) according to the phenol / chloroform extraction method [Hopwood, D A, et al (1985)]
  • the cleaved DNA was electrophoresed on 0.6% horizontal agarose gels
  • the DNA fragments were again eluted using the JETsorb kit (see Example 1).
  • DNA fragments from agarose gels were transferred to membranes by the "Southern Transfer” method [Southern, EM (1975)].
  • the agarose gels obtained according to Example 2 were swirled in 0.25 M HC1 for 20 minutes 3MM absorbent Whatman paper (Whatmann, Maidstone,
  • nylon filters were then shaken at least 2 h at 68 ° C in 50-100 ml prahyb ⁇ disisation solution in a water bath. The solution was changed at least twice. The hybridization took place in the hybridization cabinet for at least 12 h. 15 ml hybridization solution, which the acb -Sonde-II contained (s example
  • the nylon filters were then washed for 15 minutes with 6x postwash and 1 x postwash.
  • the nylon filters were then covered with cling film while still moist.
  • the autoradiography was carried out with Hyperfilm-MP
  • the ligation took place in a volume of 20 ⁇ l, the ratio of fragment to vector being 3 1 with 0.01-0.1 ⁇ g of DNA in the batch.
  • 1 U of the T4 DNA ligase with the appropriate buffer Gibco BRL , Eggenstein, Germany
  • the eluted _9g / ⁇ fragments were ligated into the Z-mHI-hydrolyzed vector plasmid pBluescript II KS.
  • the ligation was carried out as with the Sstl and Pstl
  • Transformation-competent cells from E.coh DH5 ⁇ were transformed with complete ligation approaches [according to Hanahan, D (1983)] Ampicil n-resistant transformants were transferred to LB-Amp selective plates (100 ⁇ g / ml)
  • Ampicillin-resistant transformants were examined for the presence of the 10.7 kb SstI fragment and 12 kb P / II fragment which hybridized with the acb probe II. Ten of these clones were streaked on a selective plate, incubated overnight and washed from the plate with 3 ml LB medium. The plasmid DNA was then isolated from 20 such pools of ten [according to Birnboim, HC, uJ
  • the recombined phage 10/3 was hydrolyzed with Pstl, the DNA on a horizontal agarose gel and the 2.8 kb Pvtl fragment eluted from the matrix (see example 1) and ligated into the vector pUC18.
  • the recombinant plasmid was given the name pMH and was ⁇ n Transformed £ coli DH5 ⁇
  • the recombinant phage 5/4 was hydrolyzed with Sstl, the DNA separated on a horizontal agarose gel and the 6.3 kb Sstl fragment eluted from the matrix (see Example 1) and ligated into the vector pUC18.
  • the recombinant plasmid was given the name pMJ9 and was transformed into E coli DH5 ⁇
  • the phages with acarbose biosynthesis genes were identified by plaque hybridization (according to Sambrook et al 1989) with the gene probes acb-HI and acb-IV.
  • the phage DNA which contained acarbose biosynthesis genes was made from phages which were propagated on E. coli LE392 according to Sambrook et al. (1989)
  • the PCR is used for the in vitro multiplication of selected DNA areas [Mullis, KB, u FA Falloona (1987)].
  • the Taq DNA polymerase according to the manufacturer (Gibco BRL, Eggenstein) was used in 25 reaction cycles.
  • the batches contained 5% formamide to suppress possible secondary structures in GC-rich DNA.
  • the volume was 100 ⁇ l with 50 pmol per polymer and 200 uM dNTP's were used
  • an initial five minute denaturation of DNA at 95 ° C 2.5 U of thermostable DNA polymerase were mixed in a "hot-start" added to the lugs primer extension was carried out at 72 ° C and the denaturation of DNA at the beginning of each cycle was carried out at 95 ° C. for 1 min.
  • the reactions were carried out in a Biometra thermal cycler (Gottingen)
  • the plasmid pAS5 was hydrolysed with the restriction enzyme Pstl, gel electrophoresis (0.7% agarose gel), the 5.4 kb Pstl fragment eluted from the gel and in pUC 18 (hydrolyzed with Pstl) in E. coli DH5 ⁇ cloned
  • pAS5 / 3. pAS5 / 4. pAS5 / 13. pAS5 / 16 The plasmid pAS5 was hydrolyzed with the restriction enzyme BamHl and gel-electrophoretically separated. The fragments had the following size
  • the fragments intended for subcloning with a size of 1.4 kb and 0.5 kb were eluted from the gel (see example 1).
  • the vector pUC 18 was prepared using the restriction enzyme BamHl as described in example 1. The ligations were carried out The 0.5 kb fragment was ligated into the prepared pUC 18 and the subclone pAS5 / 16 was formed.
  • the subclone pAS5 / 3 was formed after the ligation of the 1.4 kb fragment with the prepared pUC 18 the subclone pAS5 / 4 was created after ligation of the 1.2 kb fragment with the vector pUC18.
  • the subclone pAS5 / 13 was created by rehabilitation of the 7.5 kb BamHl fragment
  • PAS5 / 5 PAS5 / 7 pAS5 / U. PAS5 / 12
  • the plasmid pAS5 was with the restriction enzymes BamHl u Sstl, Pstl u. Sstl, Bglll u Pstl and Bglll u Hindill hydro- The remaining fragments were separated in a 1.2% agarose gel. The corresponding fragments were eluted from the agarose gel and cloned in E.
  • Subclone pAS5 / 5 contains the 0.48 kb Sstl BamHl fragment
  • subclone pAS5 / 12 contains the 0.63 kb BglW Pstl fragment
  • subclone pAS5 / l 1 contains the 0.68 kb BgllllHin ⁇ lll fragment
  • Example 1 and in the vector pUCBM21 (Boeh ⁇ nger, Mannheim) (hydrolyzed with Ncol Kpnl) in E. coli DH5 ⁇ , and the subclones pAS5 / 15 12 (0.9 kb fragment) and pAS5 / 15 1 1 (1, 1 kb fragment)
  • the plasmid pAS6 was hvdrolysed with the residual endonuclease Sst1 (using the residual interface of the vector) and a 5.9 kb Sstl fragment was eluted from the agarose gel and ligated with the plasmid pUC 18.
  • L coli DH5 ⁇ was transformed with the recombinant plasmid
  • the plasmid pMI6 / 6 was hydrolyzed with the residual endonucleases BamHl and Pstl, and a 0.36 kb BamHl Pstl and a 0.5 kb ⁇ wHI / Pstl fragment were obtained from the Agarose gel eluted and ligated with the plasmid pUC18 E. coli DH5 ⁇ was transformed with the recombinant plasmids
  • pMI6 / 6 2 2. pMI6 / 6 2 3. pMI6 / 6 2 4, pMJ6 / 6 2 5, pMJ6 / 6 2 6 pMJ6 / 6 2 7, pMI6 / 6 2 8 the plasmid pMI6 / 6 was used with the residual endonuclease Sall hydrolyzed and a 3.3 kb fragment, a 1.2 kb fragment, a 1.0 kb fragment, a 07 kb fragment, a 0.14 kb fragment and a 0.13 kb fragment were made from eluted the agarose gel and ligated with the plasmid pUC18. E coli DH5 ⁇ was with the recombinant plasmids transformed The plasmid pMJ6 / 6 2 2 was obtained by hydrolysis and the following reg
  • pMI6 / 8 1 the plasmid pMI6 / 6 was hydrolyzed with the restriction enzymes C / al and BamHl and a 1.1 kb fragment was eluted from an agarose gel and with the restriction enzymes C / al and BamHl and a 1.1 kb fragment was eluted from an agarose gel and with the restriction enzymes C / al and BamHl and a 1.1 kb fragment was eluted from an agarose gel and with the
  • Plasmid pBluesc ⁇ pt II KS ligated E coli DH5 ⁇ was transformed with the recombinant plasmid
  • the plasmid pMI6 / 6 was hydrolyzed with the restriction enzymes Pstl and Sall and a 1.5 kb fragment was eluted from an agarose gel and with the restriction enzymes Pstl and Sall and a 1.5 kb fragment was eluted from an agarose gel and with the restriction enzymes Pstl and Sall and a 1.5 kb fragment was eluted from an agarose gel and with the
  • Plasmid pUC18 ligated E. coli DH5 ⁇ was transformed with the recombinant plasmid
  • the plasmid pAS6 was hvdrolyzed with the residual endonuclease BamHl and a 2.8 kb BamHl fragment was eluted from the agarose gel, ligated to the plasmid pUC 18 and transformed into E coli DH5 ⁇
  • pAS6 / 3 1 The plasmid pAS6 / 3 was hvdrolyzed with the residual endonuclease Hi cll and a 1.1 kb fragment in pUC18, hydrolyzed with Hincll, ligated and clomerized in L coli DH5 ⁇
  • the plasmid pAS6 / 3 was hvdrolvated with the residual endonuclease Sall, a 1.2 kb fragment in pUC18, hydrolyzed with Sall, ligated and clomerized in L coli DH5 ⁇
  • the plasmid pAS6 was hydrolysed with the residual endonuclease Pstl, a 1.45 kb fragment was eluted from the gel and ligated with pUC18. L coli DH5 ⁇ was transformed with the recombinant plasmid 11. Subcloning of the plasmid pMJl
  • the plasmid pMJl was hydrolyzed with the residual endonuclease Sphl and a 3.3 kb S M fragment (0.6 kb Sphl / Pstl fragment ligated m ⁇ tpUC 18) eluted from the agarose gel. This fragment was re gated and clomerized in E coli DH5 ⁇
  • the plasmid pMJ1 was hydrolyzed with the residual endonuclease Sal and a 3.9 kb Sal fragment (1.2 kb Sal / Pstl fragment ligated with pUC18) eluted from the agarose gel. This fragment was rehabilitated and clomerized in E coli DH5 ⁇
  • the plasmid pM l was hydrolyzed with the residual endonuclease Sal and a 4.1 kb Sstl / Pstl fragment (1.4 kb SstllPstl fragment ligated to pUC 18) eluted from the agarose gel. This fragment was rehabilitated and clomerized in E coli DH5 ⁇
  • the plasmid pMJl was hvdrolyzed with the residual endonuclease Sall and a 0.9 kb SaWSmal fragment was eluted from the agarose gel and ligated with the plasmid pUC 18.
  • the recombinant plasmid was transformed into E coli DH5 ⁇
  • the pAS5 / 6 subclones were produced using the “double-stranded nested deletion kit” (Pharmacia, Freiburg, Germany). 10 ⁇ g pAS5 / 6 DNA was prepared as described in Example 1 and hydrolyzed with 10 U each Xhol and Ss / I The subsequent incubation with exonuclease III was carried out according to the manufacturer's instructions for a total of 20 min. At intervals of 5 min, portions were removed from the reaction mixture which corresponded to a DNA amount of approx. 2.5 ⁇ g DNA. Treatment with S 1 nuclease to produce non-overlapping DNA -Ends took place for 30 min at 20 ° C according to the manufacturer's instructions. These DNA molecules were rehabilitated with T4-L ⁇ gase and clomerized in E coli DH5 ⁇ 13. DNA sequencing of acarbose biosynthesis genes from Actinoplanes sp.
  • the plasmids described in Examples 8 to 11 were sequenced. 6-8 ⁇ g of plasmid DNA from a preparation (see Example 1) were used in the sequencing reaction. The sequencing reaction was carried out using the auto-read sequencing kit (Pharmacia, Freiburg , Germany) The standard protocol for the sequencing of dsDNA was used. In order to enable the nucleotide sequence to be evaluated with the ALF (automated laser fluorescence (DNA) sequencer), the starter molecules for the sequence reaction were the
  • Fluorescein-labeled universal and reverse sequencing polymer was used (see Table 2). 8 ml of Hydro Link Long Ranger (Serva Heidelberg), 33.6 g of urea, 8 ml of 10X TBE buffer, ad 80 ml with H 2 were used to prepare the gel 0 mixed, filtered and degassed for 1 minute The polymerization was initiated by adding 350 ⁇ l 10% (w / v) ammonium persulfate and 40 ⁇ l N, N, N ', N', tetramethylethylenediamine. The solution was dissolved in a gel form (50x50x0, 05 cm) cast The electrophoresis was carried out at 38 W and a constant temperature of 45 ° C.
  • the Tx buffer was used as the running buffer.
  • the measured fluorescence was processed into a DNA sequence using a connected computer (Compaq 386 / 20e), which was also used for Control of the electrophoresis unit was used (program A. LF Manager 2 5
  • the DNA sequence of the acbC gene shows two possible translation starting points for
  • starting point 1 represents the probable start of AcbC due to a more significant ribosome binding site, both possible AcbC proteins were overexposed.
  • the plasmids pETl la and pET16b were used for expression in E coli in order to ensure an optimal start of the expression If the ATG start codon, with a suitable distance to an E coli-like RBS, the pET vectors should be used, it is necessary to construct a ⁇ Wel recognition sequence at the start codon of acbC.
  • the O gonucleotides AS7 (sequence position 6617) and AS8 (sequence position 6638) are used for the synthesis of a elWel recognition site at the two possible start codons.
  • the gonucleotide AS9 binds 66 bp downstream of a BamHl recognition sequence at sequence position 6877 to the DNA using the PCR method (see example 8) two DNA fragments were amplified, which are necessary for expression of the two possible AcbC Prot one was used.
  • the addition of the polymers took place at 40 ° C. for 40 seconds, and the extension of the polymer took place in 30 seconds.
  • the two amplified DNA fragments were hydrolyzed with the residual endonucleases Ndel and BamHl and correspondingly into the vectors pET11a and pET16b ligated
  • the 2.2 kb ⁇ wHI fragment was isolated from the recombinant plasmid pAS2 [EP A 0 730 029 / DE 19507214] and fused to the monied PCR fragments via the _5_7mHI recognition site after the orientation of the 2.2 kb P ⁇ mHI fragment was checked, the complete acbC gene was present in the expression vectors.
  • the expression vectors were given the name pAS8 / l - pAS8 / 4 (FIG. 4).
  • the AcbC protein was expressed in S lividans 1326 by means of the plasmid vector pIJ6021 [Takano, e, et al (1995)].
  • a fragment from chromosomal DNA was amplified using the PCR method [Mulhs u Falloona, (1987)], which only the encoding region of the acbC gene
  • the OHgonucleotide AS-Cl and AS-C2 were used, a Ndel recognition sequence at the start codon 2 of the acbC gene being constructed with the aid of the polymer AS-C1 (sequence position 6089)
  • Ogonucleotide AS-C2 binds at sequence position 7882 and was used to construct an EcoRI recognition sequence.
  • the addition of the polymer took place in 20 seconds at 50 ° C., and the polymer was extended in 40 seconds.
  • the acbC DNA fragment thus obtained was first blom-ended in the vector pUC18 and the correctness of the DNA sequence was checked after the PCR.
  • This recombinant plasmid with the cloned acbC gene was called pAS8 / 5 1.
  • the plasmid pAS8 / 5 1 was labeled with the residual functions endonucleases Ndel and EcoRI hydrolyzed, the DNA separated on an agarose gel and eluted from the matrix.
  • the “cAC fragment thus prepared was ligated into the vector pIJ6021.
  • the acbE gene could be obtained from the plasmid pAS5 / 6.9-6 by means of hydrolysis with the restriction endonucleases EcoRI and Hmdlll. After separation of the DNA on an agarose gel and elution of the 3.8 kb EcoRI / HwdIII fragment from the matrix, this acbE fragment was ligated accordingly into the vector pUWL219 [J. Wehmeier, U.F .. (1995)]. For a later expression of AcbE in S. lividans, a possible promoter sequence on the 200 bp "upstream" region should be used in these vectors (see Table 5). The recombinant plasmid was named pASl 1 (FIG. 7).
  • Tab. 5 The intercistronic area between the genes acbE and acbD.
  • Inverted repeat (IR) and direct repeat (DR) sequences that could be involved in regulation are underlined.
  • TAC TTAAAG CTC TGC GCA AGC TTA GGG TTG AAG TGG CGG TGA TGC ATC CAT CAC TGT ATG ATG AAT TTC GAG ACG CGT TCG AAT CCC AAC TTC ACC GCC ACT ACG TAG GTA GTG ACA TAC
  • Protoplasts from S. lividans TK23 were transformed with the plasmid pASl 1.
  • both in the S. lividans TK23 / pASl 1 and in the Actinoplanes sp. Approaches an extracellular protein the size of
  • Electrophoresis was carried out either with the SERVA Blue-Vertical 100 / C apparatus (gel form, 80 x 100 x 0.75 mm) or with the Renner Twin Vertical apparatus (gel form, 180 x 170 x 1 mm)
  • the protein concentration of the samples to be analyzed was determined using the protein assay (BioRad, Kunststoff), a calibration line being established using BSA
  • the "VILL Dalton marker” (14.2 kDa - 66 kDa) and the "High Molecular Weight Standard” (29 kDA - 210 kDa) from Sigma (Deisenhofen) served as the standard for the molecular weights of the separated proteins.
  • the N-terminal amino acid sequence of the AcbE protein was compared by comparing Actinoplanes sp and the clone S. lividans TK23 / pASl 1. 50 ml cultures were incubated in MD 50 medium for three days. The cells were removed by centrifugation and the culture supernatants for 12 h against buffer (5 mM
  • Tris / HCl pH 7.5, 1 mM CaCl 2 dialyzed at 4 ° C.
  • the supernatants were then freeze-dried in 48 h and taken up in 1.5 ml of sample buffer.
  • the culture supernatants prepared in this way were analyzed in an SDS-PAGE using the Renner-Twin-Vertical - Equipment (gel form, 180 x 170 x 3 mm) separated In order to ensure the best possible separation of the AcbE protein from other extracellular proteins, a gradient gel (5% - »10%) was used.
  • the AcbC extract required for the enzyme test was prepared by dialysis (12 h) against 2.5 liters of digestion buffer at 4 ° C. This extract could be kept at -20 ° C. for two months be stored without noticeably losing activity.
  • the protein content of the extract was determined with the protein assay (BioRad, Kunststoff) and 15 ⁇ g analyzed in an SDS-PAGE (FIG. 6)
  • the enzyme test was carried out in a 20 mM P buffer (pH 7.5) with 40 ⁇ M CoCl 2 at RT for 2 h. 20 ⁇ g total protein from the AcbC extract and 8 mM sedoheptulose-7-phosphate in the enzyme - test used In addition, the reaction mixture contained 2 mM NaF, to unspecific
  • Inhibit phosphatases in the extract were 100 ⁇ l.
  • the evaluation was carried out by TLC on silica gel foils with butanol / ethanol H 2 O (9 7 4) as the eluent, 25 ⁇ l being analyzed from a reaction batch.
  • cerium -Reagent s buffer and solutions
  • After a 15-minute incubation at 90 ° C in the drying cabinet the organic compounds were made visible.
  • a mixture of Valienon and Valiolon (Prof. HG Floss, Seattle) served as reference substance.
  • Sedoheptulose-7-phosphate could be implemented specifically by the AcbC protein expressed in S. lividans (FIG. 9). However, the reaction product showed a slightly different running behavior in the DC than the Valienon-Naliolon standard. A reduction in the migration distance of the reaction product on the silica gel Foil could be excluded by the reaction buffer (Fig. 9, lane 5)
  • the cultures of S lividans TK23 / pAS l 1 were grown in TSB medium and MD 50 medium in the presence of 25 ⁇ g / ml thiostrepton. After 3-4 days of incubation, the cultures were harvested by centrifugation (3500 g) at 4 ° C for 10
  • the cells were removed for min.
  • the supernatants were dialyzed against buffer (25 mM Tris HCl pH 7.5, 1 mM CaCl) for 12 h at 4 ° C. From the supernatants prepared in this way, 500 ⁇ l were dried in vacuo, in sample buffer (s buffer and Solutions) were added, the proteins in the supernatants were separated on an SDS-PAGE (FIG. 8).
  • Sample buffer s buffer and Solutions
  • the ⁇ -amylase activity was determined by measuring the decrease in turbidity of a 1% starch suspension.
  • the solutions are sterile filtered after mixing
  • the acb probe is placed in 15 ml prehybridization solution.
  • Genome of Actinoplanes sp SE50 / 110 (see Fig. 2)
  • the black bar indicates the area claimed in the original patent, which overlaps the genes acbCBA (order from left to right as indicated) z T
  • Fig. 2 gene map of the acarbose biosynthesis cluster
  • FIG. 4 The recombinant plasmids which - starting from the plasmids pETl la and pETl ⁇ b - were constructed for the expression of AcbC in E. coli
  • Fig. 5 The recombinant plasmid pAS8 / 7 2, which - starting from the
  • Plasmid pIJ6021 - was constructed for the expression of AcbC in S lividans 1326
  • Plasmid pUWL219 - was constructed for the expression of AcBE in S lividans rK 23
  • Track 5 and track 6 can be seen Detection of the AcbC enzyme activity by thin layer chromatography on silica gel films (see Example 19 1)

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The invention concerns biosynthesis genes from the acarbose gene cluster from Actinoplanes sp. SE 50/110, their isolation from Actinoplanes sp. or from producers of pseudooligosaccharides, a process for isolating these biosynthesis genes, the proteins coded by said genes, the expression of the proteins in heterologous host strains, and the use of the acarbose biosynthesis genes for optimizing the process.

Description

ACARBOSE ACB-CLUSTER AUS ACTINOPLANES SP. SE 50/110 ACARBOSE ACB CLUSTER FROM ACTINOPLANES SP. SE 50/110
Die vorliegende Erfindung bezieht sich auf die Isolierung von weiteren Genen derThe present invention relates to the isolation of further genes of the
Biosynthese und des Stoffwechsels von Acarbose aus Actinomyceten, vorwiegend aus Actinoplanes sp SE 50/1 10 und seinen Mutanten, die mit den bereits bekannten Bio- synthesegenen in einem gemeinsamen Gencluster vergesellschaftet sind, die Nutzung dieser Gene für die Herstellung von Acarbose und Acarbose-Homologen mit Actino- planes sp und anderen Produzenten von Acarbose-verwandten NaturstoffenBiosynthesis and metabolism of acarbose from Actinomycetes, predominantly from Actinoplanes sp SE 50/1 10 and its mutants, which are associated with the already known biosynthetic genes in a common gene cluster, the use of these genes for the production of acarbose and acarbose homologues with Actinoplan sp and other producers of acarbose-related natural products
(Pseudoohgosaccharide), die Nutzung dieser Gene für die Verfahrensoptimierung durch Methoden des biochemisch-molekularbiologischen "Engineering" sowie die heterologe Expression dieser Gene in anderen Mikroorganismen(Pseudoohgosaccharide), the use of these genes for process optimization by methods of biochemical-molecular biological "engineering" as well as the heterologous expression of these genes in other microorganisms
Gegenstand alterer Patentanmeldungen (z B DE 20 64 092, DE 22 09 834) ist dieThe subject of older patent applications (eg DE 20 64 092, DE 22 09 834) is
Erkenntnis, daß eine Reihe von Actinomyceten, vor allem die Actinoplanaceen, ohgo- sacchaπdartige Inhibitoren von Glycosidhydrolasen vorzugsweise kohlenhydratspal- tender Enzyme des Verdauungstraktes bilden Als potentester Inhibitor dieser Gruppe ist die Verbindung O-4,6-Dιdeoxy-4-[[lS-(l S, 4R, 5S, 6S)-4,5,6-tπhydroxy-l- (hydroxymethyl)-2-cyclohexen-l-yl]-arruno]-α-D-glucopyranosyl-(l -» 4)-O-α-D- glucopyranosyl-(l→ 4)-D-glucopyranose als Acarbose beschrieben [DE 23 47 782]Recognition that a number of actinomycetes, especially the actinoplanaceae, ohgo-saccharin-like inhibitors of glycoside hydrolases preferentially form carbohydrate-splitting enzymes of the digestive tract. The most potent inhibitor of this group is the compound O-4,6-ddedeoxy-4 - [[IS- ( l S, 4R, 5S, 6S) -4,5,6-tπhydroxy-l- (hydroxymethyl) -2-cyclohexen-l-yl] -arruno] -α-D-glucopyranosyl- (l - »4) -O -α-D-glucopyranosyl- (l → 4) -D-glucopyranose described as acarbose [DE 23 47 782]
Acarbose ist ein potenter α-Glucosidase-Inhibitor, der als orales Antidiabetikum unter dem Markennamen Glucobay® für die Therapie des Diabetes melhtus eingesetzt wird Die Bildung des Sekundarmetabohten Acarbose erfolgt durch Actinoplanes sp SE 50Acarbose is a potent α-glucosidase inhibitor which is used as an oral antidiabetic under the brand name Glucobay ® for the therapy of diabetes melhtus. The secondary metabohten acarbose is formed by Actinoplanes sp SE 50
(CBS-Nr 791 96) und durch eine natürliche Variante dieses Stammes, SE 50/1 10 (CBS 793 96) [DE 22 09 834], sowie durch deren Selektanten und Mutanten In den genannten Patentanmeldungen, z B in den Beispielen 1 bis 4 der genannten deutschen Patentanmeldung P 22 09 834, wird die Gewinnung eines derartigen α-Glucosidase - Inhibitors beschrieben Mittels molekularbiologischer Methoden lassen sich bestimmte Gene direkt aus einem nicht charakterisierten Genom isolieren, wobei Gensonden - z B 32P-markιerte DNA- Fragmente - eingesetzt werden, die spezifisch an die gesuchte DNA-Sequenz binden(CBS No. 791 96) and by a natural variant of this strain, SE 50/1 10 (CBS 793 96) [DE 22 09 834], and by their selectants and mutants in the patent applications mentioned, for example in Examples 1 to 4 of the aforementioned German patent application P 22 09 834, the production of such an α-glucosidase inhibitor is described Using molecular biological methods, certain genes can be isolated directly from an uncharacterized genome, using gene probes - for example 32 P-labeled DNA fragments - that bind specifically to the DNA sequence sought
Weiterhin ist bei Actinomyceten - vor allem Streptomyceten - bekannt, daß bei den bisher untersuchten Sekundarmetabolit-Produzenten die Biosynthesegene auf dem Chromosom, seltener auf einem Plasmid, in einem Cluster nebeneinander angeordnet sind [Hershberger, C L , et al (1989)] Damit lassen sich durch die Verwendung von Gensonden benachbarte, bisher unbekannte Biosynthesegene isolieren, deren Bedeu- tung für die gewünschte Biosynthese dann aufgeklart werden kann Ebenso können mit Hilfe der Gensonden die entsprechenden Biosynthesegene in anderen Mikroorganismen nachgewiesen werdenFurthermore, with actinomycetes - especially streptomycetes - it is known that the secondary metabolite producers examined so far have the biosynthesis genes on the chromosome, more rarely on a plasmid, arranged side by side in a cluster [Hershberger, CL, et al (1989)] isolate neighboring, previously unknown biosynthesis genes by using gene probes, the importance of which for the desired biosynthesis can then be elucidated. The corresponding biosynthesis genes can also be detected in other microorganisms with the aid of the gene probes
Aus der Struktur der Acarbose war zu vermuten, daß der Desoxyglucose-Teil des Acarbose-Molekuls entsprechend der Biosynthese von 6-Desoxyzuckerresten verschiedener Antibiotika gebildet wird (z B Aminoglykoside, wie Streptomycin, Kasugamycin, Makrolide, wie Erythromycin, Tylosin, Polyene, wie Amphoteπcin A, B, Nystatin, Anthrazychne, wie Daunorubicin, Glykopeptide, wie Vancomycin) Daher wurde eine Gensonde und heterolog einsetzbare PCR-Pπmerpaare von hoch-kon- servierten Proteinbereichen bekannter dTDP-Glucose-Dehydratase-Enzymen abgeleitetFrom the structure of acarbose it was to be assumed that the deoxyglucose part of the acarbose molecule is formed in accordance with the biosynthesis of 6-deoxy sugar residues from various antibiotics (eg aminoglycosides such as streptomycin, kasugamycin, macrolides such as erythromycin, tylosin, polyenes such as amphoteπcin A, B, nystatin, anthracycles, such as daunorubicin, glycopeptides, such as vancomycin) Therefore, a gene probe and heterologous PCR polymer pairs were derived from highly conserved protein regions of known dTDP-glucose-dehydratase enzymes
Die Anwendung der geschilderten Techniken führte bei Actinoplanes sp SE 50/1 10 zunächst zur Isolierung und Sequenzierung eines 2,2 kb ZJα/wHI-DNA-Fragments mit der vollständigen DNA-Sequenz von acbB (codierend für dTDP-Glucose Dehydra- tase) sowie den DNA-Teilsequenzen von acbA (codierend für dTDP-Glucose Syn- thase) und acbC (codierend für eine Cyclase) [EP A 0 730 029 / DE 19507214] Als weitere Enzyme, die an der Acarbose-Biosynthese beteiligt sind, wurde die Acarviosyl Transferase aus Actinoplanes sp SE 50/110 und -Mutanten beschrieben (codiert von acbD) [DE 196 25 269 5] sowie die Acarbose 7-Phosphotransferase (codiert von acbK) [Goeke, K , et al (1996), Drepper, A , et al (1996)] Für die Acarviosyl Transferase wurde die Fähigkeit beschrieben, bei Acarviosin-haltigen Pseudooligosacchariden den jeweiligen Zuckerrest gegen andere Zucker auszutauschen Acarbose 7-Phosphotransferase (Acarbose Kinase) konnte an der Herstellung einer Transportform der Acarbose aus der Zelle beteiligt sein Außerdem wird die Acarbose 7-Phos- photransferase als Teil eines Selbstschutzmechanismus gesehenThe use of the described techniques initially resulted in the isolation and sequencing of a 2.2 kb ZJα / wHI DNA fragment with the complete DNA sequence of acbB (coding for dTDP-glucose dehydratase) and in Actinoplanes sp SE 50/1 10 the DNA partial sequences of acbA (coding for dTDP-glucose synthase) and acbC (coding for a cyclase) [EP A 0 730 029 / DE 19507214] The acarviosyl was another enzyme which is involved in the acarbose biosynthesis Transferase from Actinoplanes sp SE 50/110 and mutants (encoded by acbD) [DE 196 25 269 5] and acarbose 7-phosphotransferase (encoded by acbK) [Goeke, K, et al (1996), Drepper, A, et al (1996)] For acarviosyl transferase, the ability to exchange the respective sugar residue with acarviosin-containing pseudooligosaccharides for other sugars was described. Acarbose 7-phosphotransferase (acarbose kinase) could be involved in producing a form of transport of acarbose from the cell. In addition, acarbose 7-phosphotransferase is seen as part of a self-protection mechanism
Acarbose hemmt stark die cytoplasmatische α-Glucosidase des Produktionsstammes, die durch Acarbose 7-Phosphotransferase phorphorylierte Verbindung dagegen nicht, so daß der zelleigene Substratmetabolismus nicht gestört wird Solche Schutzmechanismen sind für viele Produzenten von Aminocychtol-Antibiotika beschrieben wordenAcarbose strongly inhibits the cytoplasmic α-glucosidase of the production strain, but the compound phorphorylated by acarbose 7-phosphotransferase does not, so that the cell's own substrate metabolism is not disturbed. Such protective mechanisms have been described for many producers of aminocychtol antibiotics
In der vorliegenden Patentanmeldung wird das Cluster der Biosynthesegene sowie anderer Gene des Stoffwechsels der Acarbose aus Actinoplanes sp SE 50/1 10 in einem Abschnitt von 18 kb beschrieben (s Fig 1 - 3) Die Isolierung weiterer Gene des Acarbose-Stoffwechsels erbrachte überraschenderweise, daß die schon bekannten Biosynthesegene, acbABC [EP A 0 730 029 / DE 19507214], mit Genen der Acarbo- semodifikation (Acarviosyltransfer, Phosphorylierung, Gene acbD, acbK), des extrazellularen bzw des cytoplasmatischen Maltodextπn- und Glucose-Stoffwechsels (Enzyme der Familien der α-Amylasen und 4-α-Glucanotransferasen bzw Amylomalta- sen) und des Bindeprotein-abhangigen Zuckertransports (Maltodextπn- oder Disacchaπd-Aufnahme in das Cytoplasma) in einem gemeinsamen Gencluster verge- sellschaftet sind Dieser Befund ist für die biotechnische Produktion der Acarbose inIn the present patent application, the cluster of the biosynthesis genes and other genes of the metabolism of acarbose from Actinoplanes sp SE 50/1 10 is described in a section of 18 kb (see FIGS. 1-3). The isolation of further genes of the acarbose metabolism surprisingly showed that the already known biosynthetic genes, acbABC [EP A 0 730 029 / DE 19507214], with genes of acarbosemodification (acarviosyl transfer, phosphorylation, genes acbD, acbK), of the extracellular and cytoplasmic maltodextine and glucose metabolism of the families (enzymes of the families α-amylases and 4-α-glucanotransferases or amylomaltases) and the binding protein-dependent sugar transport (maltodextine or disaccharide uptake into the cytoplasm) are socialized in a common gene cluster. This finding is for the biotechnological production of acarbose in
Hinblick auf die gezielte Optimierung des Verfahrens von erheblicher Bedeutung Denn hiermit ist als ein neuer, die in früheren Patenten aufgezeigten Möglichkeiten erweiternder Gesichtspunkt die Verfügbarkeit wichtiger Teile des gesamten Acarbose-Stoffwechsels für die Methoden des biochemisch-molekularbiologischen "Engineerings" gegeben So können jetzt auch das für die Synthese der Acarbose offensichtlich wichtige Bereitstellen von α-l,4-Glucan- Vorstufen über Starke-/Malto- dextπn-Abbau, die Aufnahme / Abgabe sowie der cytoplasmatische Umbau von Oli- gosacchaπden bis zur Maltosestufe, die Vielfalt des Produktspektrums sowie die möglicherweise für die Acarbose-Ausschleusung und/oder Freisetzung außerhalb der Zelle wichtigen Modifikationen (z B Acarbose-Phosphoryherung) beeinflußt werden Ein Gegenstand der Erfindung ist damit die Isolierung von weiteren Biosynthesegenen aus Actinoplanes sp SE 50/1 10 und ihre Verwendung zur Isolierung der angrenzenden DNA-Bereiche zur weiteren Aufklarung des Acarbose-GenclustersConsiderable with regard to the targeted optimization of the process. This is a new point of view, which expands the possibilities shown in previous patents, by the availability of important parts of the entire acarbose metabolism for the methods of biochemical-molecular biological "engineering" Obviously important for the synthesis of acarbose are the provision of α-1,4-glucan precursors via starch / maltodextine degradation, the uptake / release and the cytoplasmic conversion of oligosaccharides up to the maltose level, the variety of the product spectrum and the Modifications that are important for acarbose discharge and / or release outside the cell (for example acarbose phosphorylation) can be influenced The invention therefore relates to the isolation of further biosynthetic genes from Actinoplanes sp SE 50/1 10 and their use for isolating the adjacent DNA regions for further clarification of the acarbose gene cluster
Die Aufklarung des Acarbose-Genclusters mit Isolierung und Charakterisierung derClarification of the acarbose gene cluster with isolation and characterization of the
Acarbose-Biosynthesegene ist essentiell für eine gezielte Verbesserung des Produktionsprozesses z B durchAcarbose biosynthesis genes are essential for a targeted improvement of the production process e.g.
Steigerung der Acarbose-Syntheseleistung in Actinoplanes durch Genamplifikation von "Bottleneck"-Enzymen, Verwendung effektiverer Promotoren, Ausschaltung oder Verstärkung von RegulationsereignissenIncrease in acarbose synthesis performance in actinoplanes by gene amplification of "bottleneck" enzymes, use of more effective promoters, elimination or amplification of regulatory events
Verbesserte Bereitstellung von Vorstufen vor allem aus dem Zuckerstoffwechsel mit Optimierung der Transportmechanismen, wie Substrattransport in die Zelle und Ausschleusen von Acarbose oder modifizierten VerbindungenImproved provision of precursors, especially from the sugar metabolism, with optimization of the transport mechanisms, such as substrate transport into the cell and discharge of acarbose or modified compounds
Eingrenzung des Produktspektrums in Actinoplanes auf das gewünschte Hauptprodukt Acarbose durch Ausschalten unerwünschter Biosynthesewege zu Nebenkomponenten oder durch Ausschalten unerwünschter enzymatischer AbbaureaktionenLimitation of the product range in Actinoplanes to the desired main product acarbose by switching off undesirable biosynthetic pathways to secondary components or by switching off unwanted enzymatic degradation reactions
Expression in heterologen Wirtsstammen zur Produktionssteigerung durch eine verbesserte Raum- Zeit- Ausbeute, zur Vereinfachung des Aufarbeitungsverfahrens, zur gezielten Einschränkung des ProduktspektrumsExpression in heterologous host strains to increase production through an improved space-time yield, to simplify the work-up process, to deliberately limit the product range
Verwendung einzelner oder mehrerer Acarbose-Biosynthesegene für die m v/tro-Synthese von Acarbose oder Verbindungen dieser Stoffklasse, ausgehend von synthetisch oder mikrobiell hergestellten Vorstufen Die Erfindung offenbart daher:Use of one or more acarbose biosynthesis genes for the mv / tro synthesis of acarbose or compounds of this class, starting from synthetically or microbially produced precursors The invention therefore discloses:
Ein rekombinantes DNA-Molekül, das Gene für die Biosynthese von Acarbose und Acarbose-Hσmologen enthält, die im Gencluster gemäß Abbildung 2 angeordnet sind.A recombinant DNA molecule that contains genes for the biosynthesis of acarbose and acarbose hsmologists, which are arranged in the gene cluster according to Figure 2.
Ein rekombinantes DNA-Molekül mit einem Restriktionsenzymschnittstellenmuster gemäß Abbildung 1.A recombinant DNA molecule with a restriction enzyme interface pattern as shown in Figure 1.
Die vollständige DNA-Sequenz des 18 kb Fragments mit den in Tab. 1 aufgeführten Genen gemäß Abb. 3 sowie die daraus resultierenden Aminosäure-Sequenzen. The complete DNA sequence of the 18 kb fragment with the genes listed in Tab. 1 as shown in Fig. 3 and the resulting amino acid sequences.
Tab 1 Eigenschaften der ct)-Gene und der Acb-GenprodukteTab 1 Properties of the ct ) genes and the Acb gene products
die Positionsnummern beziehen sich auf die Basenpaare im Bglll-Sstl-Frag- ment in Fig. 3. In Klammern gesetzt sind Sequenz-Informationen, die entweder noch unvollständig sind oder auf unsichere Leserahmen hindeuten, die Accession No. der Datenbankeintrage sind in Klammern angegeben, AS = Aminosäuren,the position numbers relate to the base pairs in the Bglll-Sstl fragment in FIG. 3. Sequence information which is either incomplete or indicates uncertain reading frames, the accession no. the database entries are given in brackets, AS = amino acids,
Dabei codieren die Gene acbA und acbB mit hoher Wahrscheinlichleit Enzyme der Acarbose-Biosynthese, da sie hohe Sequenzidentitat von AcbA bzw AcbB zu be- kannten bakteriellen dTDP-Glucose Synthasen bzw dTDP-Glucose 4,6-Dehydratasen aufweisen Die Ähnlichkeit der Proteinsequenzen zum jeweils nächsten bekannten Vertreter der beiden Enzymfamihen (vgl Fig 3) liegt weit über derjenigen anderer beliebiger Paare fünktionsidentischer Proteine aus beiden Gruppen Erstaunlich dabei ist, daß AcbA seine nächsten Verwandten unter Streptomyceten-Proteinen hat, wahrend AcbB naher verwandt ist mit verschiedenen RfbB-Proteinen Gram-negativer Bakterien Dieses Phänomen wird aber auch von anderen entsprechenden Streptomv- ceten-Proteinen, z B TylAl und TylA2 aus dem Tylosin-Produzenten Streptomyces fradiae [Merson-Davies u Cundliffe (1994)], gezeigt, die ebenfalls von benachbarten Genen in einem gemeinsamen Gencluster codiert werdenThe genes acbA and acbB with high probability encode enzymes of acarbose biosynthesis, since they have high sequence identity of AcbA and AcbB to be knew bacterial dTDP-glucose synthases or dTDP-glucose 4,6-dehydratases. The similarity of the protein sequences to the next known representative of the two enzyme families (see FIG. 3) is far above that of any other pairs of functionally identical proteins from both groups. It is surprising that AcbA has its closest relatives among Streptomycete proteins, while AcbB is more closely related to various RfbB proteins of Gram-negative bacteria. This phenomenon is also used by other corresponding Streptomvceten proteins, eg TylAl and TylA2 from the tylosin producer Streptomyces fradiae [Merson-Davies and Cundliffe (1994)], which are also encoded by neighboring genes in a common gene cluster
Das Gen acbC codiert ein wahrscheinliches Enzym der Acarbose-Biosynthese, da das Enzym AcbC mit AroB-Proteinen, Dehydrochinasaure-Synthasen, verwandt ist und nach Uberexpression in Streptomyces lividans eine Enzymaktivitat zeigt, die - wie zu erwarten - Heptulosephosphate (z B Sedoheptulose-7-phosphat) zu Produkten umsetzt, die ahnliche Eigenschaften wie Va enon und Va olon autweisen (mögliche Vorstufen der Acarbose-Biosynthese), jedoch nicht identisch mit diesen VerbindungenThe acbC gene encodes a probable enzyme of acarbose biosynthesis, since the enzyme AcbC is related to AroB proteins, dehydroquinic acid synthases and, after overexpression in Streptomyces lividans, shows an enzyme activity which - as expected - heptulose phosphates (e.g. sedoheptulose-7 -phosphate) to products which have properties similar to those of Va enon and Va olon (possible precursors of acarbose biosynthesis), but not identical to these compounds
Die Gene acbK (Acarbose-7-Kιnase), acbL (Ketozucker oder Zuckeralkohol Oxidoreductase) und acbM (unbekannte Funktion) sowie das acbN-Gen (direkte Verbindung mit den Leserahmen acbL und acbC ist durch überlappende Start-/Stopcodons angedeutet) codieren wahrscheinlich Enzyme der Acarbose-Biosynthese, da sie alle zusammen mit acbC und evtl auch acbQ ein wahrscheinliches Operon (Transkriptionseinheit) bilden und wahrscheinlich translationell gekoppelt abgelesen werden Auch die Funktion einer spezifischen, cytoplasmatisch lokalisierten Acarbose- Kinase (AcbK) und einer möglichen Dehydrogenase (AcbL) sprechen für eine direkte Beteiligung am innerzellularen Acarbose-Stoffwechsel, die Zucker-Dehvdrogenase AcbL konnte dabei an der Vorstufensynthese des C-7 Cyc tols oder der 6- Desoxyhexose, bzw deren Kondensation beteiligt sein Die beiden Gene acbD (Acarviosyl Transferase) [DE 196 25 269 5, Goeke, K , et al (1996), Drepper, A , et al (1996)] und acbE (α-Amylase), die einander gegenüber mit einer gemeinsamen Promotor-Region im Cluster von Actinoplanes sp SE 50/1 10 liegen, und die beide für Enzyme der Amylase-Famihe codieren, deuten darauf hin, daß eine enge Verflechtung der Regulation des Starkeabbaus und der Produktion derThe genes acbK (acarbose-7-Kιnase), acbL (keto sugar or sugar alcohol oxidoreductase) and acbM (unknown function) as well as the acbN gene (direct connection to the reading frame acbL and acbC is indicated by overlapping start / stop codons) probably encode enzymes Acarbose biosynthesis, since they all form a probable operon (transcription unit) together with acbC and possibly also acbQ and are likely to be read translationally coupled. The function of a specific, cytoplasmic localized acarbose kinase (AcbK) and a possible dehydrogenase (AcbL) speak For a direct involvement in the intracellular acarbose metabolism, the sugar dehydrogenase AcbL could be involved in the preliminary synthesis of the C-7 cyc tol or the 6-deoxyhexose or its condensation The two genes acbD (acarviosyl transferase) [DE 196 25 269 5, Goeke, K, et al (1996), Drepper, A, et al (1996)] and acbE (α-amylase), which are opposite to each other with a common promoter Region in the cluster of Actinoplanes sp SE 50/1 10, and which both code for enzymes of the amylase family, indicate that a close intertwining of the regulation of starch degradation and the production of
Acarbose besteht Dies wird durch den Befund bestätigt, daß beide Enzyme in Actinoplanes sp bei Wachstum auf Starke als C-Quelle die am stärksten expπmierten extrazellularen Proteine im Kulturuberstand von Actinoplanes sp sind Dies gilt für die αcZ>E-Expressιon unter Kontrolle des eigenen Promotors sogar auch in Streptomy- ces lividans (s Beispiele)Acarbose exists. This is confirmed by the finding that both enzymes in Actinoplanes sp are the most highly expressed extracellular proteins in the culture supernatant of Actinoplanes sp when they grow to starch as a C source. This even applies to the αcZ> E expression under the control of its own promoter also in Streptomyces lividans (s examples)
Die Gene acbHFG codieren ein wahrscheinlich extrazellulares Zucker-Bindeprotein, AcbH, und zwei typische Membrankomponenten, AcbF und AcbG, eines bakteriellen Zuckertransporters vom Typ ABC-Importer Sie sind wahrscheinlich am Stoffwechsel der Acarbose durch Aufnahme von Oligo-Maltodextπnen beteiligt oder rezykhsierenThe acbHFG genes encode a probably extracellular sugar-binding protein, AcbH, and two typical membrane components, AcbF and AcbG, a bacterial sugar transporter of the ABC-Importer type. They are probably involved in or metabolize the metabolism of acarbose by ingestion of oligo-maltodextins
Acarbose als Transportvehikel kurzer Ohgo-α- 1 ,4-Glucane (höhere Homologe der Acarbose) durch Aufnahme in die Zelle An einem solchen Vorgang konnte auch das Amylomaltase-ahn che Genprodukt (AcbQ) des acbO-Gens beteiligt seinAcarbose as a transport vehicle for short ohgo-α-1,4-glucans (higher homologues of acarbose) by being taken into the cell The amylomaltase-like gene product (AcbQ) of the acbO gene could also be involved in such a process
Weiterhin offenbart die ErfindungThe invention further discloses
Ein Verfahren zur Isolierung von Acarbose-Biosynthesegenen aus Actinomyceten, vor allem aus Actinoplanes, dadurch gekennzeichnet, daß Gensonden verwendet werden, die sich von einem 2,2 kb ßα/wHI-Fragment ableiten Das 2,2 kb Ba Hl -Fragment, das mittels einer Gensonde, die durch PCR-Pπmer gewonnen wurde, von hochkonservierten Proteinbereichen bekannter dTDP-Glucose-Dehydratase-Enzyme abgeleitet wurde, ist in der Patentanmeldung [EP A 0 730 029 / DE 19507214] beschriebenA method for the isolation of acarbose biosynthesis genes from Actinomycetes, especially from Actinoplanes, characterized in that gene probes are used which are derived from a 2.2 kb βα / wHI fragment. The 2.2 kb Ba Hl fragment, which by means of A gene probe, which was obtained by PCR polymer and was derived from highly conserved protein regions of known dTDP-glucose dehydratase enzymes, is described in the patent application [EP A 0 730 029 / DE 19507214]
Ein Verfahren zur Isolierung von Biosynthesegenen von Acarbose-verwandten Na- turstoffen in Actinomyceten (z B für Vahdamycin, Ohgostatine (Trestatin), Adipo- Verfahren zur Steigerung der Acarbose-Syntheseleistung in Actinoplanes durch erhöhte Gendosis für geschwindigkeitsbestimmende B io syntheseenzyme, effektivere Promotoren für geschwindigkeitsbestimmende Biosynthese- enzyme,A method for isolating biosynthetic genes from acarbose-related natural substances in actinomycetes (e.g. for vahdamycin, ohgostatine (trestatin), adipo- Process for increasing the acarbose synthesis performance in actinoplanes by increasing the gene dose for rate-determining biosynthetic enzymes, more effective promoters for rate-determining biosynthetic enzymes,
Ausschaltung von unerwünschten RegulationsschrittenElimination of unwanted regulation steps
Ein Verfahren zur Steigerung der Acarbose-Syntheseleistung in Actinoplanes durch Protein Engineering bei den die Acarbose-Synthese limitierenden Biosyntheseschritten oder zur Vermeidung von Abbauprodukten, die durch unerwünschte Ruckreaktionen von Biosyntheseenzymen entstehen.A process for increasing the acarbose synthesis performance in actinoplanes by protein engineering in the biosynthesis steps that limit the acarbose synthesis or for avoiding degradation products that arise from undesired back reactions of biosynthesis enzymes.
Ein Verfahren zur Eingrenzung des Produktspektrums in Actinoplanes auf das gewünschte Hauptprodukt durch Ausschalten unerwünschter Biosynthesewege zu Ne- benkomponenten oder durch Ausschalten unerwünschter enzymatischer Abbaureaktionen, wie z B durch eine Inaktivierung des acbD-GensA process for restricting the product spectrum in Actinoplanes to the desired main product by switching off undesirable biosynthetic pathways to secondary components or by switching off unwanted enzymatic degradation reactions, such as by inactivating the acbD gene
Ein Verfahren zur Veränderung von Transport-Mechanismen im Hinblick auf einen verbesserten Transport von Substraten in die Zelle oder ein effektiveres Ausschleusen von Acarbose aus der Zelle.A method for changing transport mechanisms with a view to an improved transport of substrates into the cell or a more effective removal of acarbose from the cell.
Ein Verfahren zur Expression in heterologen Wirtsstammen (z B Pseudo-oligosac- charid-bildenden Streptomyceten sowie in anderen Streptomyceten wie Streptomyces lividans, in schnell wachsenden Bakterien wie E. coli oder in Hefen und Pilzen), A method for expression in heterologous host strains (eg pseudo-oligosaccharide-forming Streptomycetes as well as in other Streptomycetes such as Streptomyces lividans, in fast-growing bacteria such as E. coli or in yeasts and fungi),
zur Erzielung einer Produktionssteigerung durch eine verbesserte Raum- Zeit-Ausbeute, zur Vereinfachung des Aufarbeitungsverfahrens, zur gezielten Einschränkung des Produktspektrumsto achieve an increase in production through an improved space-time yield, to simplify the reprocessing process, to deliberately limit the product range
Ein Verfahren zur Verwendung der Acarbose-Biosynthesegene für die in vitro-Syn- these von Acarbose oder Verbindungen dieser Stoffklasse, ausgehend von synthetisch oder mikrobiell hergestellten VorstufenA method for using the acarbose biosynthesis genes for the in vitro synthesis of acarbose or compounds of this class of substances, starting from synthetically or microbially produced precursors
Die Erfindung wird im folgenden detailliert beschrieben Ferner wird die Erfindung durch den Inhalt der Ansprüche bestimmtThe invention is described in detail below. Furthermore, the invention is determined by the content of the claims
Alle gentechnologischen Methoden wurden, wenn nicht anders angegeben, wie in Sambrook et al (1989) durchgeführtUnless otherwise stated, all genetic engineering methods were carried out as described in Sambrook et al (1989)
Für das Screening wurden drei verschiedene Gensonden verwendet Sie wurden aus den Plasmiden pAS2, pAS5/7 3 und pAS6/3 isoliert Das Plasmid pAS2 wurde aus E coli DH5α mit Hilfe der "Boiling-Method" oder durch alkalische Lyse präpariert und mittels der Restπktionsendonuklease BamHl hydrolysiert Das resultierende 2,2 kb Ba Hl Fragment wurde isoliert und durch sogenannte "Nick-translation" mit j2P- markierten Desoxynukleotiden markiert Dieses radioaktiv markierte Fragment wurde als Gensonde für die Isolierung von Acarbose-Biosynthese-Genen eingesetzt und wird im folgenden als acb-Sonde-II bezeichnet Die zweite Gensonde wurde aus dem Plasmid p AS 5/7 3 isoliert Das Sphl-Sstl Fragment wurde isoliert und wie oben be- schrieben radioaktiv markiert Im folgenden wird diese Gensonde als acb-Sonde-III bezeichnet Die dritte Gensonde wurde aus dem Plasmid pAS6/3 isoliert Das BamHl Fragment wurde isoliert und wie oben beschrieben radioaktiv markiert Diese Sonde bekam die Bezeichnung acb-Sonde-IVThree different gene probes were used for the screening. They were isolated from the plasmids pAS2, pAS5 / 7 3 and pAS6 / 3. The plasmid pAS2 was prepared from E coli DH5α using the "boiling method" or by alkaline lysis and using the BamHl residual endonuclease hydrolyzed The resulting 2.2 kb Ba HI fragment was isolated and labeled with j2 P-labeled deoxynucleotides by so-called "nick translation". This radioactively labeled fragment was used as a gene probe for the isolation of acarbose biosynthesis genes and is hereinafter referred to as acb -Sonde-II designated The second gene probe was isolated from the plasmid p AS 5/7 3 The Sphl-Sstl fragment was isolated and radioactively labeled as described above. In the following this gene probe is referred to as acb-Probe-III isolated from plasmid pAS6 / 3. The BamHl fragment was isolated and radioactively labeled as described above. This probe was given the name acb-probe-I V
Acarbosebiosynthese-Gene wurden auf zwei Arten wie folgt isoliert 1 ) Chromosomale DNA von Actinoplanes sp wurde mit den Restriktionsenzymen Ssf, Bglll und Pstl hydrolysiert, Gel-chromatographisch getrennt und durch "Southern" -Hybridisierung mit der acb-Sonde-II (Sstl und BgHl- Hydrolyse) bzw. acb-Sonde-III (P -Hydrolyse) nach einer homologen DNA- Sequenz untersucht. Das mit der Gensonde hybridisierende S tl-Fragment hat eine Große von ca.10,7 kb und das 5g//I-Fragment von ca 10 2 kb Das 10,7 kb Ätl-Fragment und das 12 kb .Sg ZI-Fragment wurden aus dem Gel eluiert, in den Vektor pUC18 bzw. pBluescript II KS ligiert und in E.co/i DH5α klo- niert Die resultierenden Plasmide bekamen die Bezeichnung pAS5 (Sstl- Fragment) und pAS6 (5g /I-Fragment) Ein mit dem Ätl-Fragment überlappendes 2,8 kb Rs ll-Fragment, das mit der Gensonde acb-Sonde-III hybridisierte, wurde in den Vektor pUC18 kloniert und mit pMJl bezeichnetAcarbose biosynthesis genes were isolated in two ways as follows 1) Chromosomal DNA from Actinoplanes sp was hydrolyzed with the restriction enzymes Ssf, Bglll and Pstl, separated by gel chromatography and by "Southern" hybridization with acb probe II (Sstl and BgHl hydrolysis) and acb probe III (P hydrolysis) after a homologous DNA sequence. The S tl fragment hybridizing with the gene probe has a size of approx. 10.7 kb and the 5 g // I fragment of approx. 10 2 kb. The 10.7 kb Etl fragment and the 12 kb .Sg ZI fragment were eluted from the gel, ligated into the vector pUC18 or pBluescript II KS and cloned into E.co/i DH5α. The resulting plasmids were given the names pAS5 (SstI fragment) and pAS6 (5g / I fragment) one with the Etl fragment overlapping 2.8 kb Rs II fragment, which hybridized with the gene probe acb probe III, was cloned into the vector pUC18 and designated pMJl
2) Eine GEM 12-Phagen-Genbank genomischer DNA von Actinoplanes sp wurde mit den Sonden acb-Sonde-III und acb-Sonde-IV mittels Plaquehybri- disierung gescreent. Insgesamt wurden mit der acb-Sonde-III 15 Phagen isoliert, mit der acb-Sonde-IV zwei Phagen, die insgesamt ca 38 5 kb kolineare Actinoplanes sp. DNA mit Acarbose Biosynthese-Genen enthalten Die Phagen, die naher charakterisiert wurden, tragen die Bezeichnung 10/3 und 5/4 Aus dem Phagen 10/3 wurde das Plasmid pM l durch eine Hydrolyse mit dem2) A GEM 12 phage gene bank of genomic DNA from Actinoplanes sp was screened with the probes acb probe III and acb probe IV by means of plaque hybridization. A total of 15 phages were isolated with the acb probe III, two phages with the acb probe IV, which total approx. 38 5 kb colinear Actinoplanes sp. Containing DNA with acarbose biosynthesis genes. The phages that were characterized in more detail bear the designations 10/3 and 5/4
Restriktionsenzym Pstl und Klonierung eines 2,8 kb .s/l-DNA-Fragments in das Plasmid pUC18 gewonnen. Aus dem Phagen 5/4 wurde durch Hydrolyse mit dem Restriktionsenzym Sstl und folgender Klonierung in pUC 18 (S tlhydrolysiert) das Plasmid pMI9 (N 6,3 kb Fragment) erhaltenRestriction enzyme Pstl and cloning of a 2.8 kb .s / l DNA fragment in the plasmid pUC18 were obtained. The plasmid pMI9 (N 6.3 kb fragment) was obtained from the phage 5/4 by hydrolysis with the restriction enzyme Sstl and subsequent cloning in pUC 18 (S hydrolyzed)
Für die Bestimmung der DNA-Sequenz des 10,7 kb S -Fragments (pAS5) von Actinoplanes sp wurden folgende rekombinante Plasmide, ausgehend von dem Vektor pUC18, konstruiert und die Sequenz der inserierten DNA analysiert pAS5 10,7 kb Sstl Fragment aus chromosomaler DNA vonFor the determination of the DNA sequence of the 10.7 kb S fragment (pAS5) from Actinoplanes sp, the following recombinant plasmids based on the vector pUC18 were constructed and the sequence of the inserted DNA was analyzed pAS5 10.7 kb Sstl fragment from chromosomal DNA from
Actinoplanes pAS2 2,2 kb BamHl Fragment aus chromosomaler DNA vonActinoplanes pAS2 2.2 kb BamHl fragment from chromosomal DNA from
Actinoplanes (siehe Patentanmeldung DE 195 07214) p AS5/ 15 3 , 8 kb Hindlll/Sstl Fragment aus pAS5Actinoplanes (see patent application DE 195 07214) p AS5 / 15 3, 8 kb Hindlll / Sstl fragment from pAS5
(siehe Patentanmeldung DE 196 25 269 5) pAS5/l 5 1 =2,6 kb HindlϊllPstl Fragment aus pAS5 pAS5/l 5 2 =0,75 kb Sall Fragment aus pAS5/l 5 1 p AS 5/15 3 =0,5 kb Sall Fragment aus p AS 5/15 1 pAS5/l 5 4 =0,4 kb Sall Fragment aus ρAS5/l 5 1 pAS5/15 5 =0,35 kb Sall Fragment aus pAS5/15 1 p AS 5/ 15 6 =1 25 kb Pvull Fragment aus p AS 5/ 15 1 pAS5/l 5 7 =0,7 kb PvwII/Hindlll Fragment aus pAS5/l 5 1 pAS5/l 5 9 =0,1 kb Pvull Fragment aus pAS5/l 5 1 p AS5/15 1 1 = 1 , 1 kb KpnVNcol Fragment aus pAS5/ 15 pAS5/l 5 12 =0,9 kb KpnVNcol Fragment aus pAS5/l 5(see patent application DE 196 25 269 5) pAS5 / l 5 1 = 2.6 kb HindllllPstl fragment from pAS5 pAS5 / l 5 2 = 0.75 kb Sal fragment from pAS5 / l 5 1 p AS 5/15 3 = 0, 5 kb Sall fragment from p AS 5/15 1 pAS5 / l 5 4 = 0.4 kb Sall fragment from ρAS5 / l 5 1 pAS5 / 15 5 = 0.35 kb Sall fragment from pAS5 / 15 1 p AS 5/15 6 = 1 25 kb Pvull fragment from p AS 5/15 1 pAS5 / l 5 7 = 0.7 kb PvwII / Hindlll fragment from pAS5 / l 5 1 pAS5 / l 5 9 = 0.1 kb Pvull fragment from pAS5 / l 5 1 p AS5 / 15 1 1 = 1.1 kb KpnVNcol fragment from pAS5 / 15 pAS5 / l 5 12 = 0.9 kb KpnVNcol fragment from pAS5 / l 5
Mit der PCR-Methode wurden drei DNA-Bereiche amplifiziert und die entsprechenden Fragmente kloniert und sequenziertThree DNA regions were amplified using the PCR method and the corresponding fragments were cloned and sequenced
pAS5/l 7 =0,46 kb PCR Fragment pAS5/18 =0,26 kb PCR Fragment pAS5/19 =0,27 kb PCR FragmentpAS5 / l 7 = 0.46 kb PCR fragment pAS5 / 18 = 0.26 kb PCR fragment pAS5 / 19 = 0.27 kb PCR fragment
pAS5/6 5,4 kb Pstl Fraqment aus dem Plasmid pAS5pAS5 / 6 5.4 kb Pstl fragment from the plasmid pAS5
Klone, die durch die Enzyme Exonuclease III und Nuklease S 1 ausgehend von dem Plasmid pAS5/6 nach Hydrolyse mit Xhol und Sstl erstellt wurden p AS 5/6 3 - 15 = 5 , 1 kb Insert-DN A p AS 5/6 12-4 = 4,7 kb Insert-DNA pAS5/6 3- 1 8 = 4,3 kb Insert-DNA pAS5/6 6-3 = 4,2 kb Insert-DNA p AS 5/6 9-2 = 3,8 kb Insert-DNA pAS5/6 9-6 = 3,8 kb Insert-DNA pAS5/6 12-6 = 3,2 kb Insert-DNA p AS 5/6 3-6 = 3,0 kb Insert-DNA pAS5/6 15-1 = 2,8 kb Insert-DNA pAS5/6 3-16 = 2,3 kb Insert-DNA pAS5/6 9-l = 1,8 kb Insert-DNA pAS5/6 9-3 = 1,2 kb Insert-DNA pAS5/6 6-l = 0,9 kb Insert-DNA pAS5/6 12-3 = 0,47 kb Insert-DNA pAS5/6 12-2 = 0, 17 kb Insert-DNAClones created by the enzymes exonuclease III and nuclease S 1 starting from the plasmid pAS5 / 6 after hydrolysis with Xhol and Sstl p AS 5/6 3-15 = 5.1 kb insert-DN A p AS 5/6 12 -4 = 4.7 kb insert DNA pAS5 / 6 3- 1 8 = 4.3 kb insert DNA pAS5 / 6 6-3 = 4.2 kb insert DNA p AS 5/6 9-2 = 3, 8 kb insert DNA pAS5 / 6 9-6 = 3.8 kb insert DNA pAS5 / 6 12-6 = 3.2 kb insert DNA p AS 5/6 3-6 = 3.0 kb insert DNA pAS5 / 6 15-1 = 2.8 kb insert DNA pAS5 / 6 3-16 = 2.3 kb insert DNA pAS5 / 6 9-l = 1.8 kb insert DNA pAS5 / 6 9-3 = 1.2 kb insert DNA pAS5 / 6 6-l = 0.9 kb insert DNA pAS5 / 6 12-3 = 0.47 kb insert DNA pAS5 / 6 12-2 = 0.17 kb insert DNA
pAS5/3 1,4 kb BamHl Fragment aus dem Plasmid pAS5 pAS5/3 1 = 0 35 kb SphllFspl Fragment aus pAS5/3 pAS5/3 2 = 0 85 kb SphllBamHl Fragment aus pAS5/3 p AS 5/3 3 = 0 55 kb SphllBamHl Fragment aus p AS 5/3pAS5 / 3 1.4 kb BamHl fragment from the plasmid pAS5 pAS5 / 3 1 = 0 35 kb SphllFspl fragment from pAS5 / 3 pAS5 / 3 2 = 0 85 kb SphllBamHl fragment from pAS5 / 3 p AS 5/3 3 = 0 55 kb SphllBamHl fragment from p AS 5/3
pAS5/4 1,2 kb BamHl Fragment aus dem Plasmid pAS5 p AS 5/5 0,48 kb Sstl/Ba Hl Fragment aus dem Plasmid pAS5 pAS5/7 1,2 kb PstllSstl Fragment aus dem Plasmid pAS5 pAS5/7 1 0,64 kb Pv-.II/_4ccI Fragment aus dem Plasmid pAS5/7 pAS5/7 2 0,54 kb PstllSphl Fragment aus dem Plasmid pAS5/7 ρAS5/7 3 0,67 kb SphllSstl Fragment aus dem Plasmid ρAS5/7 p AS 5/11 0,68 kb BgWHinάlll Fragment aus dem Plasmid pAS5 pAS5/12 0,63 kb BglLLTstl Fragment aus dem Plasmid pAS5 pAS5/13 4,8 kb BamHl Sstl Fragment aus dem Plasmid pAS5 pAS5/16 0,5 kb BamHl Fragment aus dem Plasmid pAS5pAS5 / 4 1.2 kb BamHl fragment from the plasmid pAS5 p AS 5/5 0.48 kb Sstl / Ba Hl fragment from the plasmid pAS5 pAS5 / 7 1.2 kb PstllSstl fragment from the plasmid pAS5 pAS5 / 7 10, 64 kb Pv-.II / _4ccI fragment from the plasmid pAS5 / 7 pAS5 / 7 2 0.54 kb PstllSphl fragment from the plasmid pAS5 / 7 ρAS5 / 7 3 0.67 kb SphllSstl fragment from the plasmid ρAS5 / 7 p AS 5 / 11 0.68 kb BgWHinάlll fragment from the plasmid pAS5 pAS5 / 12 0.63 kb BglLLTstl fragment from the plasmid pAS5 pAS5 / 13 4.8 kb BamHl Sstl fragment from the plasmid pAS5 pAS5 / 16 0.5 kb BamHl fragment from the Plasmid pAS5
Für die Bestimmung der DNA-Sequenz konstruierte Plasmide, die DNA-Fragmente mit Acarbose-Biosynthese-Genen von Actinoplanes sp aus dem Plasmid pAS6 (vgl Beispiel 6) enthalten Die im Plasmid pAS6 klonierte DNA hat ein 6,2 kb Acarbose- biosynthese-Gene enthaltenes ßg/II/Sstl-Fragment mit dem Plasmid pAS5 gemeinsam Für die Sequenzierung des 5,9 kb -5 /II/SstI-Fragments, welches sich an das Plasmid pAS5 anschließt (Fig. 1), wurden folgende rekombinante Plasmide in dem Vektor pUC 18 konstruiert.Plasmids constructed for the determination of the DNA sequence, which contain DNA fragments with acarbose biosynthesis genes from Actinoplanes sp from plasmid pAS6 (cf. Example 6). The DNA cloned in plasmid pAS6 has a 6.2 kb acarbose biosynthesis gene contained ßg / II / SstI fragment together with the plasmid pAS5 For the sequencing of the 5.9 kb -5 / II / SstI fragment which is attached to the plasmid following pAS5 (FIG. 1), the following recombinant plasmids were constructed in the vector pUC 18.
pMI6/6 5,9 \ώ Bglll/ Sstl Fragment aus dem Plasmid pAS6 pMI6/4.2 0,5 kb BamHVPstl Fragment aus dem Plasmid pMI6/6 pM 6/4.1 0,36 kb Ba Hl/Pstl Fragment aus dem Plasmid pMI6/6 pMI6/6.2.2 0,5 kb Sall Religand pMJ6/6.2.3 3 , 3 kb Sall Fragment pMI6/6.2.4 1 , 2 kb Sall Fragment pMI6/6.2.5 1 ,0 kb Sall Fragment pMI6/6.2.6 0,7 kb &/I Fragment pMI6/6.2.7 0, 14 kb Sall Fragment pMI6/6.2.8 0, 13 kb Sall Fragment pMI6/8.1 1 , 1 kb ClaV BamHl Fragment pMI6/l 0 1 ,5 kb Pstl/ Sall FragmentpMI6 / 6 5.9 \ ώ Bglll / Sstl fragment from the plasmid pAS6 pMI6 / 4.2 0.5 kb BamHVPstl fragment from the plasmid pMI6 / 6 pM 6 / 4.1 0.36 kb Ba Hl / Pstl fragment from the plasmid pMI6 / 6 pMI6 / 6.2.2 0.5 kb Sall Religand pMJ6 / 6.2.3 3.3 kb Sall fragment pMI6 / 6.2.4 1.2 kb Sall fragment pMI6 / 6.2.5 1.0 kb Sall fragment pMI6 / 6.2.6 0 , 7 kb & / I fragment pMI6 / 6.2.7 0.14 kb Sall fragment pMI6 / 6.2.8 0.13 kb Sall fragment pMI6 / 8.1 1.1 kb ClaV BamHl fragment pMI6 / l 0 1.5 Kb Pstl / Sall fragment
pAS6/3 2,8 kb BamHl Fragment aus dem Plasmid pAS6 pAS6/3.1 1 , 1 kb Hincll Fragment aus dem Plasmid pAS6/ pAS6/3.2 1 ,2 kb Sall Fragment aus dem Plasmid pAS6/3 pAS6/3.3 1,45 kb Pstl Fragment aus dem Plasmid pAS6/3pAS6 / 3 2.8 kb BamHl fragment from the plasmid pAS6 pAS6 / 3.1 1, 1 kb Hincll fragment from the plasmid pAS6 / pAS6 / 3.2 1, 2 kb SalI fragment from the plasmid pAS6 / 3 pAS6 / 3.3 1.45 kb Pstl Fragment from the plasmid pAS6 / 3
Für die Bestimmung der DNA-Sequenz des 2,8 kb Pstl-Fragment (pMJ l ) von Actinoplanes sp. wurden folgende Plasmide konstruiert und die Sequenz der Insert- DNA analysiert.For the determination of the DNA sequence of the 2.8 kb PstI fragment (pMJ I) from Actinoplanes sp. The following plasmids were constructed and the sequence of the insert DNA was analyzed.
pMJl/1 0,6 kb SphlPstl Fragment aus dem Plasmid pMJl,pMJl / 1 0.6 kb SphlPstl fragment from the plasmid pMJl,
Religand nach Sphl Hydrolyse pMJ 1/2 1 ,2 kb Satl'Pstl Fragment aus dem Plasmid pMJ 1 ,Religion after Sphl hydrolysis pMJ 1/2 1, 2 kb Satl'Pstl fragment from the plasmid pMJ 1,
Religand nach Sa Hydrolyse pMJl/3 1 ,4 kb SstlPstl Fragment aus dem Plasmid pMJ 1.Religand after Sa hydrolysis pMJl / 3 1, 4 kb SstlPstl fragment from the plasmid pMJ 1.
Religand nach Sstl Hydrolyse pMI 1/4.1 0, 9 kb Sall Smal Fragment aus dem Plasmid pMI 1 Für die DNA- Sequenzierung wurde die Methode von Sanger et al. (1977) oder ein davon abgeleitetes Verfahren angewandt. Es wurde mit dem Autoread Sequencing Kit (Pharmacia, Freiburg, Deutschland) in Verbindung mit dem Automated Laser Fluo- reszens (ALF) DNA-Sequenzierungsgerät (Pharmacia, Freiburg, Deutschland) gearbeitet. Geeignete Fluoreszein-markierte pUC reverse sequencing und sequencing Primer wurden käuflich erworben (Pharmacia, Freiburg, Deutschland). Die Sequenz des ca. 18,0 kb Bglll - Pstl Fragmentes ist in Abb. 3 dargestellt. Tab. 1 gibt eine Übersicht über die Eigenschaften der αct Gene und der von ihnen codierten Produkte.Religand after Sstl hydrolysis pMI 1 / 4.1 0.9 kb Sall Smal fragment from plasmid pMI 1 The method of Sanger et al. (1977) or a method derived therefrom. The autoread sequencing kit (Pharmacia, Freiburg, Germany) was used in conjunction with the automated laser fluorescence (ALF) DNA sequencing device (Pharmacia, Freiburg, Germany). Suitable fluorescein-labeled pUC reverse sequencing and sequencing primers were purchased (Pharmacia, Freiburg, Germany). The sequence of the approx. 18.0 kb Bglll - Pstl fragment is shown in Fig. 3. Tab. 1 gives an overview of the properties of the αct genes and the products they encode.
Tab. 2. Sequenzen der Primer für die PCR und die Sequenzreaktion.Tab. 2. Sequences of the primers for the PCR and the sequence reaction.
Primer für die PCR:Primers for the PCR:
Plasmid pAS5/l 7: Primerbezeichnung Sequenz acbD/El 5' GGCGGCGATTCGGCCTGCGCGG 31 acbD/E2 5' GCGGCGATGGCATGCCTGGCG 3'Plasmid pAS5 / l 7: Primer name sequence acbD / El 5 'GGCGGCGATTCGGCCTGCGCGG 3 1 acbD / E2 5' GCGGCGATGGCATGCCTGGCG 3 '
Plasmid pAS5/l 8: Primerbezeichnung Sequenz acbD3 5' ACCAGGCCGAGGACGGCGCCC 31 acbD4 5' AGCGGCATGTGCTTGACGGCG 3'Plasmid pAS5 / l 8: primer name sequence acbD3 5 'ACCAGGCCGAGGACGGCGCCC 3 1 acbD4 5' AGCGGCATGTGCTTGACGGCG 3 '
Plasmid pAS5/19: Primerbezeichnung Sequenz acbD5 5' ACCGGCTCGAACGGGCTGGCACC 3' acbD6 5' CCCTCGACGGTGACGGTGGCG 3' Primer für die Amplifizierung des acbC-Gens:Plasmid pAS5 / 19: Primer name sequence acbD5 5 'ACCGGCTCGAACGGGCTGGCACC 3' acbD6 5 'CCCTCGACGGTGACGGTGGCG 3' Primer for the amplification of the acbC gene:
Die Sequenzbereiche, mit denen Erkennungsstellen für die Restriktionsendonukleasen Ndel bzw. EcoRI konstruiert wurden, sind unterstrichen. Primerbezeichnung SequenzThe sequence regions with which recognition sites for the restriction endonucleases Ndel and EcoRI were constructed are underlined. Primer name sequence
AS7 5'GGAAGCTCATATGAGTGGTGTCG3AS7 5 ' GGAAGCTCATATGAGTGGTGTCG3
AS8 5 CGAGACGGTACATATGCACGCGGATG3'AS8 5 CGAGACGGTACATATGCACGCGGATG3 '
AS9' 5CCGTCTCGCCCACCCGCATCACC3'AS9 '5CCGTCTCGCCCACCCGCATCACC3'
AS-C1' 5%AGGGAAGCTCATATGAGTGGTGTCGAG3' AS-C2 5'GGTATCGCGCCAAGAATTCCTGGTGGACTG3AS-C1 '5 % AGGGAAGCTCATATGAGTGGTGTCGAG3' AS-C2 5'GGTATCGCGCCAAGAATTCCTGGTGGACTG3
Primer für die Sequenzreaktion: Primerbezeichnung Sequenz universal primer 51 GTAAAACGACGGCCAGT 3' reverse primer 5' GAAACAGCTATGACCATG 3'Primer for the sequence reaction: Primer name sequence universal primer 5 1 GTAAAACGACGGCCAGT 3 'reverse primer 5' GAAACAGCTATGACCATG 3 '
Die N-terminale Sequenzanalyse des AcbΕ-Proteins wurde mit dem Gasphasenpro- teinsequenzer 473 A der Firma Applied Biosystems (Forster City, CA., USA) durchgeführt. Das Standard-Proteinsequenzierungsprogramm Fastblott wurde verwendet. Der Proteinsequenzer, die verschiedenen Programme, die Abbauzyklen sowie dasThe N-terminal sequence analysis of the AcbΕ protein was carried out using the gas phase protein sequencer 473 A from Applied Biosystems (Forster City, CA., USA). The standard Fastblott protein sequencing program was used. The protein sequencer, the various programs, the breakdown cycles and the
PTH-Identifikationssystem sind im Handbuch des Sequenzers beschrieben (User's manual protein sequenzing System model 473 A (1989); Applied Biosystems Forster City, CA 94404, USA).PTH identification systems are described in the manual of the sequencer (User's manual protein sequencing system model 473 A (1989); Applied Biosystems Forster City, CA 94404, USA).
Der Nachweis der PTH- Aminosäuren wurde on-line mit eienr RP-18-Säule (220 mm x 2 mm, 5μ-material) von Applied Biosystems durchgeführt. Die PTH- Aminosäuren wurden mittels eines 50 pMol Standard identifiziert und quantifiziert. Die Daten wurden mit dem Sequenzerdatensystem 610A von Applied Biosystems verarbeitet.The detection of the PTH amino acids was carried out on-line with an RP-18 column (220 mm x 2 mm, 5μ material) from Applied Biosystems. The PTH amino acids were identified and quantified using a 50 pmol standard. The data was processed with Applied Biosystems 610A sequencer data system.
Alle eingesetzten Chemikalien für den Proteinsequenzer waren von Applied Biosystems. Beispiele:All chemicals used for the protein sequencer were from Applied Biosystems. Examples:
1. Anzucht der E. coli Stämme, Präparation der Plasmid-DNA und Isolierung von DNA-Fragmenten1. Cultivation of the E. coli strains, preparation of the plasmid DNA and isolation of DNA fragments
E coli DH5α wurde in LB-Medium bei 37°C bebrütet Plasmidtragende Bakterien wurden unter Selektionsdruck (Ampicillin, 100 μg/ml) gehalten Die Kultivierung erfolgte auf einem Rundschuttier bei 270 rpm Als Ubernachtkultur (UK) wurden Ansätze bezeichnet, die wenigstens 16 h bebrütet wurdenE coli DH5α was incubated in LB medium at 37 ° C. Plasmid-bearing bacteria were kept under selection pressure (ampicillin, 100 μg / ml). The cultivation was carried out on a rotary duster at 270 rpm. Approaches were described as overnight culture (UK) which incubated for at least 16 h were
Für die Praparation von Plasmid-DNA wurden die Zellen aus 1,5 ml einer unter Selektionsdruck bebruteten UK eingesetzt Die Isolierung der Plasmide erfolgte nach der Methode der alkalischen SDS-Lyse [Birnboim, H C , u J Doly (1979)]For the preparation of plasmid DNA, the cells from 1.5 ml of a UK incubated under selection pressure were used. The plasmids were isolated by the alkaline SDS lysis method [Birnboim, HC, and J Doly (1979)]
Zur gezielten Hydrolyse von Vektor-DNA wurden ausschließlich Restriktionsendonukleasen nach Vorschrift des Herstellers (Gibco BRL, Eggenstein, Deutschland) eingesetzt Zur Restriktion von 10 μg Plasmid-DNA wurden 5 U der jeweiligen Re- stπktionsendonuklease eingesetzt und 2 h bei 37°C inkubiert Um eine vollständige Hydrolyse zu gewährleisten, wurde die gleiche Menge Restπktionsendonuklease ein zweites Mal zugegeben und erneut mindestens 1 h inkubiertOnly restriction endonucleases according to the manufacturer's instructions (Gibco BRL, Eggenstein, Germany) were used for the targeted hydrolysis of vector DNA. 5 U of the respective restriction endonuclease were used for the restriction of 10 μg plasmid DNA and incubated at 37 ° C. for 2 hours To ensure complete hydrolysis, the same amount of residual endonuclease was added a second time and incubated again for at least 1 h
Die gespaltene DNA wurde, je nach Große der DNA-Fragmente, auf 0,5 -1,2 %ιgen horizontalen Agarosegelen elektrophoretisch getrennt Zur Elution wurde das Gelstuck, welches das DNA-Fragment enthielt, mit einem sterilen Skalpell ausgeschnitten und gewogen Die Elution der DNA-Fragmente aus der Agarose erfolgte nach Vorschrift mit dem ETsorb-Kit (Genomed, Bad Oeynhausen, Deutschland) 2. Anzucht von Actinoplanes sp. SE50/110, Präparation, Spaltung der chromosomalen DNA und gelelektrophoretische TrennungDepending on the size of the DNA fragments, the cleaved DNA was electrophoretically separated on 0.5-1.2% horizontal agarose gels. For elution, the gel piece, which contained the DNA fragment, was cut out with a sterile scalpel and weighed DNA fragments from the agarose were carried out according to the instructions with the ETsorb kit (Genomed, Bad Oeynhausen, Germany) 2. Cultivation of Actinoplanes sp. SE50 / 110, preparation, cleavage of the chromosomal DNA and gel electrophoretic separation
Actinoplanes sp SE50/1 10 wurde bei 30°C in TSB-Medium auf einem Rundschuttier für 3 d bebrütet Die Vorkultur (5 ml) erfolgte bei 240 rpm in Kulturrohrchen, dieActinoplanes sp SE50 / 1 10 was incubated at 30 ° C. in TSB medium on a rotary debris for 3 d. The preculture (5 ml) was carried out at 240 rpm in culture tubes
Hauptkultur (50 ml) in 500 ml Schikanekolben bei 100 rpm Die Zellen wurden nach der Kultivierung durch Zentπfugation sedimentiert und zweimal in TE-Puffer gewaschenMain culture (50 ml) in 500 ml baffle flasks at 100 rpm. After cultivation, the cells were sedimented by centrifugation and washed twice in TE buffer
Die Praparation der Gesamt-DNA erfolgte mit 1,5 - 2 mg Zellen (Frischgewicht) nach der Methode der Phenol/Chloroform-Extraktion [Hopwood, D A , et al (1985)]The total DNA was prepared with 1.5-2 mg cells (fresh weight) according to the phenol / chloroform extraction method [Hopwood, D A, et al (1985)]
Die Hydrolyse von 20 μg chromosomaler DNA wurde mit 10 U des entsprechenden Restriktionsenzyms (Gibco BRL, Eggenstein, Deutschland) für 2 h bei 37°C in dem zugehörigen Puffer durchgeführt Um eine vollständige Hydrolyse zu gewahrleisten, wurde die gleiche Menge Restπktionsendonuklease ein zweites Mal zugegeben und erneut für mindestens 1 h inkubiertThe hydrolysis of 20 μg chromosomal DNA was carried out with 10 U of the corresponding restriction enzyme (Gibco BRL, Eggenstein, Germany) for 2 h at 37 ° C. in the associated buffer. In order to ensure complete hydrolysis, the same amount of residual endonuclease was added a second time and incubated again for at least 1 h
Die gespaltene DNA wurde auf 0,6%ιgen horizontalen Agarosegelen elektrophore- tisch getrenntThe cleaved DNA was electrophoresed on 0.6% horizontal agarose gels
Die Elution von DNA-Fragmenten erfolgte wiederum mit dem JETsorb-Kit (s Beispiel 1)The DNA fragments were again eluted using the JETsorb kit (see Example 1).
3. Herstellung der acb-Gensonde-II, acb-Gensonde-III und acb-Gensonde-IV3. Production of the acb gene probe II, acb gene probe III and acb gene probe IV
Die nach Beispiel 1 präparierten Fragmente aus pAS2 (s DE 195 07214), pAS5/7 3 und pAS6/3 wurden mit dem "Nick Translation System" des Herstellers Gibco BRL, Eggenstein, Deutschland nach dessen Angaben radioaktiv markiert Hierbei wurden 0,5 - 1,0 μg DNA-Fragment eingesetzt Es wurde [α 2P]dCTP verwendet (3000The fragments from pAS2 (see DE 195 07214), pAS5 / 7 3 and pAS6 / 3 prepared according to Example 1 were radioactively marked with the "Nick Translation System" from the manufacturer Gibco BRL, Eggenstein, Germany. 1.0 μg DNA fragment used. [Α 2 P] dCTP was used (3000
Ci/mM, Amersham Buchler, Braunschweig) Anschließend wurde der Ansatz 10 Mi- nuten gekocht (Denaturierung) und sofort zu der Hybridisierungslosung gegeben (s Beispiel 4)Ci / mM, Amersham Buchler, Braunschweig) The batch was then 10 mi grooves cooked (denaturation) and immediately added to the hybridization solution (see example 4)
4. DNA-Transfer auf Membranen, DNA-Hybridisierung (Southern- Hybridisierung und Autoradiographie)4. DNA transfer on membranes, DNA hybridization (Southern hybridization and autoradiography)
Die Übertragung von DNA-Fragmenten aus Agarosegelen auf Membranen erfolgte nach der Methode des "Southern-Transfer" [ Southern, E M (1975)] Die nach Beispiel 2 erhaltenen Agarosegele wurden 20 Minuten in 0,25 M HC1 geschwenkt Die Gele wurden auf 3 Lagen saugfahiges Whatman-Papier 3MM (Whatmann, Maidstone,DNA fragments from agarose gels were transferred to membranes by the "Southern Transfer" method [Southern, EM (1975)]. The agarose gels obtained according to Example 2 were swirled in 0.25 M HC1 for 20 minutes 3MM absorbent Whatman paper (Whatmann, Maidstone,
GB) gelegt und eine Hybond™-N+Membran (Amersham Buchler, Braunschweig) luftblasenfrei aufgelegt Darauf wurden mehrere Schichten saugfahiges Papier gelegt Auf den Filterstapel wurde ein ca 1 kg schweres Gewicht gestellt Der DNA-Transfer erfolgte durch Durchsaugen von 0,4 M NaOH Nach mindestens 12 h Transferzeit wurden die Nylonfilter mit 2xSSC für 5 Minuten gespult und an der Luft getrocknetGB) and a Hybond ™ -N + membrane (Amersham Buchler, Braunschweig) applied without air bubbles. Several layers of absorbent paper were placed on top. A weight of approx. 1 kg was placed on the filter stack. The DNA transfer was carried out by sucking through 0.4 M NaOH After at least 12 h transfer time, the nylon filters were rinsed with 2xSSC for 5 minutes and air-dried
Die Nylon-Filter wurden dann mindetens 2 h bei 68°C in 50-100 ml Prahybπdisie- rungslosung im Wasserbad geschüttelt Dabei wurde die Losung mindestens zweimal gewechselt Die Hybridisierung fand im Hybridisierschrank für mindestens 12 h statt Es wurden 15 ml Hybridisierungslosung, welche die acb-Sonde-II enthielt (s BeispielThe nylon filters were then shaken at least 2 h at 68 ° C in 50-100 ml prahybπdisisation solution in a water bath. The solution was changed at least twice. The hybridization took place in the hybridization cabinet for at least 12 h. 15 ml hybridization solution, which the acb -Sonde-II contained (s example
3), eingesetzt.3), used.
Die Nylon-Filter wurden anschließend für jeweils 15 Minuten mit 6x Postwash und l x Postwash gewaschen Die Nylon-Filter wurden dann im noch feuchten Zustand mit Frischhaltefolie abgedeckt Die Autoradiographie erfolgte mit Hyperfilm-MPThe nylon filters were then washed for 15 minutes with 6x postwash and 1 x postwash. The nylon filters were then covered with cling film while still moist. The autoradiography was carried out with Hyperfilm-MP
(Amersham Buchler, Braunschweig) in einer lichtdichten Kassette mit Verstarkerfo- hen bei -80°C für mindestens 16 h 5. Isolierung und Klonierung der Bglll-, Pstl- und Sstl-Fragmente aus der Gesamt-DNA von Actinoplanes sp.(Amersham Buchler, Braunschweig) in a light-tight cassette with amplifying foals at -80 ° C for at least 16 h 5. Isolation and cloning of the BglII, Pstl and Sstl fragments from the total DNA of Actinoplanes sp.
Chromosomale DNA aus Actinoplanes sp wurde mit Bglll, Pstl und Sstl vollständig hydrolysiert, durch Agarose-Gelelektrophorese getrennt und die Sstl-Fragmente derChromosomal DNA from Actinoplanes sp was completely hydrolyzed with Bglll, Pstl and Sstl, separated by agarose gel electrophoresis and the Sstl fragments of the
Lange 9,0 -12 kb, _5g- II-Fragmente der Lange 1 1 - 13 kb und Pstl Fragmente der Lange 2,5-3,5 kb aus der Agarose eluiert (s Beispiel 1) Die eluierten Sstl-Fragmente und Pstl-Fragmente wurden mit Vektorplasmid pUC18, präpariert aus E. coli DH5α, hydrolysiert mit Sstl bzw Pstl ligiert. Die Vektorplasmide wurden zuvor mit alkali- scher Phosphatase (Boehringer, Mannheim) nach Vorschrift des Herstellers behandeltLong 9.0 -12 kb, _5g- II fragments of the length 1 1 - 13 kb and Pstl fragments of the length 2.5-3.5 kb eluted from the agarose (see example 1) The eluted Sstl fragments and Pstl- Fragments were ligated with vector plasmid pUC18, prepared from E. coli DH5α, hydrolyzed with Sstl or Pstl. The vector plasmids were previously treated with alkaline phosphatase (Boehringer, Mannheim) according to the manufacturer's instructions
Die Ligation fand in einem Volumen von 20 μl statt, wobei das Verhältnis von Fragment zu Vektor 3 1 betrug mit 0,01 -0, 1 μg DNA im Ansatz Es wurde 1 U der T4- DNA-Ligase mit dem entsprechendem Puffer (Gibco BRL, Eggenstein, Deutschland) eingesetzt Die eluierten _9g/Η-Fragmente wurden in das Z- mHI-hydrolisierte Vektor- plasmid pBluescript II KS ligiert Die Ligation wurde wie bei den Sstl- und Pstl-The ligation took place in a volume of 20 μl, the ratio of fragment to vector being 3 1 with 0.01-0.1 μg of DNA in the batch. 1 U of the T4 DNA ligase with the appropriate buffer (Gibco BRL , Eggenstein, Germany) The eluted _9g / Η fragments were ligated into the Z-mHI-hydrolyzed vector plasmid pBluescript II KS. The ligation was carried out as with the Sstl and Pstl
Fragmenten durchgeführtFragments performed
Transformationskompetente Zellen von E.coh DH5α wurden mit vollständigen Liga- tionsansatzen transformiert [nach Hanahan, D (1983)] Ampicil n-resistente Trans- formanden wurden auf LB-Amp Selektivplatten (100 μg/ml) übertragenTransformation-competent cells from E.coh DH5α were transformed with complete ligation approaches [according to Hanahan, D (1983)] Ampicil n-resistant transformants were transferred to LB-Amp selective plates (100 μg / ml)
6. Identifizierung von Klonen, welche das 10,7 kb Sstl-Fragment, 12 kb ßg/π-Fragment, 2,8 kb Psrt-Fragment und das 6,3 kb Sstl Fragment aus dem Acarbose-Biosynthesecluster enthalten6. Identification of clones which contain the 10.7 kb Sstl fragment, 12 kb ßg / π fragment, 2.8 kb Psrt fragment and the 6.3 kb Sstl fragment from the acarbose biosynthesis cluster
Ampicillin-resistente Transformanden wurden auf das Vorhandensein des 10,7 kb Sstl- Fragments und 12 kb P /II-Fragments, das mit der acb-Sonde-II hybridisiert, untersucht eweils zehn dieser Klone wurden auf einer Selektivplatte ausgestrichen, über Nacht bebrütet und mit 3 ml LB-Medium von der Platte gewaschen Es wurde dann aus 20 solcher Zehner-Pools die Plasmid-DNA isoliert [nach Birnboim, H C , u JAmpicillin-resistant transformants were examined for the presence of the 10.7 kb SstI fragment and 12 kb P / II fragment which hybridized with the acb probe II. Ten of these clones were streaked on a selective plate, incubated overnight and washed from the plate with 3 ml LB medium. The plasmid DNA was then isolated from 20 such pools of ten [according to Birnboim, HC, uJ
Doly (1979)] Um die klonierten Sstl-Fragmente aus dem Polylinker zu entfernen, wurden die 20 verschiedenen Plasmidpraparationen mit den Restriktionsendonukle- asen EcoRI und Hinάlll , bzw Sstl und Hwdlll hydrolysiert Die Restriktionsansatze wurden dann auf einem 0,6% Agarosegel elektrophoretisch getrennt und die DNA mittels Southern-Transfer aus dem Agarosegel auf einen Nylon-Filter übertragen (s Beispiel 4) Die Hybπdisierung erfolgte wiederum mit der acb-Sonde-II (s Beispiel 4) e einer der Pools reagierte positiv mit der acb-Sonde-II und wurde in die zehn Einzelklone geteilt Deren Plasmide wurden ebenfalls isoliert und der oben beschriebenen Prozedur unterworfen Die hybridisierenden Plasmide wurden mit pAS5 bzw pAS6 bezeichnet Sie enthalten ein 10,7 kb Ss/I-Fragment (pAS5) bzw ein 12 kb /II-Fragment (pAS6)Doly (1979)] In order to remove the cloned SstI fragments from the polylinker, the 20 different plasmid preparations with the restriction endonucleotides were asen EcoRI and Hinάlll, or Sstl and Hwdlll hydrolyzed The restriction batches were then electrophoresed on a 0.6% agarose gel and the DNA was transferred from the agarose gel to a nylon filter using Southern transfer (see Example 4). The hybridization was again carried out with the acb-Probe-II (see Example 4) e one of the pools reacted positively with the acb-Probe-II and was divided into the ten individual clones. Their plasmids were also isolated and subjected to the procedure described above. The hybridizing plasmids were designated pAS5 or pAS6 They contain a 10.7 kb Ss / I fragment (pAS5) or a 12 kb / II fragment (pAS6)
Der rekombinierte Phage 10/3 wurde mit Pstl hydrolysiert, die DNA auf einem horizontalen Agarosegel und das 2,8 kb Pvtl Fragment aus der Matrix eluiert (s Beispiel 1 ) und in den Vektor pUC18 ligiert Das rekombinante Plasmid bekam die Bezeichnung pMH und wurde ιn £ coli DH5α transformiertThe recombined phage 10/3 was hydrolyzed with Pstl, the DNA on a horizontal agarose gel and the 2.8 kb Pvtl fragment eluted from the matrix (see example 1) and ligated into the vector pUC18. The recombinant plasmid was given the name pMH and was ιn Transformed £ coli DH5α
Der rekombinante Phage 5/4 wurde mit Sstl hydrolysiert, die DNA auf einem horizontalen Agarosegel getrennt und das 6,3 kb Sstl Fragment aus der Matrix eluiert (siehe Beispiel 1) und in den Vektor pUC18 ligiert Das rekombinante Plasmid bekam die Bezeichnung pMJ9 und wurde in E coli DH5α transformiertThe recombinant phage 5/4 was hydrolyzed with Sstl, the DNA separated on a horizontal agarose gel and the 6.3 kb Sstl fragment eluted from the matrix (see Example 1) and ligated into the vector pUC18. The recombinant plasmid was given the name pMJ9 and was transformed into E coli DH5α
7. Herstellung der GEM12-Genbank und Isolierung von rekombinanten Phagen, die Acarbose-Biosynthese-Gene enthalten und Präparation der Phagen-DNA.7. Preparation of the GEM12 library and isolation of recombinant phages containing acarbose biosynthesis genes and preparation of the phage DNA.
Chromosomale DNA aus Actinoplanes sp wurde mit Stπ.3AI partiell hydrolysiertChromosomal DNA from Actinoplanes sp was partially hydrolyzed with Stπ.3AI
Hierfür wurde 50 μg chromosomale Acfinoplanes-DNA mit 0,015 U „S ./3AI für 30 mm bei 37°C inkubiert Die Enzvmreaktion wurde durch Extraktion mit Phenol Chloroform und Ethanolprazipitation [nach Sambrook et al (1989)] gestoppt Die weitere Behandlung der DNA-Fragmente und die Ligation mit Phagenvektor GEM12 erfolgte nach Angabe des Herstellers (Promega Heidelberg) Die in vitro Verpackung des Ligationansatzes wurde mit dem „DNA packaging kit" von Boehπnger (Mannheim) durchgeführt Die Phagen wurden in E coli LE392, nach der bei Sam- brook et al. (1989) beschriebenen Methode vermehrt Die Phagen mit Acarbosebio- synthese-Genen wurden durch Plaquehybridisierung (nach Sambrook et al 1989) mit den Gensonden-acb-HI und -acb-IV identifiziert Die Phagen-DNA, die Acarbose- biosynthese-Gene enthielt, wurde aus Phagen, die auf E. coli LE392 vermehrt wurden, nach Sambrook et al. (1989) präpariertFor this, 50 μg of chromosomal Acfinoplanes DNA was incubated with 0.015 U „S ./3AI for 30 mm at 37 ° C. The enzyme reaction was stopped by extraction with phenol chloroform and ethanol precipitation [according to Sambrook et al (1989)]. The further treatment of the DNA Fragments and ligation with phage vector GEM12 were carried out according to the manufacturer (Promega Heidelberg). The in vitro packaging of the ligation mixture was carried out using the “DNA packaging kit” from Boehπnger (Mannheim). The phages were in E coli LE392, according to the brook et al. (1989), the method described increased. The phages with acarbose biosynthesis genes were identified by plaque hybridization (according to Sambrook et al 1989) with the gene probes acb-HI and acb-IV. The phage DNA which contained acarbose biosynthesis genes was made from phages which were propagated on E. coli LE392 according to Sambrook et al. (1989)
8. Polymerase-Ketten-Reaktion8. Polymerase chain reaction
Die PCR dient der in vitro Vermehrung ausgesuchter DNA Bereiche [Mullis, K.B , u F A Falloona (1987)]. Es wurde für alle Reaktionen die Taq-DNA-Polymerase nach Angaben des Herstellers (Gibco BRL, Eggenstein) in 25 Reaktionszyklen eingesetzt Die Ansätze enthielten zur Unterdrückung möglicher Sekundarstrukturen bei GC- reicher DNA 5 % Formamid Das Volumen betrug 100 μl wobei 50 pmol je Pπmer und 200 μM dNTP's eingesetzt wurden Nach einer einleitenden fünfminutigen Denaturierung der DNA bei 95 °C wurden 2,5 U der temperaturstabilen DNA-Polymerase in einem "hot-start" den Ansätzen zugefügt Die Primerverlängerung erfolgte bei 72 °C und die Denaturierung der DNA am Anfang jedes Zyklus erfolgte bei 95 °C für 1 Min Die Reaktionen wurden in einem Biometra Thermocycler (Gottingen) durchgeführtThe PCR is used for the in vitro multiplication of selected DNA areas [Mullis, KB, u FA Falloona (1987)]. For all reactions, the Taq DNA polymerase according to the manufacturer (Gibco BRL, Eggenstein) was used in 25 reaction cycles. The batches contained 5% formamide to suppress possible secondary structures in GC-rich DNA. The volume was 100 μl with 50 pmol per polymer and 200 uM dNTP's were used After an initial five minute denaturation of DNA at 95 ° C 2.5 U of thermostable DNA polymerase were mixed in a "hot-start" added to the lugs primer extension was carried out at 72 ° C and the denaturation of DNA at the beginning of each cycle was carried out at 95 ° C. for 1 min. The reactions were carried out in a Biometra thermal cycler (Gottingen)
Tab 3 Protokolle für die PCPv, um DNA-Fragmente aus dem Acarbose-Cluster zu amplifizierenTab 3 protocols for the PCPv to amplify DNA fragments from the acarbose cluster
Die Bezeichnung der rekombinanten Plasmide, die die entsprechenden Fragmente enthalten, sind aufgeführtThe names of the recombinant plasmids which contain the corresponding fragments are listed
9. Subklonierung des Plasmids pAS5 9. Subcloning of the plasmid pAS5
Ausgehend von dem Plasmid pAS5 wurden mehrere Subklone erstellt, um die Sequenz der Doppelstrang-DNA aufzuklarenStarting from the plasmid pAS5, several subclones were created in order to clarify the sequence of the double-stranded DNA
pAS5/6 Das Plasmid pAS5 wurde mit dem Restriktionsenzym Pstl hydrolysiert, Gel- elektrophoretisch (0,7%igen Agarosegel ) aufgetrennt, das 5,4 kb Pstl-Fragment aus dem Gel eluiert und in pUC 18 (hydrolysiert mit Pstl) in E. coli DH5α kloniertpAS5 / 6 The plasmid pAS5 was hydrolysed with the restriction enzyme Pstl, gel electrophoresis (0.7% agarose gel), the 5.4 kb Pstl fragment eluted from the gel and in pUC 18 (hydrolyzed with Pstl) in E. coli DH5α cloned
pAS5/3. pAS5/4. pAS5/13. pAS5/16 Das Plasmid pAS5 wurde mit dem Restriktionsenzym BamHl hydrolysiert und Gel-elektrophoretisch aufgetrennt Die Fragmente hatten die folgende GroßepAS5 / 3. pAS5 / 4. pAS5 / 13. pAS5 / 16 The plasmid pAS5 was hydrolyzed with the restriction enzyme BamHl and gel-electrophoretically separated. The fragments had the following size
1.4 kb BamHl Fragment 1,2 kb BamHl Fragment 2,3 kb BamHl Fragment1.4 kb BamHl fragment 1.2 kb BamHl fragment 2.3 kb BamHl fragment
0,5 kb BamHl Fragment 0,45 kb BamHl Fragment0.5 kb BamHl fragment 0.45 kb BamHl fragment
7.5 kb BamHl Fragment (= 4,8 kb BamHl Sstl Fragment aus Actinoplanes DNA ligiert mit pUC 18)7.5 kb BamHl fragment (= 4.8 kb BamHl Sstl fragment from Actinoplanes DNA ligated to pUC 18)
Die für die Subklonierung vorgesehenen Fragmente mit der Große von 1,4 kb und 0,5 kb wurden aus dem Gel eluiert (s Beispiel 1) Für die Klonierung wurde der Vektor pUC 18 mittels des Restriktionsenzyms BamHl wie unter Beispiel 1 beschrieben präpariert Die Ligationen wurden wie unter Beispiel 5 beschrieben durchgeführt Das 0,5 kb Fragment wurde in den präparierten pUC 18 ligiert, und es entstand der Subklon pAS5/16 Der Subklon pAS5/3 entstand nach der Ligation des 1 ,4 kb Fragments mit dem präparierten pUC 18 Der Subklon pAS5/4 entstand nach der Ligation des 1 ,2 kb Fragments mit dem Vektor pUC18 Der Subklon pAS5/13 entstand durch Rehgation des 7,5 kb BamHl FragmentsThe fragments intended for subcloning with a size of 1.4 kb and 0.5 kb were eluted from the gel (see example 1). For the cloning, the vector pUC 18 was prepared using the restriction enzyme BamHl as described in example 1. The ligations were carried out The 0.5 kb fragment was ligated into the prepared pUC 18 and the subclone pAS5 / 16 was formed. The subclone pAS5 / 3 was formed after the ligation of the 1.4 kb fragment with the prepared pUC 18 the subclone pAS5 / 4 was created after ligation of the 1.2 kb fragment with the vector pUC18. The subclone pAS5 / 13 was created by rehabilitation of the 7.5 kb BamHl fragment
PAS5/5. PAS5/7, pAS5/U. PAS5/12 Das Plasmid pAS5 wurde mit den Restriktionsenzymen BamHl u Sstl, Pstl u. Sstl, Bglll u Pstl sowie Bglll u Hindill hydro- lysiert Die Restπktionsansatze wurden in einem l,2%ιgen Agarosegel getrennt Die entsprechenden Fragmente wurden aus dem Agarosegel eluiert und in pUC 18 (hvdrolysiert mit BamHl u Sstl, Pstl u Sstl, BamHl u Pstl oder BamHl u Hmάlll) in E coli DH5α klomert Der Subklon pAS5/5 enthalt das 0,48 kb Sstl BamHl Frag- ment, der Subklon pAS5/12 das 0,63 kb BglW Pstl Fragment und der Subklon pAS5/l 1 das 0,68 kb BgllllHinάlll FraqmentPAS5 / 5. PAS5 / 7, pAS5 / U. PAS5 / 12 The plasmid pAS5 was with the restriction enzymes BamHl u Sstl, Pstl u. Sstl, Bglll u Pstl and Bglll u Hindill hydro- The remaining fragments were separated in a 1.2% agarose gel. The corresponding fragments were eluted from the agarose gel and cloned in E. coli DH5α in pUC 18 (hydrolyzed with BamHl u Sstl, Pstl u Sstl, BamHl u Pstl or BamHl u Hmάlll) Subclone pAS5 / 5 contains the 0.48 kb Sstl BamHl fragment, subclone pAS5 / 12 contains the 0.63 kb BglW Pstl fragment and subclone pAS5 / l 1 contains the 0.68 kb BgllllHinάlll fragment
pAS5/15 1 1. pAS5/15 12 Das Plasmid p AS 5/ 15 wurde mit den Restriktionsendonukleasen Ncol und Kpnl hydrolysiert Die dadurch entstandenen 0,9 kb Ncol Kpnl u 1, 1 kb Ncol/Kpnl Fragmente wurden aus einem l,2%ιgen Agarosegel eluiert (spAS5 / 15 1 1. pAS5 / 15 12 The plasmid p AS 5/15 was hydrolyzed with the restriction endonucleases Ncol and Kpnl. The resulting 0.9 kb Ncol Kpnl u 1, 1 kb Ncol / Kpnl fragments were extracted from a 1.2% Agarose gel eluted (see
Beispiel 1 ) und in den Vektor pUCBM21 (Boehπnger, Mannheim) (hydrolysiert mit Ncol Kpnl) in E coli DH5α klomert, und es entstanden die Subklone pAS5/15 12 (0,9 kb Fragment) und pAS5/15 1 1 (1, 1 kb Fragment)Example 1) and in the vector pUCBM21 (Boehπnger, Mannheim) (hydrolyzed with Ncol Kpnl) in E. coli DH5α, and the subclones pAS5 / 15 12 (0.9 kb fragment) and pAS5 / 15 1 1 (1, 1 kb fragment)
10. Subklonierung der Plasmide pAS6, pMJ 6/6 und des Phagen 5/410. Subcloning of plasmids pAS6, pMJ 6/6 and phage 5/4
pMJ6/6 Das Plasmid pAS6 wurde mit der Restπktionsendonuklease Sstl hvdrolysiert (unter Ausnutzung der Restπktionsschnittstelle des Vektors) und ein 5,9 kb Sstl Fragment aus dem Agarose-Gel eluiert und mit dem Plasmid pUC 18 ligiert L coli DH5α wurde mit dem rekombinanten Plasmid transformiertpMJ6 / 6 The plasmid pAS6 was hvdrolysed with the residual endonuclease Sst1 (using the residual interface of the vector) and a 5.9 kb Sstl fragment was eluted from the agarose gel and ligated with the plasmid pUC 18. L coli DH5α was transformed with the recombinant plasmid
pMI6/4 1 und pMJ6/4 2 Das Plasmid pMI6/6 wurde mit den Restπktions-endo- nucleasen BamHl und Pstl hydrolysiert, und ein 0,36 kb BamHl Pstl- sowie ein 0,5 kb ßαwHI/Pstl-Fragment wurden aus dem Agarose-Gel eluiert und mit dem Plasmid pUC18 ligiert E coli DH5α wurde mit den rekombinanten Plasmiden transformiertpMI6 / 4 1 and pMJ6 / 4 2. The plasmid pMI6 / 6 was hydrolyzed with the residual endonucleases BamHl and Pstl, and a 0.36 kb BamHl Pstl and a 0.5 kb βαwHI / Pstl fragment were obtained from the Agarose gel eluted and ligated with the plasmid pUC18 E. coli DH5α was transformed with the recombinant plasmids
pMI6/6 2 2. pMI6/6 2 3. pMI6/6 2 4, pMJ6/6 2 5, pMJ6/6 2 6 pMJ6/6 2 7, pMI6/6 2 8 das Plasmid pMI6/6 wurde mit der Restπktionsendonuclease Sall hydro- lysiert und ein 3,3 kb- Fragment, ein 1,2 kb Fragment, ein 1,0 kb- Fragment ein 0 7 kb-Fragment, ein 0, 14 kb-Fragment und ein 0, 13 kb- Fragment wurden aus dem Agarose- Gel eluiert und mit dem Plasmid pUC18 ligiert E coli DH5α wurde mit den rekombinanten Plasmiden transformiert Das Plasmid pMJ6/6 2 2 wurde durch Hydrolyse und folgende Re gation erhaltenpMI6 / 6 2 2. pMI6 / 6 2 3. pMI6 / 6 2 4, pMJ6 / 6 2 5, pMJ6 / 6 2 6 pMJ6 / 6 2 7, pMI6 / 6 2 8 the plasmid pMI6 / 6 was used with the residual endonuclease Sall hydrolyzed and a 3.3 kb fragment, a 1.2 kb fragment, a 1.0 kb fragment, a 07 kb fragment, a 0.14 kb fragment and a 0.13 kb fragment were made from eluted the agarose gel and ligated with the plasmid pUC18. E coli DH5α was with the recombinant plasmids transformed The plasmid pMJ6 / 6 2 2 was obtained by hydrolysis and the following reg
pMI6/8 1 das Plasmid pMI6/6 wurde mit den Restriktionsenzymen C/al und BamHl hydrolysiert und ein 1, 1 kb Fragment aus einem Agarosegel eluiert und mit dempMI6 / 8 1 the plasmid pMI6 / 6 was hydrolyzed with the restriction enzymes C / al and BamHl and a 1.1 kb fragment was eluted from an agarose gel and with the
Plasmid pBluescπpt II KS ligiert E coli DH5α wurde mit dem rekombinanten Plasmid transformiertPlasmid pBluescπpt II KS ligated E coli DH5α was transformed with the recombinant plasmid
pMI6/10 Das Plasmid pMI6/6 wurde mit den Restriktionsenzymen Pstl und Sall hydrolysiert und ein 1,5 kb Fragment aus einem Agarosegel eluiert und mit dempMI6 / 10 The plasmid pMI6 / 6 was hydrolyzed with the restriction enzymes Pstl and Sall and a 1.5 kb fragment was eluted from an agarose gel and with the
Plasmid pUC18 ligiert E coli DH5α wurde mit dem rekombinanten Plasmid transformiertPlasmid pUC18 ligated E. coli DH5α was transformed with the recombinant plasmid
pAS6/3 Das Plasmid pAS6 wurde mit der Restπktionsendonuclease BamHl hvdroly- siert und ein 2,8 kb BamHl Fragment aus dem Agarose-Gel eluiert, mit dem Plasmid pUC 18 ligiert und in E coli DH5α transformiertpAS6 / 3 The plasmid pAS6 was hvdrolyzed with the residual endonuclease BamHl and a 2.8 kb BamHl fragment was eluted from the agarose gel, ligated to the plasmid pUC 18 and transformed into E coli DH5α
pAS6/3 1 Das Plasmid pAS6/3 wurde mit der Restπktionsendonuclease Hi cll hvdrolysiert und ein 1, 1 kb Fragment in pUC18, hydrolysiert mit Hincll, ligiert und in L coli DH5α klomertpAS6 / 3 1 The plasmid pAS6 / 3 was hvdrolyzed with the residual endonuclease Hi cll and a 1.1 kb fragment in pUC18, hydrolyzed with Hincll, ligated and clomerized in L coli DH5α
pAS6/3 2 Das Plasmid pAS6/3 wurde mit der Restπktionsendonuclease Sall hvdrolv- siert, ein 1,2 kb Fragment in pUC18, hydrolysiert mit Sall, ligiert und in L coli DH5α klomertpAS6 / 3 2 The plasmid pAS6 / 3 was hvdrolvated with the residual endonuclease Sall, a 1.2 kb fragment in pUC18, hydrolyzed with Sall, ligated and clomerized in L coli DH5α
pAS6/3 3 Das Plasmid pAS6 wurde mit der Restπktionsendonuclease Pstl hydrolv- siert, ein 1,45 kb Fragment aus dem Gel eluiert und mit pUC18 ligiert L coli DH5α wurde mit dem rekombinanten Plasmid transformiert 11. Subklonierung des Plasmids pMJlpAS6 / 3 3 The plasmid pAS6 was hydrolysed with the residual endonuclease Pstl, a 1.45 kb fragment was eluted from the gel and ligated with pUC18. L coli DH5α was transformed with the recombinant plasmid 11. Subcloning of the plasmid pMJl
pMJl/1 Das Plasmid pMJl wurde mit der Restπktionsendonuklease Sphl hydrolysiert und ein 3,3 kb S M-Fragment (0,6 kb Sphl/Pstl Fragment ligiert mιtpUC 18) aus dem Agarosegel eluiert Dieses Fragment wurde re giert und in E coli DH5α klomertpMJl / 1 The plasmid pMJl was hydrolyzed with the residual endonuclease Sphl and a 3.3 kb S M fragment (0.6 kb Sphl / Pstl fragment ligated mιtpUC 18) eluted from the agarose gel. This fragment was re gated and clomerized in E coli DH5α
pM l/2 Das Plasmid pMJl wurde mit der Restπktionsendonuklease Sall hydrolysiert und ein 3,9 kb Sall -Fragment (1,2 kb Sall/Pstl Fragment ligiert mit pUC18) aus dem Agarosegel eluiert Dieses Fragment wurde rehgiert und in E coli DH5α klomertpM 1/2 The plasmid pMJ1 was hydrolyzed with the residual endonuclease Sal and a 3.9 kb Sal fragment (1.2 kb Sal / Pstl fragment ligated with pUC18) eluted from the agarose gel. This fragment was rehabilitated and clomerized in E coli DH5α
pMJl/3 Das Plasmid pM l wurde mit der Restπktionsendonuklease Sall hydrolysiert und ein 4, 1 kb Sstl/Pstl-Fragment (1,4 kb SstllPstl Fragment ligiert mit pUC 18) aus dem Agarosegel eluiert Dieses Fragment wurde rehgiert und in E coli DH5α klomertpMJl / 3 The plasmid pM l was hydrolyzed with the residual endonuclease Sal and a 4.1 kb Sstl / Pstl fragment (1.4 kb SstllPstl fragment ligated to pUC 18) eluted from the agarose gel. This fragment was rehabilitated and clomerized in E coli DH5α
pMJl/4 1 Das Plasmid pMJl wurde mit der Restπktionsendonuklease Sall hvdrolysiert und ein 0,9 kb SaWSmal Fragment aus dem Agarose-Gel eluiert und mit dem Plasmid pUC 18 ligiert Das rekombinante Plasmid wurde in E coli DH5α transformiertpMJl / 4 1 The plasmid pMJl was hvdrolyzed with the residual endonuclease Sall and a 0.9 kb SaWSmal fragment was eluted from the agarose gel and ligated with the plasmid pUC 18. The recombinant plasmid was transformed into E coli DH5α
12. Herstellung von Subklonen aus pAS5/612. Production of subclones from pAS5 / 6
Die Herstellung der pAS5/6-Subklone erfolgte mit dem „double-stranded Nested Deletion Kit" (Pharmacia, Freiburg, Deutschland) 10 μg pAS5/6 DNA wurde wie in Beispiel 1 beschrieben präpariert und mit je 10 U Xhol und Ss/I hydrolysiert Die anschließende Inkubation mit Exonuklease III erfolgte nach Herstellerangaben für insgesamt 20 min In Abstanden von 5 min wurden dem Reaktionsansatz Teilmengen entnommen, die einer DNA-Menge von ca 2,5 μg DNA entsprachen Die Behandlung mit S l -Nuklease zur Herstellung icht-uberlappender DNA-Enden erfolgte für 30 min bei 20 °C nach Herstellerangaben Diese DNA-Molekule wurden mit T4-Lιgase rehgiert und in E coli DH5α klomert 13. DNA-Sequenzierung von Acarbose-Biosynthese-Genen aus Actinoplanes sp.The pAS5 / 6 subclones were produced using the “double-stranded nested deletion kit” (Pharmacia, Freiburg, Germany). 10 μg pAS5 / 6 DNA was prepared as described in Example 1 and hydrolyzed with 10 U each Xhol and Ss / I The subsequent incubation with exonuclease III was carried out according to the manufacturer's instructions for a total of 20 min. At intervals of 5 min, portions were removed from the reaction mixture which corresponded to a DNA amount of approx. 2.5 μg DNA. Treatment with S 1 nuclease to produce non-overlapping DNA -Ends took place for 30 min at 20 ° C according to the manufacturer's instructions. These DNA molecules were rehabilitated with T4-Lιgase and clomerized in E coli DH5α 13. DNA sequencing of acarbose biosynthesis genes from Actinoplanes sp.
Es wurden die unter Beispiel 8 bis 1 1 beschriebenen Plasmide sequenziert In die Se- quenzierungsreaktion wurden 6 - 8 μg Plasmid-DNA aus einer Praparation (s Beispiel 1 ) eingesetzt Die Sequenzierreaktion wurde mit dem Auto-Read-Sequenzing- Kit (Pharmacia, Freiburg, Deutschland) durchgeführt Hierbei kam das Standardprotokoll zur Sequenzierung von dsDNA zur Anwendung Um die Auswertung der Nukleotidsequenz mit dem A L F (automatisierter Laser Fluoreszens-(DNA)-Se- quenzierer) zu ermöglichen, wurden als Startermolekule für die Sequenzreaktion dieThe plasmids described in Examples 8 to 11 were sequenced. 6-8 μg of plasmid DNA from a preparation (see Example 1) were used in the sequencing reaction. The sequencing reaction was carried out using the auto-read sequencing kit (Pharmacia, Freiburg , Germany) The standard protocol for the sequencing of dsDNA was used. In order to enable the nucleotide sequence to be evaluated with the ALF (automated laser fluorescence (DNA) sequencer), the starter molecules for the sequence reaction were the
Fluorescein-markierten universellen und reversen Sequenzier-Pπmer verwendet (s Tab 2) Zur Herstellung des Gels wurden 8 ml Hydro Link Long Ranger (Serva Heidelberg), 33,6 g Harnstoff, 8 ml lOx TBE-Puffer, ad 80 ml mit H20 vermischt, steπlfiltπert und 1 Minute entgast Die Polymerisation wurde durch Zugabe von 350 μl 10% (w/v) Ammoniump er sulfat und 40 μl N,N,N',N', Tetramethylethylendiamin eingeleitet Die Losung wurde in eine Gelform (50x50x0,05 cm) gegossen Die Elektrophorese erfolgte bei 38 W und einer konstanten Temperatur von 45°C Als Laufpuffer diente lx TBE-Puffer Die Verarbeitung der gemessenen Fluoreszenz zu einer DNA-Sequenz erfolgte über einen angeschlossenen Computer (Compaq 386/20e), der auch zur Steuerung der Elektrophoreseeinheit diente (Programm A. L F Manager 2 5Fluorescein-labeled universal and reverse sequencing polymer was used (see Table 2). 8 ml of Hydro Link Long Ranger (Serva Heidelberg), 33.6 g of urea, 8 ml of 10X TBE buffer, ad 80 ml with H 2 were used to prepare the gel 0 mixed, filtered and degassed for 1 minute The polymerization was initiated by adding 350 μl 10% (w / v) ammonium persulfate and 40 μl N, N, N ', N', tetramethylethylenediamine. The solution was dissolved in a gel form (50x50x0, 05 cm) cast The electrophoresis was carried out at 38 W and a constant temperature of 45 ° C. The Tx buffer was used as the running buffer. The measured fluorescence was processed into a DNA sequence using a connected computer (Compaq 386 / 20e), which was also used for Control of the electrophoresis unit was used (program A. LF Manager 2 5
Pharmacia, Freiburg)Pharmacia, Freiburg)
14. Transformation von S. lividans14. Transformation of S. lividans
Die Protoplastierung und Transformation von S lividans TK23 und 1326 erfolgte nach der Methode von Babcock und Kendπck ( 1988), wobei die Zellen in TSB-PEG 8000 angezogen wurden 15. Überexpression von AcbCThe protoplasting and transformation of S lividans TK23 and 1326 was carried out according to the method of Babcock and Kendπck (1988), the cells being grown in TSB-PEG 8000 15. Overexpression of AcbC
15.1 Überexpression von AcbC in E. coli15.1 Overexpression of AcbC in E. coli
Die DNA-Sequenz des acbC-Gens zeigt zwei mögliche Translation-Startpunkte fürThe DNA sequence of the acbC gene shows two possible translation starting points for
AcbC Obwohl Startpunkt 1 aufgrund einer signifikanteren Ribosomenbindestelle den wahrscheinlichen Start von AcbC darstellt, wurden beide möglichen AcbC-Proteine uberexpπmiert Dazu wurden die Plasmide pETl la und pET16b (Novagen, Heidelberg) für eine Expression in E coli genutzt Um einen optimalen Translaüonsstart für die Expression zu gewährleisten, sollte das ATG Start-Codon, mit passendem Abstand zu einer E coli ahnlichen RBS, der pET- Vektoren genutzt werden Dazu ist es notwendig, eine ΛWel-Erkennungssequenz am Start-Codon von acbC zu konstruieren Es wurden die O gonucleotide AS7 (Sequenzposition 6617) und AS8 (Sequenzposition 6638) für die Synthese einer ΛWel-Erkennungsstelle an den beiden möglichen Start-Codons eingesetzt Das O gonucleotid AS9 bindet 66 bp stromabwärts von einer BamHl Erkennungssequenz an der Sequenzposition 6877 an die DNA Mit der PCR-Methode (s Beispiel 8) wurden zwei DNA-Fragmente amplifiziert, die für eine Expression der beiden möglichen AcbC Proteine genutzt wurden Die Anlagerung der Pπmer erfolgte für 40 Sek bei 45 °C, und die Pπmerverlan- gerung fand in 30 Sek statt Die beiden amp fizierten DNA-Fragmente wurden mit den Restπktionsendonucleasen Ndel und BamHl hydrolysiert und in die Vektoren pETl la und pET16b entsprechend ligiert Aus dem rekombinanten Plasmid pAS2 [EP A 0 730 029 / DE 19507214] wurde das 2,2 kb ÄαwHI-Fragment isoliert und über die _5_7mHI-Erkennungsstelle mit den Monierten PCR-Fragmenten fusioniert Nachdem die Orientierung des 2,2 kb PαmHI-Fragments überprüft wurde, lag das vollständige acbC Gen in den Expressionsvektoren vor Die Expressionsvektoren bekamen die Bezeichnung pAS8/l - pAS8/4 (Fig 4) Zusätzlich befindet sich der vollständige acbB Leserahmen (in entgegengesetzter Orientierung) und der Anfang des acbA Gens auf der Monierten DNA in den Expressionsvektoren In IPTG-indu- zierten E coli BL21pLys-Kulturen konnte jeweils ein zusätzlich expπmiertes Protein identifiziert werden Die Große der uberexpπmierten AcbC Proteine ist in Tab 4 dargestellt edoch wurden alle Proteine in Form unlöslicher "inclusion bodies" gebildet Tab 4 Die Struktur der AcbC-Expressionsvektoren für die Expression in E coliAcbC Although starting point 1 represents the probable start of AcbC due to a more significant ribosome binding site, both possible AcbC proteins were overexposed. For this purpose, the plasmids pETl la and pET16b (Novagen, Heidelberg) were used for expression in E coli in order to ensure an optimal start of the expression If the ATG start codon, with a suitable distance to an E coli-like RBS, the pET vectors should be used, it is necessary to construct a ΛWel recognition sequence at the start codon of acbC. The O gonucleotides AS7 (sequence position 6617) and AS8 (sequence position 6638) are used for the synthesis of a elWel recognition site at the two possible start codons. The gonucleotide AS9 binds 66 bp downstream of a BamHl recognition sequence at sequence position 6877 to the DNA using the PCR method (see example 8) two DNA fragments were amplified, which are necessary for expression of the two possible AcbC Prot one was used. The addition of the polymers took place at 40 ° C. for 40 seconds, and the extension of the polymer took place in 30 seconds. The two amplified DNA fragments were hydrolyzed with the residual endonucleases Ndel and BamHl and correspondingly into the vectors pET11a and pET16b ligated The 2.2 kb ÄαwHI fragment was isolated from the recombinant plasmid pAS2 [EP A 0 730 029 / DE 19507214] and fused to the monied PCR fragments via the _5_7mHI recognition site after the orientation of the 2.2 kb PαmHI fragment was checked, the complete acbC gene was present in the expression vectors. The expression vectors were given the name pAS8 / l - pAS8 / 4 (FIG. 4). In addition, the complete acbB reading frame (in opposite orientation) and the beginning of the acbA gene are on the cloned DNA in the expression vectors In IPTG-induced E coli BL21pLys cultures, an additionally expressed protein was identified The overexpanded AcbC proteins are shown in Table 4, but all proteins were formed in the form of insoluble "inclusion bodies" Tab. 4 The structure of the AcbC expression vectors for expression in E coli
15.2 Überexpression von AcbC in S. lividans 132615.2 Overexpression of AcbC in S. lividans 1326
Das AcbC Protein wurde in S lividans 1326 mittels des Plasmidvektors pIJ6021 [Takano, e , et al (1995)] expπmiert Es wurde mittels der PCR-Methode [Mulhs u Falloona, (1987)] ein Fragment aus chromosomaler DNA amplifiziert, das ausschließlich den kodierenden Bereich des acbC-Gens umfaßt Für die PCR wurden die OHgonucleotide AS-Cl und AS-C2 eingesetzt, wobei mit Hilfe des Pπmers AS-C l (Sequenzposition 6089) eine Ndel Erkennungssequenz am Start-Codon 2 des acbC- Gens konstruiert wurde Das O gonucleotid AS-C2 bindet an Sequenzposition 7882 und wurde genutzt, um eine EcoRI-Erkennungssequenz zu konstruieren Die Anlagerung der Pπmer erfolgte in 20 Sek bei 50 °C, und die Pπmer wurden in 40 Sek ver- langert Das so erhaltene acbC DNA-Fragment wurde zuerst in den Vektor pUC18 "blunt-end" klomert und die Richtigkeit der DNA-Sequenz nach der PCR überprüft Dieses rekombinante Plasmid mit dem klonierten acbC-Gen bekam die Bezeichnung pAS8/5 1 Das Plasmid pAS8/5 1 wurde mit den Restπktionsendonucleasen Ndel und EcoRl hydrolysiert, die DNA auf einem Agarosegel getrennt und aus der Matrix elu- lert Das so präparierte «cAC-Fragment wurde in den Vektor pIJ6021 ligiert Das rekombinante Expressionsplasmid bekam die Bezeichnung pAS8/7 2 (Fig 5) Protoplasten von S lividans 1326 wurden mit dem Plasmid pAS8/7 2 transformiert Mit dem so erhaltenen Klon konnte das AcbC Protein in Thiostrepton induzierten Kulturen in loslicher Form uberexpπmiert werden (Fig 6) 16. Überexpression von AcbE in S. lividans TK23The AcbC protein was expressed in S lividans 1326 by means of the plasmid vector pIJ6021 [Takano, e, et al (1995)]. A fragment from chromosomal DNA was amplified using the PCR method [Mulhs u Falloona, (1987)], which only the encoding region of the acbC gene For the PCR, the OHgonucleotide AS-Cl and AS-C2 were used, a Ndel recognition sequence at the start codon 2 of the acbC gene being constructed with the aid of the polymer AS-C1 (sequence position 6089) Ogonucleotide AS-C2 binds at sequence position 7882 and was used to construct an EcoRI recognition sequence. The addition of the polymer took place in 20 seconds at 50 ° C., and the polymer was extended in 40 seconds. The acbC DNA fragment thus obtained was first blom-ended in the vector pUC18 and the correctness of the DNA sequence was checked after the PCR. This recombinant plasmid with the cloned acbC gene was called pAS8 / 5 1. The plasmid pAS8 / 5 1 was labeled with the residual functions endonucleases Ndel and EcoRI hydrolyzed, the DNA separated on an agarose gel and eluted from the matrix. The “cAC fragment thus prepared was ligated into the vector pIJ6021. The recombinant expression plasmid was given the name pAS8 / 7 2 (FIG. 5) protoplasts from S lividans 1326 were transformed with the plasmid pAS8 / 7 2. With the clone obtained in this way, the AcbC protein in thiostrepton-induced cultures could be overexposed in soluble form (FIG. 6). 16. Overexpression of AcbE in S. lividans TK23
Das acbE-Gen konnte aus dem Plasmid pAS5/6.9-6 mittels einer Hydrolyse mit den Restriktionsendonucleasen EcoRI und Hmdlll gewonnen werden. Nach Trennung der DNA auf einem Agarose-Gel und Elution des 3,8 kb EcoRI/HwdIII Fragments aus der Matrix wurde dieses acbE Fragment entsprechend in den Vektor pUWL219 ligiert [J. Wehmeier, U.F.. (1995)]. Für eine spätere Expression von AcbE in S. lividans sollte in diesen Vektoren eine mögliche Promotor-Sequenz auf dem 200 bp großen "upstream"-Bereich genutzt werden (s. Tab. 5). Das rekombinante Plasmid bekam die Bezeichnung pASl l (Fig. 7).The acbE gene could be obtained from the plasmid pAS5 / 6.9-6 by means of hydrolysis with the restriction endonucleases EcoRI and Hmdlll. After separation of the DNA on an agarose gel and elution of the 3.8 kb EcoRI / HwdIII fragment from the matrix, this acbE fragment was ligated accordingly into the vector pUWL219 [J. Wehmeier, U.F .. (1995)]. For a later expression of AcbE in S. lividans, a possible promoter sequence on the 200 bp "upstream" region should be used in these vectors (see Table 5). The recombinant plasmid was named pASl 1 (FIG. 7).
Tab. 5: Der intercistronische Bereich zwischen den Genen acbE und acbD.Tab. 5: The intercistronic area between the genes acbE and acbD.
Inverted repeat (IR) und direct repeat (DR) Sequenzen, die an einer Regulation beteiligt sein könnten, sind unterstrichen.Inverted repeat (IR) and direct repeat (DR) sequences that could be involved in regulation are underlined.
<- CGT GGA CCC TCT CTC GCG ATC GCT GGG ACG CTA GCC CGG CGG GAG ACG TGC CCG CAA GAΛ AcbE GCA CCT GGG AGA GAG CGC TAG CGACCC TGC GAT CGG GCC GCC CTC TGC ACG GGC GTT CTT<- CGT GGA CCC TCT CTC GCG ATC GCT GGG ACG CTA GCC CGG CGG GAG ACG TGC CCG CAA GAΛ AcbE GCA CCT GGG AGA GAG CGC TAG CGACCC TGC GAT CGG GCC GCC CTC TGC ACG GGC GTT CTT
IR 1 CTT GCT GTTITAGCAAGAAGTTTC AGAACC GGG ACG GCA CGC TGT AGC CCAGAT CΛT AGAIR 1 CTT GCT GTTITAGCAAGAAGTTTC AGAACC GGG ACG GCA CGC TGT AGC CCAGAT CΛT AGA
GAA CGACAAAAT GCT TCT TCA AAG TCT TGG CCC TGC CGT GCG ACA TCG GGT CTA GTΛ TCTGAA CGACAAAAT GCT TCT TCA AAG TCT TGG CCC TGC CGT GCG ACA TCG GGT CTA GTΛ TCT
Hind III IR 2Hind III IR 2
TAC TTAAAG CTC TGC GCA AGC TTA GGG TTG AAG TGG CGG TGA TGC ATC CAT CAC TGT ATG ATG AAT TTC GAG ACG CGT TCG AAT CCC AAC TTC ACC GCC ACT ACG TAG GTA GTG ACA TACTAC TTAAAG CTC TGC GCA AGC TTA GGG TTG AAG TGG CGG TGA TGC ATC CAT CAC TGT ATG ATG AAT TTC GAG ACG CGT TCG AAT CCC AAC TTC ACC GCC ACT ACG TAG GTA GTG ACA TAC
IR 3 DR1IR 3 DR1
CGC ATC TGA ATG ACG TCT TCT GCA AGTTCT TGC AGC GGT CTC CGG GCC CTG CCC TTC CTC GCG TAG ACT TAC TGC AGA AGACGT TCAAGA ACG TCG CCA GAG GCC CGG GAG GGG AAG GAGCGC ATC TGA ATG ACG TCT TCT GCA AGTTCT TGC AGC GGT CTC CGG GCC CTG CCC TTC CTC GCG TAG ACT TAC TGC AGA AGACGT TCAAGA ACG TCG CCA GAG GCC CGG GAG GGG AAG GAG
GTC ATC CCT TCACAAGGAGAA GCT C AcbD CAG TAG GGA AGT GTT CCT CTT CGAG →GTC ATC CCT TCACAAGGAGAA GCT C AcbD CAG TAG GGA AGT GTT CCT CTT CGAG →
Protoplasten von S. lividans TK23 wurden mit dem Plasmid pASl 1 transformiert. In den Überständen aus MD 50-Kulturen war sowohl in den S. lividans TK23/pASl 1 als auch in den Actinoplanes sp. Ansätzen ein extrazelluläres Protein mit der Größe vonProtoplasts from S. lividans TK23 were transformed with the plasmid pASl 1. In the supernatants from MD 50 cultures, both in the S. lividans TK23 / pASl 1 and in the Actinoplanes sp. Approaches an extracellular protein the size of
110 kDa zu erkennen (Fig. 8). Diese Größe entspricht dem Molekulargewicht des von acbE abgeleiteten Proteins. Die Identität dieser Proteine wurde durch entsprechende Enzymtests (s Beispiel 19 2) und die Sequenzierung der N-termmalen Aminosäuren (s Beispiel 18) nachgewiesen In dem Überstand aus der Kontroll-Kultur S. lividans TK23/pUWL219 in MD 50-Medium konnte kein entsprechendes Protein nachgewiesen werden Daher ist es wahrscheinlich, daß die mögliche Promotorsequenz (Tab 5) "upstream" vom acbE-Gen für die Expression von AcbE in den S. lividans/pAS 1 1To recognize 110 kDa (Fig. 8). This size corresponds to the molecular weight of the protein derived from acbE. The identity of these proteins was confirmed by Enzyme tests (see Example 19 2) and the sequencing of the N-terminal amino acids (see Example 18) demonstrated No corresponding protein could be detected in the supernatant from the control culture S. lividans TK23 / pUWL219 in MD 50 medium. It is therefore likely that the possible promoter sequence (Tab 5) "upstream" from the acbE gene for the expression of AcbE in the S. lividans / pAS 1 1
Kulturen in MD 50-Medium verantwortlich istCultures in MD 50 medium is responsible
17. Gelelektrophoretische Darstellung von Proteinen17. Gel electrophoretic representation of proteins
Die denaturierende Trennung von Proteinen in SDS-Polyacrylamidgelen und derenThe denaturing separation of proteins in SDS polyacrylamide gels and their
Färbung mit dem Coomassie-Farbstoff erfolgte nach der Methode von Lugtenberg (1975) Je nach Ansatz wurden 8 %ige oder 11 %ige Gele verwendet Gelzusammensetzung ( 11 %iges Gel)Staining with the Coomassie dye was carried out according to the Lugtenberg method (1975). Depending on the approach, 8% or 11% gels were used. Gel composition (11% gel)
Trenngel SammelgelSeparating gel stacking gel
Losung A* 8,0 mlSolution A * 8.0 ml
Losung B* 0,64 mlSolution B * 0.64 ml
APS (2 mg/ml) 0,8 ml 0, 15 mlAPS (2 mg / ml) 0.8 ml 0.15 ml
10 % (w/w) SDS 0,64 ml 0,064 ml10% (w / w) SDS 0.64 ml 0.064 ml
0,75 M Tris/HCl pH 8,8 16 ml0.75 M Tris / HCl pH 8.8 16 ml
0,25 M Tris/HCl pH 6,8 3,2 ml0.25 M Tris / HCl pH 6.8 3.2 ml
A dest 6,56 mlA least 6.56 ml
TEMED 25 μl 10 μlTEMED 25 μl 10 μl
siehe Puffer und Losungensee buffers and solutions
Die Elektrophorese erfolgte entweder mit der SERVA Blue- Vertical 100/C Apparatur (Gelform, 80 x 100 x 0,75 mm) oder mit der Renner-Twin-Vertical- Apparatur (Gelform, 180 x 170 x 1 mm)Electrophoresis was carried out either with the SERVA Blue-Vertical 100 / C apparatus (gel form, 80 x 100 x 0.75 mm) or with the Renner Twin Vertical apparatus (gel form, 180 x 170 x 1 mm)
Die Bestimmung der Proteinkonzentration der zu analysierenden Proben erfolgte mit dem Protein- Assay (BioRad, München), wobei mit BSA eine Eichgerade erstellt wurde Als Standard für die Molekulargewichte der getrennten Proteine dienten der "VILL Dalton-Marker" (14,2 kDa - 66 kDa) und der "High Molecular Weight Standard" (29 kDA - 210 kDa) von Sigma (Deisenhofen)The protein concentration of the samples to be analyzed was determined using the protein assay (BioRad, Munich), a calibration line being established using BSA The "VILL Dalton marker" (14.2 kDa - 66 kDa) and the "High Molecular Weight Standard" (29 kDA - 210 kDa) from Sigma (Deisenhofen) served as the standard for the molecular weights of the separated proteins.
18. Bestimmung der N-terminalen Aminosäuresequenz18. Determination of the N-terminal amino acid sequence
Es wurde die N-terminale Aminosauresequenz des AcbE Proteins vergleichend aus Actinoplanes sp und dem Klon S. lividans TK23/pASl 1 bestimmt Dazu wurden 50 ml Kulturen in MD 50-Medium für drei Tage bebrütet Die Zellen wurden durch Zentrifügieren entfernt und die Kulturuberstande für 12 h gegen Puffer (5 mMThe N-terminal amino acid sequence of the AcbE protein was compared by comparing Actinoplanes sp and the clone S. lividans TK23 / pASl 1. 50 ml cultures were incubated in MD 50 medium for three days. The cells were removed by centrifugation and the culture supernatants for 12 h against buffer (5 mM
Tris/HCl pH 7 5, 1 mM CaCl2) bei 4 °C dialysiert Anschließend wurden die Überstände in 48 h gefriergetrocknet und in 1,5 ml Probenpuffer aufgenommen Die so präparierten Kulturuberstande wurden in einer SDS-PAGE mit der Renner- Twin- Vertical- Apparatur (Gelform, 180 x 170 x 3 mm) getrennt Um eine möglichst gute Trennung des AcbE Proteins von anderen extracellularen Proteinen zu gewahrleisten, wurde ein Gradientengel (5 % — » 10 %) eingesetzt. Der Transfer der Proteine aus dem SDS-Polyacrylamidgel auf eine Polyvinylfluorid (PVDF) Membran (Amersham Buchler, Braunschweig) erfolgte in einem halbtrockenen elektrophoretischen Verfahren mit einer Fast-Blott B33-Apparatur (Biometra, Gottingen) nach Vorschrift der Hersteller Der Transfer erfolgte für 45 Min mit 250 mA Als Transferpuffer dienteTris / HCl pH 7.5, 1 mM CaCl 2 ) dialyzed at 4 ° C. The supernatants were then freeze-dried in 48 h and taken up in 1.5 ml of sample buffer. The culture supernatants prepared in this way were analyzed in an SDS-PAGE using the Renner-Twin-Vertical - Equipment (gel form, 180 x 170 x 3 mm) separated In order to ensure the best possible separation of the AcbE protein from other extracellular proteins, a gradient gel (5% - »10%) was used. The transfer of the proteins from the SDS polyacrylamide gel to a polyvinyl fluoride (PVDF) membrane (Amersham Buchler, Braunschweig) was carried out in a semi-dry electrophoretic process using a Fast-Blott B33 apparatus (Biometra, Gottingen) according to the manufacturer's instructions.The transfer took place for 45 Min with 250 mA served as transfer buffer
1 2 verdünnter Laufpuffer (s Puffer und Losungen) Die Membranen wurden 30 Min gefärbt und mit Entfarbelosung (s Puffer u Losungen) entfärbt Zur Bestimmung der N-terminalen Aminosauresequenz wurde das Blottstuck vor der Sequenzierung zweimal mit je 100 μl 50 %igem Methanol gewaschen, um überschüssige Salze zu entfernen Nach dem Trocknen wurde die Sequenzanalyse mittels Blottcartridge sowie eines mit Polybren vorbehandelten Filters durchgeführt Für die Sequenzanalyse wurde der Fastblottzyklus verwendet Das Ergebnis ist in Tab 6 dargestellt Tab 6 Die Ergebnisse der Sequenzierung der N-terminalen Aminosauresequenz des AcbE Proteins aus Actinoplanes sp und dem Klon S. //v/- -ώtts TK23/pASl l1 2 diluted running buffer (s buffer and solutions) The membranes were stained for 30 min and decolorized with decolorization (s buffer and solutions). To determine the N-terminal amino acid sequence, the blott was washed twice with 100 μl 50% methanol before sequencing, to remove excess salts After drying, the sequence analysis was carried out using a blott cartridge and a filter pretreated with polybrene. The fast blott cycle was used for the sequence analysis. The result is shown in Table 6 Tab. 6 The results of the sequencing of the N-terminal amino acid sequence of the AcbE protein from Actinoplanes sp and the clone S. // v / - -ώtts TK23 / pASl l
19. Bestimmung von Enzym-Aktivitäten19. Determination of enzyme activities
19.1. Bestimmung der Valiolon-Synthase Aktivität19.1. Determination of valiolone synthase activity
Für die Uberexpression von AcbC wurden 10 ml YEME-Medium (50 μg/ml Km) mit einer Sporensuspension von S. lividans 1326/pAS8 7 2 beimpft Nach ein- bis zweitägiger Kultivierung befanden sich die Kulturen in der frühen logarithmischen Wachstumsphase Zu diesem Zeitpunkt wurden die Kulturen mit 7,5 μg/ml Thiostrepton induziert Die Kulturen wurden 20 h nach der Induktion geerntet Die sedi- mentierten Zellen wurden in 1,5 ml kaltem Aufschlußpuffer (s Puffer und Losungen) aufgenommen und schonend mit Ultraschall aufgeschlossen Durch eine 30 minutige Zentrifügation bei 15 000 g und 4 °C wurden die Zelltrummer entfernt Durch eine Dialyse (12 h) gegen 2,5 Liter Aufschlußpuffer bei 4 °C wurde der für den Enzymtest notige AcbC-Extrakt hergestellt Dieser Extrakt konnte für zwei Monate bei -20 °C gelagert werden, ohne merklich an Aktivität zu verlieren Der Proteingehalt des Extraktes wurde mit dem Protein- Assay (BioRad, München) bestimmt und 15 μg in einer SDS-PAGE analysiert (Fig 6) Der Enzymtest wurde in einem 20 mM P-Puffer (pH 7,5) mit 40 μM CoCl2 bei RT für 2 h durchgeführt Es wurden 20 μg Gesamt- Protein aus dem AcbC-Extrakt und 8 mM Sedoheptulose-7-Phosphat in dem Enzym- test eingesetzt Zusatzlich enthielt der Reaktionsansatz 2 mM NaF, um unspezifischeFor the overexpression of AcbC, 10 ml of YEME medium (50 μg / ml Km) was inoculated with a spore suspension of S. lividans 1326 / pAS8 7 2. After one to two days of cultivation, the cultures were in the early logarithmic growth phase the cultures were induced with 7.5 μg / ml thiostrepton. The cultures were harvested 20 h after the induction. The sedimented cells were taken up in 1.5 ml of cold digestion buffer (s buffer and solutions) and gently digested with ultrasound by means of a 30-minute centrifugation the cell dummies were removed at 15,000 g and 4 ° C. The AcbC extract required for the enzyme test was prepared by dialysis (12 h) against 2.5 liters of digestion buffer at 4 ° C. This extract could be kept at -20 ° C. for two months be stored without noticeably losing activity. The protein content of the extract was determined with the protein assay (BioRad, Munich) and 15 μg analyzed in an SDS-PAGE (FIG. 6) The enzyme test was carried out in a 20 mM P buffer (pH 7.5) with 40 μM CoCl 2 at RT for 2 h. 20 μg total protein from the AcbC extract and 8 mM sedoheptulose-7-phosphate in the enzyme - test used In addition, the reaction mixture contained 2 mM NaF, to unspecific
Phosphatasen in dem Extrakt zu hemmen Das Reaktionsvolumen betrug 100 μl Die Auswertung erfolgte über eine DC auf Kieselgelfolien mit Butanol/Ethanol H2O (9 7 4) als Laufmittel, wobei 25 μl aus einem Reaktionsansatz analysiert wurden Durch Besprühen der DC-Folien mit Cer-Reagenz (s Puffer und Losungen) und an- schließender 15 minütiger Inkubation bei 90 °C im Trockenschrank konnten die organischen Verbindungen sichtbar gemacht werden Als Referenzsubstanz diente ein Gemisch aus Valienon und Valiolon (Prof. H G Floss, Seattle)Inhibit phosphatases in the extract. The reaction volume was 100 μl. The evaluation was carried out by TLC on silica gel foils with butanol / ethanol H 2 O (9 7 4) as the eluent, 25 μl being analyzed from a reaction batch. By spraying the TLC foils with cerium -Reagent (s buffer and solutions) and After a 15-minute incubation at 90 ° C in the drying cabinet, the organic compounds were made visible. A mixture of Valienon and Valiolon (Prof. HG Floss, Seattle) served as reference substance.
Durch das in S. lividans exprimierte AcbC Protein konnte Sedoheptulose-7-Phosphat spezifisch umgesetzt werden (Fig. 9) Allerdings zeigte das Reaktionsprodukt ein geringfügig anderes Laufverhalten in der DC als der Valienon-Naliolon-Standard Eine Verminderung der Wanderungsstrecke des Reaktionsproduktes auf der Kieselgel-Folie durch den Reaktionspuffer konnte ausgeschlossen werden (Fig 9, Spur 5)Sedoheptulose-7-phosphate could be implemented specifically by the AcbC protein expressed in S. lividans (FIG. 9). However, the reaction product showed a slightly different running behavior in the DC than the Valienon-Naliolon standard. A reduction in the migration distance of the reaction product on the silica gel Foil could be excluded by the reaction buffer (Fig. 9, lane 5)
19.2. Bestimmung der α-Amylase Aktivität19.2. Determination of the α-amylase activity
Die Kulturen von S lividans TK23/pAS l 1 wurden in TSB-Medium und MD 50-Me- dium in Gegenwart von 25 μg/ml Thiostrepton angezuchtet. Nach 3-4 tagiger Inku- bation wurden die Kulturen geerntet Durch Zentrifügation (3500 g) bei 4 °C für 10The cultures of S lividans TK23 / pAS l 1 were grown in TSB medium and MD 50 medium in the presence of 25 μg / ml thiostrepton. After 3-4 days of incubation, the cultures were harvested by centrifugation (3500 g) at 4 ° C for 10
Min wurden die Zellen entfernt Die Überstände wurden für 12 h bei 4 °C gegen Puffer (25 mM Tris HCl pH 7,5, 1 mM CaCl ) dialysiert Aus den so präparierten Überstanden wurden 500 μl im Vakuum getrocknet, in Probenpuffer (s Puffer und Losungen) aufgenommen, die Proteine in den Überstanden wurden auf einer SDS- PAGE (Fig 8) getrennt. Als Referenz dienten Überstände aus Actinoplanes sp Kulturen, die unter identischen Bedingungen gewachsen waren Die α-Amylase Aktivität wurde durch Messung der Trubungsabnahme einer 1 % Starkesuspension bestimmt Für eine Messung wurden 100 μl dialysierter Kulturuberstand mit 900 μl Starkesuspension gemischt und die Abnahme der Extinktion bei 300 nm zeitabhängig aufge- zeichnet [Virolle, M.J , et al. (1990)] Zum Vergleich wurden entsprechende Untersuchungen mit einer α-Amylase aus Bacillus sp (Sigma, Deisenhofen) durchgeführt Die Ergebnisse sind in (Fig. 10) dargestellt. Die AcbE Aktivität in Actinoplanes sp MD 50-Kulturen und in den S. lividans TK23/pASl l MD 50-Kulturen ließen sich durch 1 mM Acarbose im Test nicht hemmen Dahingegen ließ sich die Hintergrund- Aktivität in S. lividans TK23/pUWL219 MD50-Kulturen durch 0, 1 mM Acarbose imThe cells were removed for min. The supernatants were dialyzed against buffer (25 mM Tris HCl pH 7.5, 1 mM CaCl) for 12 h at 4 ° C. From the supernatants prepared in this way, 500 μl were dried in vacuo, in sample buffer (s buffer and Solutions) were added, the proteins in the supernatants were separated on an SDS-PAGE (FIG. 8). Supernatants from Actinoplanes sp cultures which had grown under identical conditions were used as a reference. The α-amylase activity was determined by measuring the decrease in turbidity of a 1% starch suspension. For a measurement, 100 μl dialyzed culture supernatant was mixed with 900 μl starch suspension and the decrease in absorbance at 300 nm recorded as a function of time [Virolle, MJ, et al. (1990)] For comparison, corresponding tests were carried out with an α-amylase from Bacillus sp (Sigma, Deisenhofen). The results are shown in (FIG. 10). AcbE activity in Actinoplanes sp MD 50 cultures and in the S. lividans TK23 / pASl l MD 50 cultures could not be inhibited by 1 mM acarbose in the test. In contrast, the background activity in S. lividans TK23 / pUWL219 MD50- Cultures by 0.1 mM acarbose in
Test hemmen Die Bacillus sp α-Amylase wurde ebenfalls durch 0, 1 mM Acarbose inhibiert (Fig 10) Puffer und Lösungen:Inhibit test The Bacillus sp α-amylase was also inhibited by 0.1 mM acarbose (FIG. 10) Buffers and solutions:
Medien für die BakterienanzuchtMedia for growing bacteria
LB-Medium:LB medium:
Trypton 10 gTrypton 10 g
NaCI 10 gNaCI 10 g
Hefeextrakt 5 gYeast extract 5 g
H2O ad 1000 ml Es wurde mit 4 M NaOH ein pH-Wert von 7,5 eingestelltH 2 O ad 1000 ml A pH of 7.5 was set with 4 M NaOH
MD 50-MediumMD 50 medium
Lösung ISolution I
Stärkehydrolysat MD 50 70 g Starch hydrolyzate MD 50 70 g
Hefeextrakt 2 g ad 400 ml mit H2OYeast extract 2 g ad 400 ml with H 2 O
Lösung IISolution II
K2HPO4 i gK 2 HPO 4 ig
KH2PO4 l gKH 2 PO 4 lg
Tri-Natriumcitrat 5 g ab 400 ml mit H2O pH-Einstellung auf 7.0 mit IM NaOHTri-sodium citrate 5 g from 400 ml with H 2 O pH adjustment to 7.0 with IM NaOH
Lösung IIISolution III
MgCl26H2O l gMgCl 2 6H 2 O lg
FeCl36H2O 0,25 gFeCl 3 6H 2 O 0.25 g
CaCl22H2O 2 g ad 200 ml mit H2OCaCl 2 2H 2 O 2 g ad 200 ml with H 2 O
Die Lösungen werden nach dem Mischen sterilfiltriertThe solutions are sterile filtered after mixing
TSB-Medium:TSB medium:
Tryptone-Soya Broth (Oxoid) 30 gTryptone-Soya Broth (Oxoid) 30 g
H2O ad 1000 ml TSB-PEG 8000 [s Babcock et al (1988)]H 2 O ad 1000 ml TSB-PEG 8000 [s Babcock et al (1988)]
Tryptone Soya Broth (Oxoid) 30 gΛTryptone Soya Broth (Oxoid) 30 gΛ
PEG 8000 50g/l nach dem AutoklavierenPEG 8000 50g / l after autoclaving
Glycin (20 %) 25 mlGlycine (20%) 25 ml
MgCl2 (2,5 M) 2 mlMgCl 2 (2.5 M) 2 ml
YEME [Hopwood, DA, , etal (1985)]YEME [Hopwood, DA,, et al (1985)]
Hefeextrakt 3g/lYeast extract 3g / l
Pepton 5g/lPeptone 5g / l
Malzextrakt 3g/lMalt extract 3g / l
Glukose 10g/lGlucose 10g / l
Saccharose 340 g/1 nach dem AutoklavierenSucrose 340 g / 1 after autoclaving
MgCl2 (2,5 M) 2 mlMgCl 2 (2.5 M) 2 ml
Standardpraparation von Plasmid-DNA [modifiziert nach Birnboimu Doly(1979)]Standard preparation of plasmid DNA [modified from Birnboimu Doly (1979)]
Mixl 50 mM GlukoseMixl 50 mM glucose
50 mM Tπs-HCl (pH 8,0)50 mM Tπs-HCl (pH 8.0)
10mMEDTA(pH8,0)10mMEDTA (pH8.0)
5 mg/ml Lysozym 5 mg / ml lysozyme
1 % (w/v) SDS (Natπumdodecylsulfat)1% (w / v) SDS (sodium dodecyl sulfate)
Mix III 3 M Ka umacetatMix III 3 M potassium acetate
1,8 MFormiat1.8 M formate
TE-Puffer (pH 8.0)TE buffer (pH 8.0)
Tπs-HCl 10 mMTπs-HCl 10 mM
Na2-EDTA 1 mMNa 2 EDTA 1mM
DNA-DNA-HvbπdisierungDNA-DNA-Hvbπdisierung
20x SSC20x SSC
3 M NaCl 0,3 M Na-Citrat3 M NaCl 0.3 M Na citrate
Prähybridisierungslösung: 6x SSC 0,01 M Natriumphosphatpuffer pH 6,8Prehybridization solution: 6x SSC 0.01 M sodium phosphate buffer pH 6.8
1 mM EDTA 0,5 % SDS 0,1 % Magermilchpulver1 mM EDTA 0.5% SDS 0.1% skimmed milk powder
Hybridisierungslosung:Hybridization solution:
In 15 ml Prähybridisierugslösung wird die acb-Sonde nach der Markierungsreaktion gegeben.After the labeling reaction, the acb probe is placed in 15 ml prehybridization solution.
6x Postwash6x postwash
6x SSC 0.5% SDS6x SSC 0.5% SDS
DNA- Sequenzierung:DNA sequencing:
TBE-Puffer (pH 8,0)TBE buffer (pH 8.0)
IM Tris-Base 0,83 M Borsäure 10 mM EDTAIM Tris base 0.83 M boric acid 10 mM EDTA
Denaturierende Polvacrylamid-Gelelektrophorese von Proteinen Probenpuffer 5 xDenaturing polvacrylamide gel electrophoresis of proteins 5 x sample buffer
Glycerin 25 mlGlycerin 25 ml
SDS 5 gSDS 5 g
BPB 2,5 mgBPB 2.5 mg
2-Mercaptoethanol 12,5 ml ad 50 ml 0,625 M Tris/HCl (pH 6,8)2-mercaptoethanol 12.5 ml ad 50 ml 0.625 M Tris / HCl (pH 6.8)
trodenputterturf putter
Tris/HCl (pH 8,3) 25 mMTris / HCl (pH 8.3) 25 mM
Glycin 190 mM SDS(w/v) 0,1% pH-Einstellung vor SDS -ZugabeGlycine 190 mM SDS (w / v) 0.1% pH adjustment before adding SDS
Lösung ASolution A
Acrylamid 44 gAcrylamide 44 g
N,N-Methylen-N, N-methylene
Bisacrylamid 0,8 g ad 100mlH2OBisacrylamide 0.8 g ad 100mlH 2 O
Lösung BSolution B
Acrylamid 30 gAcrylamide 30 g
N,N-Methylen-N, N-methylene
Bisacrylamid 0,8 g adl00mlH2OBisacrylamide 0.8 g adl00mlH 2 O
FärbelösungStaining solution
SERVA-Blau 0,15'SERVA blue 0.15 '
R-250 (w/v)R-250 (w / v)
Methanol (v/v) 50%Methanol (v / v) 50%
Essigsäure (v/v) 10%Acetic acid (v / v) 10%
EntfärbelösungDecolorization solution
Methanol (v/v) 25%Methanol (v / v) 25%
Essigsäure (v/v) 10%Acetic acid (v / v) 10%
Aufschlußpuffer AcbCAcbC digestion buffer
K2HPO4/KH2Pθ4(pH7,5) 20 mMK 2 HPO 4 / KH 2 PO 4 (pH 7.5) 20 mM
NAD 0,2 mMNAD 0.2 mM
DTT 0,5 mMDTT 0.5 mM
Phosphatpuffer α-Amylase-TestPhosphate buffer α-amylase test
K2HPθ4/KH2PO4 (pH 6,8) 50 mM KC1 50 mMK 2 HPθ 4 / KH 2 PO 4 (pH 6.8) 50 mM KC1 50 mM
Cer-ReagenzCerium reagent
Molybdatophosphorsäure 1,25 g Cer-4-sulfat 0,5 gMolybdatophosphoric acid 1.25 g cerium 4-sulfate 0.5 g
H2SO4 3 ml ad 50 ml mit H2O H 2 SO 4 3 ml ad 50 ml with H 2 O
Literatur:Literature:
Babcock, M , Kendπck, K E (1988)Babcock, M, Kendπck, K E (1988)
Cloning of DNA involved in sporulation of Streptomyces griseus J Bacteπol 170, 2802-2808Cloning of DNA involved in sporulation of Streptomyces griseus J Bacteπol 170, 2802-2808
Birnboim, H C , Doly, J (1979)Birnboim, H C, Doly, J (1979)
A rapid alka ne extraction procedure for screening recombinant plasmid DNAA rapid alkan ne extraction procedure for screening recombinant plasmid DNA
Nucleic Acids Res 7, 1513-1523 Drepper, A , Pape, H (1996)Nucleic Acids Res 7, 1513-1523 Drepper, A, Pape, H (1996)
Acarbose 7-phosphotransferase from Actinoplanes sp puπfication, proper- ties, and possible physiological fünction J Antibiot , 49, 664-669 Goeke, K , Drepper, A , Pape, H (1996) Formation of acarbose phosphate by a cell-free extract from the acarbose pro- ducer Actinoplanes sp J Antibiot , 49, 661-663 Hanahan, D (1983)Acarbose 7-phosphotransferase from Actinoplanes sp puπfication, proper- ties, and possible physiological function J Antibiot, 49, 664-669 Goeke, K, Drepper, A, Pape, H (1996) Formation of acarbose phosphate by a cell-free extract from the acarbose producer Actinoplanes sp J Antibiot, 49, 661-663 Hanahan, D (1983)
Studies on transformation of Escherichia coli with plasmids J Mol Biol 166, 557-580Studies on transformation of Escherichia coli with plasmids J Mol Biol 166, 557-580
Hershberger, C L , et a (1989)Hershberger, C L, et a (1989)
Genetics of Molecular Biology of Industπal Microorganisms Amer Soc Microbiol , S 35-39, S 58, S 61-67, S 147-155 Hopwood, D A , et al (1985) Genetic manipulation of Streptomyces,Genetics of Molecular Biology of Industrial Microorganisms Amer Soc Microbiol, S 35-39, S 58, S 61-67, S 147-155 Hopwood, D A, et al (1985) Genetic manipulation of Streptomyces,
A laboratory manual, The John Innes Foundation, Norwich, England Lugtenberg, B , et al (1975)A laboratory manual, The John Innes Foundation, Norwich, England Lugtenberg, B, et al (1975)
Electrophoretic resolution of the "major" outer membrane protein of Eschen- chia coli into four bands FEBS Lett 58, 254-258Electrophoretic resolution of the "major" outer membrane protein of Eschen- chia coli into four bands FEBS Lett 58, 254-258
Merson-Davies, L A , Cundliffe, E (1994)Merson-Davies, LA, Cundliffe, E (1994)
Analysis of five tylosin biosynthetic genes from the tyllBA region of the Streptomyces fradiae genome Mol. Microbiol., 13, 349-355. Mullis, K.B., Falloona, F.A. (1987)Analysis of five tylosin biosynthetic genes from the tyllBA region of the Streptomyces fradiae genome Mol. Microbiol., 13, 349-355. Mullis, KB, Falloona, FA (1987)
Specific synthesis of DNA in vitro via a polymerase catalyzed chain reaction.Specific synthesis of DNA in vitro via a polymerase catalyzed chain reaction.
Methods Enzymol., 155, 335-350. Sambrook, J., et al. (1989)Methods Enzymol., 155, 335-350. Sambrook, J., et al. (1989)
Molecular cloning; a laboratory manual, 2nd ed.Molecular cloning; a laboratory manual, 2nd ed.
Cold Spring Harbour Laboratory Press, N.Y., USA. Sanger F.; Nicklan S.; Coulson AR. (1977)Cold Spring Harbor Laboratory Press, N.Y., USA. Sanger F .; Nicklan S .; Coulson AR. (1977)
DNA sequencing with chain determinating inhibitors Proc. Natl. Acad. Sei. USA, 74, 5463-5467DNA sequencing with chain determinating inhibitors Proc. Natl. Acad. Be. USA, 74, 5463-5467
Southern E.M., (1975) Detection of specific sequences among DNA Fragments sepa- rated by gel electrophoresisSouthern E.M., (1975) Detection of specific sequences among DNA fragments separated by gel electrophoresis
J.Mol.Biol., 98. 503-521. Takano, E., et al. (1995) Construction of thiostrepton-inducible, high-copy-number expression vectors for use in Streptomyces spp.J.Mol.Biol., 98. 503-521. Takano, E., et al. (1995) Construction of thiostrepton-inducible, high-copy-number expression vectors for use in Streptomyces spp.
Gene, 166, 133-137. Virolle, M.J., Morris, V.J., Bibb, M.J. (1990)Gene, 166, 133-137. Virolle, M.J., Morris, V.J., Bibb, M.J. (1990)
A simple and reliable turbidimetric and kinetic assay for alpha-amylase that is really applied to eulture supernatants and cell extractsA simple and reliable turbidimetric and kinetic assay for alpha-amylase that is really applied to eulture supernatants and cell extracts
J. Industrial Microbiol., 5, 295-302 Wehmeier, U.F. (1995)J. Industrial Microbiol., 5, 295-302 Wehmeier, U.F. (1995)
New multifunctional Escherichia coli-Streptomyces Shuttle vectors allowing blue-white screening on XGal plates. Gene, 165, 149-150. New multifunctional Escherichia coli-Streptomyces Shuttle vectors allowing blue-white screening on XGal plates. Gene, 165, 149-150.
LegendenLegends
Fig 1 Restriktionskarte des sequenzierten ca 18 kb Abschnittes aus demFig. 1 restriction map of the sequenced approximately 18 kb section from the
Genom von Actinoplanes sp SE50/110 (vgl Fig 2) Der schwarze Balken gibt den im ursprunglichen Patent beanspruchten Bereich an, der die Gene acbCBA (Reihenfolge wie angegeben von links nach rechts) z T überlapptGenome of Actinoplanes sp SE50 / 110 (see Fig. 2) The black bar indicates the area claimed in the original patent, which overlaps the genes acbCBA (order from left to right as indicated) z T
Fig 2 Genkarte des Acarbose Biosynthese-ClustersFig. 2 gene map of the acarbose biosynthesis cluster
Fig 3 DNA Sequenzen aus dem Acarbose Biosynthese-Cluster3 DNA sequences from the acarbose biosynthesis cluster
Fig 4 Die rekombinanten Plasmide, die - ausgehend von den Plasmiden pETl la und pETlόb - für die Expression von AcbC in E coli konstru- lert wurdenFIG. 4 The recombinant plasmids which - starting from the plasmids pETl la and pETlόb - were constructed for the expression of AcbC in E. coli
Fig 5 Das rekombinante Plasmid pAS8/7 2, welches - ausgehend von demFig. 5 The recombinant plasmid pAS8 / 7 2, which - starting from the
Plasmid pIJ6021 - für die Expression von AcbC in S lividans 1326 konstruiert wurdePlasmid pIJ6021 - was constructed for the expression of AcbC in S lividans 1326
Fig 6 Gelelektrophoretische Trennung von Zellysaten (s Beispiel 15 2) DieFig. 6 Gel electrophoretic separation of cell lysates (see Example 15 2)
Expression von AcbC (42 kDa) in der mit Thiostrepton induzierten S lividans 1326/pAS8/7 Kultur ist in der Spur 3 dargestelltExpression of AcbC (42 kDa) in the thiostrepton-induced S lividans 1326 / pAS8 / 7 culture is shown in lane 3
Fig 7 Das rekombinante Plasmid pASl l, welches - ausgehend von demFig. 7, the recombinant plasmid pASl l, which - starting from the
Plasmid pUWL219 - für die Expression von AcBE in S lividans rK 23 konstruiert wurdePlasmid pUWL219 - was constructed for the expression of AcBE in S lividans rK 23
Fig 8 Gelelektrophoretische Trennung von Proteinen aus Kulturuberstanden (s Beispiel 16) Die Expression von AcbE (1 10 kDa) ist in Spur 2,8 gel-electrophoretic separation of proteins from culture supernatants (see Example 16). The expression of AcbE (110 kDa) is in lane 2,
Spur 5 und Spur 6 zu erkennen Nachweis der AcbC-Enzymaktivitat durch Dunnschicht-Chromatogra- phie auf Kieselgelfolien (s Beispiel 19 1)Track 5 and track 6 can be seen Detection of the AcbC enzyme activity by thin layer chromatography on silica gel films (see Example 19 1)
1 ) Extrakt aus Actinoplanes sp1) Extract from Actinoplanes sp
2) Extrakt aus S. lividans 1326/pJ6021 3) Extrakt aus S. lividans 1326/pAS8/7 2 (Extrakt 2 Monate bei2) extract from S. lividans 1326 / pJ6021 3) extract from S. lividans 1326 / pAS8 / 7 2 (extract 2 months at
-20°C gelagert)-20 ° C stored)
4) Extrakt aus S. lividans 1326/pAS8/7 2 (gekocht)4) Extract from S. lividans 1326 / pAS8 / 7 2 (cooked)
5) Extrakt aus S. lividans 1326/pAS8/7 2 (Valienon statt Sedo- heptulose-7-Phosphat als Substrat) 6) Valiolon / Valienon Standard5) Extract from S. lividans 1326 / pAS8 / 7 2 (Valienon instead of sedoheptulose-7-phosphate as substrate) 6) Valiolon / Valienon standard
7) Sedoheptulose7) Sedoheptulose
8) Sedoheptulose-7-Phosphat8) Sedoheptulose-7-phosphate
9) Extrakt aus S. lividans 1326/pAS8/7 2 (Extrakt frisch präpariert)9) extract from S. lividans 1326 / pAS8 / 7 2 (extract freshly prepared)
Bestimmung der α-Amylase Aktivität in Kulturuberstanden Die Anzucht der Bakterien erfolgt in MD-50 Medium Mit gekochten Kulturuberstanden konnte keine Aktivität gemessen werden Die Testdauer betrug 6 min. Zum Vergleich wurde in den Ansätzen 9-1 1 je- weils 2,8 mU gekaufte α-Amylase eingesetzt Determination of the α-amylase activity in culture supernatants The bacteria are grown in MD-50 medium. No activity could be measured with cooked culture supernatants. The test duration was 6 min. For comparison, 2.8 mU of α-amylase purchased were used in batches 9-1

Claims

Patentansprüche claims
1. Acarbose Biosynthese Gen Cluster enthaltend DNA aus der Fig. 3.1. Acarbose biosynthesis gene cluster containing DNA from FIG. 3.
2. Acarbose Gene enthaltend DNA aus der Fig. 2. Acarbose genes containing DNA from FIG.
3. Third
EP98906953A 1997-02-28 1998-02-16 ACARBOSE (ACB) CLUSTER FROM $i(ACTINOPLANES) SP. SE 50/110 Withdrawn EP0968294A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
DE19708127 1997-02-28
DE19708127A DE19708127A1 (en) 1997-02-28 1997-02-28 Acarbose acb clusters: isolation of other genes of acarbose biosynthesis and acarbose metabolism from Actinoplanes sp. SE 50/110 and its use
PCT/EP1998/000862 WO1998038313A1 (en) 1997-02-28 1998-02-16 Acarbose (acb) cluster from actinoplanes sp. se 50/110

Publications (1)

Publication Number Publication Date
EP0968294A1 true EP0968294A1 (en) 2000-01-05

Family

ID=7821816

Family Applications (1)

Application Number Title Priority Date Filing Date
EP98906953A Withdrawn EP0968294A1 (en) 1997-02-28 1998-02-16 ACARBOSE (ACB) CLUSTER FROM $i(ACTINOPLANES) SP. SE 50/110

Country Status (15)

Country Link
EP (1) EP0968294A1 (en)
KR (1) KR20000075777A (en)
CN (1) CN1249001A (en)
AU (1) AU6296898A (en)
BG (1) BG103672A (en)
BR (1) BR9807640A (en)
CA (1) CA2282735A1 (en)
CZ (1) CZ9903054A3 (en)
DE (1) DE19708127A1 (en)
HU (1) HUP0000889A2 (en)
IL (1) IL131433A0 (en)
NO (1) NO994164L (en)
PL (1) PL335369A1 (en)
WO (1) WO1998038313A1 (en)
ZA (1) ZA981659B (en)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0796915A3 (en) * 1996-03-22 1999-04-14 Bayer Ag Process for the preparation and use of acarviosyl-transferase in the conversion of ascarbose-homologous in acarbose and in the preparation of acarbose-homologous
TW201217533A (en) * 2010-08-04 2012-05-01 Bayer Pharma AG Genomics of actinoplanes utahensis
CN106167814B (en) * 2016-08-31 2019-08-09 河北华荣制药有限公司 A method of improving acarbose fermentation unit
CN106566796B (en) * 2016-10-28 2020-11-10 上海交通大学 Genetic operation system of acarbose producing bacterium Actinoplanes spp
EP4045520A1 (en) * 2019-10-16 2022-08-24 Bayer Aktiengesellschaft Methods for the improved formation of acarbose
CN112592878B (en) * 2020-12-25 2022-08-26 上海交通大学 Method for enhancing expression of positive regulatory protein gene to improve acarbose fermentation level
CN113444670A (en) * 2021-07-28 2021-09-28 山东鲁抗医药股份有限公司 Screening method and culture method of high-activity acarbose producing strain

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE19507214A1 (en) * 1995-03-02 1996-10-31 Bayer Ag Acarbose biosynthesis genes from Actinoplanes sp., Process for their isolation and their use
DE19622783A1 (en) * 1996-06-07 1997-12-11 Hoechst Ag Isolation of the biosynthetic genes for pseudo-oligosaccharides from Streptomyces glaucescens GLA.O and their use

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9838313A1 *

Also Published As

Publication number Publication date
CN1249001A (en) 2000-03-29
CZ9903054A3 (en) 1999-11-17
PL335369A1 (en) 2000-04-25
NO994164D0 (en) 1999-08-27
CA2282735A1 (en) 1998-09-03
BR9807640A (en) 2000-03-21
NO994164L (en) 1999-08-27
IL131433A0 (en) 2001-01-28
BG103672A (en) 2000-05-31
WO1998038313A1 (en) 1998-09-03
HUP0000889A2 (en) 2000-07-28
ZA981659B (en) 1998-09-10
AU6296898A (en) 1998-09-18
DE19708127A1 (en) 1998-09-03
KR20000075777A (en) 2000-12-26

Similar Documents

Publication Publication Date Title
DE102004061846A1 (en) Multiple promoters
EP0915981B1 (en) Isolation of the biosynthesis genes for pseudo-oligosaccharides from streptomyces glaucescens gla.o and their use
Tamura et al. The E. coli divE mutation, which differentially inhibits synthesis of certain proteins, is in tRNASer1.
EP1700864A1 (en) Method for the production of S-adenosylmethionine by fermentation
DE4018441A1 (en) RECOMBINANT RESTRICTIONAL ENZYME SAU3AI
Spížek et al. Some aspects of overproduction of secondary metabolites
DE69531686T2 (en) GENE ENCODING GLYCOSYL TRANSFERASE AND ITS USE
EP1897939B1 (en) Microorganism strain for producing recombinant proteins
EP0968294A1 (en) ACARBOSE (ACB) CLUSTER FROM $i(ACTINOPLANES) SP. SE 50/110
DE19846493A1 (en) DNA sequence coding for products involved in the biosynthesis of polyketide or heteropolyketide compounds, especially epothilone
EP0604495B1 (en) Secondary-metabolite biosynthesis genes from actinomycetes, method of isolating them, and their use
EP0730029B1 (en) Actinoplanes sp. biosynthetic pathway genes for acarbose, isolation and use
DE69832783T2 (en) MICROORGANISMS WITH INCREASED PREPARATION OF CLAVLANIC ACID
EP0524604B1 (en) Process for the preparations of S-(+)-2,2-dimethyl-cyclopropane carboxamid by genetically engineered microorganismes
EP2499253B1 (en) Microorganisms having enhanced sucrose mutase activity
EP0796915A2 (en) Process for the preparation and use of acarviosyl-transferase in the conversion of ascarbose-homologous in acarbose and in the preparation of acarbose-homologous
DE60225366T2 (en) Expression control sequence
KR101263597B1 (en) Microorganism having enhanced fk506 or fk520 productivity and method of producing fk506 or fk520 using the same
DE69533141T2 (en) METHOD FOR THE PRODUCTION OF ANTHRACYCLINES AND THEIR INTERMEDIATE PRODUCTS
DE102021003944A1 (en) Collinolactone Biosynthesis and Production
WO2006032232A2 (en) Novel lysolipin biosynthesis gene cluster
DE10204798A1 (en) Procedure for overexpression of dehydrogenases
EP0733704A2 (en) Controlable expression system
DE10021667A1 (en) New nucleic acid sequences from Actinoplanes, useful for synthesis and bioconversion of acarbose and related inhibitors of alpha-glucosidase
WO2003018825A2 (en) Method for producing vitamin b12

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19990928

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: RO PAYMENT 19990928

RTI1 Title (correction)

Free format text: ACARBOSE (ACB) CLUSTER FROM ACTINOPLANES SP. SE 50/110

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Withdrawal date: 20000831