CZ289067B6 - Method of producing root knot nematode resistant plants - Google Patents

Abstract

In the present invention there is disclosed a method of producing root knot nematode resistant plants, wherein in respect of root knot nematode infected plant there is identified a gene which is expressed in the giant cells and/or the accompanying hypertrophic cells of root knots of the plant, the promoter of said gene is taken and fused with a coding sequence to provide a chimeric gene, which encodes a molecule which is inimical to one or more of the root knot giant cells and/or the root knot hypertrophic cells and/or the root knot nematodes, and a further plant is transformed with said chimeric gene.

Description

BACKGROUND OF THE INVENTION The present invention relates to a method for the preparation of plants resistant to root cancer caused by nematode (nematode) of Meloidogyne spp.

BACKGROUND OF THE INVENTION

Root nematodes (Meloidogyne spp.) Are the main pathogens of many crops such as vegetables, edible legumes, tobacco, tomatoes, watermelons, vines, peanuts and cotton.

Chemical control, cultivation practices and the use of resistant varieties are the main options for nematode control that are currently available and are often used in an integrated way against root nematode nematodes. There is a need to improve nematode control since current solutions provide inadequate crop protection. Nematicides are environmentally problematic and are not always effective. Cultivation control makes it possible to prevent plant losses in various ways. Wide range of root nematode hosts usefulness of economically pure non-host crop plants. Effective resistant cultivars are often unavailable and those that the grower can use are often sensitive cultivars at low densities of the root nematodes. Loss of resistance can also occur at high soil temperatures that occur in tropical and subtropical environments.

If the root nematode invades the plant root, it migrates intracellularly until it reaches the root meristem. Pharyngeal gland secretions are then injected with nematode spines into cells in the meristem area. This causes the normal development of these cells to be interrupted, whereby nuclear division occurs without cell division. This creates more nuclear cells, also known as giant cells. The formation of giant cells is associated with their expansion into surrounding cells, known as hypertrophic cells, which the nematode did not directly attack by prick penetration. The enormous cells and the surrounding cells together form a place where the root nematodes live. The observed tumor, formed on the infected root, contains such giant cells in conjunction with hypertrophic cells that are the result of multiple infections with nematodes. The mechanism of production of giant cells is similar in all sensitive plant species.

Upon induction of giant root nematode cells, they lose locomotor ability as the nematode food intake on the giant cell and the nematode receives food, develops and reproduces at the food intake site.

International patent application WO 92/04453 describes a method for controlling nematode root cysts. In an article entitled "Gene Exprassion in Nematode-Infected Plant Roots" by Gurra et al. (1191), described with respect to nematodes of potato cysts, a method comprising cDNA from mRNA was found to be a syncitium of a plant that was infected with root nematode nematodes.

SUMMARY OF THE INVENTION

SUMMARY OF THE INVENTION The present invention provides a method for the preparation of plants resistant to the root cancer caused by the nematode Meloidogyne spp. the gene is removed and fused with a coding sequence to form a chimeric gene that encodes a molecule that is detrimental to the giant

Root tumor cells and / or hypertrophic root tumor cells and / or Meloidogyne spp. and then another plant is transformed with this chimetric gene.

Plants in which resistance to rootworm nematodes can be improved in accordance with the present invention include vegetable plants, edible pulses, tobacco, plants producing edible fruit and cotton. For example, with regard to vegetables, the present invention can be applied to carrot plants and, with respect to fruit plants, it can be applied to tomato plants.

Since the mechanism of production of giant cells is similar for all susceptible plant species, the method of the invention is in fact applicable to all such species which are also transformable in accordance with the transformation step of the method.

The method of the invention is applicable to Meloidogyne species, including, but not limited to, M. incognita, M. javanica, M. arenaria, and M. hapla.

The gene identified and selected from the infected plant is preferably one whose expression did not take place before the nematode lost substantially locomotor ability.

Sequences (in the chimeric gene) expressed under the control of said promoter include one or more of:

Coding sequence for a molecule which causes necrosis of giant cells and / or hypertrophic cells.

2. Coding sequence for a molecule which causes necrosis of the nematode root cancer.

3. A coding sequence for any of a number of enzymes that are active in damaging plant cell metabolism.

4. 'Antisense' specific food intake gene.

5. "Antisense" coding sequences for enzymes critical for plant cell metabolism.

It is generally necessary to ensure that a gene is selected, which is a gene that is expressed only in giant cells and / or associated hypertrophy cells, because if the gene is expressed elsewhere, the expression product of the chimeric gene produced elsewhere would could adversely affect the transformed plant.

An advantage of the present invention is that resistance to root knot nematode nematodes can be conferred to plants without the need to produce an antinematode infection product as set forth in 1-5 above.

A preferred embodiment of the invention will now be described.

DETAILED DESCRIPTION OF THE INVENTION

Growth and infection of tobacco plants

C319 tobacco seeds germinate on Fisons FI compost under the following conditions. Light intensity 4,500 to 5,000 lux with a 16 hour light period, followed by 8 hours of darkness and a temperature between 20 and 25 ° C. After about 3 weeks, the seedlings are gently rinsed in tap water to remove soil and transferred to pouches (2 plants per pouch, Northrup-king) and growing for another week in Conviron at 25 ° C and at light intensity of 5,000 lux for 16 h. is followed by an 8 hour dark period. The roots are equipped from the back of the pouch and supported at their ends

-2GB 289067 B6

Whatman CF / A with fiberglass paper. The three-day-old nematode (M.javanica) is then delivered to the tip of these roots in 10 µl (50 nematode) aliquots and a second piece of CF / A paper is placed upwards to completely close the root tip. 24 hours after infection, GF / A paper is removed to allow synchronous infection. 3 days after infection, the tumors were excised (leaving a healthy root and posterior root tip tissue) and frozen immediately in liquid nitrogen. Approximately 0.5 to 1 g of infected root tissue is obtained from 80 inoculated plants.

Staining for visualization of nematodes in infected roots

To determine the quality of infection, the number of nematodes (infecting) per root tip is determined. The roots were harvested on the third day after infection of the plants and immersed for 90 seconds in lactophenol containing 0.1% Cotton Blue at 95 ° C. After 5 seconds of water washing, the roots are placed in lactophenol at RT (RT) for 3-4 days for purification. Stained nematodes are then visualized using light microscopy.

Isolation of RNA from healthy and infected root tissue

The root tissue is crushed to a fine powder in a frozen (liquid nitrogen) mortar with pestle. About 100 mg aliquots are then transferred to equally frozen Eppendorf tubes and 300 µL of hot phenol extraction buffer (50% phenol, 50% extraction buffer: 0.1 N lithium chloride, 0.1 M Tris-Hcl pH 8.0 ( RT), 10 mM EDTA, 1% SDS) and incubated at 80 ° C for 5 minutes. An equal volume of chloroform was then added and the homogenate was centrifuged at 4 ° C for 15 minutes. The aqueous phase is then extracted with 600 µl phenol / chloroform and micro-centrifuged as above. Then, the aqueous phase is again removed and then RNA is precipitated with an equal volume of lithium chloride at 4 ° C overnight. The precipitate is pelleted by microcentrifugation for 15 min. at RT and washed in 70% ethanol. The pellet is lyophilized, resuspended in DEPC treated water and evaluated by spectrophotometer. RNA quality is assessed by contamination according to gel electrophoresis. (Adapted to Shirzedegan et al. 1991).

Subtractive cloning of infection-specific cDNAs

Poly (A) ⁺ RNA (mRNA) was isolated from 200 µg of whole RNA samples from healthy and infected C319 root tissue using magnetic "dt Dynabeads" according to the manufacturer's instructions. First strand cDNA synthesis is performed in situ on Dynabead-bound poles (A) ⁺ fraction from healthy tissue. This is the driver DNA. First and second chain synthesis is performed in situ on Dynabead-bound poles (A) ⁺ fraction from infected tissue. This is the target DNA. All cDNA reactions were performed using a Pharmacia cDNA synthesis kit and following the manufacturer's instructions. Three oligonucleotides SUB21 (5'CTCTTGCTTGAATTCGGACTA3 '), SUB25 (5'TAGTCCGAATTCAAGCAAGAGCACA3') (sequence from Duduid-Dinauer, 1990) and LDT15 (5'GACAGAAGCGGATCCd (T) ₁₅ 3 '), (O'Reilly et al., 1991). kinase by T4 polynucleotide kinase according to Maniatis et al. (1982). SUB21 and Sub25 are then annealed to form a linker which is then ligated to the target DNA by the T4 DNA ligase of King and Blakesley (1986). Thereafter, the target bearing beads were washed extensively with TE and the second strand of cDNA eluted at 95 ° C in 5 x SSC.

RNA bound to Dynabead bound control DNA is removed by heating and the eluted target DNA hybridizes to the control DNA at 55 ° C in 5 x SSC for 5 hours. The non-hybridizing target DNA is separated from the bead-bound control DNA at room temperature according to the manufacturer's instructions, and then hybridized to the control DNA at 55 ° C in 5 x SSC for 5 hours. The non-hybridizing target DNA is separated from the bead-bound control DNA at room temperature according to the manufacturer's instructions, and then the hybridizing target DNA is similarly separated from the bead-bound control DNA at 95 ° C. The RT eluted target DNA is then added back to the control DNA and the hybridization is repeated. This process is repeated until the amount of target hybridizing to the control no longer exceeds the amount that it hybridizes. DNA concentration is determined using Invitrogen‘s DNA Dipstick according to the manufacturer's instructions.

-3GB 289067 B6

Aliquots of the final RT eluted fraction are used in PCR amplification (Eckert et al., 1990) to generate double-stranded cDNA for cloning into a plasmid vector. Target DNA amplification is achieved using primers SUB21 and LTD 15 and Hybaid Thermal Cycler under the conditions described by Frohman et al., 1988. The PCR products are then ligated into the SmaI digested pBluescript vector according to King and Blakesley (1986).

Screening of the Reverse North subtractive library by analysis

Recombinants are identified by column PCR (Gussow and Clackson, 1989). The amplified inserts are blotted by Southem three times on Pall Biodyne membranes according to the membrane manufacturer's instructions. Prehybridization and hybridization are performed at the same temperature and buffer, which are 42 ° C and 5 x SSPE, 0.05% BLOTTO, 50% formamide. They hybridize separately to cDNA probes (see below) from healthy and infected tissue and to a probe containing amplified target DNA from the final subtraction. Clones that show a hybridization signal only to the infected cDNA probe or that show a hybridization signal to the subtracted probe but not to the cDNA probes are selected for further analysis.

Generation of cDNA probe

To achieve high specific activity of the probes after differential screening, cDNA synthesis is performed "cold" on total RNA and the synthesis of the products is then labeled with oligotagging. Samples of 10 µg of total RNA from healthy and infected tissue were first treated with 2.5 units of DNase 1 at 37 ° C for 15 minutes. The DNase is then denatured at 95 ° C for 10 minutes prior to cDNA synthesis (standard Pharmacia protocol). The RNA is then removed in the presence of 0.4 M sodium hydroxide for 10 minutes at RT and the DNA is purified over a Sephacryl 400HR column. CDNA yield and concentration were determined using DNA Dipsticks (Invitrogen). The cDNA products were labeled according to the Pharmacia standard oligotagging protocol (c. 35 µg probe).

Northem blotting

To determine the expression profile of selected and Reverse Northems cDNAs in various plant tissues, clones are used as probes in North analysis of either total or poles of (A) ⁺ RNA from healthy and infected roots, stems, leaves and flowers. Total RNA blots contain 25 µg RNA per lane, while poly (A) 'blots contain 0.5 to 1 µg RNA per lane. RNA is electrophoresed on formaldehyde gels and blotted onto a Pall Biodyne B membrane as described by Foumey et al. (1988). The probes are labeled and hybridized to blots as described above.

Southem blotting

To determine whether cDNAs are of plant or nematode origin, C319 and M. javanica DNA were prepared according to Gawel and Jarret (1991). The Southem blots are prepared containing 10 µg EcoRI and Hind ΙΠ digested DNA per lane. The blots were hybridized to the oligotraded probes as described above.

Hydridization in situ

In situ hybridizations were performed to determine the site of expression of the interesting cDNAs at the feeding site. Tissues from infected and healthy roots are waxed, split and hybridized to probes as described by Jackson (1991).

Isolation of the 5‘ end of mRNA

The ends of the RNA of interest are determined before isolating their promoter sequences. This is achieved by using 5‘RACE as described by Frohman et al. (1988).

-4GB 289067 B6

Isolation of promoter regions

The promoter regions of the genes of interest are isolated by a procedure termed VectorLigated PCR. 100 µg of restriction endonuclease digested C319 genomic DNAs were ligated for 4 hours at RT (King and Blakesley, 1986) with 100 µg of pBluescript samples (digested with a restriction enzyme producing a compatible end). Typically, the enzymes used are EcoRI, BamHI, HindIII, BGII, XhoI, ClaI, SalI, KpnI, PstI, and SstI. PCR is then performed on ligation using a vector primer such as a -40 Sequencing primer and a primer complementary to the 5 'end of the mRNA. The PCR products are then cloned and sequenced. If necessary, the process is repeated with a new primer complementary to the 5 'end of the promoter fragment to ensure that the control sequences are isolated.

Construction of chimeric genes in binary vectors for plant transformation

The isolated promoters are ligated to a 5 ‘sequence which is one of the sequences of classes 1-5, as described above. Examples are the "antisense" of the gene itself (class 4) or the bamas gene (Hartley et al., 1972) (class 1 and / or class 3). These are constructed in binary vectors (Bevan, 1984).

Production of transgenic plants

Transgenic plants, such as tobacco, can be produced by the standard Agrobacterium-mediated leaf disc method described by Horsch et al. (1985), which provides plants resistant to nematode root cancer. Seeds or other plant propagating material of the present invention may be retained for future use.

Those skilled in the art will recognize in which classes of plants it may be appropriate or necessary to transform the plant using a method other than the Agrobacterium-mediated method.

It will also be appreciated by those skilled in the art that upon infection with the product of the invention, the plants will cease to suffer from the deleterious effects of such infection and the reproductive capacity of the root nematodes of the root cancers is reduced to an economically insignificant extent.

Resistance to nematode root tumors can be granted in accordance with the present invention to all monocotyledonous, dicotyledonous, plant and woody species susceptible to nematode root cancer.

-5GB 289067 B6

Links

BEVAN, M. (1984) Nucleic Acids Research 12 (22): 8711-8721.

DEGUID, J.R. - DINAUER, M.C. (1990) Nucleic Acids Research 18 (9): 2789-2792.

ECKERT, K.A. - Kunkel, T.A. (1990) Nucleic Acids Research (18) 13: 3737-3744.

FOURNEY, R.M. , MIYAKOSHI, J., DAY III, R.S. - Paterson, M.C. (1988) Focus 10 (1): 5-7.

FROHMAN, M.A., DUSH, M.K. - MARTIN, G.R. (1988) Proceedings of the National Academy of Sciences, USA 85: 8998-9002.

GAWEL, N.J. - JARRET, R.L. (1991). Planat Molecular Biology Reporter 9 (3): 262-266.

GUSSOW, D., - CLACKSON, T. (1989). Nucleic Acids Research 17: 4000.

GURR, S.J., McPHERSON, M.J., SCOLLAN, S., ATKINSON, H.J. BOWLES, D.J. (1991) Gene Expression in Nematode-Infected Plant Roots, Mol. Gene. Genet, 226: 361-366.

HARTLEY, R.W. , ROGERSON, D.L. - SMEATON, J.R. (1972)

Preparative Biochemistry 2: 243-250.

HORSCH, R.B., FRY, J.E., HOFFMANN, N.L. EICHHOLT2, D. ROGERS, S.G. - FRALEY, R.T., (1985) Science 227: 1229-1231. Jacques, D. (1991). Molecular Plant Pathology: A Practical Approach. IRL Press, Oxford.

KING, P.V. - BLAKESLEY, R.W. (1986). Focus 8: 1-3.

MANIATIS, T., FRITSCH, E.F. - SAMBROOK, J. (1982) Molecular Cloning: A Laboratory Manual. NY. Cold Spring Harbor Laboratory.

O'REILLY, D., THOMAS, C.J.R. - COUTTS, R.H.A. (1991) Joumal of General Virology 72: 1-7.

SHIRZADEGAN, M. CHRISTIE, P. - SEEMANN, J.R. (1991) Nucleic Acids Research 19 (21) 6060.

Claims (14)

PATENT CLAIMS Method for the preparation of plants resistant to the root cancer caused by nematode Meloidogyne spp., Characterized by identifying a gene that is expressed in giant cells and / or voluntary root tumor cells of a plant infected with nematode Meloidogyne spp. and fusing with a coding sequence to form a chimeric gene that encodes a molecule that is detrimental to giant root tumor cells and / or hypertrophy of the root tumor cell and / or Meloidogyne spp. and then another plant is transformed with this chimeric gene. The method of claim 1, wherein said molecule is a molecule capable of causing necrosis of giant cells and / or hypertrophic cells. The method of claim 1, wherein said molecule is a molecule capable of causing necrosis of the nematode Meloidogyne spp. The method of claim 1, wherein said molecule is an enzyme molecule effective to damage plant cell metabolism. 5. The method of claim 1, wherein said molecule is an antisense RNA of said gene identified in said infected plant. 6. The method of claim 1, wherein said molecule is an antisense RNA gene encoding an enzyme that is critical to plant cell metabolism. Plant resistant to root root cancer caused by nematode Meloidogyne spp., Prepared by the method of claim 1. The plant of claim 7, which is a plant selected from the group consisting of vegetable plants, edible legumes, fruits and nuts, and fiber plants. The plant of claim 7, which is a tobacco plant. The plant of claim 8, which is a tomato plant. The plant of claim 8, which is a carrot plant. The plant of claim 8, which is cotton. Plant propagating material according to claim 7. A chimeric gene, comprising a coding sequence that encodes a molecule that is harmful to giant root tumor cells and / or hypertrophic root tumor cells and / or Meloidogyne spp., Said gene further comprising a promoter sequence taken from a gene that has been expressed in giant cells and / or accompanying hypertrophic root tumor cells of a Meloidogyne spp. infected plant, wherein the promoter is capable of inducing expression of said coding sequence in giant root tumor cells and / or hypertrophic root tumor cells in a plant transformed with such a chimeric gene.