KR102194867B1 - Defense suppression function of OsWRKY55 gene, or promoter region recognized by the effector of Xanthomonas oryzae pv. oryzae and uses thereof - Google Patents

Abstract

The present invention relates to a disease defense suppression gene OsWRKY55, a promoter combined with effector of Xanthomonas oryzae pv. oryzae, and uses thereof. According to the present invention, mutations in an RNAi base sequence for a gene and an OsWRKY55 promoter recognition site of LJ4 are induced, such that a mutant of an OsWRKY55 promoter fragment is used, thereby being usefully used as base technology capable of developing rice blight resistant crops and reducing damage caused by rice blight.

Description

Defense suppression function of OsWRKY55 gene, or promoter region recognized by the effector of Xanthomonas oryzae pv. oryzae and uses thereof}

It relates to disease defense inhibitory gene OsWRKY55, rice white leaf blight effector binding promoter, and use thereof.

Plants inherently have genes that inhibit disease defense. When there is no invasion of pathogens, the immune response is suppressed by expressing the disease defense suppression gene so that all energy can be used for reproduction and growth, and the plant can grow normally and bear seeds with the energy obtained through photosynthesis.

However, while plants are growing, they are constantly invaded by pathogens or pests. At this time, pathogens recognize genes that inhibit disease defense inherent in the host plant, thereby helping the pathogen to grow.

On the other hand, when a plant is attacked by pathogens or pests, it activates a sophisticated immune system to defend it. In the case of invasion of pathogens, resistance to disease is obtained by expressing disease defense (resistance) genes or suppressing the expression of another disease-causing gene. Accordingly, studies have been conducted to obtain resistance to diseases by separating disease defense genes from plants and overexpressing them in plants or suppressing the expression of disease-causing genes.

In addition, plants are known to have a complex mechanism in recognizing pathogen attacks and activating internal immune responses. Plants and pathogens each have coevolution through the relationship between adaptability and infectivity. This phenomenon appears as a relationship between the non-pathogenic gene (avr gene) and the resistance gene (R gene) in the attack and defense of pathogens and host plants. Pathogens must destroy the plant's dual defense system for successful propagation and efficient parasitics in the host plant through infection. Through the primary defense system, plants recognize microbe-associated molecular patterns (MAMPs) of pathogens using PRRs (Patterns recognition receptors) that induce basic defense systems. However, this primary defense system is disrupted by a secretory effector, which is then recognized by the R protein inside the plant. The R gene, a disease resistance gene in plants, mainly encodes a receptor protein, and binds directly or indirectly to a secretory protein (effector), a product of the bacterial infectious Avr gene.

Rice ( Oryza sativa L.) white leaf blight, which is generally caused by rice white leaf blight ( Xanthomonas oryzae pv. oryzae, Xoo ), causes serious damage to most rice producing countries, especially in the equator. Rice white leaf blight (bacterial blight) is a Gram-negative bacillus, Xanthomonas oryzae pv. It is one of the major diseases of rice caused by oryzae ( Xoo ). It invades through the hand and wound of rice leaves and proliferates along the duct. Rice white leaf blight bacteria ( Xoo ) emit many effector proteins, including a transcription activator-like effector, through T3SS (Type III Secretion System) (Annu Rev Microbiol., 54:735-774, 2000). ; Biochim Biophys Acta., 1694(1-3):181-206, 2004).

TAL effectors (transcription activator-like effectors, TALEs) are structurally and functionally unique proteins of plant bacterial pathogens, and are found in most of the bacteria of the genus Xanthomonas , and each of the Xanthomonas bacteria has a variable number of TAL effectors. The TAL effector acts as a transcription factor and specifically binds to a specific gene promoter region of a host cell and regulates the expression of that gene. The interaction of the TAL effector with the plant activates the host gene that promotes pathogenicity or triggers a defense mechanism against the TAL effector (Mol Plant Microbe Interact., 13(12): 1322-1329, 2000). The TAL effector has nuclear localization signals (NLSs) and transcription factor-specific AAD (acid activation domain) at the N-terminus and C-terminus required for T3SS. The TAL effector has a different central region, mainly 33-34 amino acid length domains are repetitively present. In particular, polymorphism occurs at residues 12 and 13 of the domains, which is called RVD (repeat-variable di-residue).

The promotion of transcription of the rice Os8N3 gene by the TAL effector PthXo1, a major pathogenic factor of rice white leaf blight ( Xoo ), plays an important role in promoting bacterial proliferation and the onset of white leaf blight, and the TAL effector AvrXa7 activates the rice Os11N3 gene. It has been reported that rice increases susceptibility to rice white leaf blight ( Xoo ) by doing so (Current Opinion in Plant Biology, 13:394-401, 2010). Xoo strains isolated from Korea (Nucleic acid research, 33:577-586, 2005), Japan (Jpn Agric Res Q., 39:275-287, 2005), and the Philippines (BMC genomics., 9:204, 2008). The sequence was reported, but surprisingly, the sequence of the TAL effector RVD of the Xoo strain was completely different depending on the country in which it was isolated. Since the co-evolution of each country strain was carried out differently depending on the rice variety being grown, it is important to study the TAL effector of the Korean strain.

In the present invention, it was attempted to isolate a disease defense inhibitory gene from rice ( Oryza sativa ). The purpose of this study was to develop a plant capable of obtaining resistance to disease by suppressing disease defense or suppressing the expression of disease-causing genes (sensitivity genes) against rice white leaf blight bacteria. In addition, using the promoters of these genes, it was attempted to select a rice plant that is resistant to white leaf blight or to improve resistance to rice white leaf blight.

Korean Patent Registration No. 110-1785101

One object of the present invention is to provide a recombinant vector for enhancing rice white leaf blight resistance comprising a RNAi (ribonucleic acid interference) nucleotide sequence for the OsWRKY55 gene.

Another object of the present invention is to provide a plant transformed with a recombinant vector for enhancing rice white leaf blight resistance comprising the RNAi nucleotide sequence for the OsWRKY55 gene.

Another object of the present invention is to produce a transgenic plant with improved rice white leaf blight resistance, comprising the step of transforming the plant with a recombinant vector for enhancing rice white leaf blight resistance comprising the RNAi nucleotide sequence for the OsWRKY55 gene To provide a way.

Another object of the present invention is a method for enhancing rice white leaf blight resistance by inhibiting the expression of OsWRKY55, a disease defense inhibitory gene in a plant, comprising the step of introducing a recombinant vector containing the RNAi nucleotide sequence for the OsWRKY55 gene into a plant. Is to provide.

Another object of the present invention is a disease defense inhibitory gene consisting of the nucleotide sequence of SEQ ID NO: 18, which binds to the TAL effector LJ4 (Transcription activator-like effector LJ4) gene of rice white leaf blight ( Xanthomonas oryzae pv. oryzae , Xoo ) OsWRKY55 promoter region is provided.

Another object of the present invention is to provide a recombinant vector for TAL effector LJ4 gene sequence recognition, comprising the OsWRKY55 promoter region consisting of the nucleotide sequence of SEQ ID NO: 18.

Another object of the present invention is a) introducing a recombinant vector for recognizing the TAL effector LJ4 gene sequence in order to cultivate a rice white leaf blight resistant variety; b) infecting the rice white leaf blight resistant cultivar or rice white leaf blight resistant candidate plant into which the recombinant vector for recognizing the TAL effector LJ4 gene sequence was introduced, with Xanthomonas oryzae pv. oryzae, Xoo ); And c) evaluating the degree of the OsWRKY55 promoter activity of the rice white leaf blight-resistant candidate plant using the rice white leaf blight-resistant cultivar as a control; it is to provide a method for selecting rice white leaf blight-resistant plants.

Another object of the present invention is to provide an OsWRKY55 promoter variant fragment consisting of the nucleotide sequence of SEQ ID NO: 19.

Another object of the present invention is to provide a recombinant vector for enhancing rice white leaf blight resistance comprising the OsWRKY55 promoter variant fragment.

Another object of the present invention is to provide a plant transformed with a recombinant vector for enhancing rice white leaf blight resistance comprising the OsWRKY55 promoter variant fragment.

Another object of the present invention is to provide a method for producing a transgenic plant with improved rice white leaf blight resistance, comprising transforming a recombinant vector for enhancing rice white leaf blight resistance including the OsWRKY55 promoter variant fragment into a plant Is to do.

Another object of the present invention is to provide a method for enhancing rice white leaf blight resistance of plants, comprising the step of introducing a recombinant vector containing the OsWRKY55 promoter variant fragment into a plant.

Under this background, the present inventors have made intensive research efforts to develop rice white leaf blight-resistant crops and easily select resistant crops, and as a result, it was found that the OsWRKY55 gene derived from rice is activated by the rice white leaf blight (Xanthomonas oryzae pv. oryzae) XOO _KXO576 . The present invention was completed by confirming and deriving the recognition site of the OsWRKY55 promoter that specifically binds to the TAL effector LJ4 of rice white leaf blight based on this.

As an aspect for achieving the above object, the present invention provides a recombinant vector for enhancing rice white leaf blight resistance comprising the RNAi nucleotide sequence for the OsWRKY55 gene.

In the present invention, the term "rice white leaf blight ( Xanthomonas oryzae pv. oryzae , Xoo )" is a gram-negative bacterium, which is a pathogen having host-specific characteristics that are only pathogenic to rice. It infects rice, causing Bacterial Blight (BB), and invades through handwork and wounds of rice leaves and proliferates along the duct.

In the present invention, the term "OsWRKY55" is a gene belonging to the WRKY family, and several signaling molecules such as methyl jasmonate, salicylic acid, and 1-aminocyclo-propane-1-carboxylic acid (ACC), or wounds B. Implement defense mechanisms against abiotic factors such as pathogen infection.

In the present invention, the specific nucleotide sequence and protein information of the gene encoding the OsWRKY55 protein are known from NCBI (GenBank: Accession AK101653.1, BAG95171.1, etc.).

In the present invention, the term "recombinant" refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a peptide, a heterogeneous peptide, or a protein encoded by a heterogeneous nucleic acid. Recombinant cells may express genes or gene segments that are not found in the natural form of the cell in either a sense or antisense form. In addition, the recombinant cells can express genes found in cells in their natural state, but the genes are modified and reintroduced into cells by artificial means.

In the present invention, the term "vector" is used to refer to a DNA fragment(s) or nucleic acid molecule to be delivered into a cell. Vectors replicate DNA and can be reproduced independently in host cells. The term “expression vector” is often used interchangeably with “recombinant vector”. The term “recombinant vector” refers to a recombinant DNA molecule comprising a coding sequence of interest and an appropriate nucleic acid sequence essential for expressing the coding sequence operably linked in a particular host organism. Promoters, enhancers, termination signals and polyadenylation signals usable in eukaryotic cells are known.

In the present invention, the term "RNAi" is a process in which short double-stranded RNA selectively degrades the target mRNA corresponding to its nucleotide sequence to stop transcription of the target gene and protein synthesis. In order to produce siRNA (small interfering RNA) used to specifically induce such RNAi phenomenon, a method of directly synthesizing siRNA in vitro and then introducing it into cells through transfection, and a method designed to express siRNA in cells. A method using a short hairpin RNA (shRNA) expression vector is widely used.

In the present invention, using the gene consisting of the nucleotide sequence of SEQ ID NO: 24, RNAi technology was used to control the expression of the OsWRKY55 gene, and a recombinant vector including the RNAi (ribonucleic acid interference) nucleotide sequence for the OsWRKY55 gene was produced. I did.

In the rice plant (OsWRKY55RNAi) transformed with a recombinant vector containing RNAi for OsWRKY55 containing a gene consisting of the nucleotide sequence of SEQ ID NO: 24, it was confirmed that disease resistance increased and the length of disease occurrence was reduced. Accordingly, it was found that OsWRKY55 acts as a disease defense inhibitory gene against Xoo , and when the OsWRKY55 gene is overexpressed, it was found that susceptibility to rice white leaf blight bacteria was increased. Therefore, it was found that the OsWRKY55 gene plays a role in inhibiting disease defense so that plants can grow well when there is no invasion of pathogens.

As another aspect, the present invention provides a plant transformed with a recombinant vector for enhancing rice white leaf blight resistance comprising a RNAi (ribonucleic acid interference) nucleotide sequence for OsWRKY55 gene.

In the present invention, descriptions of the terms "OsWRKY55 gene", "RNAi for the OsWRKY55 gene", "recombinant vector", and rice white leaf blight are as described above.

In the present invention, the term "transformation" refers to a phenomenon in which DNA enters the cell and changes the genotypic trait when DNA, which is a genetic material, is injected into a living cell of another lineage. Transformation, transformation, Or it is also called casting.

In the present invention, as a transformation method for introducing the vector into a plant, a transformation method using Agrobacterium, microprojectile bombardment, electroporation, PEG-mediated fusion method (PEG-mediated fusion) , Microinjection, liposome-mediated method, in planta transformation, vacuum infiltration method, floral meristem dipping method, or agro Bacteria spraying method (Agrobacterium spraying method) may be used, but is not limited thereto.

In addition, the method of the present invention includes the step of regenerating a transformed plant from the transformed plant cell. Any method known in the art may be used as a method of regenerating a transformed plant from a transformed plant cell.

In the present invention, the term "plant" is meant to include not only mature plants, but also plant cells, plant tissues, and seeds of plants that can develop into mature plants.

In the present invention, the plant is not particularly limited, and as an example, rice, wheat, barley, corn, soybeans, potatoes, wheat, red beans, food crops including oats or sorghum; Vegetable crops including Arabidopsis, Chinese cabbage, radish, pepper, strawberry, tomato, watermelon, cucumber, cabbage, melon, pumpkin, green onion, onion or carrot; Specialty crops including ginseng, tobacco, cotton, sesame, sugar cane, sugar beet, perilla, peanut or rapeseed; Fruit trees including apple tree, pear tree, jujube tree, peach, papaver, grape, citrus, persimmon, plum, apricot or banana; Flowers including roses, gladiolus, gerberas, carnations, chrysanthemums, lilies or tulips; And any one selected from the group consisting of ryegrass, red clover, orchardgrass, alpha alpha, tall fescue, or perennial ryegrass, and specifically rice, but is not limited thereto.

In the present invention, when the expression of the OsWRKY55 gene is suppressed, since the resistance of the plant to rice white leaf blight is increased, in order to improve the resistance of the plant to rice white leaf blight, as described above, the OsWRKY55 gene consisting of the nucleotide sequence of SEQ ID NO: 24 is A recombinant vector containing the RNAi nucleotide sequence is prepared and transformed into a plant to inhibit the expression of the OsWRKY55 gene, thereby enhancing the resistance of the plant to rice white leaf blight.

As another aspect, the present invention, comprising the step of transforming a recombinant vector for enhancing rice white leaf blight resistance including the RNAi nucleotide sequence for the OsWRKY55 gene into a plant, rice white leaf blight resistance is enhanced transformation It provides a method for producing a plant.

In the present invention, descriptions of the terms "rice white leaf blight", "RNAi against the OsWRKY55 gene", "OsWRKY55 gene", "recombinant vector", "transformation" and "plant" are as described above.

In the present invention, a recombinant vector comprising the RNAi nucleotide sequence for the OsWRKY55 gene consisting of the nucleotide sequence of SEQ ID NO: 24 is prepared and transformed into a plant, thereby making it possible to produce a transgenic plant with improved resistance to rice white leaf blight.

As yet another aspect, the present invention provides a method for enhancing rice white leaf blight resistance of a plant comprising the step of introducing a recombinant vector containing the RNAi nucleotide sequence for the OsWRKY55 gene into a plant.

In the present invention, descriptions of the terms "rice white leaf blight", "RNAi against the OsWRKY55 gene", "OsWRKY55 gene", "recombinant vector", "transformation" and "plant" are as described above.

In the present invention, the term "introducing into a plant" means a step of constructing a recombinant vector including a polynucleotide having a specific nucleotide sequence and transforming the recombinant vector into a plant.

Specifically, in the present invention, a recombinant vector for transformation was prepared by inserting the RNAi nucleotide sequence for the OsWRKY55 gene, and a transformant thereof was prepared. It was confirmed that it is improved.

According to the present invention, when the expression of the OsWRKY55 gene is suppressed, since the resistance of the plant to rice white leaf blight is enhanced, the RNAi base for the OsWRKY55 gene consisting of the nucleotide sequence of SEQ ID NO: 24 in order to increase the resistance of the plant to rice white leaf blight It is also possible to prepare a recombinant vector comprising the sequence and transform it into a plant to inhibit the expression of the OsWRKY55 gene, thereby enhancing the rice white leaf blight of the plant.

In yet another aspect, the present invention is a TAL effector LJ4 (Transcription activator-like effector LJ4) gene of rice white leaf blight ( Xanthomonas oryzae pv. oryzae , Xoo ), which binds to the nucleotide sequence of SEQ ID NO: 18 OsWRKY55 Promoter site (fragment) is provided.

In the present invention, it was confirmed that the white leaf blight bacteria ( Xanthomonas oryzae pv. oryzae , Xoo ) increased the expression of the disease defense inhibitory gene OsWRKY55 inherent in plants, thereby increasing the susceptibility to rice white leaf blight.

Among the TAL effectors of rice white leaf blight ( Xanthomonas oryzae pv. oryzae , Xoo ), LJ4 ( transscription activator-like effector LJ4) increases the expression of the disease defense suppressor gene OsWRKY55 gene, and the OsWRKY55 promoter consisting of the nucleotide sequence of SEQ ID NO: 18 ) It was confirmed that it binds to the site.

In the present invention, the description of the terms "rice white leaf blight" and "OsWRKY55 gene" is as described above.

In the present invention, the term "rice white leaf blight ( Xanthomonas oryzae pv. oryzae , Xoo )" ejects many effector proteins including TAL effectors (Transcription activator-like effector, TALE) through T3SS (type III secretion system) do.

In the present invention, the rice white leaf blight ( Xanthomonas oryzae pv. oryzae , Xoo ) is XOO _KXO576 , and has about 18 effector proteins.

In the present invention, the term "TAL effector (Transcription activator-like effector, TALE)" is a structurally and functionally unique type of protein of plant bacterial pathogens, and is found in most of the bacteria of the genus Xanthomonas . Each Xanthomonas bacteria is a variable number of TAL effectors. Have. The TAL effector has nuclear localization signals (NLSs) and transcription factor-specific AAD (acid activation domain) at the N-terminus and C-terminus required for the T3SS (type III secretion system), and is injected into plant cells through T3SS. do. It moves from the plant cell to the nucleus and binds to the TAL effector-specific DNA sequence and is involved in the expression of sub-genes, and the interaction with the plant activates the host gene that promotes pathogenicity or suppresses the disease defense mechanism to cause disease. Deepen

In the present invention, the term "TAL effector LJ4 (Transcription activator-like effector LJ4)" refers to rice white leaf blight ( Xanthomonas oryzae pv. oryzae , Xoo ) XOO _KXO576- derived TAL effector, LJ4 is NI HG NI NI NI NI NN HD NS NN NS NN HD NN NI HD NN NI NG HD NG Consists of 20 RVDs (repeat variable dinucleotide, SEQ ID NO: 12), and the'RVD sequence' is understood as a continuous sequence of RVDs within the TAL effector binding domain. Sequences are specified in the NC-direction, ie from N-terminus to C-terminus, unless otherwise specified.

In the present invention, the term "promoter" is located upstream (5') with respect to the transcriptional direction of the transcription initiation site of the gene (the transcription start point is represented by the position +1 of the sequence, and any upstream Nucleotides are indicated using negative numbers), the binding site for DNA-dependent RNA polymerase, the transcription initiation site, the transcription factor binding site, the inhibitory factor and activator protein binding site, and the amount of transcription from the promoter directly or indirectly regulated. Controls the transcription of one or more genes, structurally identified by the presence of any other DNA domain (cis-acting sequence), including, but not limited to, any other nucleotide sequence known to those skilled in the art to act Represents a nucleic acid fragment having a function. Examples of eukaryotic cis-acting sequences upstream of the transcription initiation point (+1) include a TATA box, a CAAT box, a 5'enhancer or a silencing factor element.

In the present invention, the term "OsWRKY55 promoter" is a rice-derived transcription factor OsWRKY55 gene promoter, consisting of the nucleotide sequence of SEQ ID NO: 17, and an upstream site (-1000) based on the transcription start site (+1) of the OsWRKY55 gene It contains the sites to, and is an inducible promoter activated by rice white leaf blight ( Xanthomonas oryzae pv. oryzae , Xoo ) XOO _KXO576 .

The "inducible promoter" refers to a promoter that is physiologically (eg, exogenous action of a specific compound) or embryologically regulated.

In the present invention, the term "OsWRKY55 promoter fragment" is a partial region of the OsWRKY55 promoter to which transcription factors bind, and is a P1 region that specifically binds to the TAL effector LJ4 of rice white leaf blight, which acts as a transcription factor. . OsWRKY55 promoter fragment is included in the upstream (-300) to (-30), more specifically, (-68) to (-48) sites based on the transcription start site (+1) of the OsWRKY55 gene, ' It consists of the nucleotide sequence of AGAGCGGTGGTGGTTTTTAT' (SEQ ID NO: 18).

In one embodiment of the present invention, it was confirmed that the expression of the OsWRKY55 gene was significantly increased by the rice white leaf blight (Xanthomonas oryzae pv. oryzae) XOO _KXO576 , and the fragment of the OsWRKY55 promoter was a TAL effector derived from the rice white leaf blight XOO _KXO576. It was confirmed that it specifically binds to LJ4 to induce promoter activity (FIG. 4).

As another aspect, the present invention provides a recombinant vector for TAL effector LJ4 gene sequence recognition, comprising the OsWRKY55 promoter fragment consisting of the nucleotide sequence of SEQ ID NO: 18.

In the present invention, the terms "recombinant vector" and "OsWRKY55" are as described above.

Rice white leaf blight bacteria ( Xanthomonas oryzae pv. oryzae ) XOO _KXO576 according to an embodiment of the present invention plant pathogen inducible expression vector containing the OsWRKY55 inducible promoter activated by the constitution of a conventional plant expression vector It may, and may include known components essential to the vector for plant expression. For example, the plant pathogen-inducible expression vector may include an enhancer, a pathogen-inducible promoter of the present invention, a cloning site, a transcription terminator, and a selection marker. In addition, the plant pathogen inducible expression vector may be one obtained by substituting the promoter of the present invention in a conventional vector, and the conventional vector is a pUC family vector such as pBR322, pBI121, pCAMBIA vector series, Gateway It may be a vector derived therefrom, such as a binery vector or Ti-plasmid, but is not limited thereto.

In the present invention, the recombinant vector includes a foreign gene encoding a protein of interest operably linked to the promoter fragment.

The term "foreign gene" of the present invention refers to a gene introduced into a plant from the outside, and may already exist in an individual (ie, a subject to induce transformation) or may not exist. The nucleotide sequence of the foreign gene can be obtained through codon optimization of the target protein.

The term "operably linked" refers to a state in which a nucleic acid expression control sequence and a nucleic acid sequence encoding a protein or peptide of interest are functionally linked to perform a general function. For example, a promoter and a nucleic acid sequence encoding a protein may be operably linked to affect the expression of the nucleic acid sequence. The operative linkage with the expression vector may be prepared using gene recombination techniques well known in the art, and site-specific DNA cleavage and linkage may use enzymes generally known in the art.

The foreign gene includes a marker gene or a fluorescent protein gene. The marker gene may be, but is not limited to, GUS (β-glucuronidase), and the fluorescent protein is, but is not limited to, GFP (green fluorescent protein), luciferase, or CFP (cyan fluorescent protein). protein).

The recombinant expression vector according to the present invention may include, but is not limited to, both the marker gene and the fluorescent protein gene, and may optionally include a marker gene or a fluorescent protein gene, respectively.

The recombinant vector for recognizing the TAL effector LJ4 gene sequence according to the present invention may essentially include an OsWRKY55 promoter fragment consisting of the nucleotide sequence of'AGAGCGGTGGTGGTTTTTAT' (SEQ ID NO: 18), that is, an OsWRKY55 promoter recognition site, and the OsWRKY55 promoter recognition site It may include the OsWRKY55 promoter consisting of the nucleotide sequence of SEQ ID NO: 17 containing (SEQ ID NO: 18). As long as the OsWRKY55 promoter recognition site consisting of the nucleotide sequence of SEQ ID NO: 18 is essentially included, the OsWRKY55 promoter gene included in the recombinant vector for recognizing the TAL effector LJ4 gene sequence is not limited to some specific nucleotide sequences.

In one embodiment of the present invention, the TAL effector vector named 35S::LJ4-YFP containing the TAL effector LJ4 of rice white leaf blight bacteria XOO _KXO576 and OsWRKY55 gene promoter region (SEQ ID NO: 17; OsWRKY55 A reporter vector named pOsWRKY55::GFP-GUS containing the promoter recognition site P1 (which contains SEQ ID NO: 18) was constructed, and each of the protoplasts derived from the mesocotyls of rice was prepared using PEG to protoplasts. After transfection, in order to measure the activity of the OsWRKY55 promoter according to the binding of the TAL effector LJ4 and the P1 region, the recognition site of the OsWRKY55 promoter, the color reaction of the GUS gene, a marker gene, was observed. As a result, rice white leaf blight bacteria Xoo _{It was confirmed that} the recognition site of the _KXO576- derived TAL effector LJ4 and the rice-derived OsWRKY55 promoter specifically binds to exhibit activity (Figs. 3 and 4).

Therefore, using a reporter vector named pOsWRKY55::GFP-GUS containing a fragment (SEQ ID NO: 18) of the OsWRKY55 gene promoter of the present invention, the TAL effector of rice white leaf blight Xoo _KXO576 as a target sequence When the LJ4 gene sequence is recognized, it can be determined whether or not the rice white leaf blight bacteria Xoo _KXO576 are infected according to the presence or absence of a marker gene or a fluorescent protein gene.

In another aspect, the present invention a) introducing a recombinant vector for recognizing the TAL effector LJ4 gene sequence to a rice white leaf blight resistant cultivar or a rice white leaf blight resistant candidate plant; b) Infecting rice white leaf blight bacteria ( Xanthomonas oryzae pv. oryzae , Xoo ) to the rice white leaf blight-resistant cultivar or rice white leaf blight-resistant candidate plant into which the recombinant vector for recognizing the TAL effector LJ4 gene sequence was introduced; And c) evaluating the degree of the OsWRKY55 promoter activity of the rice white leaf blight-resistant candidate plants using the rice white leaf blight-resistant cultivar as a control; it provides a method for selecting rice white leaf blight-resistant plants.

In the present invention, the recombinant vector for recognizing the TAL effector LJ4 gene sequence is a recombinant vector comprising an OsWRKY55 promoter fragment consisting of the nucleotide sequence of SEQ ID NO: 18 and a foreign gene encoding the target protein operably linked to the group promoter fragment. Same as one.

The rice white leaf blight-resistant varieties in step a) may be, but are not limited to, Suan rice, Surye Jinmi, Sinbaek rice, Manbaek, Anbaek, Sujin rice, or Ilmi rice, which are conventional rice white leaf blight-resistant varieties.

The method of introducing the recombinant vector for recognizing the TAL effector LJ4 gene sequence comprising the OsWRKY55 promoter fragment consisting of the nucleotide sequence of SEQ ID NO: 18 in step a) into a rice white leaf blight resistant variety or a rice white leaf blight resistant candidate plant is not limited thereto. Although not, it can be performed by a transformation technique known to those skilled in the art.

In the present invention, as a transformation method for introducing the vector into a plant, a transformation method using Agrobacterium, microprojectile bombardment, electroporation, PEG-mediated fusion method (PEG-mediated fusion) , Microinjection, liposome-mediated method, in planta transformation, vacuum infiltration method, floral meristem dipping method, or agro A bacterium spraying method may be used, and more specifically, PEG-mediated fusion may be used, but is not limited thereto.

In the present invention, the term "transformation" refers to a phenomenon in which DNA enters the cell and changes the genotypic trait when DNA, which is a genetic material, is injected into a living cell of another lineage. Transformation, transformation, Or it is also called casting.

In addition, the method of the present invention includes the step of regenerating a transformed plant from the transformed plant cell. Any method known in the art may be used as a method of regenerating a transformed plant from a transformed plant cell.

The rice white leaf blight bacteria ( Xanthomonas oryzae pv. oryzae , Xoo ), which infects the rice white leaf blight resistant variety or the rice white leaf blight resistant candidate plant in step b), are, but are not limited to, the rice white leaf blight strain Xoo _KXO576 strain. I can.

Meanwhile, a recombinant vector for TAL effector LJ4 gene sequence recognition comprising an OsWRKY55 promoter fragment consisting of a nucleotide sequence represented by SEQ ID NO: 18 introduced in step a) and a foreign gene encoding a target protein operably linked to the promoter fragment And, by the interaction with the TAL effector LJ4 derived from the rice white leaf blight bacteria Xoo _KXO576 infected in step b), that is, by the transcription-promoting activity through specific binding between the OsWRKY55 promoter fragment and the TAL effector LJ4, specifically, a marker gene Alternatively, the expression of the fluorescent protein is induced.

Accordingly, the evaluation of the degree of OsWRKY55 promoter activity in step c) is performed by using rice white leaf blight resistant varieties as a control, and specifically, the expression level of a marker gene or fluorescent protein, that is, the degree of color reaction or fluorescence intensity. Rice white leaf blight resistant plants can be selected by determining the degree of resistance of the resistant candidate plants to rice white leaf blight bacteria. For example, when the degree of color reaction or fluorescence intensity is similar to or higher than the rice white leaf blight resistant variety, the rice white leaf blight resistance candidate plant may be determined or selected as a rice white leaf blight resistant variety.

As another aspect, the present invention provides an OsWRKY55 promoter variant fragment consisting of the nucleotide sequence of SEQ ID NO: 19.

As described above, the "OsWRKY55 promoter fragment" is a partial region of the OsWRKY55 promoter to which transcription factors bind, and P1 specifically binds to the TAL effector LJ4 of rice white leaf blight, which acts as a transcription factor. Region, and the OsWRKY55 promoter fragment is included in the upstream region (-300) to (-30) more specifically, (-68) to (-48) region based on the transcription start site (+1) of the OsWRKY55 gene. And consists of the nucleotide sequence of'AGAGCGGTGGTGGTTTTTAT' (SEQ ID NO: 18).

In the present invention, the term "OsWRKY55 promoter variant fragment" consists of the nucleotide sequence of SEQ ID NO: 19. "Variant fragment" refers to the deletion, insertion, or substitution of a specific base within the base sequence of the OsWRKY55 promoter fragment consisting of the base sequence of SEQ ID NO: 18, specifically the base sequence of SEQ ID NO: 19 Have.

The OsWRKY55 promoter variant fragment consisting of the nucleotide sequence of SEQ ID NO: 19 inhibits binding of the TAL effector LJ4 gene of rice white leaf blight ( Xanthomonas oryzae pv. oryzae , Xoo ). By the OsWRKY55 promoter mutant fragment, the OsWRKY55 promoter fragment, that is, the OsOsWRKY55 promoter recognition site, specifically, the binding of the P1 region to the TAL effector LJ4 of rice white leaf blight is inhibited or blocked. Accordingly, the transcriptional activity of the OsWRKY55 promoter induced by rice white leaf blight bacteria is inhibited, and resistance of plants to rice white leaf blight bacteria can be improved.

As another aspect, the present invention provides a recombinant vector for enhancing rice white leaf blight resistance comprising the OsWRKY55 promoter variant fragment.

In the present invention, descriptions of the terms "OsWRKY55 promoter variant fragment", "recombinant vector", and "rice white leaf blight" are as described above.

In one embodiment of the present invention, the TAL effector LJ4 was isolated to prepare an expression vector 35S::YFP-LJ4 for plant transformation, and the OsWRKY55 promoter containing the P1 region of the OsWRKY55 promoter was isolated to pOsWRKY55::GFP. -GUS reporter vector was prepared, and pOsWRKY55m::GFP-GUS reporter vector was prepared using the OsWRKY55 promoter variant consisting of the nucleotide sequence of SEQ ID NO: 19 in which the P1 region of the OsWRKY55 promoter was mutated, and the prepared vector was used. Using the TAL effector LJ4 and OsWRKY55 promoter activity according to the binding of the P1 region, the recognition site of the OsWRKY55 promoter was assayed. As a result, no activity was observed in the OsWRKY55 promoter variant consisting of the nucleotide sequence of SEQ ID NO: 19 in which the P1 region of the OsWRKY55 promoter was mutated (FIG. 4).

Therefore, by the recombinant vector containing the OsWRKY55 promoter variant fragment, the binding of the OsOsWRKY55 promoter recognition site P1 region to the TAL effector LJ4 of the rice white leaf blight was inhibited or blocked, and the transcriptional activity of the OsWRKY55 promoter induced by the rice white leaf blight was inhibited. It is inhibited, and can improve the resistance of plants to rice white leaf blight.

In yet another aspect, the present invention provides a plant transformed with a recombinant vector for enhancing rice white leaf blight resistance, including the OsWRKY55 promoter variant fragment.

In the present invention, descriptions of the terms "transformation", "OsWRKY55 promoter variant fragment", "rice white leaf blight", "recombinant vector", and "plant" are as described above.

In the present invention, the transformed plant is inhibited or blocked from binding between the OsWRKY55 promoter recognition site P1 region and the TAL effector LJ4 of the rice white leaf blight by introducing a recombinant vector containing the OsWRKY55 promoter variant fragment. The transcriptional activity of the OsWRKY55 promoter induced by this is inhibited, and the resistance of plants to rice white leaf blight bacteria can be improved.

As another aspect, the present invention is a method for producing a transgenic plant with improved rice white leaf blight resistance, comprising transforming the plant with a recombinant vector for enhancing rice white leaf blight resistance comprising the OsWRKY55 promoter variant fragment Provides.

In the present invention, descriptions of the terms "OsWRKY55 promoter variant fragment", "rice white leaf blight", "recombinant vector", "transformation", and "plant" are as described above.

The present invention is to prepare a recombinant vector comprising the OsWRKY55 promoter mutant fragment having resistance to rice white leaf blight consisting of the nucleotide sequence of SEQ ID NO: 19, and transform it into a plant, thereby improving resistance to rice white leaf blight. It is possible to manufacture.

In the present invention, the transformed plant is inhibited or blocked from binding of the OsOsWRKY55 promoter recognition site P1 region to the TAL effector LJ4 of the rice white leaf blight by introducing a recombinant vector containing the OsWRKY55 promoter variant fragment. The transcriptional activity of the OsWRKY55 promoter induced by this is inhibited, and the resistance of plants to rice white leaf blight bacteria can be improved.

In yet another aspect, the present invention provides a method for enhancing rice white leaf blight resistance of a plant, comprising introducing a recombinant vector containing the OsWRKY55 promoter variant fragment into a plant.

In the present invention, descriptions of the terms "OsWRKY55 promoter variant fragment", "rice white leaf blight", "OsWRKY55 gene", "transformation", and "plant" are as described above.

In the present invention, the term "introducing into a plant" means a step of constructing a recombinant vector including a polynucleotide having a specific nucleotide sequence and transforming the recombinant vector into a plant.

In the present invention, the transformed plant is inhibited or blocked from binding of the OsOsWRKY55 promoter recognition site P1 region to the TAL effector LJ4 of the rice white leaf blight by introducing a recombinant vector containing the OsWRKY55 promoter variant fragment. The transcriptional activity of the OsWRKY55 promoter induced by this is inhibited, and the resistance of plants to rice white leaf blight bacteria can be improved.

According to the present invention, using the RNAi sequence for the OsWRKY55 gene and a mutant of the OsWRKY55 promoter fragment, it is possible to develop rice white leaf blight-resistant crops, as well as to reduce the damage caused by rice white leaf blight. It can be usefully used. In addition, if the OsWRKY55 promoter region that binds to the TAL effector LJ4 gene of rice white leaf blight bacteria is edited (mutated) using gene scissors technology, it can be usefully used to cultivate rice white leaf blight resistant crops.

Figure 1 shows the expression pattern of rice white leaf blight resistance test and disease resistance genes in the overexpression body and expression suppressor of OsWRKY55.1.
Figure 2 is a diagram schematically showing a vector map for plant transformation of TAL effector LJ4 of rice white leaf blight bacteria KACC10331. Here, P35S is the Cauliflower mosaic virus (CaMV) 35S promoter, and DsRed::His is Discosoma sp . red fluorescent protein::6×histidine, Tnos is nopaline sy, Fig. 1 shows the expression pattern of rice white leaf blight resistance test and disease resistance genes in the overexpression and expression suppressor of OsWRKY55. being.
2 is a plant trait of TAL effector LJ4 of rice white leaf blight bacteria KACC10859
It is a diagram schematically showing a vector map for conversion. Here, P35S is a Cauliflower mosaic virus (CaMV) 35S promoter, yellow flourescence protein (YFP), Tnos is a nopaline synthase terminator, Bar is a bialaphos resistance gene, and T35S is a CaMV 35S terminator.
Figure 3 shows the promoter binding site for the OsWRKY55 promoter of LJ4 by chromatin immunopreciptation.
Figure 4 shows the results of promoter activity analysis for the OsWRKY55 promoter in which the LJ4 binding site is modified.
Figure 5 is a diagram showing the amino acid sequence of LJ4 isolated by the TAL effector (transcription activator-like effector) of the rice white leaf blight bacteria Xoo _KXO57 according to an embodiment of the present invention. Here, the amino acid sequence located in the yellow box is a repeat sequence, and the amino acid sequence located in the yellow box indicates the promoter binding domain.

Hereinafter, embodiments of the present invention will be described in detail with reference to the accompanying drawings so that those of ordinary skill in the art can easily implement the present invention. However, the present invention may be implemented in various different forms and is not limited to the embodiments described herein.

<Example 1> Confirmation of resistance to rice white leaf blight of OsWRKY55 transformant

<Example 1-1> OsWRKY55 overexpression transgenic plant production

RNA was extracted from rice leaves and cDNA was synthesized from the extracted RNA. From the cDNA, the OsWRKY55OX-F primer, 5'-CAAAAAAGCAGGCTTGATGTCTCCTGTGCCGAGTC-3' (SEQ ID NO: 27: OsWRKY55OX-F) and OsWRKY55OX-R primer, 5'-AGAAAGCTGGGTTCAAAAAATGAATCTGA-3' (SEQ ID NO: 28: OsWRKY55OX-R) The first PCR was performed, and the PCR product amplified through PCR was attB1 primer-F (5'-GGGGACAAGTTTGTACAAAAAAGCAGGCT-3': SEQ ID NO: 22 below) and attB2 primer-R (5'-GGGGACCACTTTGTACAAGAAAGCTGGGT-3': the following SEQ ID NO: 23) was used to perform the second PCR. After purification, the secondary PCR product was cloned using BP clonase with pDNOR221 vector to prepare an entry clone. From the above entry clone, 35S::YFP-OsWRKY55 was finally produced for the production of overexpressing plants by LR clonase reaction to pEarleygate104, a vector for plant overexpression (destination). OsWRKY55 was derived from virus Cauliflower Mosaic Using the Virus (35S) promoter, a transformant (OsWRKY55OX) overexpressed through Agrobacterium was made in Japan ( Oryza sativa L. ssp. Japonica cv. Ilmi).

<Example 1-2> OsWRKY55 expression inhibition transgenic plant production

Primary PCR was performed from the entry clone of OsWRKY55 using OsWRKY55 RNAi-F primer, 5'-AAAAAAGCAGGCTCTGCACTGAGCTCCAATCTT-3' (SEQ ID NO: 29) and OsWRKY55 RNAi-R primer, 5'-AGAAAGCTGGGTCGGTGACATGCAAGGAAACC-3' (SEQ ID NO: 30). The PCR product amplified through PCR was attB1 primer-F(5'-GGGGACAAGTTTGTACAAAAAAGCAGGCT-3') (SEQ ID NO: 22 below) and attB2 primer-R (5'-GGGGACCACTTTGTACAAGAAAGCTGGGT-3') (SEQ ID NO: 23 below). Second PCR was performed. After purification, the secondary PCR product was cloned using BP clonase with pDNOR221 vector to prepare an entry clone. From the entry clone, a vector for constructing an expression-suppressing transgenic plant was finally constructed by an LR reaction to pB7GWIWG2(ii), which is a vector for gene expression suppression (destination). Oryza sativa L. ssp. Japonica cv. Ilmi) was prepared via Agrobacterium , an OsWRKY55 expression inhibitory transformant (OsWRKY55RNAi) comprising OsWRKY55 RNAi consisting of the nucleotide sequence of SEQ ID NO: 24.

<Example 1-3> Disease reaction analysis of OsWRKY55 overexpression rice and expression suppression rice

In order to confirm the disease resistance of the transformants prepared in Examples 1-1 and 1-2, Xanthomonas oryzae pv. Xoo _KXO576 , a strain of oryzae (XOO) , was inoculated in Japan and the transformant through a scissors-dip method. As a result, it was confirmed that in the case of the overexpression of OsWRKY55, disease resistance decreased and the length of disease occurrence increased (FIG. 1). On the contrary, it was confirmed that the transgenic plant (OsWRKY55RNAi), which reduced the expression of OsWRKY55 through RNAi (RNA interference, RNAi) for OsWRKY55, increased disease resistance and reduced the length of disease occurrence.

Through this, it was found that OsWRKY55 is a disease defense inhibitory gene against Xoo . In other words, it was found that the OsWRKY55 gene showed susceptibility to rice white leaf blight bacteria.

<Example 1-4> Analysis of the expression pattern of disease defense-related genes in OsWRKY55 overexpressing rice and suppressed rice

Japanese rice, OsWRKY55OX, and OsWRKY55RNAi seeds were germinated for 3 days, and the rice 3 weeks old after sowing was secured in a greenhouse. Thereafter, total RNA from rice leaves was isolated using a Trizol reagent kit (Invitrogen, USA), and oligo dT primer and MMLV reverse transcriptase (Promega, USA). ) Was used to synthesize cDNA. OsWRKY55, Chitinase, PR1a, BetV1 qRT-PCR (Quantitative real-time PCR) primers (Table 1) were used to perform qPCR using MyIQ (BioRad, USA).

Sequence number Primer name Primer direction Sequence (5'→3') One OsWRKY55 qRT-PCR-F Forward direction 5'-AGGGGTGCCCTAGTTTGGTA-3' 2 OsWRKY55 qRT-PCR-R Reverse 5'-AGACACACCCGGAGAGAGAA-3' 3 Chitinase qRT-PCR-F Forward direction 5'-TGGGCTATCTCTCGTCCTCT-3' 4 Chitinase qRT-PCR-R Reverse 5'-TTCAGGAACGATTGCCGTGT-3' 5 PR1a qRT-PCR-F Forward direction 5'-GGAAGTACGGCGAGAACATC-3' 6 PR1a qRT-PCR-R Reverse 5'-TGGTCGTACCACTGCTTCTC-3' 7 BetV1 qRT-PCR-F Forward direction 5'-CAGATGATCGAGGCGTACCT-3' 8 BetV1 qRT-PCR-R Reverse 5'-CCACGCCACAGTAACATGAC-3' 9 Osactin qRT-PCR-F Forward direction 5'-ATCCTTGTATGCTAGCGGTCGA-3' 10 Osactin qRT-PCR-R Reverse 5'-ATCCAACCGGAGGATAGCATG-3'

Expression of disease defense genes in OsWRKY55OX (overexpression transformants) and RNAi plants (expression-inhibiting transformants) to analyze the cause of the decreased resistance (or increased susceptibility) seen in OsWRKY55OX and the increased resistance (or decreased susceptibility) seen in OsWRKY55RNAi. Was analyzed. As a result, it was observed that the expression of genes involved in disease resistance such as Chitinase, PR1a, and BetV1 was decreased in OsWRKY55OX and increased in OsWRKY55RNAi plants (FIG. 1). These results show that the OsWRKY55 gene decreases the expression of disease resistance genes, thereby reducing disease resistance. Therefore, it was found that suppressing the expression of the OsWRKY55 gene induces disease defense, which was inhibited by OsWRKY55, and increases resistance to rice white leaf blight.

<Example 2> Investigation of whether Xoo regulates OsWRKY55 gene expression and search for a promoter-binding effector

Pathogens (e.g. Xoo) use host (e.g. rice) genes that can help pathogen growth.Since OsWRKY55 gene is a gene that suppresses disease defense, we investigated whether Xoo uses OsWRKY55 gene for proliferation . For this, as a result of searching using a web program, it was presumed that the LJ4 effector had a high binding potential, and it was confirmed that the gene expression of OsWRKY55 was increased by binding to the promoter of OsWRKY55 through experiments.

<Example 2-1> Preparation of vector for expression of TAL effector LJ4 plant

Xoo has There is a transcription activator-like effector (TALe), which, when combined with a host, enters the host cell through the Type3 secretion system (T3SS) and specifically expresses the host cell's gene, which is a favorable environment for them. Make Xoo _KXO576 was confirmed to have 18 TALes through genome analysis. Among these, the'TATAAAAACCACCACCGCTCT' (SEQ ID NO: 11) part of LJ4 was added to the OsWRKY55 promoter using TAL Effector Nucleotide Targeter 2.0 (https://tale-nt.cac.cornell.edu) to find TALe that may regulate OsWRKY55. It was expected to be combined.

For plant transformation through LR clonase reaction using an invitrogen gateway entry vector including the LJ4 gene sequence (SEQ ID NO: 15) and amino acid sequence (SEQ ID NO: 16) 35S::YFP-LJ4 was made by cloning into the expression vector pEarleygate104 vector (Fig. 2).

TAL effector effector binding element sequence direction LJ4 TATAAAAACCACCACCGCTCT (SEQ ID NO: 11) Reverse

<Example 2-2> TAL effector LJ4 OsWRKY55 promoter binding confirmation and expression increase analysis

Based on the contents of Example 2-1, it was confirmed whether the promoters of LJ4 and OsWRKY55 were bound by using chromatin immunopreciptation. As a result, unlike the control group, it was found that binding to LJ4 was made at the P1 site among the four sites of the promoter of OsWRKY55 (FIG. 3). These results mean that LJ4 specifically binds to the P1 site (AGAGCGGTGGTGGTTTTTAT: SEQ ID NO: 18).

<Example 2-3> Measurement of promoter activity of OsWRKY55 using rice protoplasts

In Example 2-2, it was confirmed that LJ4, one of the TAL effectors of the rice white leaf blight ( Xanthomonas oryzae pv. oryzae ) Xoo _KXO576 , specifically binds to the P1 site of the OsWRKY55 promoter. Promoter assay was performed to determine how this binding affects the promoter activity of OsWRKY55. To this end, the OsWRKY55 promoter containing the P1 region of the OsWRKY55 promoter was isolated to produce a pOsWRKY55::GFP-GUS reporter vector. Specifically, according to the Gateway cloning method, a promoter (SEQ ID NO: 17) of about 1.0 kb from the start codon of OsWRKY55 (Os03g20550.1) was transferred to pOsWRKY55 cloning-F (SEQ ID NO: 20, Table 4) and pOsWRKY55 cloning-R. It was isolated by performing PCR using the primers of (SEQ ID NO: 21, Table 4). Thereafter, attB1 and attB2 primers (SEQ ID NOs: 22 and 23) were used to perform secondary PCR, followed by BP reaction, and cloned into pDONR221 vector. After that, in order to produce a reporter vector, a vector was prepared in the form of (pOsWRKY55::GFP-GUS) through LR reaction to the pBGWFS7 vector.

A promoter assay was performed in rice protoplasts using the prepared vector, and the OsWRKY55 promoter activity according to the binding of the TAL effector LJ4 and the P1 region, which is the recognition site of the OsWRKY55 promoter, was assayed (FIG. 3). As a result, it can be seen that LJ4 increases the promoter activity of OsWRKY55, which leads to the expression of the OsWRKY55 gene and inhibits disease defense, thus increasing the occurrence of rice white leaf blight.

OsWRKY55 promoter cloning primer sequence information Burn primer name Primer direction Sequence (5'→3') pOsWRKY55 cloning-F Forward direction 5'-CAAAAAAGCAGGCTTGATTTCACTTGCAATTTTACT-3' pOsWRKY55 cloning-R Reverse 5'-AGAAAGCTGGGTTGTTTCCAGAGAGAAAGAAA-3'

<Example 3> Preparation of mutant OsWRKY55 promoter and analysis of promoter activity for LJ4

<Example 3-1> Preparation of OsWRKY55 mutant promoter

A promoter of OsWRKY55 including a portion (SEQ ID NO: 19: AGCGCGGTGGTAGTTCTTAT) in which three nucleotides were modified at the site to which LJ4 binds (SEQ ID NO: 11, Table 2) of the OsWRKY55 promoter portion was constructed (pW55m). pW55m was cloned into the entry vector and then cloned into the pBGWFS7 vector in the form of pOsWRKY55::GFP-GUS through LR reaction according to the Gateway cloning method.

Burn primer name Primer direction Sequence (5'→3') attB1-F Forward direction 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCT-3' attB2-R Reverse 5'-GGGGACCACTTTGTACAAGAAAGCTGGGT-3'

From the entry clone, a plant promoter activity assay pOsWRKY55:GFP-GUS reporter vector was finally produced by LR reaction to pBGWFS7, a vector for cloning a plant promoter, by LR clonase reaction.

<Example 3-2> Measurement of mutant OsWRKY55 promoter activity

The normal OsWRKY55 promoter and the mutant promoter cloned in the above example were transfected into the protoplasts derived from the middle embryonic axis of a two-week-old rice using PEG. At this time, the promoter activity of OsWRKY55 was compared with the addition of LJ4, the TAL effector (transcription activator-like effector) of rice white leaf blight XOO _KXO576 , with and without the addition. In addition, Renilla luciferase to which the CAM35S promoter is bound was transfected together for comparison of promoter expression.

The transfected protoplasts were incubated at 28°C for 12 hours, and then the activity of the promoter was analyzed using MUG (4-metylumbelliferyl-bD-glucuronide hydrate). In order to compare the expression in the protoplasts, the activity of Renilla luciferase was determined by Promega. LTD) produced a dual luciferase assay system.

As a result, in the normal promoter (pW55) of OsWRKY55, when LJ4 was expressed together, its activity increased, but in the mutant promoter (pW55m), the activity was hardly changed by LJ4 (Fig. 4). These results indicate that LJ4, one of the TALes of Xoo, binds to the P1 site of the promoter of OsWRKY55 and increases its activity, thereby increasing the expression of OsWRKY55.

Accordingly, by mutating the recognition site of the OsWRKY55 promoter, which specifically binds to the TAL effector LJ4 derived from rice white leaf blight, by controlling the interaction between the TAL effector and the plant, it is possible to develop rice white leaf blight-resistant crops. In addition, rice white leaf blight resistant crops targeting the TAL effector LJ4 can also be easily selected using the recognition site of the OsWRKY55 promoter.

<110> Republic of Korea <120> Defense suppression function of OsWRKY55 gene, or promoter region recognized by the effector of Xanthomonas oryzae pv. oryzae and uses thereof <130> DP20190143 <160> 30 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OsWRKY55 qRT-PCR-F primer <400> 1 aggggtgccc tagtttggta 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OsWRKY55 qRT-PCR-R primer <400> 2 agacacaccc ggagagagaa 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Chitinase qRT-PCR-F primer <400> 3 tgggctatct ctcgtcctct 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Chitinase qRT-PCR-R primer <400> 4 ttcaggaacg attgccgtgt 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PR1a qRT-PCR-F primer <400> 5 ggaagtacgg cgagaacatc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PR1a qRT-PCR-R primer <400> 6 tggtcgtacc actgcttctc 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BetV1 qRT-PCR-F primer <400> 7 cagatgatcg aggcgtacct 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BetV1 qRT-PCR-R primer <400> 8 ccacgccaca gtaacatgac 20 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Osactin qRT-PCR-F primer <400> 9 atccttgtat gctagcggtc ga 22 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Osactin qRT-PCR-R primer <400> 10 atccaaccgg aggatagcat g 21 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> LJ4 binding element sequence <400> 11 tataaaaacc accaccgctc t 21 <210> 12 <211> 40 <212> PRT <213> Artificial Sequence <220> <223> LJ4 RVD sequence <400> 12 Asn Ile His Gly Asn Ile Asn Ile Asn Ile Asn Asn His Asp Asn Ser 1 5 10 15 Asn Asn Asn Ser Asn Asn His Asp Asn Asn Asn Ile His Asp Asn Asn 20 25 30 Asn Ile Asn Gly His Asp Asn Gly 35 40 <210> 13 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> XooKXO576 C genomic PCR-F primer <400> 13 aggcgtcttt gcatgcattc gccgattcgc t 31 <210> 14 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> XooKXO576 C genomic PCR-R primer <400> 14 tcagatcgtc cctccgactg agcctgact 29 <210> 15 <211> 5838 <212> DNA <213> Artificial Sequence <220> <223> LJ4 <400> 15 gcgctcggtg cggatgtagg tgatgtcggc cacccaggct tggtccgcag cactgggctt 60 gaagcgccga tccagaacgt tggccgccac aggcaagtcg tgccggctgt cggtggtgtg 120 ggtgaacttg cgtttccagc gcgccttcag cccgtggcgc ttcatcaggc ggcggacccg 180 gtggcgacca gcgggcaggc cctgggcctt caggctggcg ctcaatcgac ggctgccata 240 gttgccgccg ctggcctgga aggccgtctg caccgctgcc gcaagtacat cagcgcgtgg 300 agccggtcgc cgtcggcgcg ccgcatacac ccccgaacga ctcaccccca gcaaccggca 360 cagccgggcg gttctggcct tctcctgcca ctgctggatc atctgctgga tcacttcagt 420 tcccgggcga agaaggccga cgcttttttt aacaggctgt tgtcctcacg cagccgttgg 480 ttttcccgct ccaattcacg gatgcgttgc tgctcgggcg tcagcggccg gccttgtccc 540 ggctggccgc tctgctcggc ttggtactgg gccaaccagc ggcgcacggc gctatcgacc 600 agatcacagg tcgcggcaca cctgacccac actcagacct tggtctcgga tcatctgcac 660 cacgtgcagc ttgaaggcag tatcgaaatt cctacgcggg cgggatgtca tatcgggttc 720 ggtcctcgtt gggatgatca tcccctatcg aggtgtccac gagaattaga ccaggacatc 780 tacctgcggg acgtactgga gggttggcag ggattcgtat aaaaaacagc caaaagtggg 840 ctaactcgct gtcagcacag aaatttttca caaccctctg ccgatcctcc atgcgggtcc 900 gggatcgcct tcatgtctgc gcctcaccct ggtcgtcgag ggttgccagg atcacccgaa 960 gttgtgtact gccatgcggc ctcggaagct acgtagggac cacagaccgc tagtctggag 1020 gcgaccatgt aaagaggtat gcctgatgga tcccattcgt tcgcgcacgc caagtcctgc 1080 ccgcgagctt ctgcccggac cccaaccgga tagggttcag ccgactgcag atcggggggg 1140 gggctccgcc tgctggcggc cccctggatg gcttgcccgc tcggcggacg atgtcccgga 1200 cccggctgcc atctccccct gcgccctcgc ctgcgttctc ggcgggcagc ttcagcgatc 1260 tgctccgtca gttcgatccg tcgcttcttg atacatcgct tcttgattcg atgcctgccg 1320 tcggcacgcc gcatacagcg gctgccccag cagagtgcga tgaggtgcaa tcgggtctgc 1380 gtgcagccga tgacccgcca cccaccgtgc gtgtcgctgt cactgccgcg cggccgccgc 1440 gcgccaagcc ggccccgcga cggcgtgcgg cgcaaccctc cgacgcttcg ccggccgcgc 1500 aggtggatct acgcacgctc ggctacagtc agcagcagca agagaagatc aaaccgaagg 1560 tgcgttcgac agtggcgcag caccacgagg cactggtggg ccatgggttt acacacgcgc 1620 acatcgttgc gctcagccaa cacccggcag cgttagggac cgttgctgtc acgtatcagg 1680 acataatcag ggcgttgcca gaggcgacac acgaagacat cgttggcgtc ggcaaacagt 1740 ggtccggcgc acgcgccctg gaggccttgc tcacggaggc gggggagttg agaggtccgc 1800 cgttacagtt ggacacaggc caacttctca agattgcaaa acgtggcggc gtgaccgcag 1860 tggaggcagt gcatgcatgg cgcaatgcac tgacgggtgc ccccctgaac ctgaccccgg 1920 accaagtggt ggccatcgcc agcaatattg gcggcaacca ggcgctggag acggtgcagc 1980 ggctgttgcc ggtgctgtgc caggcccatg gcctgacccc ggaccaggtc gtggccatcg 2040 ccagccatgg cggcggcaag caggcgctgg agacggtgca gcggctgttg ccggtgctgt 2100 gccaggacca tggcctgacc ccggaccagg tggtggccat cgccagcaat attggcggca 2160 agcaggcgct ggagacggtg caacggctgt tgccggtgct gtgccaggac catggcctga 2220 ccccggacca ggtggtggcc atcgccagca atattggcgg caagcaggcg ctggagacgg 2280 tgcagcggct gttgccggtg ctgtgccagg accatggcct gaccccggac caggtggtgg 2340 ccatcgccag caatattggc ggcaagcagg cgctggagac ggtgcagcgg ctgttgccgg 2400 tgctgtgcca ggaccatggc ctgaccccgg accaggtggt ggccatcgcc aacaataacg 2460 gcggcaagca ggcgctggag acggtgcaac ggctgttgcc ggtgctgtgc caggaccatg 2520 gcctgacccc ggaccaggtg gtggccatcg ccagccacga tggcggcaag caggcgctgg 2580 agacggtgca gcggctgttg ccggtgctgt gccagggcca tggcctgacc ccggacaagg 2640 tggtggccat cgccagcaat agtggcggca agcaggcgct ggagacggtg cagcggctgt 2700 tgccagtgct gtgccaggcc catggcctga ccccggacaa ggtggtggcc atcgccaaca 2760 ataacggcgg caagcaggcg ctggagacgg tgcagcggct gttgccggtg ctgtgccagg 2820 accatggcct gaccccggac caggtggtgg ccatcgccag caatagtggc ggcaagcagg 2880 cgctggagac ggtgcagcgg ctgttgccgg tgctgtgcca ggaccatggt ctgaccccgg 2940 cccaggtggt ggccatcgcc aacaataacg gcggcaagca ggcgctggag acggtgcggc 3000 ggctgttgcc ggtgctgtgc caggaccatg gcctgacccc ggaccaggtc gtggccatcg 3060 ccagccacga tggcggcaag caggcgctgg agacggtgca gcggctgttg ccggtactgt 3120 gccaggacca tggcctgacc ccggaccagg tggtggccat cgccaacaat aacggcggca 3180 agcaggcgct ggagacggtg cagcggctgt tgccggtgct gtgccaggac catggcctga 3240 cccaggacca ggtggtggcc atcgccagca atattggcgg caagcaggcg ctggagacgg 3300 tgcagcggct gttgccggtg ctgtgccagg accatggcct gaccccggac caggtggtgg 3360 ccatcgccag ccacgatggc ggcaagcagg cgctggagac ggtgcagcgg ctgttgccgg 3420 tgctgtgcca ggaccatggc ctgaccccgg cccaggtggt ggccatcgcc aacaataacg 3480 gcggcaagca ggcgctggag acggtgcagc ggctgttgcc ggtgctgtgc caggaccatg 3540 gcctgagccc ggaccaggtc gtggccatcg ccagcaatat tggcggcaag caggcgctgg 3600 agacggtgca gcggctgttg ccggtgctgt gccaggacca tggcctgacc ccggaccagg 3660 tggtggccat cgccagcaat ggcggcggca agcaggcgct ggagacggtg cagcggctgt 3720 tgccggtgct gtgccaggac catggcctga gcccggacca ggtcgtggcc atcgccagcc 3780 atgatggcgg caagcaggcg ctggagacgg tgcagcggct gttgccggtg ctgtgccagg 3840 accatggcct gaccccggac caggtggtgg ccatcgccag caatggcggc ggcaagcagg 3900 cgctggagag cattgttgcc cagttatctt gccctgatcc ggcgttggcc gcgttgacca 3960 acgaccacct cgtcgccttg gcctgcctcg gcggacgtcc tgccatggat gcagtgaaaa 4020 agggattgcc gcacgcgccg gaattgatca gaagagtcaa tagccgtatt ggcgaacgca 4080 cgtcccatcg cgttgccgac tacgcgcaag tggttcgcgt gctggagttt ttccagtgcc 4140 actcccaccc agcgtacgca tttgatgagg ccatgacgca gttcgggatg agcaggaacg 4200 ggttggtaca gctctttcgc agagtgggcg tcaccgaact cgaagcccgc tgcggaacgc 4260 tccccccagc ctcgcagcgt tgggaccgta tcctccaggc atcagggatg aaaagggcca 4320 aaccgtcccc tacttcagct caaacaccgg atcaggcgtc tttgcatgca ttcgccgatt 4380 cgctggagcg tgaccttgat gcgcccagcc caatgcacga gggagatcag acgcgggcaa 4440 gcagccgtaa acggtcccga tcggatcgtg ctgtcaccgg cccctccgca cagcaatctt 4500 tcgaggtgcg cgttcccgaa cagcgcgatg cgctgcattt gcccctcagc tggagggtaa 4560 aacgcccgcg taccaggatc gggggcggcc tcccggatcc tggtacgccc atcgctgccg 4620 acctggcagc gtccagcacc gtgatgtggg aacaagatgc ggcccccttc gcaggggcag 4680 cggatgattt cccggcattc aacgaagagg agctcgcatg gttgatggag ctattgcctc 4740 agtcaggctc agttggaggg acgatctgag gggcggcagg gattcgagta agaaaccttt 4800 actgacagca agttagctca cttttggctg tgttttacac gaatccctgc cgaccctcta 4860 ctccggcgca ggcgtgaaat gcggttatca gtggtggatc gcgcggggtt cgccgacaga 4920 gcgcgtgtgg tccggcgtac acgtgggcca cgaagtccaa ggcgcaggtg aggcgttatc 4980 cgtaggggcg atgcccctac acccctacaa tcccggagca tcgtcattgg ggaccgtatg 5040 agctacagac cgcagaacaa ccaagatggg ctttggtggg aaatcgccct gggcatcttc 5100 gtcggccagc tgatgaccgc agcgttcgca ggtgtggtgg ccctgtgcct gggctacttc 5160 acgctgcgca gcgtcagcgc aggactaccg gcaccacgat tactgccggt cactccacag 5220 gaagcggact gaacaatgac ctttgacacc tacgagcgcg tagacctgac cggcccttgg 5280 gccggttttg gttttcaggg acatcgattc ttcacaccag aaaattacga catcgagccc 5340 tgcggcatgc ggtactgggc gctgacctgc gccatcgcac gggagtggtc gctgatgatg 5400 tccgaagaac gcaatacgcg ctcggcgacc ccgcgaacgc ctactgccac caggtctccg 5460 gggtcgcgtt tgtctcaagg cgcagaagtg atctacctgc gggacgtact ggagggttgg 5520 cagggattcg tgtaaaaaac agccaaaagt gggctaactc gctgtcagca cagaaatttc 5580 tcacaaccct ctgccgatcc tccatgcggg tccgggatcg ccttcatgtc tgcgcctcac 5640 cctggtcgtc gagggttgcc aggatcaccc gaagttgtgt actgccatgc ggcctcggaa 5700 gctatgtagg gaccacagac cgctagtctg gaggcgacca tgtaaagagg tatgcctgat 5760 ggatcccatt cgttcgcgca cgccaagtcc tgcccgcgag cttctgcccg gaccccaacc 5820 ggatagggtt cagccgac 5838 <210> 16 <211> 1945 <212> PRT <213> Artificial Sequence <220> <223> LJ4 <400> 16 Ala Leu Gly Ala Asp Val Gly Asp Val Gly His Pro Gly Leu Val Arg 1 5 10 15 Ser Thr Gly Leu Glu Ala Pro Ile Gln Asn Val Gly Arg His Arg Gln 20 25 30 Val Val Pro Ala Val Gly Gly Val Gly Glu Leu Ala Phe Pro Ala Arg 35 40 45 Leu Gln Pro Val Ala Leu His Gln Ala Ala Asp Pro Val Ala Thr Ser 50 55 60 Gly Gln Ala Leu Gly Leu Gln Ala Gly Ala Gln Ser Thr Ala Ala Ile 65 70 75 80 Val Ala Ala Ala Gly Leu Glu Gly Arg Leu His Arg Cys Arg Lys Tyr 85 90 95 Ile Ser Ala Trp Ser Arg Ser Pro Ser Ala Arg Arg Ile His Pro Arg 100 105 110 Thr Thr His Pro Gln Gln Pro Ala Gln Pro Gly Gly Ser Gly Leu Leu 115 120 125 Leu Pro Leu Leu Asp His Leu Leu Asp His Phe Ser Ser Arg Ala Lys 130 135 140 Lys Ala Asp Ala Phe Phe Asn Arg Leu Leu Ser Ser Arg Ser Arg Trp 145 150 155 160 Phe Ser Arg Ser Asn Ser Arg Met Arg Cys Cys Ser Gly Val Ser Gly 165 170 175 Arg Pro Cys Pro Gly Trp Pro Leu Cys Ser Ala Trp Tyr Trp Ala Asn 180 185 190 Gln Arg Arg Thr Ala Leu Ser Thr Arg Ser Gln Val Ala Ala His Leu 195 200 205 Thr His Thr Gln Thr Leu Val Ser Asp His Leu His His Val Gln Leu 210 215 220 Glu Gly Ser Ile Glu Ile Pro Thr Arg Ala Gly Cys His Ile Gly Phe 225 230 235 240 Gly Pro Arg Trp Asp Asp His Pro Leu Ser Arg Cys Pro Arg Glu Leu 245 250 255 Asp Gln Asp Ile Tyr Leu Arg Asp Val Leu Glu Gly Trp Gln Gly Phe 260 265 270 Val *** Lys Thr Ala Lys Ser Gly Leu Thr Arg Cys Gln His Arg Asn 275 280 285 Phe Ser Gln Pro Ser Ala Asp Pro Pro Cys Gly Ser Gly Ile Ala Phe 290 295 300 Met Ser Ala Pro His Pro Gly Arg Arg Gly Leu Pro Gly Ser Pro Glu 305 310 315 320 Val Val Tyr Cys His Ala Ala Ser Glu Ala Thr *** Gly Pro Gln Thr 325 330 335 Ala Ser Leu Glu Ala Thr Met *** Arg Gly Met Pro Asp Gly Ser His 340 345 350 Ser Phe Ala His Ala Lys Ser Cys Pro Arg Ala Ser Ala Arg Thr Pro 355 360 365 Thr Gly *** Gly Ser Ala Asp Cys Arg Ser Gly Gly Ala Pro Pro Ala 370 375 380 Gly Gly Pro Leu Asp Gly Leu Pro Ala Arg Arg Thr Met Ser Arg Thr 385 390 395 400 Arg Leu Pro Ser Pro Pro Ala Pro Ser Pro Ala Phe Ser Ala Gly Ser 405 410 415 Phe Ser Asp Leu Leu Arg Gln Phe Asp Pro Ser Leu Leu Asp Thr Ser 420 425 430 Leu Leu Asp Ser Met Pro Ala Val Gly Thr Pro His Thr Ala Ala Ala 435 440 445 Pro Ala Glu Cys Asp Glu Val Gln Ser Gly Leu Arg Ala Ala Asp Asp 450 455 460 Pro Pro Pro Thr Val Arg Val Ala Val Thr Ala Ala Arg Pro Pro Arg 465 470 475 480 Ala Lys Pro Ala Pro Arg Arg Arg Ala Ala Gln Pro Ser Asp Ala Ser 485 490 495 Pro Ala Ala Gln Val Asp Leu Arg Thr Leu Gly Tyr Ser Gln Gln Gln 500 505 510 Gln Glu Lys Ile Lys Pro Lys Val Arg Ser Thr Val Ala Gln His His 515 520 525 Glu Ala Leu Val Gly His Gly Phe Thr His Ala His Ile Val Ala Leu 530 535 540 Ser Gln His Pro Ala Ala Leu Gly Thr Val Ala Val Thr Tyr Gln Asp 545 550 555 560 Ile Ile Arg Ala Leu Pro Glu Ala Thr His Glu Asp Ile Val Gly Val 565 570 575 Gly Lys Gln Trp Ser Gly Ala Arg Ala Leu Glu Ala Leu Leu Thr Glu 580 585 590 Ala Gly Glu Leu Arg Gly Pro Pro Leu Gln Leu Asp Thr Gly Gln Leu 595 600 605 Leu Lys Ile Ala Lys Arg Gly Gly Val Thr Ala Val Glu Ala Val His 610 615 620 Ala Trp Arg Asn Ala Leu Thr Gly Ala Pro Leu Asn Leu Thr Pro Asp 625 630 635 640 Gln Val Val Ala Ile Ala Ser Asn Ile Gly Gly Asn Gln Ala Leu Glu 645 650 655 Thr Val Gln Arg Leu Leu Pro Val Leu Cys Gln Ala His Gly Leu Thr 660 665 670 Pro Asp Gln Val Val Ala Ile Ala Ser His Gly Gly Gly Lys Gln Ala 675 680 685 Leu Glu Thr Val Gln Arg Leu Leu Pro Val Leu Cys Gln Asp His Gly 690 695 700 Leu Thr Pro Asp Gln Val Val Ala Ile Ala Ser Asn Ile Gly Gly Lys 705 710 715 720 Gln Ala Leu Glu Thr Val Gln Arg Leu Leu Pro Val Leu Cys Gln Asp 725 730 735 His Gly Leu Thr Pro Asp Gln Val Val Ala Ile Ala Ser Asn Ile Gly 740 745 750 Gly Lys Gln Ala Leu Glu Thr Val Gln Arg Leu Leu Pro Val Leu Cys 755 760 765 Gln Asp His Gly Leu Thr Pro Asp Gln Val Val Ala Ile Ala Ser Asn 770 775 780 Ile Gly Gly Lys Gln Ala Leu Glu Thr Val Gln Arg Leu Leu Pro Val 785 790 795 800 Leu Cys Gln Asp His Gly Leu Thr Pro Asp Gln Val Val Ala Ile Ala 805 810 815 Asn Asn Asn Gly Gly Lys Gln Ala Leu Glu Thr Val Gln Arg Leu Leu 820 825 830 Pro Val Leu Cys Gln Asp His Gly Leu Thr Pro Asp Gln Val Val Ala 835 840 845 Ile Ala Ser His Asp Gly Gly Lys Gln Ala Leu Glu Thr Val Gln Arg 850 855 860 Leu Leu Pro Val Leu Cys Gln Gly His Gly Leu Thr Pro Asp Lys Val 865 870 875 880 Val Ala Ile Ala Ser Asn Ser Gly Gly Lys Gln Ala Leu Glu Thr Val 885 890 895 Gln Arg Leu Leu Pro Val Leu Cys Gln Ala His Gly Leu Thr Pro Asp 900 905 910 Lys Val Val Ala Ile Ala Asn Asn Asn Gly Gly Lys Gln Ala Leu Glu 915 920 925 Thr Val Gln Arg Leu Leu Pro Val Leu Cys Gln Asp His Gly Leu Thr 930 935 940 Pro Asp Gln Val Val Ala Ile Ala Ser Asn Ser Gly Gly Lys Gln Ala 945 950 955 960 Leu Glu Thr Val Gln Arg Leu Leu Pro Val Leu Cys Gln Asp His Gly 965 970 975 Leu Thr Pro Ala Gln Val Val Ala Ile Ala Asn Asn Asn Gly Gly Lys 980 985 990 Gln Ala Leu Glu Thr Val Arg Arg Leu Leu Pro Val Leu Cys Gln Asp 995 1000 1005 His Gly Leu Thr Pro Asp Gln Val Val Ala Ile Ala Ser His Asp Gly 1010 1015 1020 Gly Lys Gln Ala Leu Glu Thr Val Gln Arg Leu Leu Pro Val Leu Cys 1025 1030 1035 1040 Gln Asp His Gly Leu Thr Pro Asp Gln Val Val Ala Ile Ala Asn Asn 1045 1050 1055 Asn Gly Gly Lys Gln Ala Leu Glu Thr Val Gln Arg Leu Leu Pro Val 1060 1065 1070 Leu Cys Gln Asp His Gly Leu Thr Gln Asp Gln Val Val Ala Ile Ala 1075 1080 1085 Ser Asn Ile Gly Gly Lys Gln Ala Leu Glu Thr Val Gln Arg Leu Leu 1090 1095 1100 Pro Val Leu Cys Gln Asp His Gly Leu Thr Pro Asp Gln Val Val Ala 1105 1110 1115 1120 Ile Ala Ser His Asp Gly Gly Lys Gln Ala Leu Glu Thr Val Gln Arg 1125 1130 1135 Leu Leu Pro Val Leu Cys Gln Asp His Gly Leu Thr Pro Ala Gln Val 1140 1145 1150 Val Ala Ile Ala Asn Asn Asn Gly Gly Lys Gln Ala Leu Glu Thr Val 1155 1160 1165 Gln Arg Leu Leu Pro Val Leu Cys Gln Asp His Gly Leu Ser Pro Asp 1170 1175 1180 Gln Val Val Ala Ile Ala Ser Asn Ile Gly Gly Lys Gln Ala Leu Glu 1185 1190 1195 1200 Thr Val Gln Arg Leu Leu Pro Val Leu Cys Gln Asp His Gly Leu Thr 1205 1210 1215 Pro Asp Gln Val Val Ala Ile Ala Ser Asn Gly Gly Gly Lys Gln Ala 1220 1225 1230 Leu Glu Thr Val Gln Arg Leu Leu Pro Val Leu Cys Gln Asp His Gly 1235 1240 1245 Leu Ser Pro Asp Gln Val Val Ala Ile Ala Ser His Asp Gly Gly Lys 1250 1255 1260 Gln Ala Leu Glu Thr Val Gln Arg Leu Leu Pro Val Leu Cys Gln Asp 1265 1270 1275 1280 His Gly Leu Thr Pro Asp Gln Val Val Ala Ile Ala Ser Asn Gly Gly 1285 1290 1295 Gly Lys Gln Ala Leu Glu Ser Ile Val Ala Gln Leu Ser Cys Pro Asp 1300 1305 1310 Pro Ala Leu Ala Ala Leu Thr Asn Asp His Leu Val Ala Leu Ala Cys 1315 1320 1325 Leu Gly Gly Arg Pro Ala Met Asp Ala Val Lys Lys Gly Leu Pro His 1330 1335 1340 Ala Pro Glu Leu Ile Arg Arg Val Asn Ser Arg Ile Gly Glu Arg Thr 1345 1350 1355 1360 Ser His Arg Val Ala Asp Tyr Ala Gln Val Val Arg Val Leu Glu Phe 1365 1370 1375 Phe Gln Cys His Ser His Pro Ala Tyr Ala Phe Asp Glu Ala Met Thr 1380 1385 1390 Gln Phe Gly Met Ser Arg Asn Gly Leu Val Gln Leu Phe Arg Arg Val 1395 1400 1405 Gly Val Thr Glu Leu Glu Ala Arg Cys Gly Thr Leu Pro Pro Ala Ser 1410 1415 1420 Gln Arg Trp Asp Arg Ile Leu Gln Ala Ser Gly Met Lys Arg Ala Lys 1425 1430 1435 1440 Pro Ser Pro Thr Ser Ala Gln Thr Pro Asp Gln Ala Ser Leu His Ala 1445 1450 1455 Phe Ala Asp Ser Leu Glu Arg Asp Leu Asp Ala Pro Ser Pro Met His 1460 1465 1470 Glu Gly Asp Gln Thr Arg Ala Ser Ser Arg Lys Arg Ser Arg Ser Asp 1475 1480 1485 Arg Ala Val Thr Gly Pro Ser Ala Gln Gln Ser Phe Glu Val Arg Val 1490 1495 1500 Pro Glu Gln Arg Asp Ala Leu His Leu Pro Leu Ser Trp Arg Val Lys 1505 1510 1515 1520 Arg Pro Arg Thr Arg Ile Gly Gly Gly Leu Pro Asp Pro Gly Thr Pro 1525 1530 1535 Ile Ala Ala Asp Leu Ala Ala Ser Ser Thr Val Met Trp Glu Gln Asp 1540 1545 1550 Ala Ala Pro Phe Ala Gly Ala Ala Asp Asp Phe Pro Ala Phe Asn Glu 1555 1560 1565 Glu Glu Leu Ala Trp Leu Met Glu Leu Leu Pro Gln Ser Gly Ser Val 1570 1575 1580 Gly Gly Thr Ile *** Gly Ala Ala Gly Ile Arg Val Arg Asn Leu Tyr 1585 1590 1595 1600 *** Gln Gln Val Ser Ser Leu Leu Ala Val Phe Tyr Thr Asn Pro Cys 1605 1610 1615 Arg Pro Ser Thr Pro Ala Gln Ala *** Asn Ala Val Ile Ser Gly Gly 1620 1625 1630 Ser Arg Gly Val Arg Arg Gln Ser Ala Cys Gly Pro Ala Tyr Thr Trp 1635 1640 1645 Ala Thr Lys Ser Lys Ala Gln Val Arg Arg Tyr Pro *** Gly Arg Cys 1650 1655 1660 Pro Tyr Thr Pro Thr Ile Pro Glu His Arg His Trp Gly Pro Tyr Glu 1665 1670 1675 1680 Leu Gln Thr Ala Glu Gln Pro Arg Trp Ala Leu Val Gly Asn Arg Pro 1685 1690 1695 Gly His Leu Arg Arg Pro Ala Asp Asp Arg Ser Val Arg Arg Cys Gly 1700 1705 1710 Gly Pro Val Pro Gly Leu Leu His Ala Ala Gln Arg Gln Arg Arg Thr 1715 1720 1725 Thr Gly Thr Thr Ile Thr Ala Gly His Ser Thr Gly Ser Gly Leu Asn 1730 1735 1740 Asn Asp Leu *** His Leu Arg Ala Arg Arg Pro Asp Arg Pro Leu Gly 1745 1750 1755 1760 Arg Phe Trp Phe Ser Gly Thr Ser Ile Leu His Thr Arg Lys Leu Arg 1765 1770 1775 His Arg Ala Leu Arg His Ala Val Leu Gly Ala Asp Leu Arg His Arg 1780 1785 1790 Thr Gly Val Val Ala Asp Asp Val Arg Arg Thr Gln Tyr Ala Leu Gly 1795 1800 1805 Asp Pro Ala Asn Ala Tyr Cys His Gln Val Ser Gly Val Ala Phe Val 1810 1815 1820 Ser Arg Arg Arg Ser Asp Leu Pro Ala Gly Arg Thr Gly Gly Leu Ala 1825 1830 1835 1840 Gly Ile Arg Val Lys Asn Ser Gln Lys Trp Ala Asn Ser Leu Ser Ala 1845 1850 1855 Gln Lys Phe Leu Thr Thr Leu Cys Arg Ser Ser Met Arg Val Arg Asp 1860 1865 1870 Arg Leu His Val Cys Ala Ser Pro Trp Ser Ser Arg Val Ala Arg Ile 1875 1880 1885 Thr Arg Ser Cys Val Leu Pro Cys Gly Leu Gly Ser Tyr Val Gly Thr 1890 1895 1900 Thr Asp Arg *** Ser Gly Gly Asp His Val Lys Arg Tyr Ala *** Trp 1905 1910 1915 1920 Ile Pro Phe Val Arg Ala Arg Gln Val Leu Pro Ala Ser Phe Cys Pro 1925 1930 1935 Asp Pro Asn Arg Ile Gly Phe Ser Arg 1940 1945 <210> 17 <211> 1000 <212> DNA <213> Artificial Sequence <220> <223> OsWRKY55 promoter <400> 17 atctatctat ctatctatct atctatctat ctatctatct atctatttat ctatcaaatt 60 tatgatctac tatcaatcta tcctggctat agtatattca tggtgcattg ccatcagcat 120 tttcacttgc aattttacta ccaaaaaaaa aagcacattt actgcttcag gcttgcagtg 180 ccacttgatg catcaactgg ctgctatcat cgtgatgcat tcatcaactg gccgctatca 240 tcgtgatgca cataacgtct gtactgccaa tctctacaaa aatatcccca gtggccgggc 300 aatgcatccg cccagttgcc acgcgcccct tttaactaag acccctattg gaggcaaagc 360 acagtacatc actggtgaga tcattttccg ggtcctaaat taggcgaaaa gcgggagatt 420 ccttgctgcc tcaacttgtc ctgcagcatg tgcaggtctt taaaaaaacc atcgatatgc 480 gttaggtatc agctaatctc cctccccaag caacgagacg attcctgcct ctggctttgt 540 gaggcaaagg aaagaatcag gtcaagtcca actagtttat aattaatcaa ttatctaagc 600 aatcaccaac gcaccggggc aggcttccat tctggccaag atttgtgaac tggtccggcc 660 gattatataa tcaatttgcc cgagttccaa tcaaagcaat taattaacca tttaatcgcc 720 ccaagttgct agatcgatga cagtgcttag tccttaaaaa aacggggtga cacatcattt 780 tgaggccact tgtagctcct atgtgtgtcc ggggcctttg aagaagctgc aaagaaattt 840 ctcaagtcgc cccgtcggtg cgcgggagca cgtgacagcg atacggggag aggagaagat 900 aatctttgca tcgtttttgg tcttcagctt agagagcggt ggtggttttt atatggtgat 960 aagggcctca attatggagc tctttgatgt tttaagctaa 1000 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OsWRKY55 promoter P1 region <400> 18 agagcggtgg tggtttttat 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OsWRKY55 promoter P1 region mutant <400> 19 agcgcggtgg tagttcttat 20 <210> 20 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> pOsWRKY55 cloning-F primer <400> 20 caaaaaagca ggcttgattt cacttgcaat tttact 36 <210> 21 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> pOsWRKY55 cloning-R primer <400> 21 agaaagctgg gttgtttcca gagagaaaga aa 32 <210> 22 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> attB1-F primer <400> 22 ggggacaagt ttgtacaaaa aagcaggct 29 <210> 23 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> attB2-R primer <400> 23 ggggaccact ttgtacaaga aagctgggt 29 <210> 24 <211> 228 <212> DNA <213> Artificial Sequence <220> <223> OsWRKY55 RNAi <400> 24 ctgcactgag ctccaatctt gcagcaccga atgtcaggat gcattttcag ctggtacgat 60 tcctgaagag acagtagatg caggaagatt tggttctatc agattcttcc attttttgta 120 aatgaattaa tggaagacag tttattttat ttcaaagagc taatatgata cacatgtttt 180 ttcctctaca ccctcaaaga gtatgagagg ttttccttgc atgtcacc 228 <210> 25 <211> 633 <212> DNA <213> Artificial Sequence <220> <223> OsWRKY55 <400> 25 atgtctcctg tgccgagtcc gcatcaatca caccatctag gccatggctc aaggaaagag 60 aagcgcatga ggaaggtgga tacctttgcg ccgcacaacg acggccacca gtggaggaag 120 tacggcgaga agaagataaa caactgtaat ttccccagat actactacag atgcacctat 180 aaagataaca tgaattgccc agcaacgaag cagattcagc agaaagatta tagtgatcca 240 ccattgtact cagtcaccta ctacaatgag catacatgta atagtgcttt tcttcctctt 300 agcccctcag agttccagct gcagactgca tctgggaagg cagtctccat ctgctttgaa 360 tcatctgggg ctcaagaacc aatgaccaat gccagctcac cttcttcaag cgcagcacgg 420 cgtagcacac cttcagagaa caagaatcag cctcttccac ggcattcgga agcctattct 480 tggggggttg gtgttgtaga acaaaagccg tcctgcactg agctccaatc ttgcagcacc 540 gaatgtcagg atgcattttc agctggtacg attcctgaag agacagtaga tgcaggaaga 600 tttggttcta tcagattctt ccattttttg taa 633 <210> 26 <211> 210 <212> PRT <213> Artificial Sequence <220> <223> OsWRKY55 <400> 26 Met Ser Pro Val Pro Ser Pro His Gln Ser His His Leu Gly His Gly 1 5 10 15 Ser Arg Lys Glu Lys Arg Met Arg Lys Val Asp Thr Phe Ala Pro His 20 25 30 Asn Asp Gly His Gln Trp Arg Lys Tyr Gly Glu Lys Lys Ile Asn Asn 35 40 45 Cys Asn Phe Pro Arg Tyr Tyr Tyr Arg Cys Thr Tyr Lys Asp Asn Met 50 55 60 Asn Cys Pro Ala Thr Lys Gln Ile Gln Gln Lys Asp Tyr Ser Asp Pro 65 70 75 80 Pro Leu Tyr Ser Val Thr Tyr Tyr Asn Glu His Thr Cys Asn Ser Ala 85 90 95 Phe Leu Pro Leu Ser Pro Ser Glu Phe Gln Leu Gln Thr Ala Ser Gly 100 105 110 Lys Ala Val Ser Ile Cys Phe Glu Ser Ser Gly Ala Gln Glu Pro Met 115 120 125 Thr Asn Ala Ser Ser Pro Ser Ser Ser Ala Ala Arg Arg Ser Thr Pro 130 135 140 Ser Glu Asn Lys Asn Gln Pro Leu Pro Arg His Ser Glu Ala Tyr Ser 145 150 155 160 Trp Gly Val Gly Val Val Glu Gln Lys Pro Ser Cys Thr Glu Leu Gln 165 170 175 Ser Cys Ser Thr Glu Cys Gln Asp Ala Phe Ser Ala Gly Thr Ile Pro 180 185 190 Glu Glu Thr Val Asp Ala Gly Arg Phe Gly Ser Ile Arg Phe Phe His 195 200 205 Phe Leu 210 <210> 27 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> OsWRKY55OX-F primer <400> 27 caaaaaagca ggcttgatgt ctcctgtgcc gagtc 35 <210> 28 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> OsWRKY55OX-R primer <400> 28 agaaagctgg gttcaaaaaa tgaatctga 29 <210> 29 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> OsWRKY55 RNAi-F primer <400> 29 aaaaaagcag gctctgcact gagctccaat ctt 33 <210> 30 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> OsWRKY55 RNAi-R primer <400> 30 agaaagctgg gtcggtgaca tgcaaggaaa cc 32

Claims (17)

Recombinant vector for enhancing rice white leaf blight resistance, including RNAi (ribonucleic acid interference) represented by the nucleotide sequence of SEQ ID NO: 24 for OsWRKY55 gene. delete A plant transformed with the recombinant vector of claim 1. A method for producing a transgenic plant with improved resistance to white leaf blight disease, comprising the step of transforming the plant with the recombinant vector of claim 1. A method for enhancing rice white leaf blight resistance of a plant comprising the step of introducing the recombinant vector of claim 1 into a plant. delete delete delete delete delete delete delete delete delete delete delete delete

Images