NZ260511A - Inducing cell specific necrosis by transformation with chimeric genes to provide enhanced resistance to disease-causing agents - Google Patents

Description

Patents Form 5 Priority J.s| S )S3.- i Cosnplatfl Sp^^i'A !i- n ■ J C'-xsx: (5)..ftQ!.KI./.QO.C i3 Nl.l5./.Q5,.£2,5S,.(p^ 82 : f'uivftcailan D; ^ :v0, A>^i-3i' — N.Z. No.

NEW ZEALAND Patents Act 1953 COMPLETE SPECIFICATION CELL SPECIFIC NECROSIS We, ADVANCED TECHNOLOGIES (CAMBRIDGE) LIMITED, a British company whose registered address is Millbank, Knowle Green, Staines, Middlesex TW18 1DY, England do hereby declare the invention, for which we pray that a patent may be granted to us, and the method by which it is to be performed, to be particularly described in and by the following statement:- - 1 - (Followed by 1A) 1 A Cell Specific Necrosis The subject invention relates to the induction of cell specific necrosis as a mode of, for example, providing for an enhanced resistance to disease-causing agents in plants.

It has been proposed in WO 89/10396 to transform plants using a construct comprising a tissue specific promoter and a gene which encodes RNA or a polypeptide which, when produced in the cell for which the promoter is specific, disturbs significantly the metabolism of the cell. In EP 412 911 there is disclosed a procedure in which such metabolism disturbance is countered by the expression of a second RNA or polypeptide and as is disclosed in WO 92/21757, somewhat similar technology has been proposed in relation to the stated object of rendering plants nematode resistant. EP 53 7 3 99 too provides a disclosure of a disruption/inhibition mechanism.

The subject invention provides a method of inducing a necrotic effect in a specific cell of an organism, wherein an organism is transformed with two chimaeric genes, a coding sequence of one of said genes coding for a first, cell necrotic molecule, and a coding sequence of the other of said genes coding for a second molecule, which second molecule is an inhibitor of the necrotic action of said first molecule, each of said two genes comprising a promoter, which promoters act conjointly, in response to the application of a specific stimulus to said organism, 2 so that i) the necrotic action on said cell of said first molecule is not inhibited and ii) the expression of the first and second molecules in other cells (which other cells are required, for a healthy condition of the organism, not to suffer necrosis) is such that in said other cells necrotic action of the first molecule on said other cells is inhibited.

It is an advantage of the subject invention that cell specific necrosis can be achieved without the provision of a cell specific promoter. That is to say, cell specific necrosis can be achieved by utilising two promoters, of which promoters neither of itself is capable of directing cell specific expression. However, the overlapping expression characteristics of the two promoters and the respective responses thereof to the said stimulus are such as to effect the direction of the expression of an effector gene and an inhibitor therefor so that a lethal imbalance of the said two molecules is produced in, and only in, the specific cell(s).

The organism may be a plant.

It may be that until the stimulus is applied to the organism, to the specific cell for example, there is no expression of the first molecule in the specific cell. In such case, upon application of the stimulus, the conjoint action of the promoters ensures that in the specific cell the relative levels of the first and second molecules is such that the necrotic effect of the first molecule is not inhibited. Similarly, it may be that before the stimulus is applied there is no expression of the first molecule in the said other cells. In such case the conjoint action of the two promoters ensures that after application of the stimulus the relative levels of the first and second molecules in the other cells is such that the necrotic effect of said first molecule is inhibited.

If before application of the stimulus there is expression of the first molecule in the specific cell, the conjoint action of the two promoters ensures that upon application of the stimulus the relative levels of the first and second molecules in the specific cell change so that there is a switch from a state in which the necrotic action of the first molecule is inhibited to a state in which it is no longer inhibited.

If before application of the stimulus there is expression of the first molecule in the said other cells, the relative levels of the first and second molecules in the said other cells will, both before and after application of the stimulus, be such that the necrotic action of the first molecule on the said other cells is inhibited.

As will be apparent to one skilled in the art, changes in the relative levels of the first and second molecules in the specific cell upon the application of said stimulus may be effected by an increased level of activity of the promoter of the chimaeric gene containing the gene coding for the first molecule and/or by a decreased level of activity of the promoter of the other chimaeric gene. It is also possible, of course, for the levels of the first and second molecules to both be increased or to both be decreased, so long as the relative changes in levels results in the necrotic action of the first molecule being no longer inhibited by the second molecule in said specific cell.

Diagrams A-F of Figure 1 of the drawings hereof show, by way of example, expression levels (y-axis) of the first molecule (hatched bars) and the second molecule (unhatched bars). Diagram A represents relative expression levels in a target (specific) cell which has been transformed in accordance with the subject invention, as might exist before application of the said stimulus. Diagram A might also represent the relative levels in cells other than the target cell(s) both before and after application of the said stimulus. Diagrams B-F represent differing relative levels of the first molecule and the inhibitor second molecule in a target cell(s) after application of the said stimulus. The arrows indicate increases or decreases in expression level relative to the respective levels of Diagram A. It is to be noted that in each of Diagrams B-F the first molecule has been expressed in excess of the inhibitor. Thus in each case necrosis takes place in the target cell(s).

In carrying the subject invention into effect, the first molecule may be RNase and the second may be RNase inhibitor.

Other examples of first and second molecules are: restriction endonucleases and respective DNA modification enzymes; proteases and respective protease inhibitors; and antisense and sense RNAs for key regulatory or structural genes.

The said stimulus in respect of the subject invention as applied to a plant may be constituted by a pathogenic attack.

As will be realised by those skilled in the art, the subject invention has widespread application throughout the plant kingdom for protection from attack by, for example, fungi, nematodes, bacteria and viruses, and for other purposes.

The subject invention may be utilised as a mode of selectively destroying or arresting the development of specific plant elements, thorns, axillary shoots, inflorescenses or stinging hairs for example. In such cases the said stimulus could come to be applied as a result of the natural development of the plant or by the application of an artificial stimulus such as a chemical applied to the plant.

It is to be understood that, as used herein, the term "necrotic effect" embraces the concept of substantial impairment of metabolism such that the objective, e.g. disease protection, of employing the subject invention is attained.

As will also be realised by those skilled in the art, the subject inventive concept may have application in other than the plant kingdom.

A preferred procedure for carrying out the subject invention, using the example of root knot nematode infection of tobacco plants, will now be described.

Growth and Infection of tobacco plants Seeds of C319 tobacco are germinated on Fisons F1 compost under conditions as follows. Light intensity of 4500 to 5000 lux, with 16 hour periods of light alternating with 8 hour periods of darkness, and temperatures between 20°C and 25 °C. After c. 3 weeks seedlings are gently washed in tap water to remove soil and transferred to pouches (2 plants per pouch; Northrup-King) and grown for a further week in a Conviron at 25°C and with a light intensity of 5500 lux for 16 hour periods alternating with 8 hour periods of darkness. Roots are lifted from the back of the pouch and supported with Whatman GF/A glass fibre paper at their tips. Three day old nematodes (M. javanica) are then delivered to the tips of these roots in 10/il (50 nematodes) aliquots and a second piece of GF/A paper is placed on top to fully encapsulate the root tip. Following 24 hours post infection, the GF/A paper is removed to ensure synchronous infection. Following 3 days post infection the knots are dissected out (leaving healthy root and root tip tissue behind) and frozen immediately in liquid nitrogen. Approximately 0.5 to lg of infected root tissue can be harvested from 8 0 inoculated plants.

Staining for visualisation of nematodes in infected root3 To establish the quality of the infection the number of nematodes (infecting) per root tip is determined. Roots are harvested from 3 day post infected plants and immersed for 90 seconds in lactophenol containing 0.1% Cotton Blue at 95°C. Following a 5 second rinse in water, 7 the roots are placed in lactophenol at room temperature (RT) for 3-4 days to clear. Stained nematodes are then visualised using light microscopy.

RNA isolation from healthy and infected root tissue Root tissue is ground to a fine powder in a chilled (liquid nitrogen) pestle and mortar. About lOOmg aliquots are then transferred to similarly chilled Eppendorf tubes and 300/il of hot phenol extraction buffer added (50% phenol, 50% extraction buffer : 0.1M lithium chloride, 0.1M Tris-HCl pH8.0 (RT), 10mM EDTA, 1% SDS) and incubated at 80°C for 5 mins. An equal volume of chloroform is then added and the homogenate microfuged for 15 minutes at 4°C. The aqueous phase is then extracted with 600/zl of phenol/chloroform and microfuged as above. Following this, the aqueous phase is again removed and then the RNA precipitated with an equal volume of lithium chloride at 4°C overnight. The precipitate is pelleted by microfuging for 15 minutes at RT and washed in 70% ethanol. The pellet is then lyophilised, resuspended in DEPC treated water and assayed using a spectrophotometer. RNA quality is assessed by denaturing gel electrophoresis. (Adapted from Shirzadegan et al 1991) .

Subtractive cloning of infection specific cDNAs Poly (A)+ RNA (mRNA) is isolated from 200/ug total RNA samples from healthy and infected C319 root tissue using magnetic oligo dT Dynabeads according to the manufacturer's instructions. First strand cDNA synthesis is performed in situ on the Dynabead bound poly (A) + fraction from the healthy tissue. This is the Driver DNA. 8 First and second strand synthesis is performed in situ on the Dynabead bound poly (A) + fraction from the infected tissue. This is the Target DNA. All cDNA reactions are carried out using Pharmacia's cDNA synthesis kit and according to the manufacturer's instructions. Three oligonucleotides, SUB21 (5•CTCTTGCTTGAATTCGGACTA3 ') , SUB25(5'TAGTCCGAATTCAAGCAAGAGCACA3') (sequences from Duguid & Dinauer, 1990) and LDT15 (51GACAGAAGCGGATCCd(T)153') (O'Reilly et al, 1991) are kinased with T4 polynucleotide kinase according to Maniatis et al, (1982). SUB21 and SUB25 are then annealed to form a linker which is then ligated to the target DNA with T4 DNA ligase according to King & Blakesley (1986) . Following this, the beads carrying the Target are washed extensively with TE and the second strand of the cDNA eluted at 95°C in 5xSSC.

The RNA bound to the Dynabead bound Driver DNA is removed by heat and the eluted Target DNA hybridised to the Driver DNA at 55°C in 5 x SSC for 5 hours. Non-hybridising Target DNA is separated from the bead bound driver DNA at room temperature following the manufacturer's instructions, following which, hybridising Target DNA is similarly separated from the bead bound Driver DNA at 95°C. The RT eluted Target DNA is then added back to the Driver DNA and the hybridisation repeated. This process is repeated until the amount of Target hybridising to the Driver no longer exceeds the amount that does not hybridise. DNA concentrations are 9 established using Invitrogen's DNA Dipstick in accordance with the manufacturer's instructions.

Aliquots of the final RT eluted fraction are used in PGR amplification (Eckert et al, 1990) to generate double stranded cDNA for cloning into a plasmid vector. Amplification of the Target DNA is achieved using the primers SUB21 and LDT15 and a Hybaid Thermal Cycler according to the conditions described by Frohman et al, 1988. The PCR products are then ligated into Smal digested pBluescript vector according to King & Blakesley (1986).

Screening of the subtractive library bv Reverse Northern analysis Recombinants are identified by colony PCR (Gussow & Clackson, 1989). The amplified inserts are Southern blotted in triplicate onto Pall Biodyne membranes as described by the membrane manufacturer. Prehybridisation and hybridisation are carried out with the same temperature and buffer which are 42°C and 5 x SSPE,0.05% BLOTTO,50% formamide. These are hybridised separately to cDNA probes (see below) from healthy and infected tissue and to a probe comprising amplified Target DNA from the final subtraction. Clones that show a hybridisation signal to the infected cDNA probe only or that show a hybridisation signal to the subtracted probe but not the cDNA probes are selected for further analysis. cDNA probe generation To achieve high specific activity probes for differential screening, cDNA synthesis is conducted 'cold' on total RNA and the synthesis products then labelled by oligolabelling. Samples of lOjug total RNA from healthy and infected tissue are first treated with 2.5 units DNase 1 at 37°C for 15 minutes. The DNase is then denatured at 95°C for 10 minutes before cDNA synthesis is performed (standard Pharmacia protocol). The RNA is then removed in the presence of 0.4M sodium hydroxide for 10 minutes at RT and the DNA purified through a spun Sephacryl 400HR column. cDNA yield and concentration are determined using DNA Dipsticks (Invitrogen) . The cDNA products are then labelled as for Pharmacia's standard oligolabelling protocol (c. 35ng/probe).

Northern blotting To determine the expression profile of the cDNAs selected from the Reverse Northerns in the different tissues of the plant, the clones are used as probes in Northern analysis of either total or poly (A)+ RNA from healthy and infected roots, stems, leaves and flowers. Total RNA blots comprise 25/xg RNA per lane whilst poly (A) + blots comprise 0.5 to l^g RNA per lane. The RNA is electrophoresed on formaldehyde gels and blotted onto Pall Biodyne B membrane as described by Fourney et al (1988). Probes are labelled and hybridised to blots as described above.

Southern blotting To determine whether the cDNAs are of plant or nematode origin, C319 and M.javanica DNA are prepared as described by Gawel & Jarret, (1991) . Southern blots are prepared comprising lOj^g EcoRI and Hindlll digested DNA 1 per lane. The blots are hybridised to oligolabelled probes as described above.

In Situ hybridisations To determine the locality of expression of the cDNAs of interest at the feeding site, in situ hybridisations are performed. Tissue from infected and healthy roots are embedded in wax, sectioned and hybridised to the probes as described by Jackson (1991).

Isolation of 5 * termini of mRNAs The 51 termini of the RNAs of interest are determined prior to the isolation of their promoter sequences. This is achieved by using 5' RACE as described by Frohman et al, (1988) .

Isolation of promoter regions The promoter regions of the genes of interest are isolated by a process termed Vector-Ligated PCR. lOOng samples of restriction endonuclease digested C319 genomic DNA are ligated for 4 hours at RT (King & Blakesley, 1986) with lOOng samples of pBluescript (digested with a restriction enzyme producing compatible termini). Typically, enzymes used are EcoRI, BamHI, Hindlli; BG1II, Xhol, Clal, Sail, Kpnl, PstI, and Sstl. PCR is then performed on the ligations using a vector primer such as the -40 Sequencing primer and a primer complementary to the 5' terminus of the mRNA. The PCR products are then cloned and sequenced. If necessary, the process is repeated with a new primer complementary to the 5' terminus of the promoter fragment to ensure that the control sequences of the promoters are isolated. 11 r' i / ft u Construction of the binary plant transformation vector. pStarnase The T-DNA region of the binary plant transformation vector, pStarnase, is shown diagrammatically in Figure 2. This region comprises the NPTII gene to allow selection of transgenic plants using kanamycin, the barstar ORF under the control of the CaMV 35S promoter and the barnase ORF with a proximal Not I restriction site for the insertion of the stimulus responsive promoter. This vector has been deposited under the Budapest Treaty on the International Recognition of the Deposit of Micro-Organisms for the Purposes of Patent Procedure, at the National Collection of Industrial and Marine Bacteria, Aberdeen, GB on 5 May 1994 under accession number NCIMB 40634.

Key Relating to Figure 2 A Right Border B NPTII C Nos Terminator D Barnase ORF E CaMV 35S Promoter F Barstar ORF G Nos Terminator H Left Border I NotI Site Transgenic plant production Transgenic plants, for example tobacco, may be produced by the standard Agrobacterium mediated leaf disc method described by Horsch et al (1985), thus to provide root knot nematode resistant plants. Seeds or other propagules of plants the product of the subject invention can be stored for future use.

As will be realised by those skilled in the art, with some classes of plant it may be appropriate or ncessary to transform the plant by use of a method other than an Agrobacterium mediated method.

EXAMPLE KNTl; An example of a plant parasitic nematode induced crene and the use of its promoter in accordance with the invention to produce plant parasitic nematode resistant plants.

Using the procedures described above, a gene, KNTl, was identified and isolated from tobacco plants that, although expressed at a low level in healthy plants, as determined by Northern blotting, was greatly induced upon infection by the root knot nematode, M. javanica. A KNTl promoter fragment of approximately 0.8Kbp in length, from the transcription start site, was isolated as described above and inserted into the GUS reporter vector, pBHOl (Jefferson et al, 1987). This resulted in the construct called pG21.08 which was used to transform tobacco plants. This showed that under healthy conditions this promoter sequence directed expression of the GUS gene in the apical and lateral meristematic tissue only. Upon infection with M. javanica, the expression of GUS in this tissue did not appear to change. However, strong GUS expression could now be seen in the nematode feeding site. The same promoter sequence was then inserted in the NotI site of pStarnase so that it would control the expression of the barnase ORF. This produced the construct pS21.08. Plants transformed with this construct were seen to be resistant to infection by root knot nematode.

The KNTl gene was shown to have homologues in species of plants other than tobacco. These include, but are not limited to, Solanum tuberosum, Lycopersicon esculentum and Beta vulgaris. The KNTl gene has also been seen to be induced by both root knot and cyst nematode species. The construct, pS21.08, has been deposited under the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for the Purposes of Patent Procedure, at the National Collection of Industrial and Marine Bacteria, Aberdeen, GB on 5 May 1994 under accession number NCIMB 40635. ? 6 0 5 1 1 References; DUGUID, J.R. & DINAUER, M.C. (1990) Nucleic Acids Research 18(9): 2789-2792.

ECKERT, K.A. & KUNKEL, T.A. (1990) Nucleic Acids Research 18(13): 3737-3744.

FOURNEY, R.M., MIYAKOSHI, J., DAY III, R.S. & PATERSON, M.C. (1988) Focus 10(1): 5-7.

FROHMAN, M.A., DUSH, M.K. & MARTIN, G.R. (1988) Proceedings of the National Academy of Sciences USA 85: 8998-9002.

GAWEL, N.J. & JARRET, R.L. (1991). Plant Molecular Biology Reporter 9(3) : 262-266.

GUSSOW, D., & CLACKSON, T. (1989). Nucleic Acids Research 17 : 4000-4008.

HORSCH, R.B.; FRY,, J.E.; HOFFMANN, N.L.; EICHOLTZ, D. ; ROGERS, S.G. & FRALEY,R.T. (1985). Science 227: 1229-1231.

JACKSON, D. (1991). Molecular Plant Plant Pathology: A Practical Approach. IRL Press, Oxford.

JEFFERSON, R.A.; KAVANAGH,T.A. & BEVAN, M.W. (1987) EMBO J 6 (13): 3901-3907.

KING, P.V. & BLAKESLEY, R.W. (1986) Focus 8(1): 1-3. MANIATIS, T.; FRITSCH,E.F. & SAMBROOK, J. (1982) Molecular Cloning; A Laboratory Manual. N.Y. Cold Spring Harbour Laboratory.

O'REILLY,D.; THOMAS,C.J.R. & COUTTS, R.H.A. (1991) Journal of General Virology 72: 1-7.

SHIRZADEGAN,M.;CHRISTIE,P. & SEEMANN,J.R. (1991). Nucleic Acids Research 19(21): 6055.

Claims (13)

WHAT WE CLAIM IS

1. A method of inducing a necrotic effect in a specific cell of an organism, wherein an organism is transformed with two chimaeric genes, a coding sequence of one of said genes coding for a first, cell necrotic molecule, and a coding sequence of the other of said genes coding for a second molecule, which second molecule is an inhibitor of the necrotic action of said first molecule, each of said two genes comprising a promoter, which promoters act conjointly, in response to the application of a specific stimulus to said organism, so that i) the necrotic action on said cell of said first molecule is not inhibited and ii) the expression of the first and second molecules in other cells (which other cells are required, for a healthy condition of the organism, not to suffer necrosis) is such that in said other cells necrotic action of the first molecule on said other cells is inhibited . with the proviso that such method does not include the medical treatment of humans.

2. A method according to Claim 1, wherein said organism is a plant.

3. A method according to Claim 1 or 2, wherein said first molecule is an RNase and said second molecule is an RNase inhibitor.

4. A method according to Claim 3, wherein said first molecule is barnase and said second molecule barstar. 7 n » a 5 i 17

5. A method according to Claim 1 or 2, wherein said first molecule is a restriction endonuclease and said second molecule is the corresponding DNA modification enzyme.

6. A method according to Claim 1 or 2, wherein said first molecule is a protease and said second molecule is the corresponding protease inhibitor.

7. A method according to Claim 1 or 2, wherein said second molecule is the mRNA for a regulatory or structural gene and said first molecule is the corresponding antisense RNA.

8. A method according to Claim 2 or to any one of Claims 3 to 7 as appended to Claim 2, wherein said stimulus is constituted by a pathogenic attack on said plant.

9. A method according to Claim 8, wherein the pathogenic agent is of the group comprising fungi, nematodes, bacteria and viruses.

10. A method according to any one of Claim 2 or to any one of Claims 3 to 7 as appended to Claim 2, wherein said stimulus is a result of the natural development of said plant or is the result of an artificial stimulus applied to the plant.

11. A plant which is pathogen resistant by virtue of said plant being the subject of the method of Claim 1.

12. A plant according to Claim 11, said plant being tobacco. 18

13. A method according to claim 1 substantially as herein described or exemplified. ADVANCED TECHNOLOGIES (CAMBRIDGE) LIMITED By Their Attorneys HENRY HUGHES Per