CZ285675B6 - Method od inducing necrotic action in specific plant cell - Google Patents

Abstract

The plant is transformed by two genes whose promoting agents act in tandem so that, depending on the stimulus acting on the plant and formed by, for example, pathogenic infestation, the necrotic action of a molecule coded by the first gene on a specific plant cell is not arrested by a molecule coded for the second gene, whereas in other cells the necrotic action of the first molecule is arrested by the second molecule. Such a transformed plant exhibits resistance against nematode infestation.

Description

The invention relates to a method of inducing specific cell necrosis for, for example, increasing the resistance of plants to plant disease-causing agents.

BACKGROUND OF THE INVENTION

In WO 89/10396, a method of transforming plants has been proposed using a product comprising a tissue-specific promoter and a gene that encodes a ribonucleic acid or polypeptide that, when produced in a cell for which the promoter is intended, significantly disrupts the cell metabolism.

EP-A-0 412 911 discloses a method according to which metabolic disorders are counteracted by displacement of a second ribonucleic acid or polypeptide, and as described in WO 92/21757, a somewhat similar technology has been proposed in relation to the need to maintain nematode resistance of plants. EP-A-0 537 399 discloses a mechanism for decomposing and retarding the decomposition of plant tissue.

SUMMARY OF THE INVENTION

The deficiencies of the known plant protection status are eliminated by a method of inducing a necrotic effect in a specific cell of the plant according to the invention, characterized in that the plant is transformed with two chimeric genes, the coding sequence of one of these genes encodes the first cell necrotic molecule these genes encode a second molecule, wherein the second molecule slows the necrotic action of the first molecule, the promoters of both genes act together and depending on the action of a specific stimulus on the plant, the necrotic action on the cell of the first molecule is not inhibited cells and in these other cells the necrotic action of the first molecule on these additional cells is limited.

In this embodiment of the invention, it is preferred that cell-specific necrosis can be achieved without providing a cell-specific promoter. It is to be understood that cell-specific necrosis can be achieved using two promoters, none of which are capable of directing specific cell expulsion per se. However, the overlapping displacement characteristics of the two promoters and their respective responses to external stimuli are such that they affect the direction of displacement of the effector gene and its inhibitor so as to create a lethal imbalance of the two molecules only in a specific cell or specific cells.

It may be that, as long as no stimulus is applied to the plant or at least its specific cell, for example, there is no effect of the first molecule in that specific cell.

In such a case, upon application of an external stimulus, the co-action of the promoters ensures that in a specific cell the relative levels of the first and second molecules are such that the necrotic effect of the first molecule is not inhibited. Similarly, it may happen that the first molecule will not be extruded into other cells prior to the stimulus. In such a case, the co-action of the two promoters ensures that upon application of the stimulus, the relative levels of the first and second molecules in these other cells will be such that the necrotic effect of the first molecule is inhibited.

If the first molecule is displaced into a specific cell prior to the stimulus application, the two promoters work together to ensure that relative levels change when the stimulus occurs

The first and second molecules in a specific cell change from a state in which the necrotic effect of the first molecule is inhibited to a state in which the effect is no longer inhibited.

If the first molecule is displaced into other cells before application of the stimulus, the relative levels of the first and second molecules in these other cells, both before and after the stimulus application, will be such that the necrotic action of the first molecule on these other cells is inhibited.

As will be appreciated by those skilled in the art, changes in the relative levels of the first and second molecules in a specific cell induced by an external stimulus may be due to an increased level of chimeric gene promoter activity comprising a first molecule gene coding and / or decreased level of second chimeric gene promoter activity. Of course, it is also possible for the levels of the first and second molecules to vary in both increasing or decreasing until the relative changes in the levels induce the necrotic action of the first molecule, which is no longer inhibited by the second molecule in the second specific cell.

The graphs A, B, C, D, E, F in Fig. 1, shown in the drawing by way of example, show the extrusion levels (y-axis) of the first molecule (shaded bars) and the second molecule (shaded bars). Figure A shows the relative displacement levels in the target (specific) cell transformed by the method of the invention as they could exist prior to the application of the described stimulus. Chart A could represent relative levels in cells other than target cells both before and after the application of this stimulus. Charts B to F show differences in relative levels of the first molecule and the retarding of the second molecule in the target cell after application of the described stimulus. The arrows indicate increasing or decreasing the appropriate level from Graph A. It should be noted that in each of Graphs B to F, the first molecule was displaced with an excess of inhibitor. Thus, in any case, necrosis occurs in the target cell or cells.

In carrying out the method of the invention, the first molecule may be a ribonuclease and the second molecule may be a ribonuclease inhibitor.

Other examples of the first and second molecules are: non-permissive endonuclease and the corresponding deoxyribonuclease acid modification enzymes DNA, proteinases and respective proteinase and ribonucleic acid inhibitors for key regulation or structural genes.

The stimulus applied to plants in connection with the invention may be a pathogenic attack on the plants.

As has been found by those skilled in the art, the present invention has provided broad scope for protecting plants against attack by, for example, fungi, nematodes, bacteria and viruses, as well as for other purposes.

The present invention can be used as a method of selectively destroying or stopping the further development of certain plant elements, thorns, gutter shoots, inflorescences or stinging hairs. In such cases, these stimuli may be utilized as a result of natural plant breeding or as application of artificial stimuli, for example chemicals applied to the plants.

In this context, it is understood that the term necrotic effect includes the notion of a substantial reduction in metabolism in the sense that the utilization of the invention achieves a defined objective, for example, to protect plants against diseases.

It will also be appreciated by those skilled in the art that the basic ideas of the invention may also find application in fields other than plant cultivation.

-2GB 285675 B6

In the following, a preferred embodiment of the present invention will be described, using an example of a non-mathodic infection on the root tumors of tobacco plants.

DETAILED DESCRIPTION OF THE INVENTION

Pathological growths and viral tobacco infections

Tobacco C319 seeds were germinated in Fisons FI compost under conditions alternating sixteen-hour light periods of 4500-5000 lux with eight-hour dark periods and maintaining the temperature in the range of 20 ° C to 25 ° C. After about three weeks, the seeds were gently rinsed with tap water to remove the clay and transferred to a pouch (2 plants per pouch; Northrup-King), then grown for one week in Conviron at 25 ° C and when illuminated with 5500 lux light in 16-hour periods alternating with 8-hour periods of darkness. The roots were lifted from the back of the pouch and supported on their ends with Whatman GF / A paper made of fiberglass. The three-day-old nematode (M. javanica) was then brought to the root ends in 10 µΐ (50 nematode) doses and finally a second piece of GF / A paper was deposited to completely wrap the root ends. Subsequent 24 hours after infection, GF / A paper was removed to ensure synchronous infection. The following three days after infection, the tumors at the roots were excised (the healthy tissue of the roots and their ends were left) and immediately frozen in liquid nitrogen. Approximately 0.5 to 1 g of infected root tissue was obtained from 80 vaccinated plants.

Staining for visualization of nematodes in infected roots

To determine the quality of infection, the number of nematodes (infection) per root tip must be ascertained. The roots are harvested three days after infection of the plants and immersed in lactophenol containing 0.1% Cotton Blue at 95 ° C for 90 seconds. This is followed by a five-second rinse in water, after which the roots are again immersed in lactophenol, this time at room temperature for 3-4 days to clear. The colored nematodes are then visualized by light microscopy.

Isolation of ribonucleic acid from healthy and infected root tissues

The root mesh, which has been frozen with liquid nitrogen, is ground to a fine powder in a frozen state in a mortar and pestle. About 100 g aliquots of this material are then transferred to similarly frozen Eppendorf tubes and 300 μΐ of hot phenol extraction buffer (50% phenol, 50% extraction buffer: 0.1 M lithium chloride, 0.1 M Tris) is added. -HCl pH 8.0 (RT), 10 mM EDTA, 1% SDS) and allowed to incubate at 80 ° C for 5 minutes. An equal amount of chloroform was then added and the mixture was worked for 15 minutes at 4 ° C. The aqueous phase is then collected with 600 μΐ of phenol / chloroform and treated as in the previous operation. The aqueous phase is removed again and the RNK ribonucleic acid is precipitated overnight with an equal amount of lithium chloride at 4 ° C. The precipitates are granulated by microfuging for 15 minutes at room temperature and rinsed in 70% ethanol. The granules are lyophilized, resuspended in DEPC treated water and analyzed by a spectrometer. The quality of the ribonucleic acid is determined by denaturing gel electrophoresis (adapted according to Shirzadegan et al. 1991).

Elimination cloning of infectious specific deoxyribonucleic acids cDNK

Poly (A) ⁺ RNK (mRNK) is isolated from a 200 µg sample of ribonucleic acid (RNK) from healthy and infected C319 root tissue using the magnetic oligo dT Dynabeads according to the manufacturer's instructions. The first branch of deoxyribonucleic acid cDNK synthesis is performed in place on the Dynabead bound poles (A) ⁺ healthy tissue fraction. The deoxyribonucleic acid is

-3 CZ 285675 B6

Driver DNK. The first and second partial syntheses are carried out in place at the poles (A) ⁺ fraction bound to Dynabead and recovered from the infected tissue. This is the deoxyribonucleic acid Target DNK. All reactions were performed using a cDNA synthesis kit from Pharmacia and following the manufacturer's instructions. Three oligonucleotides, SUB21 (5'CTCTTGCTTGAATTCGGACTA3 '), SUB25 (5'TAGTCCGAATTCAAGCAAGAGCA-CA3') (sequence from Duguida & Dinauer, 1990) and LDT15 (5'GACAGAAGCGGATCCd- (T) i ₃ 3 ') (O'Re ₅ '). , 1991) are kinised with the T4 polynucleotide kinase of Maniatis et al. (1982). SUB21 and SUB25 are then annealed to form a linker, which is then ligated to the target DNA with a T4 DNA ligase according to King & Blakesley (1986). In a further procedure, the beads carrying the target DNA are flushed extensively in TE and the second portion of the cDNK is eluted at 95 ° C in 5 x SSC.

The RNK ribonucleic acid bound to the Dynabead drive DBK is removed by heat treatment and the eluted target DNA is hybridized to the drive DNA at 55 ° C in 5 x SSC for 5 hours. The unhybridized target DNA is separated from the seed-bound propellant at room temperature according to the manufacturer's instructions, whereupon the hybridized target DNA is similarly separated from the bound propellant at 95 ° C. This process is repeated until the amount of target DNA hybridizing to the driving DNA exceeds the amount that it hybridizes. The deoxyribonucleic acid DNA concentrations are determined using a device termed Invitrogen's DNK Dipstick according to the manufacturer's instructions.

Aliquots of the final eluted fraction, processed at room temperature, are used in PCR amplification (Eckert et al., 1990) to generate double-stranded cDNKs for cloning into a plasmid vector. Multiplication of the drive DNA is achieved using the primers SUB21 and LDT15 and Hybaid Thermal Cycler under the conditions described by Frohman et al. PCR products are then ligated to the SmaI digested bBluescript vector of King & Blakesley.

Sorting of the subtractive series by Reverse North analysis

Recombinants are identified by PCR colony (Gussow & Clackson, 1989). The reinforced liners are Southem materials applied in triple layer to Pall Biodyne membranes according to the manufacturer's instructions. The pre-hydridation and hydridization is carried out at the same temperature and in the same buffer, i.e. at 42 ° C and in 5 x SSPE, 0.05% BLOTTO, 50% formamide. These components are hybridized separately to cDNA samples, which will be described later, from healthy and infected tissue, and to samples containing multiple target DNAs from the final subtraction. For further analysis, clones are selected which transmit only the hybridization signal to the infected cDNK sample or which transmit the hybridization signal to the subtracted sample but not to the cDNK samples.

Creating cDNK samples

To obtain samples with high specific activity for differential tracking, cDNK synthesis is performed cold over the entire amount of RNK ribonucleic acid and the synthesis products are then labeled with oligotagging. Samples, prepared in an amount of 10 µg of the entire volume of RNK ribonucleic acid from healthy or infected tissue, were first treated with 2.5 units of deoxyribonuclease 1 at 37 ° C for 15 minutes. The deoxyribonuclease is then denatured at 95 ° C for 10 minutes prior to cDNK synthesis (according to Pharmacia standard protocol). The ribonucleic acid is then removed in the presence of 0.4 M sodium hydroxide for 10 minutes at room temperature, and the DNA is then purified by passing through a Sephacryl 400HR column. The yield of cDNK and its concentration is determined by the DNK Dipstick (Invitrogen). The cDNK products are then labeled according to Pharmacia's standard oligotagging protocol (about 35 ng per sample).

-4GB 285675 B6

Northem blotting

To determine the extrusion profile of cDNAs selected from Reverse Northems in various plant tissues, clones are used as samples in North analysis either in their entirety or in the form of (A) + RNKs from healthy and infected roots, stalks, leaves and flowers. The total amount of RNK blots contains 25 µg RNK per lane, while the poles (A) + blots contain 0.5 to 1.0 µg RNK per lane. The ribonucleic acid is applied by electrophoresis on formaldehyde gels and on a Pall Biodyne B membrane as described by Foumey et al. (1988). Samples are labeled and hybridized as described in the previous section.

Southem blotting

To determine whether the cDNKs are of plant or non-maternal origin, C319 and M are prepared. javanica DNA as described by Gawel & Jarret (1991). Blots were then prepared containing 10 µg of EcoRI and HindIII digested DNA per lane. The blots were hybridized to the oligotagged samples as described above.

On-site hybridization

On-site hybridization is performed to determine the location of the observed cDNKs at the site of the nutrient supply. Plant tissue from infected and healthy roots is waxed, cut and hybridized to samples as described by Jackson (1991).

Isolation of 5 'ends of mRNK ribonucleic acids

The monitored 5 'ends of the RNK ribonucleic acids are determined prior to isolation of their promoter sequences. This is achieved using the 5 'RACE as described by Frohman et al., (1988).

Isolation of promotional areas

The promoter regions of the genes of interest are isolated by a method termed Vector-Ligated PCR. 100 ng of restriction endonuclease samples digested with C319 genomic DNA are ligated for 4 hours at room temperature (King & Blakesley, 1986) with 100 ng of pBluescript samples (digested with restriction enzymes producing comparable limits). Suitable enzymes used are EcoRI, BamHI, HindIII, BGII, XhoI, ClaI, SalI, KpnI, PstI and StI. Ligation PCR is then performed using a vector primer, such as a -40 Sequencing primer and a primer complementary to the 5'mRNK end. The PCR products are then cloned and sequenced. If necessary, the process can be repeated with a new primer complementary to the 5 'end of the promoter fragment to ensure that the promoter control sequences are isolated.

Construction of binary growth transformation vector, pStamases

The binary growth transformation vector region of T-DNA, pStamase, is schematically shown in Figure 2. This region contains ΝΡΤΠ genes to allow selection of transgenic plants with kanamycin, barstar RF under the control of the CaMV 35S promoter, and ORF Bamase with Proximal NotI restriction site a stimulus-responsive promoter. This vector was deposited under the Budapest Convention on the International Recognition of Deposited Microorganisms for the Purpose of Patent Application Applications at the National Collection of Industrial and Marine Bacteria in Aberdeen, UK on May 5, 1994 under NCIMB 40634.

-5GB 285675 B6

Legend to Fig. 2

A - right margin

Β -ΝΡΤΠ

C - Nose terminator

D - bamboo ORF

CaMV 35S E promoter

F-barstar ORF

G - Nose terminator

H - left edge

I -Notl

Production of transgenic plants

Transgenic plants, such as tobacco, can be produced in a standard manner using Agrobacterium mediated to a leaf disc and described by Horsch et al. (1985), so that plants resistant to root tumor nematode are obtained. Seeds and other plant parts obtained using the present invention may be retained for future use.

As will be appreciated by those skilled in the art, for some plant species, it may be appropriate or even necessary to transform the plant in a manner other than that described by Agrobacterium.

DETAILED DESCRIPTION OF THE INVENTION

KNT1: An example of a gene produced by nematodes parasitic on plants and the use of its promoter according to the invention for the cultivation of plants resistant to parasitic nematodes.

Using the methods described in the previous sections, the KNTI gene from tobacco plants has been identified and isolated, which is found in small amounts in healthy plants while increasing significantly after infection with root nematodes, M. javanica. A KNTI promoter fragment of approximately 0.8 Kbp in length, originating from the transcription start site, was isolated as described above and inserted into a GUS reporter vector, pBHO1 (Jefferson et al., 1987). The result is a construct called pG21.08, which is used to transform tobacco. This suggests that, under conditions for healthy plant growth, this expression for the GUS gene under the control of the promoter sequence occurs only in the vertex and lateral meristematic tissues. After infection by M. javanica, there is no change in the expression of GUS in this tissue. However, a marked change in the expression of the GUS form occurs in the places where nematodes eat food. The same promoter sequence was then inserted into the NotI site of pStamase to control the extrusion of the ORF bamase. This produces the construct pS21.08. Plants transformed with this construct have been shown to be resistant to infection by root nematodes.

It turns out that the KNTI gene also has homologues in other plant species than tobacco. These homologues are Solanum tuberosum, Lycopersicon esculentum and Beta vulgaris, and are not limited to the examples. It also appears that the KNTI gene was produced by both root tumor and cyst nematode species. The construct pS21.08 was deposited under the Budapest Convention on the International Recognition of Stored Microorganisms for the purpose of substantive examination of patent applications at the National Collection of Industrial and Marine Bacteria in Aberdeen, UK, May 5, 1994 under NCIMB 40635.

Claims (9)

A method of inducing necrotic action in a specific cell of a plant, characterized in that the plant is transformed with two chimeric genes, the coding sequence of one of these genes encodes the first cell necrotic molecule and the coding sequence of the other one encodes the second molecule, the necrotic action of the first molecule is slowed down, the promoters of both genes act together and depending on the action of the specific stimulus on the plant, the necrotic action on the cell of the first molecule is not inhibited and the first and second molecules are pushed into other cells and the necrotic action is the first molecules on these other cells. The method of claim 1, wherein the first molecule is RNase ribonuclease and the second molecule is RNase ribonuclease inhibitor. The method of claim 2, wherein the first molecule is a bamase and the second molecule is a barstar. The method of claim 1, wherein the first molecule is a restriction endonuclease and the second molecule is a modification enzyme to modify the corresponding deoxyribonucleic acid DNA. The method of claim 1, wherein the first molecule is a protease and the second molecule is a corresponding protease inhibitor. The method of claim 1, wherein the second molecule is a mRNK ribonucleic acid for regulatory or structural genes and the first molecule is a corresponding RNK ribonucleic acid of opposite sense. The method of claims 1-6, wherein the specific stimulus is a pathogenic attack on the plant. 8. The method of claim 7, wherein the pathogenic attack is the action of a substance selected from the group consisting of fungi, nematodes, bacteria and viruses. The method according to claims 1 to 6, characterized in that the stimulus is the result of the natural development of the plant or the result of the effect of an artificial stimulus applied to the plant.