CN1286979C - Cell specific necrosis - Google Patents
Cell specific necrosis Download PDFInfo
- Publication number
- CN1286979C CN1286979C CN 94106967 CN94106967A CN1286979C CN 1286979 C CN1286979 C CN 1286979C CN 94106967 CN94106967 CN 94106967 CN 94106967 A CN94106967 A CN 94106967A CN 1286979 C CN1286979 C CN 1286979C
- Authority
- CN
- China
- Prior art keywords
- molecule
- cell
- plant
- gene
- necrosis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The plant is transformed by two genes whose promoting agents act in tandem so that, depending on the stimulus acting on the plant and formed by, for example, pathogenic infestation, the necrotic action of a molecule coded by the first gene on a specific plant cell is not arrested by a molecule coded for the second gene, whereas in other cells the necrotic action of the first molecule is arrested by the second molecule. Such a transformed plant exhibits resistance against nematode infestation.
Description
The present invention relates to the conduct of inducing cell specific necrosis, as improving the mode of plant to the resistance of virulence factor.
In WO 89/10396, mention, transform plant with a construct that contains the gene of tissue-specific promoter and coding RNA or polypeptide, when this construct produces in the special cell of promotor, seriously interference cell metabolism.In EP412911, delivered and a kind ofly resisted metabolism interferential program by expressing another kind of RNA or polypeptide.As disclosed among the WO 92/21757, there is the people to propose the similarly relevant technology that hinders Plant nematode resistance theme.EP 537399 has also proposed a destruction/inhibition mechanism.
The invention provides the method for a necrosis induced effect in the organism specific cell.Transform plants with two mosaic genes, the encoding sequence of one of them gene first necrocytosis molecule of encoding, second molecule of encoding sequence coding of another gene.Second molecule is the inhibitor of the downright bad effect of said first molecule.These two genes all respectively contain a promotor, and this two promotor produces and replys being applied to said organic differential stimulus jointly, and so 1. first kind of molecule do not suppressed the necrosis effect of described cell; 2. the expression of first kind and second kind molecule in other cell (organism for situation that a health is arranged and be unlikely necrosis need other cell) is that first molecule is suppressed the necrosis effect of other cell in said other cell.
Advantage of the present invention is exactly unnecessaryly just can obtain cell specific necrosis with cell specificity promotor.That is to say, adopt two kinds of promotors can obtain cell specific necrosis, adopt in two any one then can not cell guiding specific expressed.Yet, the differential responses meeting that the overlapping expression characterization of two promotors reaches the stimulation of using influences the effector gene and suppresses the direction of subbase because of expressing, thereby makes the deadly imbalance that produces said two kinds of molecules in (and being only to exist) specific cell.
This organism can be a plant.
Might work as organism, when being upset as specific cell, first kind of molecule in the specific cell just can be expressed.In this case, according to suffered stimulation, the promotor acting in conjunction to be guaranteeing in the specific cell first kind of relative level with second kind of molecule, and the downright bad effect of first kind of molecule is not suppressed.Similarly, might before using stimulation, in other cell, there be the expression of first kind of molecule.In this case, these two promotor actings in conjunction with guarantee use stimulate after first kind of relative level with second kind of molecule in other cell, thereby the necrosis effect of first molecule is suppressed.
If the expression of existing first kind of molecule in the specific cell before application of stimulus, two promotor actings in conjunction so guarantee that in the specific cell first kind changes according to employed stimulation with the relative level of second kind of molecule.So just make its necrosis effect be subjected to holddown to change no longer downtrod state into from first kind of molecule.
If the expression of existing first kind of molecule in other the cell before application of stimulus, so before being upset be upset after in other cell first kind with the relative level of second kind of molecule kind of the molecule of winning is suppressed to the necrosis effect of said other cell.
Industry those of skill in the art are apparent, for the stimulation of being used, first kind can be subjected to containing the influence of the promoter activity reduction level that increases another gene in level and/or the mosaic gene of promoter activity of mosaic gene of gene of first kind of molecule of encoding with the variation of the relative level of second kind of molecule in the specific cell.Naturally also might first kind of molecule and the level of second kind of molecule all increase or all reduce, as long as the variation of level causes the necrosis effect of first kind of molecule in the specific cell no longer to be suppressed by second kind of molecule relatively.
The figure A-F of Fig. 1 represents the expression level (Y-axle) of first kind of molecule (hypographous) and second kind of molecule (unblanketed) by illustration in the accompanying drawing of this paper.Figure A is illustrated in the relative expression's level in the target cell (specificity) that transforms by the present invention, and it may just exist before using stimulation.Figure A may represent that also other non-target cell is in the level of using before and after stimulating relatively.Figure B-F has then shown and is being subjected to said stimulations afterwards first kind of molecule and the different level relatively of second kind of molecule of inhibition thereof in the target cell.Arrow is represented rising or the reduction with the corresponding expression level of figure each level of A.It should be noted that first kind of molecule expressed in any one of figure B-F under the situation that excessive inhibitor exists.Target cell will necrose like this, in each case.
When enforcement was of the present invention, first kind of molecule can be that second kind of RNase can be the RNase inhibitor.
Other first kind and second kind of molecule be: restriction enzyme and corresponding dna modification enzyme; Proteolytic enzyme and corresponding proteinase inhibitor; The crucial regulation and control or the antisense and the just RNA of structure gene.
For the present invention, the said stimulation that imposes on plant may be made of the invasion and attack of pathogen.
Industry those of skill in the art will recognize that the present invention has been widely used in vegitabilia and has protected it not to be subjected to as fungi, nematode, infection and other purpose of the invasion and attack of bacterium and virus.
The present invention can be used for selective destruction or suppress stable plant organ, for example thorn, supernumerary bud, flower or setaceous growth.In this case, said stimulation can be that the result that grows naturally of plant or artificial stimulation are as being used for the chemical agent of plant.
Be understandable that just as used herein, " downright bad effect " comprises this notion of the substantive damage of metabolism, so just can realize adopting target of the present invention, as the protection of disease.
Industry those of skill in the art people will recognize that relevant notion of the present invention can be applied to non-plant circle.
To tell about the preferred program of the present invention of implementing with the example that root knot nematode is infected tobacco plant below:
Growth of tobacco and infection
The seed of tobacco C319 is sprouted in the FisonsF1 mixed fertilizer in following condition: intensity of illumination 4500-5000Lux, and illumination in 16 hours is 8 hours dark at interval, and temperature is between 20-25 ℃.Three week back seedling are flushing gently under tap water, removes soil, and it is changed in the bag (every bag 2 strain, Northrupking), at 25 ℃, light intensity 5500Lux, illumination in 16 hours is one week of regrowth in 8 hours dark Conviron growth casees at interval.Root is raised in behind at bag, and with Whatman GF/A glass fiber paper buttress root tip, discharges the nematode of three ages in days to these tips of a root with 10 μ l (50 nematode) little equal portions, puts a GF/A paper at the tip of a root again, and the tip of a root is encased fully.Removing GF/A paper after 24 hours at nematode infection infects synchronously to guarantee nematode.After infecting 3 days, root knot is downcut (staying the tip of a root and strong root tissue), it is freezing to put into liquid nitrogen immediately, can gather in the crops about 0.5-1.0 from the plant of 80 strains inoculation nematode and restrain infected root tissue.
Dyeing is to observe the nematode in infected
For the quality of determining to infect, measure the quantity of the nematode that infects in each tip of a root.From infecting the plant results root after 3 days, with in the lactophenol solution that contains 0.1% cotton orchid of 95 ℃ of it immersions 90 seconds, water cleaned 5 seconds subsequently, and the lactophenol of again it being put into room temperature soaked 3-4 days, made root transparent.Just can observe the nematode that is colored with opticmicroscope.
The extraction of RNA in strong root and the infected root tissue
Root tissue grinds to form fine powder in the mortar with the liquid nitrogen precooling.The little equal portions of 100mg are added in the Eppendorf of similar precooling centrifuge tube.Add the hot phenol extraction buffer of 300 μ l (50% phenol, 50% extraction damping fluid: 0.1M lithium chloride .0.1MTris-HCLpH8.0 (room temperature), 10mMEDTA, 1%SDS), 80 ℃ of incubations 5 minutes add isopyknic chloroform then, and with homogenate 4 ℃ of little ultracentrifugations 15 minutes.Water is used phenol/chloroform extracting of 600 μ l again, and little ultracentrifugation is the same.Subsequently, water is shifted out again, add isopyknic lithium chloride then, cross liquid precipitate RNA for 4 ℃, the little ultracentrifugation of room temperature obtained precipitating cake in 15 minutes.With 70% washing with alcohol precipitation, will precipitate the cake lyophilize then, the water of handling with DEPC will precipitate suspension again, with spectrophotometer it be tested.The quality of RNA is determined (according to the method improvement of Shirzadegan etc. 1991) by the sex change gel electrophoresis.
Infect the deduction clone of specificity cDNA
The method that provides according to the producer is separated Poly (A) with magnetic oligomerization dTDynabead from 200 μ g take from total RNA sample of strong root of C319 and the root tissue that is infected
+-RNA (mRNA).The synthetic of first strand of cDNA chain is the Poly (A) that obtains in being combined with health tissues
+The last original position of the Dynabead of component is finished.This is to drive DNA (DriverDNA).The Poly that from infected tissue, extracts (A)
+RNA is attached to the Dynabead post, carries out original position synthetic first strand and second strand of chain, and this is target DNA (TargetDNA).All cDNA building-up reactionss all are to adopt the cDNA synthetic agent box of Pharmacia and undertaken by the method that the producer provides.The method of (1982) such as employing Maniatis is used T
4Polynueleotide kinase is to three oligonucleotide, SUB21 (5 ' CTCTTGCTTGAATTCGGACTA3 '), SUB25 (5 ' TAGTCCGAATTCAAGCAAGAGCACA3 ') (sequence is from Duguid and Dinauer, 1990) and LDT15 (5 ' GACAGAAGCGGATCCd (T)
153 ') (0 ' Reilly etc., 1991) carry out kinases and handle.Again SUB21 and SUB25 annealing are formed a linker, then with its method T according to King and Blakesley (1986)
4Dna ligase is connected with target DNA.Carry the pearl of target DNA with the abundant wash-out of TE, and second strand of chain of cDNA with 5 * SSC at 95 ℃ of wash-outs.
Can be in conjunction with being listed as the RNA that contains on the Dynabead that drives DNA by heating to remove down.The target DNA that elutes was hybridized 5 hours with driving DNA among 5 * SSC down at 55 ℃.By the method that the producer provides, separate the not target DNA of hybridization from being combined with the pearl that drives DNA at ambient temperature, subsequently, adopt similar methods under 95 ℃, to separate the hybridization target DNA from being combined with driving DNA pearl.The target DNA of wash-out is added to and drives among the DNA recross under the room temperature.Repeat this process, until no longer surpassing the amount of the target DNA of not hybridizing with the amount of the target DNA that drives DNA hybridization.Use the method that provides according to the producer, the concentration of the DNA that the DNA-Dipstick instrument of employing Invitrogen is determined.
Carry out pcr amplification (Eckert etc., 1990) with the final room temperature wash-out of little equal portions composition, generate the double-stranded cDNA of being cloned in the plasmid vector.The condition that proposes according to (1988) such as Frohman is with SUB21 and LDT15 primer and hybridize thermal cycler and carry out the amplification of target DNA.Again the product of PCR is connected on the pBluescript carrier of Smal digestion (King and Blakesley, 1986).
With reverse northern Analysis and Screening subtracted library
Bacterium PCR identifies recombinant chou by falling.(Gussow and Clackson, 1989).By the using method that the Pall Biodyne film producer provides, on this film, carry out the Southern trace with triplicate insertion fragment to amplification.Prehybridization carries out in identical temperature and damping fluid with hybridization: 42 ℃, and 5XSSPE, 0.05%BLOTTO, 50% methane amide.Respectively with from health tissues, the cDNA probe (seeing below) that obtains in the infected tissue and containing from the probe of the target DNA of final deduction thing amplification is hybridized film.Select only to show with the clone of the cDNA probe hybridization that obtains from infected tissue and with the probe of deduction but be not that the clone that the cDNA probe shows hybridization signal does further analysis.
The generation of cDNA probe
For the probe that obtains to use, with the cDNA of the plain mark of the synthetic No Parity of total RNA with high degree of specificity for differential screen analysis.Then with few mark mark synthetic product.Earlier with the DNaseI of 2.5 units under 37 ℃ of conditions, handles from health with infected tissue the total RNA sample of 10 μ g that obtains 15 minutes, follow cDNA synthesize carry out before in 95 ℃ of following sex change DNase10 minute (standard P harmacia program).Under the situation that 0.4MNaOH exists, room temperature treatment 10 minutes is removed RNA.By the Sephacryl 400HR column purification DNA of rotation,, then press the few mark standard program mark cDNA product (concentration, 35ng/ probe) of Pharmacia with amount and the concentration of DNA Dipstick instrument (Invitrogen) mensuration DNA.
The Northern trace
For determine from different plant tissues by the reverse northern choice of technology to the expression characterization of cDNA, at total RNA or Poly (A) to obtaining from healthy and the root, stem, the leaf that are infected, spending
+When carrying out the Northern analysis ,-RNA clones as probe with these.Total each swimming lane of RNA trace contains 25 μ gRNA; And Poly (A)
+Each swimming lane of-RNA trace contains 0.5 μ g-1 μ gRNA.According to (1988) described methods such as Fourney, in formaldehyde gel, carry out the RNA electrophoresis, and with on the RNA trace Pall BiodyneB film.By hereinbefore described method, with probe mark with hybridize to trace.
The Southern trace
In order to determine that cDNA derives from plant or nematode, prepare the DNA of C319 and M.Javanica by the method for Gawel and Jarret (1991).When carrying out the Southern trace, each swimming lane contains the DNA of 10 μ gEcoRI and HindIII digestion.The method of describing according to preamble, with blot hybridization to few label probe.
In situ hybridization
For determine be fed into the place we the interested cDNA site of expressing, carried out in situ hybridization.To be good for root tissue and infected root tissue is embedded in the wax by the method for Jackson (1991), section is hybridized with probe then.
The separation of mRNA5 ' end
Before the separating mRNA promoter sequence, determine interested RNA 5 '-end.Press (1988) such as Frohman described 5 '-RACE, can finish this work.
The separation of promoter region
Adopt a kind of be called process that carrier connects PCR separate we the promoter region of interested gene.Room temperature condition is down with the C319 genome DNA sample of the 100ng restriction endonuclease enzymolysis (King﹠amp that is connected 4 hours with 100ng pBluescript sample (with the Restriction Enzyme enzymolysis that can produce compatible end); Blakesley, 1986).More typical spendable enzyme has EcoRI, BamHI, HindIII, BGlII, XhoI, ClaI, SalI, KpnI, PstI and SstI.Carry out PCR reaction as-40 sequencing primers and the terminal complementary primer of mRNA5 ' to connecting product with the carrier primer, then the PCR product is cloned and check order.If necessary, new repeat PCR to guarantee to be separated to the control sequence of promotor with one with promoter fragment 5 ' end complementary primer.
The structure of double base plant conversion carrier pStarnase
Fig. 2 illustrates the T-DNA section of double base plant conversion carrier pStarnase.This district comprises NPTII gene (available Kanamycin screening transfer-gen plant).The barstar ORF of CaMV35S promotor control and the middle barnase ORF that has for the NotI restriction site of the near-end that inserts the irritant reaction promotor.On May 5th, 1994 this carrier by the preservation of collecting center of the industry of Britain Aberdeen and marine bacteria country, its registration number is NCIMB40634, and be subjected to " the international endorsement budapest treaty that the microorganism of patented procedure purpose preserves " protection.
On May 11st, 1994, this carrier is deposited in Chinese typical culture collection center, and its registration number is CCTCC94206.
The diagram of Fig. 2:
The A-right margin
B-NPT?II
The C-Nos terminator
D-Barnase?ORF
The E-CaMV 35S promoter
F-Barstar?ORF
The G-Nos terminator
The H-left margin
The I-NotI site
The production of transfer-gen plant
Transgenic plant as tobacco, can produce by the leaf dish method of described standard farming bar mattresses such as Horsch (1985) (Agrobacterium) mediation.So just can obtain anti-root knot nematode plant.Plant seed that the present invention can be obtained or other propagulum preserve further uses.
Industry those of skill in the art can be appreciated that for the plant of some guiding principle, it then is more appropriate or essential adopting non-agrobacterium mediation method to transform plant.
Embodiment
KNTI: the example of plant nematode induced gene reaches and uses the plant that its promotor produces anti-plant nematode by the present invention.
Adopt step above, from tobacco, separate and identify a KNTI gene.Although its expression level in healthy plant is very low, the Northern trace shows that the infection of root knot nematode MJavanica can its expression of induced strong.Be separated to a KNTI promoter fragment that begins from transcription initiation site that is about 0.8kb by the method for preamble, and be inserted among the Gus-report carrier pBI101 .1987 such as () Jefferson.So just obtained being called the structure of pG21.08, can come the transformation of tobacco plant with it.Can see that in the plant of health, this promoter sequence can guide gus gene only to express in tip and horizontal meristematic tissue.When being subjected to infecting of M.Javanica, the Gus expression of gene does not change in these tissues, at the strong expression that is fed into the Gus gene that then can see in the site.This promoter sequence is inserted into the NotI site of pStarnase, it just can control the expression of barnaseORF so again.This has just produced structure pS21.08.Can see that making up the conversion plant with this has resistance to infecting of root knot nematode.
The KNTI gene shows the homology with other non-tobacco plant kind.These kinds include but not limited to potato, tomato and beet.We can also see that the KNTI gene can be induced by root knot nematode and this nematode of cyst.May in 1994, this carrier construction on the 5th pS21.08 was preserved by the industry of Britain Aberdeen and collecting center of marine bacteria country; its registration number is NCIMB40635, and is subjected to " the international endorsement budapest treaty that the microorganism of patented procedure purpose preserves " protection.
This carrier is preserved in Chinese typical culture collection center on May 11st, 1994, and its registration number is CCTCC M 94027.
Reference:
DUGUID，J.R.&?DINAUER，M.C.(1990)Nucleic?Acids?Research18(9)：2789-2792.
ECKERT，K.A.&?KUNKEL，T.A.(1990)Nucleic?Acids?Research18(13)：3737-3744.
FOURNEY，R.M.，MIYAKOSHI，J.，DAY?III，R.S.&?PATERSON，M.C.(1988)Focus?10(1)：5-7.
FROHMAN，M.A.，DUSH，M.K.&?MARTIN，G.R.(1988)Proceedings?of?the?National?Academy?of?Sciences?USA?85：8998-9002.
GAWEL，N.J.&?JARRET，R.L.(1991).Plant?Molecular?BiologyReporter?9(3)：262-266.
GUSSOW，D.，&?CLACKSON，T.(1989).Nucleic?Acids?Research17：4000-4008.
HORSCH，R.B.；FRY，，J.E.；HOFFMANN，N.L.；EICHOLTZ，D.；
ROGERS，S.G.&?FRALEY，R.T.(1985).Science?227：1229-1231.
JACKSON，D.(1991).Molecular?Plant?Plant?Pathology：APractical?Approach.IRL?Press，Oxford.
JEFFERSON，R.A.；KAVANAGH，T.A.&?BEVAN，M.W.(1987)EMBOJ?6(13)：3901-3907.
KING，P.V.&?BLAKESLEY，R.W.(1986)Focus?8(1)：1-3.MANIATIS，T.；FRITSCH，E.F.&?SAMBROOK，J.(1982)MolecularCloning；A?Laboratory?Manual.N.Y.Cold?Spring?HarbourLaboratory.
O′REILLY，D.；THOMAS，C.J.R.&?COUTTS，R.H.A.(1991)Journalof?General?Virology?72：1-7.
SHIRZADEGAN，M.；CHRISTIE，P.&?SEEMANN，J.R.(1991).NucleicAcids?Research?19(21)：6055.
Claims (11)
1. the method for a necrosis induced effect in the plant specific cell, wherein plant transforms with two mosaic genes, first kind of necrocytosis molecule of encoding sequence coding of one of them described gene, and second kind of molecule of the encoding sequence of another described gene coding, the inhibitor of the necrosis effect that second kind of molecule is described first kind of molecule, described two genes respectively comprise a kind of promotor, their promotor acting in conjunction, the differential stimulus generation that described plant is suffered is replied, like this, i) described first kind of molecule do not suppressed the necrosis effect of described cell, ii) the expression of first kind and second kind molecule makes in described other cell first kind of molecule that the necrosis effect of described other cell is suppressed in other cell, and described other cell is that plant is unlikely downright bad needed cell for the situation that a health is arranged.
2. according to the process of claim 1 wherein that described first kind of molecule is RNase, second kind of molecule is a kind of RNase inhibitor.
3. according to the method for claim 2, wherein said first kind of molecule is barnase, and described second kind of molecule is barstar.
4. according to the process of claim 1 wherein that described first kind of molecule is a kind of restriction enzyme, described second kind of molecule is corresponding dna modification enzyme.
5. according to the process of claim 1 wherein that described first kind of molecule is a kind of proteolytic enzyme, described second kind of molecule is corresponding proteinase inhibitor.
6. according to the process of claim 1 wherein that described second kind of molecule is the mRNA of a kind of regulation and control or structure gene, described first kind of molecule is corresponding sense-rna.
7. according to each method among the claim 1-6, wherein said stimulation is made of pathogenic the infecting to described plant.
8. according to the method for claim 7, wherein pathogen comprises fungi, nematode, bacterium and virus.
9. according to each method among the claim 1-6, wherein said stimulation is the result that grows naturally of described plant or the result who is administered to the artificial stimulation on the plant.
10. one kind has the downright bad vegetable cell that acts on, and described vegetable cell is to use the method for claim 1 to produce.
11. according to the vegetable cell of claim 10, described vegetable cell is a kind of tobacco plant cell.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GB9310177.2 | 1993-05-18 | ||
| GB939310177A GB9310177D0 (en) | 1993-05-18 | 1993-05-18 | Cell specific necrosis |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1098436A CN1098436A (en) | 1995-02-08 |
| CN1286979C true CN1286979C (en) | 2006-11-29 |
Family
ID=10735649
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 94106967 Expired - Lifetime CN1286979C (en) | 1993-05-18 | 1994-05-18 | Cell specific necrosis |
Country Status (6)
| Country | Link |
|---|---|
| CN (1) | CN1286979C (en) |
| CZ (1) | CZ285675B6 (en) |
| GB (1) | GB9310177D0 (en) |
| MY (1) | MY134474A (en) |
| NZ (1) | NZ260511A (en) |
| ZW (1) | ZW6094A1 (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2277817A1 (en) * | 1997-01-24 | 1998-07-30 | Dna Plant Technology Corporation | Two component plant cell lethality methods and compositions |
| GB0025217D0 (en) | 2000-10-14 | 2000-11-29 | Cambridge Advanced Tech | Plant cell death system |
| GB0421598D0 (en) | 2004-09-29 | 2004-10-27 | Cambridge Advanced Tech | Modification of plant development and morphology |
| US9085774B2 (en) | 2005-04-19 | 2015-07-21 | Basf Plant Science Gmbh | Methods controlling gene expression |
| WO2014187311A1 (en) * | 2013-05-23 | 2014-11-27 | 深圳市作物分子设计育种研究院 | Plant pollen specificity-inactivating carrier and use thereof |
| US20180100162A1 (en) | 2016-10-11 | 2018-04-12 | Dow Agrosciences Llc | Modulation of Transgene Expression in Plants |
-
1993
- 1993-05-18 GB GB939310177A patent/GB9310177D0/en active Pending
-
1994
- 1994-05-11 MY MYPI9401178 patent/MY134474A/en unknown
- 1994-05-12 NZ NZ26051194A patent/NZ260511A/en not_active IP Right Cessation
- 1994-05-12 ZW ZW6094A patent/ZW6094A1/en unknown
- 1994-05-17 CZ CZ941201A patent/CZ285675B6/en not_active IP Right Cessation
- 1994-05-18 CN CN 94106967 patent/CN1286979C/en not_active Expired - Lifetime
Also Published As
| Publication number | Publication date |
|---|---|
| CZ120194A3 (en) | 1995-04-12 |
| CN1098436A (en) | 1995-02-08 |
| GB9310177D0 (en) | 1993-06-30 |
| CZ285675B6 (en) | 1999-10-13 |
| MY134474A (en) | 2007-12-31 |
| ZW6094A1 (en) | 1994-07-20 |
| NZ260511A (en) | 1995-07-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108588087B (en) | Gene GmLecRK-R for improving disease resistance of plants and application thereof | |
| CN104558130B (en) | Disease-resistance-related protein and its encoding gene and their applications in disease resistance of plant is regulated and controled | |
| CN1080302C (en) | Root knot nematode resistance | |
| CN101054411B (en) | Corn calcium adjusting phosphatase B analogy albumen, coding gene and application thereof | |
| CN113105533B (en) | Phytophthora camphora effector protein Avh49 and application thereof | |
| CN110373423A (en) | Regulate and control intermediary's factor B nMED16 gene and the application of cabbage type rape resistance to sclerotinia sclerotiorum | |
| CN109021084A (en) | Trifoliate orange Cold resistant genes PtrERF109 and its application in plant cold resistance genetic improvement | |
| CN102154313B (en) | Gossypium hirsutum proanthocyanidin promoting MYB1 gene and application thereof | |
| CN1286979C (en) | Cell specific necrosis | |
| CN113151300B (en) | CAMTA3 gene and application thereof in plants | |
| CN112979773B (en) | Phytophthora camphora effector protein RxLR29 and application thereof | |
| CN106554964B (en) | Application of cotton GbABR1 gene in verticillium wilt resistance | |
| CN111187779B (en) | Disease-resistant gene OsRLR1, transcription factor OsWRKY19 and application in breeding of rice resistant to bacterial blight | |
| CN115161332B (en) | Vitis spinosa VdERF2 gene and encoding protein and application thereof | |
| CN110357949B (en) | Elicitor protein from cladocera endophytic fungus and coding gene thereof | |
| CN110862996A (en) | Application of isolated soybean gene in improving soybean cyst nematode resistance | |
| CN108103042B (en) | Anti-verticillium wilt related receptor-like protein kinase GhPR5K, coding gene thereof and application thereof | |
| CN111778226B (en) | Plasma membrane H related to alkali stress resistance of rice+-ATPase proteins and uses thereof | |
| CN105254730B (en) | A kind of albumen improving plant salt tolerance drought tolerance and its encoding gene and application | |
| CN103524611B (en) | Meloidogyne incognita esophageal gland specific gene Msp40 and proteins encoded thereof are applied with it | |
| CN106518992B (en) | Sclerotinia heterokaryon-incompatible YD-7 protein and coding gene and application thereof | |
| CN111304220A (en) | Cymbidium CgWRKY3 gene and application thereof | |
| CN114736890B (en) | Application of rice chitinase and coding gene thereof in enhancing abiotic stress resistance of plants | |
| CN113912698B (en) | Pc-CD protein of Caesalpinia aphelenchoides, coding gene and application thereof | |
| CN114805520B (en) | Stress resistance related protein IbGT1, encoding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| ASS | Succession or assignment of patent right |
Owner name: BRITISH-AMERICAN TOBACCO COMPANY LIMITED Free format text: FORMER OWNER: ADVANCED TECHNOLOGIES (CAMBRIDGE) LTD. Effective date: 20131023 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20131023 Address after: London, England Patentee after: British-American Tobacco Company Limited Address before: England Patentee before: Advanced Technologies (Cambridge) Ltd. |
|
| C17 | Cessation of patent right | ||
| CX01 | Expiry of patent term |
Expiration termination date: 20140518 Granted publication date: 20061129 |