CN113151300B

CN113151300B - CAMTA3 gene and application thereof in plants

Info

Publication number: CN113151300B
Application number: CN202110499014.2A
Authority: CN
Inventors: 刘玉乐; 王韵婧; 龚骞
Original assignee: Tsinghua University
Current assignee: Tsinghua University
Priority date: 2021-05-08
Filing date: 2021-05-08
Publication date: 2023-01-03
Anticipated expiration: 2041-05-08
Also published as: CN113151300A

Abstract

The invention provides a CAMTA3 gene and application thereof in plants. The use of the CAMTA3 gene or an active fragment thereof to promote RNA silencing is provided. After the CAMTA3 gene is knocked out in the plant body, the RNA silencing pathway in the plant body can be obviously reduced, so that the plant is more sensitive to viruses, and the CAMTA3 gene can obviously promote the RNA silencing signal pathway in the plant body; in addition, in the camta3 gene knockout plant, the exogenous protein is transiently overexpressed by using agrobacterium, so that the amount of the exogenous protein can be obviously increased, and the camta3 gene knockout plant can be used for overexpression of the protein in a plant body or application to the field of plant disease-resistant breeding.

Description

CAMTA3 gene and application thereof in plants

Technical Field

The invention relates to the field of plant breeding, in particular to a CAMTA3 gene and application thereof in plants, and particularly relates to application of the CAMTA3 gene in the field of plant disease resistance breeding.

Background

Plants, which are organisms that cannot move instantaneously, are infested with pathogens from various external sources during their growth cycle, and as pathogens that cannot be inhibited using antibiotics, plant viruses can spread through multiple pathways and cause lifelong toxic and devastating damage to plants. Geminiviruses have attracted considerable attention in recent years as the largest class of plant DNA viruses (Fauquet et al, 2008). Geminiviridae (Geminiviridae) contains over 300 independent species, named for their characteristic twin-particle morphology of single-stranded circular DNA (ssDNA). Geminivirus can be transmitted by insects such as bemisia tabaci, leafhopper and the like. The geminivirus can infect various host crops, including okra, cassava and important economic crops such as tobacco, cotton and tomato, and can cause the curling and abnormal development of plant leaves after infecting plants; prominent vein dilation, etc. (mansor et al, 2006). Geminiviruses replicate rapidly, produce large quantities of virus in a short time, and have variable viral genomes, often resulting in a pandemic and outbreak of virus (Gibbs and Ohshima, 2010). By incomplete statistics, nearly 50 countries and regions worldwide are heavily abused by geminivirus (Pereira et al, 2010, scholthof et al, 2011 b). The research and control of geminivirus become a hotspot.

RNA silencing (RANi) refers to the mechanism by which eukaryotes regulate the expression of genes by targeting small RNAs (srnas) to gene mrnas. RNA silencing as a conserved defense mechanism in the biological world has a crucial role in the development of animals and plants, resistance to environmental stresses, etc. (Brodersen et al, 2008, chinnunamy and zhu, 2009. Plants use gene silencing approaches to achieve three goals: 1. creating and maintaining heterochromatin, such that duplicate chromosomes are not expressed; 2. biological processes such as growth and development, adversity stress and the like are promoted by regulating the expression of endogenous genes; 3. defend against external pathogenic microorganisms. Viruses rely primarily on the replication and translation system of host cells for amplification and delivery of self-genetic material and are able to replicate self-genetic material in large quantities or transcribe viral protein mRNA in a short period of time, a property that allows silencing of RNA as an important defense mechanism against viruses in plants, animals and fungi.

Further improvements are needed to improve plant performance by regulating gene expression in plants through RNA silencing.

Disclosure of Invention

The present invention is directed to solving, at least to some extent, one of the technical problems in the related art. The invention relates to a gene CAMTA3 for positively regulating and controlling plant anti-geminivirus. The inventor creatively discovers in the research process that the CAMTA3 (also called CAMTA 3) is knocked out in a plant body, so that the RNA silencing pathway of the plant is remarkably reduced, and the plant is more sensitive to viruses such as geminivirus, plum pox virus and the like; therefore, the CAMTA3 gene can remarkably promote an RNA silencing signal path in plants. Moreover, the inventor finds that: in a camta3 gene-deleted plant, the exogenous protein such as GFP protein is transiently overexpressed by agrobacterium, so that the amount of the exogenous protein can be significantly increased, and the camta3 gene-deleted or functionally silenced plant can be used for protein expression, thereby obtaining a high-yield protein or studying protein function or enhancing plant resistance.

Calmodulin-binding activator 3 (camta) is a class of gene expression regulatory proteins with conserved structure and widely existing in various eukaryotes. In recent years, reports continuously reveal that CAMTA family protein plays a key role in aspects of growth and development of plants, stress resistance, low-temperature freezing resistance, phytohormone synthesis pathways and the like. CAMTA is a multigene family: arabidopsis thaliana (Arabidopsis) has 6 members of CAMTA, of which the major gene is CAMTA3. Rice (Oryza sativa) has 7 members, soybean (Glycine max) has 15 members and tomato (Solanum lycopersicum) has at least 7 members (Bouche et al, 2002 choi et al, 2005. Transcription factors of the CAMTA family all have relatively conserved functional domains: a CG-1DNA binding domain, a TIG (tungsten inert gas) domain, an ANK repeat (alkyl repeat) domain, and a Ca are arranged in sequence from the N-terminal ²⁺ Dependent CaM binding domain (Ca) ²⁺ -dependent CaM binding domain, caMBD) and tandem repeat IQ motif (IQ motif, iqxxxrgxx). The CG-1DNA binding domain of AtCAMTA3 is mainly bound to the "CGCG Box" region of the gene promoter (CGCG-box), i.e. [ A/C/G ]]CGCG[T/C/G]And [ A/C]CGTGT(Poovaiah et al.,2013；Yang and Poovaiah,2002)。

In the research process, the inventor finds that when viruses bite into plants by wounds or insects, the plants can rapidly stimulate calcium flow, and then the CAMTA3 is activated. Activated CAMTA3 is capable of binding directly to the promoter region of the core gene RDR6 in the RNA silencing pathway and promoting its transcription. The finding shows that the CAMTA3 (CAMTA 3) knockout in the plant body can obviously reduce the RNA silencing pathway of the plant, so that the plant is more sensitive to geminivirus; but also allows the amount of GFP protein transiently overexpressed in tobacco by Agrobacterium to be significantly increased in camta3 plants. Therefore, the gene CAMTA3 can be applied to overexpression proteins in plants and disease-resistant breeding of the plants.

In a first aspect, the invention provides the use of a CAMTA3 gene or an active fragment thereof to promote RNA silencing. According to the invention, insect bites and mechanical injuries can induce the obvious expression of the core gene RDR6 in a silent pathway, and the CAMTA3 is found to be an upstream transcription factor mainly regulated and controlled by the CAMTA3. Subsequent experimental results prove that the CAMTA3 gene plays a role in positive regulation and control in a disease-resistant process and a molecular mechanism of the disease-resistant process, and in a CAMTA3 gene knockout plant, the amount of exogenous protein can be remarkably increased by using agrobacterium tumefaciens to instantaneously over-express the exogenous protein, so that the CAMTA3 gene can be used for over-expressing the protein in a plant body or applied to the field of plant disease-resistant breeding. Therefore, the invention not only provides important theoretical support for plant disease resistance breeding, but also can take the camta3 gene knockout plant as a biological generator to over-express protein in plants.

In a second aspect, the invention provides the use of the CAMTA3 gene or an active fragment thereof in the field of plant antiviral.

In a third aspect the present invention provides a method of making a transgenic plant comprising:

allowing the expression level of the CAMTA3 gene or an active fragment thereof in the target plant to show a difference from the wild type of the target plant, so as to obtain the transgenic plant.

The fourth aspect of the present invention provides a method for promoting the expression of a foreign protein in a plant, comprising:

introducing a gene encoding a foreign protein into said plant so as to promote expression of the foreign protein in said plant, wherein said plant has low or no expression of the CAMTA3 gene or active fragment thereof in vivo.

In a fifth aspect, the invention provides the use of an expression vector comprising the CAMTA3 gene or an active fragment thereof for RNA silencing.

In a sixth aspect, the invention provides the use of the CAMTA3 gene, or an active fragment thereof, in the manufacture of a kit for promoting RNA silencing.

Drawings

FIG. 1 is a graph showing the results of the changes in the mRNA levels of the CAMTA3 and RDR6 genes following insect bites and mechanical damage, provided in accordance with an embodiment of the present invention.

FIG. 2 is a graph demonstrating the results of CAMTA3 provided according to an embodiment of the present invention that can bind directly to the RDR6 promoter region and facilitate its transcription.

Fig. 3 is a graph of positive RNAi regulation results provided by CAMTA3 according to an embodiment of the invention.

FIG. 4 is a graph showing the results of enhanced infectivity of CLCuMuV on camta3 transgenic tobacco provided according to an embodiment of the present invention.

FIG. 5 is a graph showing the results of enhanced infectivity of PPV on camta3 transgenic tobacco provided in accordance with an embodiment of the present invention.

Detailed Description

The embodiments of the invention are described in detail below with reference to the following drawings: the embodiment is implemented on the premise of the technical scheme of the invention, and the detailed implementation mode and process are given for explaining the invention, but the implementation does not limit the invention.

As used herein, the term "CAMTA3 gene" refers to a gene encoding calmodulin-binding transcriptional activator (CAMTA) 3. The "active fragment" mentioned refers to a fragment capable of exhibiting the activity of the CAMTA3 gene, and the active fragment may be slightly longer or shorter in nucleic acid chain than the CAMTA3 gene as long as the activity of the CAMTA3 gene is exhibited. According to the embodiments of the present invention, reference to the activity of the CAMTA3 gene is to promote RNA silencing.

Herein, when amino acids are expressed, a single letter is used for representation, and those skilled in the art may also use three letters for representation.

In a first aspect, the invention provides the use of a CAMTA3 gene or an active fragment thereof to promote RNA silencing. The named CAMTA3 gene or an active fragment thereof may in particular facilitate an RNA silencing signaling pathway in plants.

In some embodiments of the invention, the CAMTA3 gene or an active fragment thereof has a sequence as shown in SEQ ID NO. 1.

Wherein the sequence shown in SEQ ID NO. 1 is:

ATGGCTGACAGTAGGCGTTATGGTCTGAATGCTCAACTAGATATTGATCAGATACTTTTAGAAGCACAACATAGATGGCTACGCCCTGCTGAAATTTGCGAAATTCTTAAAAACTATCAGAAGTTCCGGATTGCTCCAGAGCCTCCAAATAGGCCTCCAAGTGGTTCACTGTTTCTTTTTGATCGGAAGGTTTTACGGTATTTTCGCAAAGATGGCCATAGCTGGAGAAAGAAAAAAGATGGGAAGACTGTGAAGGAGGCTCACGAGAGGCTCAAGGCCGGAAGCATTGATGTATTGCACTGCTACTATGCCCATGGAGAAGAGAATGAGCATTTCCAAAGACGCAGCTATTGGATGCTCGAAGAGGAAATGTCACATATTGTTCTTGTCCACTACAGGGAAGTAAAGGGTACCAGGACAAATTTTAGCCGTACCAGAGAACCTCAAGAAGCTACTCCTCGTTCTCAAGAAACTGATGAAGATGTACACAGCTCTGAGGTGGACAGTTCTGCATCTACAAAATTTTATCCAAACGATTACCAAGTGAGCTCACAAGTCACTGACGCGACCAGCCTTAGCAGTGCGCAGGCCTCAGGATATGAGGATGCTGAATCAGCGTACAATCAACATCCAACTTCTGGATTTCACTCATTCCTTGATGCTCAGCCAAGTATGATGCAGAAAGCTGGAGAGAGCCTTCCTGTACCTTATCATCCGATTCCCTTCTCAAATGATCATCAAGTACAGTTTGCAGGAAGTTCTGATATGGATTTCTTCTCGAGCGCACCAGGAAATAAGAGTGGAAATACAGCAAATATGTATATACCCAGCAGGAACCTTGACTTCCCATCATGGGAGACAATTTCAGTGAATAATCCTGCTGCATATCAGTCTTACCATTTTCAGCCTTCTAGCCAGTCAGGTGCAAATAATATGACACATGAACAAGGAAGCACTACAACGGGTCAAGTATTCTTAAATGACTTCAAAAAACAGGGTCAGAACCGCATTGACGGCCTGGGAGACTGGCAGACTTCTGAAGGTGATGCTGCATTTATATCCAAGTGGTCCATGGATCAGAAGTTGAATCTGAATTTGGCATCTGATCATACCATCAGGTCTAGTGCTGCATATAATGTAGAACTTCACAATTCCTTGGAGGCTTCCCATATACTTCCTTCCCACCAAGAAAAACATCCAATGCAGAATGAACTTCCATCACAACATTCAGACGCAAATGTTGGAGGCTCTCTAAATGCTGAATTAGATCACAATCTAAGCATAGGGGTCAGAACCGATCATTCATCTTTAAAACAACCTTTGTTAGATGGTGTCTTGAGAGAAGGTTTAAAGAAGCTTGATAGCTTTGACCGGTGGATGAGTAAGGAACTTGAAGATGTGAGTGAGCCACATATGCAATCCAATTCTAGTTCCTATTGGGATAATGTTGGAGATGACGAGGGAGTTGATAATTCCACAATTGCTTCGCAAGTGCAGTTAGACACCTACATGCTAAGTCCTTCACTCTCCCAAGATCAGTTCTTTAGCATTATTGATTTCTCACCAAGCTGGGCATTTGCTGGGTCAGAAATTAAGGTTCTCATCACCGGGAAGTTTTTGAAATCCCAGCCAGAAGTGGAGAAGTGGGCATGCATGTTTGGTGAGTTGGAAGTTCCAGCAGAAGTAATAGCTGATGGTGTTCTACGCTGCCATACACCTAATCAAAAGGCAGGAAGGGTTCCATTTTATATAACATGTTCCAATAGGTTGGCATGTAGTGAAGTAAGAGAATTTGAATTTAGGGTCAGTGAGAGCCAAGATGTTGATGTTGCAAATAGTTGCAGCTCCAGTGAAAGTCTTCTTCATATGAGATTCGGAAAATTATTATCTTTGGAATCCACTGTTTCCCCAAGTTCTCCACCTCGCAGCGAGGATGATGTTTCCCATGTGTGCAGTAAAATCAATTCATTGCTAAAAGAGGATGACAATGAGTGGGAAGAAATGTTGAACCTTACTTATGAGAACAACTTTATGGCGGAGAAGGTAAAAGACCAGCTCCTACAAAAGCTTCTAAAAGAGAAGTTGCGTGTTTGGCTCCTCCAAAAGGTTGCTGAAGGCGGTAAAGGCCCTAACGTACTGGACGAGGGTGGTCAAGGAGTCCTACATTTTGCAGCCGCTCTTGGTTATGACTGGGCTATACCACCTACTATAGCTACAGGTGTAAGCGTCAATTTCCGAGATGTGAATGGATGGACTGCACTCCATTGGGCAGCATCATATGGAAGAGAGCGGACAGTGGGTTTCCTCATCTCCTTAGGTGCAGCTCCTGGAGCATTGACAGATCCTACTCCTAAACATCCTTCAGGAAGAACACCTGCTGACTTAGCTTCTAGCAATGGACATAAAGGAATTGCTGGTTATTTAGCAGAGTCATCCTTAAGCTCCCACCTTTCTTCTCTCGAGTTGAAGGAAATGAAGCAGGGTGAGAATGTGCAACCCTTTGGAGAGGCTGTTCAAACAGTTTCTGAACGGTCAGCTACGCCAGCTTGGGATGGTGACTGGCCACATGGAGTCTCATTGAAGGATTCTCTAGCTGCTGTTCGTAATGCAACTCAAGCAGCCGCTCGTATTCACCAAGTCTTCAGGGTGCAGTCGTTCCAGAGGAAGCAGCTAAAAGAACACGGTGGCAGTGAATTTGGACTATCAGATGAGCATGCTCTCTCTCTTCTTGCTTTGAAGACAAACAAGGCTGGTCAACATGATGAGCCGGTACACACTGCTGCGGTGCGTATACAAAATAAATTTCGCAGTTGGAAGGGAAGAAGAGACTATCTTCTTATCCGCCAACGAATTATTAAAATTCAGGCTCATGTAAGAGGACACCAGGTAAGGAACAAATACAAAAACATAATATGGTCTGTGGGGATCTTAGAGAAGGTAATTTTGCGATGGAGGCGGAAAGGAAGTGGATTGCGTGGGTTTAAACCAGAAGCAACACTTACTGAAGGAAGCAACACGCAAGATCGACCAGTGCAGGAGGATGACTATGATTTTTTAAAAGAAGGCAGAAAGCAAACTGAGCAAAGGTTGCAGAAGGCTCTGGCAAGGGTAAAATCGATGGTTCAATATCCTGAGGCCAGGGATCAATATCGGAGGCTGCTGAATGTTGTGTCTGACATGAAGGACACCACGACTTCGAGCGATGGTGCACCTAGCAACTCTGGGGAAGCAGCTGATTTCGGTGACGATTTGATCGATCTTGATGATCTATTGGACGATGACACTTTTATGTCTACAGCACCTTGA(SEQ ID NO:1)

in some embodiments, the CAMTA3 gene or active fragment thereof encodes the amino acid sequence set forth in SEQ ID NO. 2.

Wherein the sequence shown in SEQ ID NO. 2 is:

MADSRRYGLNAQLDIDQILLEAQHRWLRPAEICEILKNYQKFRIAPEPPNRPPSGSLFLFDRKVLRYFRKDGHSWRKKKDGKTVKEAHERLKAGSIDVLHCYYAHGEENEHFQRRSYWMLEEEMSHIVLVHYREVKGTRTNFSRTREPQEATPRSQETDEDVHSSEVDSSASTKFYPNDYQVSSQVTDATSLSSAQASGYEDAESAYNQHPTSGFHSFLDAQPSMMQKAGESLPVPYHPIPFSNDHQVQFAGSSDMDFFSSAPGNKSGNTANMYIPSRNLDFPSWETISVNNPAAYQSYHFQPSSQSGANNMTHEQGSTTTGQVFLNDFKKQGQNRIDGLGDWQTSEGDAAFISKWSMDQKLNLNLASDHTIRSSAAYNVELHNSLEASHILPSHQEKHPMQNELPSQHSDANVGGSLNAELDHNLSIGVRTDHSSLKQPLLDGVLREGLKKLDSFDRWMSKELEDVSEPHMQSNSSSYWDNVGDDEGVDNSTIASQVQLDTYMLSPSLSQDQFFSIIDFSPSWAFAGSEIKVLITGKFLKSQPEVEKWACMFGELEVPAEVIADGVLRCHTPNQKAGRVPFYITCSNRLACSEVREFEFRVSESQDVDVANSCSSSESLLHMRFGKLLSLESTVSPSSPPRSEDDVSHVCSKINSLLKEDDNEWEEMLNLTYENNFMAEKVKDQLLQKLLKEKLRVWLLQKVAEGGKGPNVLDEGGQGVLHFAAALGYDWAIPPTIATGVSVNFRDVNGWTALHWAASYGRERTVGFLISLGAAPGALTDPTPKHPSGRTPADLASSNGHKGIAGYLAESSLSSHLSSLELKEMKQGENVQPFGEAVQTVSERSATPAWDGDWPHGVSLKDSLAAVRNATQAAARIHQVFRVQSFQRKQLKEHGGSEFGLSDEHALSLLALKTNKAGQHDEPVHTAAVRIQNKFRSWKGRRDYLLIRQRIIKIQAHVRGHQVRNKYKNIIWSVGILEKVILRWRRKGSGLRGFKPEATLTEGSNTQDRPVQEDDYDFLKEGRKQTEQRLQKALARVKSMVQYPEARDQYRRLLNVVSDMKDTTTSSDGAPSNSGEAADFGDDLIDLDDLLDDDTFMSTAP(SEQ ID NO:2)

the inventor finds out in the research process that: both insect bites and mechanical damage strongly induce significant upregulation of CAMTA3 and RDR 6. When CAMTA3 is knocked out in tobacco by using CRISPR technology, the plant has no development phenotype, but the expression level of RDR6 is reduced. The luciferase reporter gene experiment and the EMSA experiment prove that CAMTA3 can be directly combined with the promoter region of the core gene RDR6 in an RNA silencing pathway and promote the transcription of the core gene RDR 6. The plant with the knocked-out CAMTA3 gene is more sensitive to viruses, so that the CAMTA3 gene or an active fragment thereof can be applied to the field of plant disease-resistant breeding, and a transgenic plant capable of resisting viruses is obtained.

Meanwhile, the inventor also finds that: the exogenous protein can be over-expressed by using CAMTA3 gene-deficient or function-deficient plants, so that the exogenous protein can be over-expressed by using the plants to research the protein function or obtain the plants highly expressing some exogenous proteins, and the method is applied to the fields of plant disease-resistant breeding or genetic engineering and the like. For example, the inventors found in their research that: in homozygous T3 generation camta3 knockout plants, transient overexpression 35s of GFP (representing overexpression of GFP protein with 35S as promoter) was injected using agrobacterium, and its expressed GFP was compared to normal untreated plants. Compared with the common benthic tobacco, the camta3 gene knockout plant expresses more GFP, and the expression shows that the mRNA level of the GFP is higher, the protein level is higher, and the siRNA mediated by the GFP is less. This indicates that CAMTA3 knockout impairs the post-transcriptional gene silencing function of plants. Meanwhile, transient co-expression of CAMTA3 and GFP shows that compared with a control, fluorescence of GFP is obviously weakened, mRNA and protein levels are reduced after the CAMTA3 is co-expressed, and GFP mediated siRNA levels are increased, which shows that transient over-expression of CAMTA3 can enhance a post-transcriptional gene silencing process.

Moreover, in the process of research, transient overexpression of CAMTA3 is found ^K979E (indicating that the 979 th amino acid was mutated from K to E, and the function of CAMTA3 was impaired by this mutation), it was found that when CAMTA3 function was impaired, the function of promoting post-transcriptional gene silencing was also impaired.

The invention also provides application of the CAMTA3 gene or the active fragment thereof in the field of plant virus resistance. In at least some embodiments, including but not limited to tobacco, such as bungaroton. The mentioned viruses include, but are not limited to, geminiviruses (DNA viruses) and RNA viruses. For example, we inoculated CLCuMuV or PPV on CAMTA3 transgenic plants to verify that after the CAMTA3 gene was knocked out, the infectivity of the virus was increased, the symptoms of the diseased plant were worsened, and the amount of virus was increased.

In at least some embodiments, the CAMTA3 gene or active fragment thereof is set forth in SEQ ID NO. 1.

In at least some embodiments, the CAMTA3 gene or active fragment thereof encodes an amino acid sequence as set forth in SEQ ID NO. 2.

The present invention also provides a method for producing a transgenic plant, comprising: allowing the expression level of the CAMTA3 gene or an active fragment thereof in the target plant to show a difference from the wild type of the target plant, so as to obtain the transgenic plant.

In at least some embodiments, the method comprises: so that the CAMTA3 gene or the active fragment thereof is over-expressed in the target plant body. According to an embodiment of the invention, the CAMTA3 gene or an active fragment thereof is introduced into a target plant such that the CAMTA3 gene or an active fragment thereof is overexpressed in the target plant. For example, the CAMTA3 gene or an active fragment thereof is introduced into a target plant via an expression vector containing the CAMTA3 gene or an active fragment thereof.

In at least some embodiments, the method comprises: so that the CAMTA3 gene or active fragments thereof is low or not expressed in the target plants. The CAMTA3 gene or active fragment thereof may be under-expressed or not expressed in the target plant using methods commonly used in the art. For example, the CAMTA3 gene or an active fragment thereof in the target plant is knocked out by using a criprpr-Cas 9 technology or a gene mutation technology is used, so that the CAMTA3 gene or the active fragment thereof is low expressed or not expressed in the target plant. The gene mutation technology can be a mutation of certain amino acid expressed by the CAMTA3 gene, for example, the 979 th amino acid is mutated from K to E.

According to an embodiment of the invention, the target plant mentioned may be tobacco.

The present invention also provides a method for promoting expression of a foreign protein in a plant, comprising: introducing a gene encoding a foreign protein into said plant so as to promote expression of the foreign protein in said plant, wherein said plant has low or no expression of the CAMTA3 gene or active fragment thereof in vivo. According to an embodiment of the invention, the plant is tobacco. The foreign protein includes but is not limited to GFP protein, but also any other functional protein.

In this context, low expression or no expression means that the amount of the CAMTA3 gene or its expression product is lower or that the corresponding protein is not expressed compared to wild-type plants.

The invention also provides the use of an expression vector comprising the CAMTA3 gene or an active fragment thereof in RNA silencing. In at least some embodiments, the expression vector includes, but is not limited to, a plasmid.

The invention also provides the use of the CAMTA3 gene or an active fragment thereof in the preparation of a kit for promoting RNA silencing. The provided kit can promote RNA silencing level in plants and animals by using CAMTA3 gene or active fragments thereof. RNA silencing is taken as a conserved defense mechanism in the biological world, plays an important role in the aspects of development of plants and animals, resistance to environmental stress and the like, and can be particularly applied to the field of plant breeding.

It will be appreciated by those skilled in the art that the following examples are illustrative of the invention only and should not be taken as limiting the scope of the invention. The examples, where specific techniques or conditions are not indicated, are to be construed according to the techniques or conditions described in the literature in the art or according to the product specifications. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

Example 1

Example 1a transgenic plant material was constructed comprising:

a vector and a construction method of a Cas9 Editing System are used for constructing transgenic tobacco NbCAMTA3-Cas9 (wherein Nb is an abbreviation of Nicotiana benthamiana) by using a vector and a construction method of the Cas9 Editing System (refer to Xingling M.A Robust CRISPR/Cas9System for convention, high-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants [ J ]. Molecular Plant,2015,8 (8): 1274-1284). The method comprises the following specific steps:

1. constructing a Cas9 vector: cas9 vectors were constructed by selecting the tandem promoter LacZ/AtU3d-AtU3b-AtU 6-1.

2. Designing a target point: the target point is designed inhttp://crispr.hzau.edu.cn/CRISPR2/Performed on a website. Nb is selected in the column of 'target gene' in a pull-down menu provided by a website, and the 'sequence' is filled with the gene sequence of the user. And then selecting a suitable target. The target selection principle is that the targeting efficiency of the positive strand target and the negative strand target of the target gene (transcription direction) is approximately the same, and the targets can be designed; the GC% of the target is not lower than 40% as much as possible, and the higher GC% of the target sequence (50-70%) has higher targeting efficiency. There are no more than 4 consecutive Ts in the target (in the 5'-N20NGG-3' direction) to prevent RNA Pol III from using it as a transcription termination signal; and (3) carrying out target specificity analysis: and (3) performing blast (Somewhat similar sequences are selected) by using the target point + NGG (plus and minus dozens of bases) and the genome, and avoiding using the target point which has less than 5 bases difference with the homologous sequence (the target point has specificity by 2 base difference between the adjacent cut point and the PAM).

3. Using online software (http://mfold.rna.albany.edu/？q＝mfold/RNA-Folding- Form2.3) And carrying out secondary structure analysis on the sgRNA. Continuous pairing of 7bp or more of the target sequence with the sgRNA sequence (note: RNA can be U-G paired) inhibits its binding to the target site of chromosomal DNA, and thus the use of continuous pairing of 7bp or more of the target sequence is to be avoided.

4. And respectively combining the selected targets with corresponding promoters, and then connecting and amplifying the targets and the sgRNA expression cassette in an overlappingPCR mode. And finally, connecting an expression cassette with a target point connected with the sgRNA and a Cas9 vector in an enzyme digestion connection mode, transferring the expression cassette into a large intestine, screening successfully connected clone colonies in a blue-white spot mode, and carrying out sequencing identification, wherein the successfully connected plasmids can be transferred into agrobacterium. A single colony was picked and inoculated into 10mL of liquid LB containing 50. Mu.g/mL of Rif and 50. Mu.g/mL of Kan, and shake-cultured overnight at 28 ℃ until the bacterial solution turned orange. Taking thick leaves on the upper part of the robust tobacco for about 50 days, taking 20 leaves on each carrier, slightly rinsing the leaves for 5 minutes by using a 2% sodium hypochlorite solution, and then rinsing the leaves for 5 times by using sterile water, wherein each time lasts for 1 minute. Cutting the leaves into leaf disks of 1cmX1 cm by using a sterilized scalpel, preparing a sterilized liquid MS culture medium, and mixing an agrobacterium liquid and the culture medium in a ratio of 1:30, the leaf disks are added and slowly shaken on a decolorization shaker for 30 minutes. Then the leaf disks were taken out, rinsed with clear water for 10 seconds, clipped out and wiped dry on absorbent paper, the leaves were placed back-up in solid callus induction medium (6-BAP 1.0mg/mL, NAA 0.1mg/mL, sucrose 3% solids MS), and cultured for 48 hours in a light incubator with shading. Clean, non-contaminating leaf disks were removed and placed on solid callus induction medium with 200. Mu.g/mL timentin and hygromycin. The culture medium is placed under the illumination and is cultured in an incubator for several days. The culture medium was changed once every 5 days. Until two young leaves grow, cutting off the leaf buds by a scalpel, placing the cut leaf buds into a rooting medium (timentin 200 mu g/mL, hygromycin 12000, sucrose 2% solid MS), transplanting the cut leaf buds into soil after the buds grow out, and taking out 0.5cm after the buds grow normally ² The leaves are quickly extracted out of DNA by an alkaline method, primers are designed at about 300bp upstream and downstream of a Cas9 target spot, and the DNA of transgenic plants is subjected to PCR by high-fidelity enzyme to amplify out the targetFragments of about 300bp near the point were sequenced.

5. Selecting the plant with the edited target point, marking as T0 generation, collecting the seeds of the plant, carrying out PCR identification in the T1 generation, collecting and identifying the seeds for the first generation until a pure and Cas-free plant is found, and collecting the seeds of the plant for an experiment.

In addition, for convenience of introduction, the NbCAMTA3-Cas9 two strains in the background of wild type native tobacco are named as camta3-1 and camta3-2; two lines of NbCAMTA3-Cas9 against 16c (35S.

Example 2

In order to prove that the stimulation of the calcium current can promote the expression of RNAi related genes (such as CAMTA3 gene and RDR6 gene), seedlings bitten by insects are used as experimental materials, and total RNA of the leaves of the seedlings bitten by the insects in 0, 2, 4 and 6 hours is extracted.

Then, the extracted total RNA was subjected to reverse transcription treatment using TransScript First-Strand cDNA Synthesis SuperMix (Transgene, AT 301-03) which is a reverse transcription kit from Seikagaku corporation.

Meanwhile, the ACTIN2 gene is used as an internal reference, and the mRNA level change condition of the RNAi partial gene is detected by adopting real-time fluorescent quantitative PCR (qRT-PCR).

The operation method of the real-time fluorescent quantitative PCR comprises the following steps:

cDNA generated by reverse transcription of RNA and DNA extracted from plants were used as templates, and the cDNA was diluted 4-fold and the DNA concentration was adjusted to 30 ng/. Mu.L. Primer design used online software Primer3. The primers used for reverse transcription using different genes are shown below:

qRT-Actin F’(SEQ ID NO:3):CCCAGAGAGGAAATACAGTG

qRT-Actin R’(SEQ ID NO:4):CAATAGACGGACCAGATTCG

qRT-NbRDR6 F’(SEQ ID NO:5)：TGTCAACCCTCCTTCTGCTT

qRT-NbRDR6 R’(SEQ ID NO:6):GCAGGGTTACTATTTGCCGG

qRT-NbCAMTA3 F’(SEQ ID NO:7):TAATTTTGCGATGGAGGCGG

qRT-NbCAMTA3 R’(SEQ ID NO:8):CCGATATTGATCCCTGGCCT

the apparatus used was CFX96 from Bio-Rad, USA ^TM Real-Time System. The dye used was 2X SYBR Green Master Mix (YEAEN, 11201ES 08X). The reaction system is as follows:

TABLE 1 fluorescent quantitative PCR reaction System

The reaction conditions are as follows:

95℃5min；

(iii) 95 ℃ 15s,60 ℃ 30s, repeating 40 cycles;

72℃10min。

application 2 according to Ct value fed back by instrument ^-ΔΔCt And (3) relatively quantifying the expression level of the target gene in the sample by taking Actin2 as an internal reference.

The experimental results are shown in fig. 1A and 1B. As can be seen from the figure, the CAMTA3 gene and the RDR6 gene both show the kurtosis change after the insect bites, and reach the peak 4 hours after the insect bites.

Meanwhile, the mechanically damaged seedlings are used as experimental materials, total RNA of leaves of the mechanically damaged seedlings is extracted for 0 hour, 1 hour, 2 hours and 3 hours, and q-PCR detection is carried out. mRNA levels of the CAMTA3 gene and RDR6 gene were determined using ACTIN2 gene as an internal control.

The results of the experiment are shown in FIGS. 1C and 1D. As can be seen from the figure, both the CAMTA3 gene, which is closely related to calcium flux, and the RDR6 gene, which is directly related to RNAi, exhibited peaked changes, reaching a peak after different times of mechanical injury.

As can be readily seen from the results presented in fig. 1, both insect bites and mechanical damage strongly induce a significant upregulation in the expression levels of the CAMTA3 gene and RDR6 gene.

Example 3

Plasmids containing 35S _pro Plasmid containing Luciferase vector and RDR6M _pro Plasmid of the Luciferase vector. Wherein, in the process of constructing the plasmidThe base vector used in (1) is an LIC vector. The LIC sequence of 20-30-nt is used as an adaptor sequence, and the fragment is inserted into two LIC adaptors by the base complementary pairing principle. The vectors used are respectively indicated as: HA-NbCAMTA3 (representing a vector carrying an HA protein tag and Nb tobacco CAMTA3 gene), HA-nLUC (representing a vector carrying an HA protein tag and an N-terminal Luciferasano Luciferase gene sequence), 35S.

The primers used were:

LIC1+NbCAMTA3 F’(SEQ ID NO:9):

CGACGACAAGACCGTCACCATGGCTGACAGTAGGCGTTAT

LIC2+NbCAMTA3 R’(SEQ ID NO:10):

GAGGAGAAGAGCCGTCGTCAAGGTGCTGTAGACATAAAAGTG

the Ligation Independent of Ligase (LIC) comprises the following steps:

firstly, carrying out enzyme digestion and recovery on a constructed LIC vector: and (3) carrying out enzyme digestion on the LIC vector for two hours by using enzymes at two ends of a ccdb sequence, carrying out DNA electrophoresis after the enzyme digestion is finished, cutting a DNA band, recovering by using a kit, treating a recovered product for 2 hours by using T4 DNA polymerase, and then carrying out DNA purification and recovery.

TABLE 2 LIC vector T4 polymerase reaction System

After the carrier is processed, the PCR fragment is processed by T4 DNA polymerase, and is placed in a PCR instrument for 20 minutes at 37 ℃ after being prepared into reaction liquid; 20 minutes at 75 ℃.

TABLE 3 LIC fragment T4 polymerase reaction System

Adding 3 mu L of LIC vector treated by T4 DNA polymerase into an LIC fragment T4 polymerase reaction system, and then placing the LIC vector in a PCR instrument at 70 ℃ for 10 minutes; the reaction was terminated at 22 ℃ for 20 minutes and then at 4 ℃.

Constructing plasmid containing 35S _pro Plasmid containing Luciferase vector and RDR6M _pro The plasmid of the Luciferase vector is transferred into agrobacterium and after the growth of the bacillus, single colony is picked and shaken, and HA-GUS and HA-CAMTA3 are shaken simultaneously.

Suspending bacteria according to the proportion of 1:1, HA-GUS and HA-CAMTA3 were added to agrobacteria containing Luciferase genes from different promoters, respectively. After the injection expression is carried out for 36 hours, the injection leaves are cut off, 1mM firefly luciferin substrate solution is prepared, the solution is dipped by a brush and evenly brushed on the leaves, and photographing record is carried out by a biopsy imaging instrument.

Wherein, the total RNA of the plant leaves of HA-nLUC and HA-CAMTA3 is extracted from the graph 2A and qRT-PCR detection is carried out. The mRNA level of RDR6 was measured. FIG. 2B Total RNA was extracted from WT and camta3 plant leaves and subjected to qRT-PCR detection. The mRNA level of RDR was measured. Statistical variance was calculated using student's t method, p <0.05 and p <0.01.

Experimental results show that the expression level of RDR6 is also obviously improved by using agrobacterium transient overexpression CAMTA3. Furthermore, the expression level of RDR6 was significantly reduced in camta3 plants.

To further explore the relationship between the CAMTA3 gene and RDR6, we designed Luciferase as a reporter gene to detect the regulation of RDR6 transcription by CAMTA3, knowing that CAMTA3 is a transcription factor.

We constructed RDR6pro, luciferase (representing a vector carrying an RDR6 gene promoter and a Luciferase reporter gene), RDR6Mpro, luciferase (representing a vector carrying an RDR6 mutant gene promoter and a Luciferase reporter gene), and then used a half-leaf method to detect the influence on RDR6 gene transcription when HA-GUS or HA-CAMTA3 is co-expressed with RDR6pro, luciferase, RDR6Mpro and Luciferase. And uniformly mixing the agrobacterium corresponding to the experiment, injecting the raw tobacco, taking down an injection leaf after 48 hours, uniformly dipping and brushing a Luciferase substrate on the leaf surface, and observing and photographing by using a living body imager.

As shown in FIGS. 2C and 2D, we found that when RDR6pro, luciferase, is co-expressed with HA-CAMTA3, the transcriptional expression level of Luciferase is significantly increased, but when 35S. When we co-express HA-CAMTA3 and RDR6Mpro, luciferase, the promotion effect of CAMTA3 on the transcription of the promoter is found to be obviously reduced or even lost. This indicates that CAMTA3 needs to promote transcription of RDR6 gene by binding to the "CGCG box" region of the promoter of RDR6 gene.

In addition, we also investigated whether CAMTA3 could bind directly to the "CGCG box" region of the RDR6 promoter using EMSA (Electrophoretic Mobility Shift Assay). Wherein, the sequences of the primers are shown as follows:

EMSA RDR6pro F(SEQ ID NO:11):TACTCGAAACATCCTTCCCGCGTGAAAAAGGAACC

EMSA RDR6pro R(SEQ ID NO:12):GGTTCCTTTTTCACGCGGGAAGGATGTTTCGAGTA

EMSA-RDR6pro probe F(SEQ ID NO:13)：TACTCGAAACATCCTTCCCGCGTGAAAAAGGAACC

EMSA-RDR6pro probe R(SEQ ID NO:14):GGTTCCTTTTTCACGCGGGAAGGATGTTTCGAGTA

wherein, GST and GST-CAMTA3 are prokaryotic expression purified proteins, the Hot probe (Hot probe) is an RDR6 promoter probe for synthesizing a CGCG box area with biotin labels, and the Cold probe (Cold probe) is an unlabeled probe. We incubated GST with GST-CAMTA3 and DNA fragment labeled with biotin in the region of the RDR6 promoter "CGCG box", respectively, and as shown in FIG. 2E, it was observed that a band of bound probes appeared after incubation of the DNA fragment with GST-CAMTA3, while the GST group did not have any band of bound probes. After we added unlabeled cold probe, the binding probe band became weaker, indicating that the interaction of the biotinylated DNA fragment with the protein was disturbed by the biotinylated DNA fragment. The experimental results show that CAMTA3 can be directly combined in the promoter 'CGCG box' region of RDR6 gene.

The results presented in FIG. 2 indicate that CAMTA3 can bind directly to the RDR6 promoter region and promote its transcription.

Example 4

Camta3-3 and camta3-4 were constructed against the background of 16C plants, respectively. The 16c seed is a transgenic plant that overexpresses gene 35s gfp in wild type Nicotiana benthamiana (Nicotiana benthamiana), and is the best material for the study of RNAi pathways. camta3-3 and camta3-4 are the aforementioned NbCAMTA3-Cas9 transgenic plants. In the background of 16C plants, the camta3 gene is knocked out by using the cas9 technology to obtain two strains, and the two strains are named as camta3-3 and camta3-4, so as to research the effect of the gene in the RNAi process.

Agrobacterium was first injected with GFP on camta3-3, camta3-4 and general 16C plants and observed for changes in GFP expression.

GFP Agrobacterium tumefaciens was injected onto the leaf blades of camta3-3 and camta3-4, and photographs were taken 4 days after injection by observation under white light and ultraviolet, the results of which are shown in FIG. 3A. Experimental observations show that on day four, GFP fluorescence on camta3-3 and camta3-4 is significantly stronger than that of the normal 16C plants.

And extracting total RNA of the tobacco leaves in the injection region, and carrying out qRT-PCR detection. mRNA level of GFP was measured using ACTIN2 as an internal control. Statistical variance was calculated using student's t method, p <0.05 and p <0.01. As shown at 3B in fig. 3. The qRT-PCR results showed that the mRNA level of GFP in the control group was significantly lower than that in the camta3-3, camta3-4 groups of plants.

The primers used are as follows:

qRT-GFP F’(SEQ ID NO:15):ATGGGCACAAATTTTCTGTCA

qRT-GFP R’(SEQ ID NO:16):TCCTCTCCTGCACGTATCC

and extracting the total protein of the tobacco leaves in the injection area, and detecting the expression quantity of GFP in the plants by using a Western blot method (Western blot). NC membranes were stained with ponceau red using anti-GFP antibody, with the ribulose-1, 5-bisphosphate carboxylase large subunit band as an internal control, and the results of the experiment are shown in FIG. 3C. Western blot results also showed that the levels of GFP protein in camta3-3, camta3-4 were much higher than in the control.

To determine that CAMTA3 affected post-transcriptional gene silencing but not other biological processes resulted in increased GFP mRNA and protein levels, we also extracted small RNAs from the leaves of the GFP-injected region in the common 16C plants and CAMTA3-3, CAMTA3-4 lines, and detected siGFP levels using GFP fragments as probes, with U6 as an internal control. The primers used for the probe with GFP fragment are as follows:

SiGFP F(SEQ ID NO:17):ATGAGTAAAGGAGAAGAACTTTTC

SiGFP R(SEQ ID NO:18):TTTGTATAGTTCATCCATGC

as shown in FIG. 3D, the results showed that the siRNA production by the leaves of the GFP injection area in camta3-3, camta3-4 plants was much less than that of the ordinary 16C plants. These results indicate that the post-transcriptional gene silencing function of plants is affected after knocking out CAMTA3 gene using CRISPR-Cas9 system.

Wherein, the small RNA extraction steps are as follows:

(1) The plant powder was ground with liquid nitrogen, about 5mL of the powder was taken, 8mL of RNAiso Plus (Takara, 9109) was added, and mixed by vortex shaker. And standing for 15 minutes.

(2) 3mL of chloroform was added to each tube, mixed well, placed in a four-degree centrifuge, centrifuged at 45000rpm,4 ℃ for 1 hour.

(3) 1.5mL of 8 new EP tubes were taken, 750. Mu.L of isopropanol was added to each tube, and the centrifuged supernatant was pipetted into each tube. (isopropanol needs to be precooled in advance, about 750 mu L of supernatant is added into each tube), the EP tube is inverted from top to bottom for 20 times, and the tubes are placed into a refrigerator with the temperature of minus 20 ℃ for refrigeration for 30 minutes.

(4) The EP tube was removed, centrifuged at 12000rpm at 4 ℃ for 15 minutes.

(5) The supernatant was discarded, and 1mL of 75% DEPC-ethanol solution was added to each tube, and the pellet was blown up by a lance tip, and 8 tubes of pellets were synthesized into 2 tubes.

(6) Centrifuge at 12000rpm for 1 min at 4 ℃ and pour off the supernatant and suck off the supernatant. And opening the cover and drying for 10 minutes.

(7) To each tube, 308. Mu.L of DEPC water was added and dissolved.

(8) Add 70. Mu.L PEG8000, 42. Mu.L 5M NaCl to each tube. Mix well with vortex shaker.

(9) Standing on ice for 1 hr, centrifuging at 12000rpm for 10 min in 4 deg.C centrifuge, collecting supernatant, discarding precipitate, adding the supernatant into new tube, adding 1mL anhydrous ethanol into each tube, and mixing.

(10) Placing the EP tube into a refrigerator at the temperature of 20 ℃ below zero for 2 hours, centrifuging at the temperature of 4 ℃ for 10 minutes at 12000rpm, pouring out the supernatant, spin-drying, sucking up the supernatant, and opening the cover to dry for 5 minutes.

(11) 50 μ L of DEPC water was added to each tube to dissolve. mu.L of the solution was used for determination of the concentration by Nano drop.

We then constructed a CAMTA3 functionally attenuated mutant 35s ^K979E (represents a mutant carrying the 35S promoter, HA protein tag and CAMTA3 gene, in which amino acid 979 of the protein expressed by the CAMTA3 gene is mutated from K to E), and GFP was compared to 35S HA-nLUC, 35S HA-CAMTA3 or 35S ^K979E Differences in GFP expression were observed by co-injection of agrobacterium into the present smoke.

Wherein the primers used in the construction of the impaired function mutants are as follows:

CAMTA3 ^K979E F(SEQ ID NO:19):CTTAGAGGAGGTAATTTTGCGAT

CAMTA3 ^K979E R(SEQ ID NO:20):CAAAATTACCTCCTCTAAGATCCC

mixing the mixture of HA-nLUC, HA-CAMTA3 and HA-CAMTA3 ^K979E The agrobacterium of (2) is co-injected into the leaves of the Nicotiana benthamiana together with agrobacterium containing GFP vectors. Photographs were observed 4 days after injection. As shown in FIGS. 3E and 3H, the experiments found that when GFP was compared with 35S, HA-CAMTA3 ^K979E After co-expression, GFP fluorescence was weaker than 35S for HA-nLUC group, but fluorescence intensity was stronger than 35S for HA-CAMTA3 group.

And extracting the total RNA of the tobacco leaf in the injection area, and carrying out qRT-PCR detection. mRNA levels of GFP were measured. Statistical variance was calculated using student's t method, representing p <0.05, representing p <0.01. Extracting the total protein of the tobacco leaf in the injection area, and detecting the expression quantity of GFP in the plant by Western blot. Extracting small RNA of tobacco leaves in the injection area, detecting the level of the siGFP by taking the GFP fragment as a probe, and taking U6 as an internal reference.

As shown at 3F, 3H and 3G in fig. 3. HA-CAMTA3 ^K979E The amount of mRNA and protein of GFP in the leaf blades of the group is less than that of the HA-nLUC group, but more than that of the HA-CAMTA3 group, and HA-CAMTA3 ^K979E The amount of GFP-mediated siRNA in the injected leaves was also greater than in the HA-nLUC group but less than in the HA-CAMTA3 group. This indicates that CAMTA3 can positively regulate RNAi, and the regulation process depends on the function of CAMTA3.

Example 5

The foregoing examples have investigated that CAMTA3 promotes transcription of the RDR6 gene and enhances post-transcriptional gene silencing. Since RNAi can be directly involved in viral infection, whether the positive regulator CAMTA, which is the RANi pathway, can also enhance plant resistance to CLCuMuV (Auricularia-Tannata-type Cotton leaf curl Virus) and? To confirm this guess, we used the previously mentioned camta3 transgenic tobacco as the experimental material, followed by inoculation of CLCuMuV with agrobacterium. Agrobacterium containing CLCuMuV was injected into wild type, camta3-1 and camta3-2 plants and the disease phenotype was observed and photographed 16 days after injection. And detecting the quantity of CLCuMuV small RNA by a Northern blot method. Southern blot was used to detect the amount of V1 in the vaccinated plants.

Wherein the primers used are:

CLCuMuV V1 label F(SEQ ID NO:21)CGACGACAAGACCGTcaccATGTCGAAGCGAGCTGC

CLCuMuV V1 label R(SEQ ID NO:22):GAGGAGAAGAGCCGTcgTCAATTCGTTACAGAGTCATAAAAATATAT

as shown in FIG. 4, A in FIG. 4 is the result of observing the phenotype of disease and photographing 16 days after injecting Agrobacterium containing CLCuMuV into wild type, camta3-1 and camta3-2 plants; b, detecting the quantity of CLCuMuV small RNA by using Northern Blot; c is the amount of V1 in the inoculated plants detected by Southern blot. The results show that the morbidity symptoms of the geminivirus on the camta3 transgenic tobacco are obviously higher than those of a control group, further Southern blot experiments prove the morbidity phenotype results, and the CLCuMuV amount in the camta3 transgenic tobacco can be obviously higher than the virus amount in the control tobacco through strip comparison; and the amount of siRNA was also significantly higher than the control. These results indicate that CAMTA3 is able to positively modulate resistance to CLCuMuV.

Is CAMTA3 positively involved in plant resistance to DNA viruses (CLCuMuV) and also enhances plant resistance to RNA viruses? We used camta3 transgenic tobacco as experimental material, followed by Agrobacterium inoculation with Plum Pox Virus (PPV). Agrobacterium containing PPV was injected into wild type, camta3-1 and camta3-2 plants and the disease phenotype was observed and photographed 5 days after injection. And detecting the amount of PPV in the inoculated plants by using a qRT-PCR method.

Wherein the primers used are:

qRT-PPV F’(SEQ ID NO:23)TCAAACGCGCTAGTCAACAC

qRT-PPV R’(SEQ ID NO:24)TGCCAAATGGTTCAAGTTCA

as shown in FIG. 5, it can be seen from A in FIG. 5 that the symptoms of the pathogenesis of plum pox virus in camta3 transgenic tobacco are significantly higher than in the control group, and the results of the qRT-PCR experiment shown in B in FIG. 5 further confirm the results of the pathogenesis phenotype. These results indicate that CAMTA3 can positively modulate resistance to PPV.

In the description of the specification, reference to the description of "one embodiment," "some embodiments," "an example," "a specific example," or "some examples" or the like means that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. In this specification, the schematic representations of the terms used above are not necessarily intended to refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, various embodiments or examples and features of different embodiments or examples described in this specification can be combined and combined by one skilled in the art without contradiction.

Although embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are exemplary and not to be construed as limiting the present invention, and that changes, modifications, substitutions and alterations can be made to the above embodiments by those of ordinary skill in the art within the scope of the present invention.

SEQUENCE LISTING

<110> Qinghua university

<120> CAMTA3 gene and application thereof in plants

<130> BI3210188

<160> 24

<170> PatentIn version 3.5

<210> 1

<211> 3306

<212> DNA

<213> Artificial Sequence

<220>

<223> CAMTA3 Gene or active fragment thereof

<400> 1

atggctgaca gtaggcgtta tggtctgaat gctcaactag atattgatca gatactttta 60

gaagcacaac atagatggct acgccctgct gaaatttgcg aaattcttaa aaactatcag 120

aagttccgga ttgctccaga gcctccaaat aggcctccaa gtggttcact gtttcttttt 180

gatcggaagg ttttacggta ttttcgcaaa gatggccata gctggagaaa gaaaaaagat 240

gggaagactg tgaaggaggc tcacgagagg ctcaaggccg gaagcattga tgtattgcac 300

tgctactatg cccatggaga agagaatgag catttccaaa gacgcagcta ttggatgctc 360

gaagaggaaa tgtcacatat tgttcttgtc cactacaggg aagtaaaggg taccaggaca 420

aattttagcc gtaccagaga acctcaagaa gctactcctc gttctcaaga aactgatgaa 480

gatgtacaca gctctgaggt ggacagttct gcatctacaa aattttatcc aaacgattac 540

caagtgagct cacaagtcac tgacgcgacc agccttagca gtgcgcaggc ctcaggatat 600

gaggatgctg aatcagcgta caatcaacat ccaacttctg gatttcactc attccttgat 660

gctcagccaa gtatgatgca gaaagctgga gagagccttc ctgtacctta tcatccgatt 720

cccttctcaa atgatcatca agtacagttt gcaggaagtt ctgatatgga tttcttctcg 780

agcgcaccag gaaataagag tggaaataca gcaaatatgt atatacccag caggaacctt 840

gacttcccat catgggagac aatttcagtg aataatcctg ctgcatatca gtcttaccat 900

tttcagcctt ctagccagtc aggtgcaaat aatatgacac atgaacaagg aagcactaca 960

acgggtcaag tattcttaaa tgacttcaaa aaacagggtc agaaccgcat tgacggcctg 1020

ggagactggc agacttctga aggtgatgct gcatttatat ccaagtggtc catggatcag 1080

aagttgaatc tgaatttggc atctgatcat accatcaggt ctagtgctgc atataatgta 1140

gaacttcaca attccttgga ggcttcccat atacttcctt cccaccaaga aaaacatcca 1200

atgcagaatg aacttccatc acaacattca gacgcaaatg ttggaggctc tctaaatgct 1260

gaattagatc acaatctaag cataggggtc agaaccgatc attcatcttt aaaacaacct 1320

ttgttagatg gtgtcttgag agaaggttta aagaagcttg atagctttga ccggtggatg 1380

agtaaggaac ttgaagatgt gagtgagcca catatgcaat ccaattctag ttcctattgg 1440

gataatgttg gagatgacga gggagttgat aattccacaa ttgcttcgca agtgcagtta 1500

gacacctaca tgctaagtcc ttcactctcc caagatcagt tctttagcat tattgatttc 1560

tcaccaagct gggcatttgc tgggtcagaa attaaggttc tcatcaccgg gaagtttttg 1620

aaatcccagc cagaagtgga gaagtgggca tgcatgtttg gtgagttgga agttccagca 1680

gaagtaatag ctgatggtgt tctacgctgc catacaccta atcaaaaggc aggaagggtt 1740

ccattttata taacatgttc caataggttg gcatgtagtg aagtaagaga atttgaattt 1800

agggtcagtg agagccaaga tgttgatgtt gcaaatagtt gcagctccag tgaaagtctt 1860

cttcatatga gattcggaaa attattatct ttggaatcca ctgtttcccc aagttctcca 1920

cctcgcagcg aggatgatgt ttcccatgtg tgcagtaaaa tcaattcatt gctaaaagag 1980

gatgacaatg agtgggaaga aatgttgaac cttacttatg agaacaactt tatggcggag 2040

aaggtaaaag accagctcct acaaaagctt ctaaaagaga agttgcgtgt ttggctcctc 2100

caaaaggttg ctgaaggcgg taaaggccct aacgtactgg acgagggtgg tcaaggagtc 2160

ctacattttg cagccgctct tggttatgac tgggctatac cacctactat agctacaggt 2220

gtaagcgtca atttccgaga tgtgaatgga tggactgcac tccattgggc agcatcatat 2280

ggaagagagc ggacagtggg tttcctcatc tccttaggtg cagctcctgg agcattgaca 2340

gatcctactc ctaaacatcc ttcaggaaga acacctgctg acttagcttc tagcaatgga 2400

cataaaggaa ttgctggtta tttagcagag tcatccttaa gctcccacct ttcttctctc 2460

gagttgaagg aaatgaagca gggtgagaat gtgcaaccct ttggagaggc tgttcaaaca 2520

gtttctgaac ggtcagctac gccagcttgg gatggtgact ggccacatgg agtctcattg 2580

aaggattctc tagctgctgt tcgtaatgca actcaagcag ccgctcgtat tcaccaagtc 2640

ttcagggtgc agtcgttcca gaggaagcag ctaaaagaac acggtggcag tgaatttgga 2700

ctatcagatg agcatgctct ctctcttctt gctttgaaga caaacaaggc tggtcaacat 2760

gatgagccgg tacacactgc tgcggtgcgt atacaaaata aatttcgcag ttggaaggga 2820

agaagagact atcttcttat ccgccaacga attattaaaa ttcaggctca tgtaagagga 2880

caccaggtaa ggaacaaata caaaaacata atatggtctg tggggatctt agagaaggta 2940

attttgcgat ggaggcggaa aggaagtgga ttgcgtgggt ttaaaccaga agcaacactt 3000

actgaaggaa gcaacacgca agatcgacca gtgcaggagg atgactatga ttttttaaaa 3060

gaaggcagaa agcaaactga gcaaaggttg cagaaggctc tggcaagggt aaaatcgatg 3120

gttcaatatc ctgaggccag ggatcaatat cggaggctgc tgaatgttgt gtctgacatg 3180

aaggacacca cgacttcgag cgatggtgca cctagcaact ctggggaagc agctgatttc 3240

ggtgacgatt tgatcgatct tgatgatcta ttggacgatg acacttttat gtctacagca 3300

ccttga 3306

<210> 2

<211> 1101

<212> PRT

<213> Artificial Sequence

<220>

<223> CAMTA3 gene or active fragment thereof encodes amino acid

<400> 2

Met Ala Asp Ser Arg Arg Tyr Gly Leu Asn Ala Gln Leu Asp Ile Asp

1 5 10 15

Gln Ile Leu Leu Glu Ala Gln His Arg Trp Leu Arg Pro Ala Glu Ile

20 25 30

Cys Glu Ile Leu Lys Asn Tyr Gln Lys Phe Arg Ile Ala Pro Glu Pro

35 40 45

Pro Asn Arg Pro Pro Ser Gly Ser Leu Phe Leu Phe Asp Arg Lys Val

50 55 60

Leu Arg Tyr Phe Arg Lys Asp Gly His Ser Trp Arg Lys Lys Lys Asp

65 70 75 80

Gly Lys Thr Val Lys Glu Ala His Glu Arg Leu Lys Ala Gly Ser Ile

85 90 95

Asp Val Leu His Cys Tyr Tyr Ala His Gly Glu Glu Asn Glu His Phe

100 105 110

Gln Arg Arg Ser Tyr Trp Met Leu Glu Glu Glu Met Ser His Ile Val

115 120 125

Leu Val His Tyr Arg Glu Val Lys Gly Thr Arg Thr Asn Phe Ser Arg

130 135 140

Thr Arg Glu Pro Gln Glu Ala Thr Pro Arg Ser Gln Glu Thr Asp Glu

145 150 155 160

Asp Val His Ser Ser Glu Val Asp Ser Ser Ala Ser Thr Lys Phe Tyr

165 170 175

Pro Asn Asp Tyr Gln Val Ser Ser Gln Val Thr Asp Ala Thr Ser Leu

180 185 190

Ser Ser Ala Gln Ala Ser Gly Tyr Glu Asp Ala Glu Ser Ala Tyr Asn

195 200 205

Gln His Pro Thr Ser Gly Phe His Ser Phe Leu Asp Ala Gln Pro Ser

210 215 220

Met Met Gln Lys Ala Gly Glu Ser Leu Pro Val Pro Tyr His Pro Ile

225 230 235 240

Pro Phe Ser Asn Asp His Gln Val Gln Phe Ala Gly Ser Ser Asp Met

245 250 255

Asp Phe Phe Ser Ser Ala Pro Gly Asn Lys Ser Gly Asn Thr Ala Asn

260 265 270

Met Tyr Ile Pro Ser Arg Asn Leu Asp Phe Pro Ser Trp Glu Thr Ile

275 280 285

Ser Val Asn Asn Pro Ala Ala Tyr Gln Ser Tyr His Phe Gln Pro Ser

290 295 300

Ser Gln Ser Gly Ala Asn Asn Met Thr His Glu Gln Gly Ser Thr Thr

305 310 315 320

Thr Gly Gln Val Phe Leu Asn Asp Phe Lys Lys Gln Gly Gln Asn Arg

325 330 335

Ile Asp Gly Leu Gly Asp Trp Gln Thr Ser Glu Gly Asp Ala Ala Phe

340 345 350

Ile Ser Lys Trp Ser Met Asp Gln Lys Leu Asn Leu Asn Leu Ala Ser

355 360 365

Asp His Thr Ile Arg Ser Ser Ala Ala Tyr Asn Val Glu Leu His Asn

370 375 380

Ser Leu Glu Ala Ser His Ile Leu Pro Ser His Gln Glu Lys His Pro

385 390 395 400

Met Gln Asn Glu Leu Pro Ser Gln His Ser Asp Ala Asn Val Gly Gly

405 410 415

Ser Leu Asn Ala Glu Leu Asp His Asn Leu Ser Ile Gly Val Arg Thr

420 425 430

Asp His Ser Ser Leu Lys Gln Pro Leu Leu Asp Gly Val Leu Arg Glu

435 440 445

Gly Leu Lys Lys Leu Asp Ser Phe Asp Arg Trp Met Ser Lys Glu Leu

450 455 460

Glu Asp Val Ser Glu Pro His Met Gln Ser Asn Ser Ser Ser Tyr Trp

465 470 475 480

Asp Asn Val Gly Asp Asp Glu Gly Val Asp Asn Ser Thr Ile Ala Ser

485 490 495

Gln Val Gln Leu Asp Thr Tyr Met Leu Ser Pro Ser Leu Ser Gln Asp

500 505 510

Gln Phe Phe Ser Ile Ile Asp Phe Ser Pro Ser Trp Ala Phe Ala Gly

515 520 525

Ser Glu Ile Lys Val Leu Ile Thr Gly Lys Phe Leu Lys Ser Gln Pro

530 535 540

Glu Val Glu Lys Trp Ala Cys Met Phe Gly Glu Leu Glu Val Pro Ala

545 550 555 560

Glu Val Ile Ala Asp Gly Val Leu Arg Cys His Thr Pro Asn Gln Lys

565 570 575

Ala Gly Arg Val Pro Phe Tyr Ile Thr Cys Ser Asn Arg Leu Ala Cys

580 585 590

Ser Glu Val Arg Glu Phe Glu Phe Arg Val Ser Glu Ser Gln Asp Val

595 600 605

Asp Val Ala Asn Ser Cys Ser Ser Ser Glu Ser Leu Leu His Met Arg

610 615 620

Phe Gly Lys Leu Leu Ser Leu Glu Ser Thr Val Ser Pro Ser Ser Pro

625 630 635 640

Pro Arg Ser Glu Asp Asp Val Ser His Val Cys Ser Lys Ile Asn Ser

645 650 655

Leu Leu Lys Glu Asp Asp Asn Glu Trp Glu Glu Met Leu Asn Leu Thr

660 665 670

Tyr Glu Asn Asn Phe Met Ala Glu Lys Val Lys Asp Gln Leu Leu Gln

675 680 685

Lys Leu Leu Lys Glu Lys Leu Arg Val Trp Leu Leu Gln Lys Val Ala

690 695 700

Glu Gly Gly Lys Gly Pro Asn Val Leu Asp Glu Gly Gly Gln Gly Val

705 710 715 720

Leu His Phe Ala Ala Ala Leu Gly Tyr Asp Trp Ala Ile Pro Pro Thr

725 730 735

Ile Ala Thr Gly Val Ser Val Asn Phe Arg Asp Val Asn Gly Trp Thr

740 745 750

Ala Leu His Trp Ala Ala Ser Tyr Gly Arg Glu Arg Thr Val Gly Phe

755 760 765

Leu Ile Ser Leu Gly Ala Ala Pro Gly Ala Leu Thr Asp Pro Thr Pro

770 775 780

Lys His Pro Ser Gly Arg Thr Pro Ala Asp Leu Ala Ser Ser Asn Gly

785 790 795 800

His Lys Gly Ile Ala Gly Tyr Leu Ala Glu Ser Ser Leu Ser Ser His

805 810 815

Leu Ser Ser Leu Glu Leu Lys Glu Met Lys Gln Gly Glu Asn Val Gln

820 825 830

Pro Phe Gly Glu Ala Val Gln Thr Val Ser Glu Arg Ser Ala Thr Pro

835 840 845

Ala Trp Asp Gly Asp Trp Pro His Gly Val Ser Leu Lys Asp Ser Leu

850 855 860

Ala Ala Val Arg Asn Ala Thr Gln Ala Ala Ala Arg Ile His Gln Val

865 870 875 880

Phe Arg Val Gln Ser Phe Gln Arg Lys Gln Leu Lys Glu His Gly Gly

885 890 895

Ser Glu Phe Gly Leu Ser Asp Glu His Ala Leu Ser Leu Leu Ala Leu

900 905 910

Lys Thr Asn Lys Ala Gly Gln His Asp Glu Pro Val His Thr Ala Ala

915 920 925

Val Arg Ile Gln Asn Lys Phe Arg Ser Trp Lys Gly Arg Arg Asp Tyr

930 935 940

Leu Leu Ile Arg Gln Arg Ile Ile Lys Ile Gln Ala His Val Arg Gly

945 950 955 960

His Gln Val Arg Asn Lys Tyr Lys Asn Ile Ile Trp Ser Val Gly Ile

965 970 975

Leu Glu Lys Val Ile Leu Arg Trp Arg Arg Lys Gly Ser Gly Leu Arg

980 985 990

Gly Phe Lys Pro Glu Ala Thr Leu Thr Glu Gly Ser Asn Thr Gln Asp

995 1000 1005

Arg Pro Val Gln Glu Asp Asp Tyr Asp Phe Leu Lys Glu Gly Arg

1010 1015 1020

Lys Gln Thr Glu Gln Arg Leu Gln Lys Ala Leu Ala Arg Val Lys

1025 1030 1035

Ser Met Val Gln Tyr Pro Glu Ala Arg Asp Gln Tyr Arg Arg Leu

1040 1045 1050

Leu Asn Val Val Ser Asp Met Lys Asp Thr Thr Thr Ser Ser Asp

1055 1060 1065

Gly Ala Pro Ser Asn Ser Gly Glu Ala Ala Asp Phe Gly Asp Asp

1070 1075 1080

Leu Ile Asp Leu Asp Asp Leu Leu Asp Asp Asp Thr Phe Met Ser

1085 1090 1095

Thr Ala Pro

1100

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> qRT-Actin F'

<400> 3

cccagagagg aaatacagtg 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> qRT-Actin R'

<400> 4

caatagacgg accagattcg 20

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> qRT-NbRDR6 F'

<400> 5

tgtcaaccct ccttctgctt 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> qRT-NbRDR6 R'

<400> 6

gcagggttac tatttgccgg 20

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> qRT-NbCAMTA3 F'

<400> 7

taattttgcg atggaggcgg 20

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> qRT-NbCAMTA3

<400> 8

ccgatattga tccctggcct 20

<210> 9

<211> 40

<212> DNA

<213> Artificial Sequence

<220>

<223> LIC1+NbCAMTA3

<400> 9

cgacgacaag accgtcacca tggctgacag taggcgttat 40

<210> 10

<211> 42

<212> DNA

<213> Artificial Sequence

<220>

<223> LIC2+NbCAMTA3

<400> 10

gaggagaaga gccgtcgtca aggtgctgta gacataaaag tg 42

<210> 11

<211> 35

<212> DNA

<213> Artificial Sequence

<220>

<223> EMSA RDR6pro F

<400> 11

tactcgaaac atccttcccg cgtgaaaaag gaacc 35

<210> 12

<211> 35

<212> DNA

<213> Artificial Sequence

<220>

<223> EMSA RDR6pro R

<400> 12

ggttcctttt tcacgcggga aggatgtttc gagta 35

<210> 13

<211> 35

<212> DNA

<213> Artificial Sequence

<220>

<223> EMSA-RDR6pro probe F

<400> 13

tactcgaaac atccttcccg cgtgaaaaag gaacc 35

<210> 14

<211> 35

<212> DNA

<213> Artificial Sequence

<220>

<223> EMSA-RDR6pro probe R

<400> 14

ggttcctttt tcacgcggga aggatgtttc gagta 35

<210> 15

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> qRT-GFP F'

<400> 15

atgggcacaa attttctgtc a 21

<210> 16

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> qRT-GFP R'

<400> 16

tcctctcctg cacgtatcc 19

<210> 17

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> SiGFP F

<400> 17

atgagtaaag gagaagaact tttc 24

<210> 18

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> SiGFP R

<400> 18

tttgtatagt tcatccatgc 20

<210> 19

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<223> CAMTA3K979E F

<400> 19

cttagaggag gtaattttgc gat 23

<210> 20

<211> 24

<212> DNA

<213> CAMTA3K979E R

<400> 20

caaaattacc tcctctaaga tccc 24

<210> 21

<211> 36

<212> DNA

<213> Artificial Sequence

<220>

<223> CLCuMuV V1 label F

<400> 21

cgacgacaag accgtcacca tgtcgaagcg agctgc 36

<210> 22

<211> 47

<212> DNA

<213> Artificial Sequence

<220>

<223> CLCuMuV V1 label R

<400> 22

gaggagaaga gccgtcgtca attcgttaca gagtcataaa aatatat 47

<210> 23

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> qRT-PPV F'

<400> 23

tcaaacgcgc tagtcaacac 20

<210> 24

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> qRT-PPV R'

<400> 24

tgccaaatgg ttcaagttca 20

Claims

1.CAMTA3Use of a gene or active fragment thereof to promote RNA silencing in a plant;

the describedCAMTA3The gene or the active fragment thereof has a sequence shown as SEQ ID NO. 1; the plant is tobacco;

optionally, theCAMTA3The gene or active fragment thereof is coded as SEQ ID NO 2.

2.CAMTA3The use of a gene or an active fragment thereof in the field of plant virus resistance, wherein the plant is tobacco;

the above-mentionedCAMTA3The gene or the active fragment thereof has a sequence shown as SEQ ID NO. 1.

3. Use according to claim 2, characterized in that saidCAMTA3The gene or the active fragment thereof codes an amino acid sequence shown as SEQ ID NO. 2.

4. A method of making a transgenic plant comprising:

make the target plant bodyCAMTA3Expressing a gene or an active fragment thereof at a level different from that of a wild type of the target plant so as to obtain the transgenic plant;

the target plant is tobacco;

5. The method of claim 4, comprising:

allowing the target plant to overexpress theCAMTA3A gene or an active fragment thereof;

optionally, mixingCAMTA3Introducing the gene or the active fragment thereof into a target plant body, so that the CAMTA3 gene or the active fragment thereof is over-expressed in the target plant body; optionally, theCAMTA3Genes or active fragments thereof by containing the sameCAMTA3An expression vector for the gene or an active fragment thereof is introduced into a target plant.

6. The method of claim 4, comprising:

so that the target plant is low expressed or not expressed in vivoCAMTA3A gene or an active fragment thereof;

optionally, knocking out the target using Crispr-Cas9 technologyIn vivoCAMTA3The gene or active fragment thereof or the gene mutation technology is utilized to ensure that the target plant is low expressed or not expressed in vivoCAMTA3A gene or an active fragment thereof.

7. A method of promoting expression of a foreign protein in a plant, comprising:

introducing a gene encoding a foreign protein into the plant to promote the expression of the foreign protein in the plant obtained by the method according to claim 6, wherein the plant is low-expressed or non-expressed in vivoCAMTA3A gene or an active fragment thereof, saidCAMTA3The gene or the active fragment thereof has a sequence shown as SEQ ID NO. 1;

the plant is tobacco.

8. The method of claim 7, wherein the foreign protein is a GFP protein.

9. Use of an expression vector for RNA silencing in plants, wherein said expression vector comprisesCAMTA3A gene or an active fragment thereof; the above-mentionedCAMTA3The gene or the active fragment thereof has a sequence shown as SEQ ID NO. 1; the plant is tobacco.

10. Use according to claim 9, wherein the expression vector is a plasmid.

11.CAMTA3Use of a gene or an active fragment thereof in the manufacture of a kit for promoting RNA silencing in a plant; the above-mentionedCAMTA3The gene or the active fragment thereof has a sequence shown as SEQ ID NO. 1; the plant is tobacco.