CN110129322A - Application of Bna-miR393 during regulating and controlling cabbage type rape reproductive development - Google Patents
Application of Bna-miR393 during regulating and controlling cabbage type rape reproductive development Download PDFInfo
- Publication number
- CN110129322A CN110129322A CN201910269331.8A CN201910269331A CN110129322A CN 110129322 A CN110129322 A CN 110129322A CN 201910269331 A CN201910269331 A CN 201910269331A CN 110129322 A CN110129322 A CN 110129322A
- Authority
- CN
- China
- Prior art keywords
- mir393
- type rape
- cabbage type
- bna
- dna fragmentation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
Abstract
The present invention relates to application of Bna-miR393 during regulating and controlling cabbage type rape reproductive development.More particularly to separation, clone and a kind of DNA fragmentation comprising Bna-miR393 precursor sequence (pre-miR393) of application, for sequence as shown in SEQ ID NO:1, sequence length is 618 bp, and corresponding maturation miRNA sequence is as shown in SEQ ID NO:2.The functional analysis of cabbage type rape genetic transformation shows that Bna-miR393 participates in the development of regulation cabbage type rape reproductive organs, this has a very important significance the improvement of cabbage type rape genetic breeding.
Description
Technical field
The present invention relates to cabbage type rape genetic engineering fields.It is obtained more particularly to separation, clone and by functional verification
A kind of cabbage type rape Bna-miR393 that can influence reproductive development answering in the improvement of cabbage type rape genetic breeding
With.The method that the present invention uses RT-PCR, is separated to the DNA fragmentation comprising cabbage type rape Bna-miR393 precursor sequence, mistake
Amount expression Bna-miR393 can influence the development of cabbage type rape reproductive organs, it was confirmed that the function and its application of the miRNA
Approach.
Background technique
Cabbage type rape (Brassica napusL.) it is the main rape cultivation type in China, there is high yield, resistance
By force, the features such as wide adaptability.MiRNA is the endogenous non-coding tiny RNA that a kind of length is about 21-24 nt.Mirnas of plant be by
DCL1 shear enzyme to primary transcript shearing, mature miRNA sequence in conjunction with the silencing complex that RNA is mediated,
It identifies the target gene complementary with miRNA sequence, realizes eventually by shearing or Translational repression is carried out to target gene to target gene
Regulation.With the development of high throughput sequencing technologies, numerous studies find that miRNA participates in many aspects of plant growth and development,
Including (the D'Ario such as seed sprouting, leaf morphology, Floral differentiation and development, the development of root, the transformation in trophophase to reproduction period
M, Griffiths-Jones S, Kim M. Small RNAs: big impact on plant development.
Trends Plant Sci, 2017,22 (12): 1056-1068)；In addition, miRNA is in plant disease-resistant and resists abiotic
Stress etc. also plays a significant role.MiR393 is miRNA family more conservative in plant, target gene encoding growth element
Receptor protein TIR1, AFB1/2/3 etc., albuminoid participation auxin signal perception and Aux/IAA protein degradation, and Aux/IAA
Albumen can be by inhibiting auxin related gene expression with the interactions such as ARF, thus regulating growth of plants and to biology
With response (Parry G, Calderon-Villalobos LI, Prigge M, the et al. Complex of abiotic stress
regulation of the TIR1/AFB family of auxin receptors. Proc Natl Acad Sci USA,
2009,106 (52): 22540-22545).Studies have shown that key effect of miR393 during plants antimicrobial, intends
MiR393 is overexpressed in southern mustard can be improved resistivity (the Navarro L, Dunoyer of plant pair external source germ bacterium infection
P, Jay F, et al. A plant miRNA contributes to antibacterial resistance by
Repressing auxin signaling. Science, 2006,312 (5772): 436).
The entirely different cabbage type rape of Reproductive organ morphology phenotype is obtained using transgenic technology to have not been reported yet.
Summary of the invention
The object of the present invention is to provide the sequence of cabbage type rape Bna-miR393 and functions, and further disclose this
Application of the miRNA in regulation cabbage type rape reproductive development.
The present invention passes through the reproductive organs different development stage of cabbage type rape early period using cabbage type rape as research material
RNA-seq comparative analysis finds that Bna-miR393 notable difference during the reproductive development of cabbage type rape is expressed, says
The bright miRNA may participate in the development of regulation cabbage type rape reproductive organs.Therefore, separation includes wild cabbage from cabbage type rape
The DNA fragmentation of type rape Bna-miR393 precursor sequence, and identify Bna-miR393 in cabbage type rape reproductive development mistake
Function played in journey will have very important significance for the improvement of cabbage type rape genetic breeding.
Present invention separation and application are a kind of comprising Bna-miR393 precursor sequence (also known as precursor miRNA, precursor miRNA
(pre-miRNA) be a part in 618bp) DNA fragmentation, sequence is as shown in SEQ ID NO:1, sequence length 618
Bp, for corresponding miRNA mature sequence as shown in SEQ ID NO:2, maturation miRNA has regulation cabbage type rape genitals
The ability of official's development.Using Agrobacterium-mediated transformation into wild type cabbage type rape plant, and it is studied in Wild cabbage type oil
The intracorporal biological function of dish provides excellent basis in the application of cabbage type rape genetic breeding for Bna-miR393.
It is an object of the invention to obtain the mature miRNA of regulation cabbage type rape reproductive development, sequence is such as
Shown in SEQ ID NO:2.
A further object of the present invention be to provide the expression cassette containing aforementioned DNA fragmentation, recombinant vector, recombinant microorganism or
Transgenic cell line.
A further object of the present invention is to provide the application of (a1) or (a2):
(a1) cabbage type rape Bna-miR393 above-mentioned or DNA fragmentation above-mentioned or expression cassette above-mentioned, recombinant vector, again
Group microorganism or transgenic cell line, the application in regulation cabbage type rape reproductive development, Reproductive organ morphology phenotype；
(a2) cabbage type rape Bna-miR393 above-mentioned or DNA fragmentation above-mentioned or expression cassette above-mentioned, recombinant vector, again
Group microorganism or transgenic cell tie up to the application in cabbage type rape genetic breeding.
The present invention also provides a kind of breeding methods of genetically modified plants for changing target plant Reproductive organ morphology, to improve
The content of miRNA described in target plant, obtains genetically modified plants；With above-mentioned comprising cabbage type rape Bna-miR393 precursor
The DNA fragmentation of sequence converts target plant, obtains genetically modified plants；The Reproductive organ morphology phenotype of the genetically modified plants is obvious
It is different from the target plant.
Breeding method specifically include the following steps:
(1) clone includes the DNA fragmentation of cabbage type rape Bna-miR393 precursor sequence；
(2) plasmid with cabbage type rape Bna-miR393 precursor sequence is converted into Agrobacterium using electric shocking method；
(3) Agrobacterium with conversion plasmid is converted into target plant using transgenic method, obtains genetically modified plants.
The expression vector for carrying DNA fragmentation of the present invention comprising Bna-miR393 precursor sequence can be by using Ti matter
Grain, plant viral vector, the standard biologics technical method such as directly delivered DNA, microinjection, electroporated import plant cell
(Weissbach, 1998, Method for Plant Molecular Biology VIII, Academy Press, New
York, pp.411-463; Geiserson and Corey, 1998, Plant Molecular Biology (2nd
Edition)).
The expression vector including the DNA fragmentation comprising Bna-miR393 precursor sequence of the invention can be used to convert host
(various plants including cabbage type rape) cultivate the plant variety of plant type improvement.
The above-mentioned DNA fragmentation comprising Bna-miR393 precursor sequence is recycled using DNA QIAquick Gel Extraction Kit, is connected using digestion
Method this segment is connected into pMDC83 skeleton carrier, construct the Overexpression vector of the DNA fragmentation, be named as pMDC83-
miR393。
Using electric robin by pMDC83-miR393 vector introduction Agrobacterium tumefaciems, Agrobacterium tumefaciens strain GV3101.
PMDC83-miR393 is converted into cabbage type rape acceptor material J9712 by the genetic transforming method that Agrobacterium infects mediation, at
Function obtains the transgenic plant that Bna-miR393 expression quantity is significantly improved relative to wild type, it has been observed that planting with wild type
Strain is compared, and significant change occurs for the transgenic brassica napus Reproductive organ morphology for being overexpressed Bna-miR393, illustrates Bna-
MiR393 can regulate and control the development of plant generative organ.
In conclusion the present invention is overexpressed Bna-miR393 transgenosis using cabbage type rape as research material, by analysis
The character mutation of the reproductive organs of cabbage type rape plant, it was found that one can regulate and control cabbage type rape reproductive development
Candidate miRNA, the miRNA may play an important role in the growth course of reproductive organs, and educate for the heredity of cabbage type rape
Kind provides important theoretical basis.
Detailed description of the invention
Sequence table SEQ ID NO:1 is the DNA fragmentation comprising Bna-miR393 precursor sequence of present invention separation clone,
Length is 618 bp；
Sequence table SEQ ID NO:2 is the sequence of mature Bna-miR393；
Expression of Fig. 1 Bna-miR393 in each tissue of cabbage type rape；
The expression of Bna-miR393 in Fig. 2 Bna-miR393 overexpressing plants, in figure: WT is Wild type control plants；
L1, L2, L7, L15 are Bna-miR393 transgenic brassica napus；
The reproductive organs phenotype of Fig. 3 Bna-miR393 overexpression transgenic brassica napus, in figure: WT is wild type control
Plant；L1, L2, L7, L15 are Bna-miR393 transgenic brassica napus.A: floral organ；B: silique；C: seed；D: petal face
Product；E: Pod length；F: seed diameter；G: mass of 1000 kernel.
Specific embodiment
Following embodiment defines the present invention, and describing the present invention in clone includes Bna-miR393 precursor sequence,
And the method for verifying Bna-miR393 function.It can be determined according to being described below with these embodiments, those skilled in the art
Essential characteristic of the invention, and without departing from the spirit and scope of the invention, various changes can be made to the present invention
And modification, so that it is suitable for different purposes and conditions.
Embodiment 1:qRT-PCR analyzes expression of the Bna-miR393 in each histoorgan of cabbage type rape
The each period different tissues sample of cabbage type rape is taken, is immediately placed in quick-frozen in liquid nitrogen, and 70 DEG C of refrigerators is transferred to and saves,
Until RNA is extracted.Total serum IgE extracting is extracted using the RNAiso Plus kit of TaKaRa company.It is tried using miRNA reverse transcription
Agent box (miRcute Plus miRNA First-StrandcDNA Synthesis Kit) and expression quantity detection kit SYBR
Green(miRcute Plus miRNA qPCR Detection Kit includes reversed universal primer), pass through poly (A) tailing
Method carries out qPCR detection to the expression of Bna-miR393.Upstream primer is the mature sequence of Bna-miR393: 5'-
TCCAAAGGGATCGCATTGATC -3'(SEQ ID NO:3), downstream primer is provided by kit.Using 5.8S RNA in
Join gene, internal control primer used are as follows: 5'- GTCTGCCTGGGTGTCACG -3'(SEQ ID NO:4), it is glimmering using ABI 7500
Fluorescent Quantitative PCR instrument carries out qPCR analysis.Response procedures are as follows: 95 DEG C of 10 min, 95 DEG C of 20 s, 58 DEG C of 34 s, acquisition fluorescence letter
Number, totally 40 recycle；60 DEG C 95 DEG C of to, every 1 DEG C of acquisition first order fluorescence signal continues 1 s.3 technologies are arranged in each sample
It repeats, after reaction, is analyzed and drawn with the software (7500 Software v2.0.1) that ABI7500 is carried, calculated
Relative expression quantity of the Bna-miR393 in each histoorgan of cabbage type rape, as shown in Figure 1.
Embodiment 2: the molecular cloning of cabbage type rape Bna-miR393 precursor sequence
Take cabbage type rape variety " Darmor-bzh " three leaf one heart stage seedling, liquid nitrogen flash freezer, place saved in -70 DEG C of refrigerators with
It is standby to extract total serum IgE.Total serum IgE extracting is extracted using the RNAiso Plus kit of Dalian TaKaRa company.Cabbage type rape cDNA
Synthesis said by the HiScript 1st Strand cDNA Synthesis Kit of Nanjing Vazyme Biotechnology Co., Ltd.
Bright book operation carries out the first chain synthesis.
It is amplification template with above-mentioned the first chain of cDNA, with the F:5'-AAGTTAAAGATGAGAAGG-3'(SEQ ID of design
NO:5) and R:5'-TTCAAGATGGGTCAG ATTCT-3'(SEQ ID NO:6) be primer, utilize RT-PCR carry out cDNA expansion
Increase, amplification condition are as follows: 94 DEG C of 3 min, 94 DEG C of 15 s, 59 DEG C of 15 s, 72 DEG C of 30 s, totally 35 recycle；72℃ 10
min.Electrophoretic analysis is carried out after PCR, and health is used to recycle purpose for the DNA QIAquick Gel Extraction Kit of century Biotechnology Co., Ltd
Amplified fragments.By the pEASY-Blunt carrier T of amplified fragments connection Beijing Quanshijin Biotechnology Co., Ltd, large intestine is converted
Bacillus competent cell, picking white colony carry out bacterium colony PCR and identify positive colony, and positive colony is sent to Yangzhou and holds up section's biology
Science and Technology Ltd.'s sequencing, is named as pre-miR393-T through the errorless plasmid of sequence verification.
The building of embodiment 3:Bna-miR393 Overexpression vector
In order to preferably analyze the function of Bna-miR393, applicant's overexpression in cabbage type rape by it passes through observation
The phenotype of transgenic plant studies the function of the miRNA.
Overexpression vector construction method is as follows: with the above-mentioned Bna-miR393 precursor sequence clone errorless through sequence verification
Vector plasmid pre-miR393-T is template, uses primer pre-miR393F:5'- TTAATTAAAAGTTAAAGATGAGAAGG
- 3') (SEQ ID NO:7) (additional connector of sequence specific primersPac I site) and pre-miR393 R:5'-
GGCGCGCCTTCAGATGGTCAGAT TCT-3') (SEQ ID NO:8) (additional connector of sequence specific primersAsc I
Point), DNA cloning, amplification condition are carried out using PCR are as follows: 94 DEG C of 3 min, 94 DEG C of 15 s, 60 DEG C of 15 s, 72 DEG C of 30 s, altogether
35 circulations；72℃ 10 min.Electrophoretic analysis is carried out after PCR, uses health for the DNA of century Biotechnology Co., Ltd
QIAquick Gel Extraction Kit recycles purpose amplified fragments.Amplified fragments are connected to the pEASY- of Beijing Quanshijin Biotechnology Co., Ltd
In Blunt carrier T, competent escherichia coli cell is converted, bacterium colony PCR is to identify positive colony for the progress of picking white colony, will
Positive colony is sent to the sequencing of Yangzhou Qing Ke Biotechnology Co., Ltd.Cloning vector plasmids comprising Bna-miR393 precursor sequence
ThroughPac I、Asc After I double digestion, target DNA fragment is recycled using DNA QIAquick Gel Extraction Kit, by this segment and corresponding digestion
PMDC83 skeleton carrier, which is connected, is built into the Overexpression vector of Bna-miR393, is named as pMDC83-miR393.
The cabbage type rape genetic transformation of embodiment 4:pMDC83-miR393 Overexpression vector
PMDC83-miR393 plasmid is imported in Agrobacterium tumefaciems GV3101 bacterial strain competent cell using electroporated method.It chooses
It takes single colonie to be inoculated in overnight incubation in 25 mL YEB culture mediums (containing 50 mg/L rifampins), 5 mL bacterium solutions is taken to be transferred to 100
In mL YEB culture medium (containing 50 mg/L rifampins), culture to OD600Bacterium solution is placed 10 min by=0.7-0.8 on ice,
5000 4 DEG C of rpm are centrifuged 10 min and collect thallus, and the cleaning of 100 mL aseptic double-distilled waters is added twice.4 mL, 10% glycerol is added
Suspension thalline is transferred in 50 mL centrifuge tubes.4 DEG C of 5500 rpm is centrifuged 10 min and collects thallus, and it is sweet that 500 μ L 10% are added
Thallus is resuspended in oil, is transferred in 1.5 mL centrifuge tubes.
50 μ L competent cells are taken, 5 μ L pMDC83-miR393 recombinant plasmids are added, are transferred to after being mixed with pipette tips
In 0.1 cm electrotransformation cup.Electrotransformation parameter: 500 μ L LB culture is added after electric shock immediately by 200 Ω, 1.7 KV, 2.5 F
Liquid.After 37 DEG C of 220 rpm cultivates 1 h, 100 μ L bacterium solutions is taken to be coated with the LB culture medium of Kanamycin resistance containing kanamycin
Screen transformant, 28 DEG C of 16 h of culture.
The genetic transforming method of cabbage type rape is to use for reference State Key Laboratory of Crop Genetic Improvent
Method for transformation improve after method be situated between using the hypocotyl of cabbage type rape aseptic seedlings as explant using Agrobacterium
Inducing defecation by enema and suppository realizes genetic transformation of the exogenous sequences in cabbage type rape.
Used medium formula is as follows:
Inoculation medium (M0): MURASHIGE & SKOOG MEDIUM(Duchefa Biochemie company)+30.0 g/L
Sucrose Sucrose+8 g/L agar Agar(pH 5.8-pH 6.0).
Co-culture medium (M1): M01.0 mg/L 2,4 dichlorophenoxyacetic acid of+18.0 g/L PEARLITOL 50C annitol+
Kinetin+100 μM of acetosyringone AS(pH 5.8 of 2,4-D+0.3 mg/L kinetin).
Callus differential medium (M2): M1+ 300.0 mg/L Ticarcillin/Clavulanate Acid Timentin+25 mg/L hygromycin
Hygromycin B。
Raw seedling culture medium (M3): MURASHIGE & SKOOG MEDIUM(Duchefa Biochemie company)+10.0
G/L glucose Glucose+0.25 g/L xylose Xylose+0.6 g/L morpholino b acid MES+2.0 mg/L zeatin
Zeatin+0.1 mg/L heteroauxin IAA+300.0 mg/L Ticarcillin/Clavulanate Acid Timentin+25 mg/L hygromycin
Hygromycin B。
Strengthening seedling and rooting culture medium (M4): M0+ 300.0 mg/L Ticarcillin/Clavulanate Acid Timentin.
MURASHIGE & SKOOG MEDIUM is referred to as MS culture medium.
Specific steps are as follows:
(1) it sterilizes:
A. 1 min of cabbage type rape seed is impregnated with 75% alcohol first, notices that the time cannot be too long；
B. then with 2% 20 min of hypochlorite disinfectant；
C. last to use aseptic water washing seed 4-5 times, it is cleaned up as far as possible.
(2) it sows:
A. sterilized seed is multicast to M with aseptic nipper0On culture medium, 30, every ware；
B. the culture tank of inoculation is placed into incubator, dark culture 6-7 d at 24 DEG C.
(3) bacterium is shaken:
After sowing 5-6 d, by Agrobacterium inoculation in sterile triangular flask or centrifuge tube containing LB liquid medium, it is placed in 28
It is cultivated in DEG C 180-220 rpm shaking table.
(4) it prepares explant and infects:
A. the seedling for after planting growing 6-7 d is cut with aseptic nipper and scalpel, it is 0.8- that its hypocotyl, which is cut into length,
The explant section of 1.0 cm.Its hypocotyl is placed in M when cutting seedling1It is cut in fluid nutrient medium, cuts better effect in this way.It cuts
When it is fast, quasi-, do not draw；
B. the OD of Agrobacterium is measured600Value (OD in LB culture medium600=0.3 or so preferably), will preparatory cultured bacterium solution with
6000 rpm are centrifuged 10 min, abandon supernatant, with the MS Liquid Culture containing 100 μM acetosyringone AS isometric with bacterium solution
Bacterium is resuspended base, repeats later primary.2 mL bacterium solutions finally are taken, the MS liquid of 100 μM of acetosyringone AS is contained with 20 mL
The dilution of body culture medium；
C. the explant cut is placed in the bacterium solution re-suspension liquid for having adjusted concentration, disseminates 10 min, pays attention to time of infection
Should not be too long, it otherwise will lead to explant death.It is appropriate that 150-200 explant is disseminated in the bacterium solution of every 20 mL；
(5) explant infected is transferred to M1On culture medium, it is advisable with 20-25 explant of every ware, is placed in 24 DEG C of half-lights
Lower culture 36-48 h；
(6) explant is gone on M2 culture medium from M1, and is transferred in illumination box culture (24 DEG C, 16 h/ of light dark 8 is h)
3 weeks；
(7) explant is transferred to M3On culture medium, every 2-3 weeks subculture is primary, until there is green bud；
(8) explant is finally transferred to M4It takes root in culture medium, rootage duration needs 2-4 weeks.
Embodiment 5: the identification of transgenic brassica napus positive plant
Cabbage type rape genomic DNA is extracted using the method for rapidly extracting DNA of plants, the specific steps are as follows:
(1) two panels young leaflet tablet (about 0.2 g) is taken, shreds and is fitted into the centrifuge tube of 2 mL, 250 μ L DNA buffer are added
(500 mM Tris-HCl, 300 mM NaCl, 300 mM Sucrose, pH=7.5) and two steel balls (6.7 mm of diameter), beat
50 Hz of model machine, 180 s smash leaf sample；
(2) sample smashed is placed in 95 DEG C of 10 min of incubation；
(3) sample taking-up is cooled to room temperature, 12000 rpm are centrifuged 5 min；
(4) 50 μ L supernatants are drawn to be transferred in 1.5 new mL centrifuge tubes, it is spare after 5 times of dilution.
Take 1 μ L DNA as template, with primer 35S(5'-TCCCACTATCCTTCGCAAG-3') (SEQ ID NO:9)
PCR amplification, amplification condition are as follows: 94 DEG C 5 are carried out with GFP(5'-tcagggtaacgggagaagc -3') (SEQ ID NO:10)
min；94 DEG C of 30 s, 58 DEG C of 30 s, 72 DEG C of 30 s, totally 30 recycle；72℃ 10 min.With transgenic brassica napus
DNA is template, can amplify specific target fragment, it was demonstrated that purpose carrier pMDC83-miR393 has been integrated into Wild cabbage type oil
In dish genome.
Embodiment 6: it is overexpressed Bna-miR393 render transgenic cabbage type rape Reproductive organ morphology and changes
The present invention uses the method for fluorescence real-time quantitative PCR to the table of Bna-miR393 in partial transgenic cabbage type rape plant
Up to being detected, the extraction of RNA and the detection method of Bna-miR393 expression quantity are shown in embodiment 1.The results show that having successfully been obtained
The transgenic plant (Fig. 2) that Bna-miR393 expression quantity is significantly improved relative to wild type Bna-miR393 expression quantity.Bna-
The expression that miR393 is overexpressed miR393 in plant improves 3 ~ 9 times compared with control.
Phenotypic analysis is carried out to the transgenic plant for being overexpressed Bna-miR393, is found compared with Wild type control plants,
Significant change occurs for the form for being overexpressed the transgenic plant reproductive organs of Bna-miR393, i.e., floral organ becomes smaller, silique shortens,
Seed becomes smaller (Fig. 3).
The floral organ that Bna-miR393 is overexpressed plant relatively compares small, and petal area has relatively compareed small 21% ~ 54%；Silique is long
Degree relatively control reduces 25% ~ 46%；Seed size relatively control reduces 4% ~ 12%；Mass of 1000 kernel relatively control reduces 6% ~ 26%.
The isolated cabbage type rape miRNA relevant to reproductive development of the present invention, can specific aim regulated and controled
The candidate miRNA of plant generative organ's development, to research crop yield and separation miRNA related to plant generative organ's development
With certain theoretical direction effect.The isolated reproductive development correlation miRNA of the present invention comes from plant itself, to ring
Border influences smaller.Using the functional study of isolated miRNA, it can be improved for rape molecular breeding and foundation is provided, and for training
Educate cabbage type rape new varieties, change cabbage type rape yield traits have very important significance.
Basic principles and main features and advantages of the present invention of the invention have been shown and described above.The skill of the industry
Art personnel it should be appreciated that the present invention is not limited to the above embodiments, the above embodiments and description only describe
The principle of the present invention, without departing from the spirit and scope of the present invention, various changes and improvements may be made to the invention, these
Changes and improvements all fall within the protetion scope of the claimed invention.The claimed scope of the invention by appended claims and
Its equivalent thereof.
Sequence table
<110>Yangzhou University
<120>application of Bna-miR393 during regulating and controlling cabbage type rape reproductive development
<130> xhx2019040403
<141> 2019-04-04
<160> 10
<170> SIPOSequenceListing 1.0
<210> 1
<211> 618
<212> DNA
<213> Brassica napus L.
<400> 1
aagttaaaga tgagaaggtg gaattaaaaa gagattaaaa acgtatttga tctatttatt 60
taaacaagag gaacatgtcc atcatttata tcaatggcct tggagaaaaa caacattgct 120
cccacttaga gagagaaaaa gagttcttca cagcaactag agaaaggatc caaagggatc 180
gcattgatcc taatcaagct gagttattcc cgaataatta ttttaaactt ttctcaatgg 240
aaagatagaa aaaaaaaaaa gatttgcttc gttttccgga tcatgcgatc tcttcggatt 300
catcctttgg tagcttccac cttggtcaaa gggtttctac aaagtttcga ggatttagga 360
tacatgtcaa gaaaacaaga atatgaggta ttcttttcca aaagtcttac tgatagaaac 420
gtcatacata cgctgaatat acatctttag agtgttcttg ttaattttac ctaagaacaa 480
attattggaa agtatatagt atatataagt taaattttaa ttctgttaca cttactagtt 540
cgaaatccta gatcaagaag tgctccgatc ccgtatttag ttctcactag tgagagtgag 600
aatctgaccc atcttgaa 618
<210> 2
<211> 21
<212> DNA
<213> Brassica napus L.
<400> 2
tccaaaggga tcgcattgat c 21
<210> 3
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
tccaaaggga tcgcattgat c 21
<210> 4
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
gtctgcctgg gtgtcacg 18
<210> 5
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
aagttaaaga tgagaagg 18
<210> 6
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
ttcaagatgg gtcagattct 20
<210> 7
<211> 26
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
ttaattaaaa gttaaagatg agaagg 26
<210> 8
<211> 26
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
ggcgcgcctt cagatggtca gattct 26
<210> 9
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
tcccactatc cttcgcaag 19
<210> 10
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
tcagggtaac gggagaagc 19
Claims (7)
1. including the DNA fragmentation of cabbage type rape Bna-miR393 precursor sequence, which is characterized in that the sequence of the DNA fragmentation
Column are as shown in SEQ ID NO:1.
2. cabbage type rape Bna-miR393, which is characterized in that its mature sequence is as shown in SEQ ID NO:2.
3. described in the DNA fragmentation described in claim 1 comprising cabbage type rape Bna-miR393 precursor sequence or claim 2
Cabbage type rape Bna-miR393 regulation cabbage type rape reproductive development in application.
4. containing expression cassette, recombinant vector, recombinant microorganism or the transgenic cell line of DNA fragmentation described in claim 1.
5.(a1) or the application of (a2):
(a1) cabbage type rape Bna-miR393 as claimed in claim 2 or DNA fragmentation described in claim 1 or right are wanted
Expression cassette described in asking 4, recombinant vector, recombinant microorganism or transgenic cell line, in regulation cabbage type rape reproductive organs hair
It educates, the application in Reproductive organ morphology phenotype；
(a2) cabbage type rape Bna-miR393 as claimed in claim 2 or DNA fragmentation described in claim 1 or right are wanted
Expression cassette described in asking 4, recombinant vector, recombinant microorganism or transgenic cell tie up to answering in cabbage type rape genetic breeding
With.
6. a kind of breeding method for the genetically modified plants for changing target plant Reproductive organ morphology, which is characterized in that wanted with right
DNA fragmentation described in asking 1 comprising cabbage type rape Bna-miR393 precursor sequence converts target plant, obtains transgenosis and plants
Object；The target plant is cabbage type rape；The Reproductive organ morphology of the genetically modified plants, phenotype are clearly distinguishable from described
Target plant.
7. a kind of breeding method of genetically modified plants for changing target plant Reproductive organ morphology according to claim 6,
It is characterised in that it includes following step:
(1) clone includes the DNA fragmentation of cabbage type rape Bna-miR393 precursor sequence；
(2) plasmid with cabbage type rape Bna-miR393 precursor sequence is converted into Agrobacterium using electric shocking method；
(3) Agrobacterium with conversion plasmid is converted into target plant using transgenic method, obtains genetically modified plants.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910269331.8A CN110129322B (en) | 2019-04-04 | 2019-04-04 | Bna-miR393 application in regulation and control of brassica napus reproductive organ development process |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910269331.8A CN110129322B (en) | 2019-04-04 | 2019-04-04 | Bna-miR393 application in regulation and control of brassica napus reproductive organ development process |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110129322A true CN110129322A (en) | 2019-08-16 |
| CN110129322B CN110129322B (en) | 2022-08-26 |
Family
ID=67569297
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910269331.8A Active CN110129322B (en) | 2019-04-04 | 2019-04-04 | Bna-miR393 application in regulation and control of brassica napus reproductive organ development process |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110129322B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111593058A (en) * | 2020-05-25 | 2020-08-28 | 扬州大学 | Bna-miR169n gene and application thereof in controlling drought resistance of brassica napus |
-
2019
- 2019-04-04 CN CN201910269331.8A patent/CN110129322B/en active Active
Non-Patent Citations (2)
| Title |
|---|
| JIAN XU等: "New insights into the roles of cucumber TIR1 homologs and miR393 in regulating fruit/seed set development and leaf morphogenesis", 《BMC PLANT BIOLOGY》 * |
| TURGAY UNVER等: "Genome-wide profiling and analysis of Festuca arundinacea miRNAs and transcriptomes in response to foliar glyphosate application", 《MOL GENET GENOMICS》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111593058A (en) * | 2020-05-25 | 2020-08-28 | 扬州大学 | Bna-miR169n gene and application thereof in controlling drought resistance of brassica napus |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110129322B (en) | 2022-08-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106957855B (en) | Method for targeted knockout of rice dwarf gene SD1 by using CRISPR/Cas9 technology | |
| CN111593058B (en) | Bna-miR169n gene and application thereof in controlling drought resistance of brassica napus | |
| CN104450711B (en) | OsmiR156f genes are increasing paddy rice effective tillering and the application in improving paddy rice single plant yield | |
| CN108623665A (en) | Application of the GhHUB2 albumen in regulation and control cotton fiber length and intensity | |
| CN109735538B (en) | Carrier for improving forest strawberry leaf regeneration efficiency and preparation method and application thereof | |
| CN113151300B (en) | CAMTA3 gene and application thereof in plants | |
| CN111635904B (en) | Gene CsWRKY10 for enhancing cucumber target spot disease resistance and application thereof | |
| CN110106269A (en) | Bna-miR156d is in the control developmental application of cabbage type rape branch | |
| CN106811471A (en) | Application of the paddy rice SPL7 genes in plant type is regulated and controled | |
| CN110204600B (en) | BnSPL14 gene, protein and application thereof in controlling cabbage type rape plant type | |
| CN110129322A (en) | Application of Bna-miR393 during regulating and controlling cabbage type rape reproductive development | |
| CN112094845B (en) | Nucleic acid for improving agronomic traits and resistance of plants and application thereof | |
| KR20100053456A (en) | A method for producing transformed rice plant removed selection marker | |
| CN110951771B (en) | Chinese cymbidiummiR390aApplication in controlling plant root system development | |
| CN114134159A (en) | Application of rice gene OsWOX3B in regulation and control of root system morphology | |
| CN109810182B (en) | BnLAX1.c gene, protein and application thereof in controlling cabbage type rape plant type | |
| US20050022267A1 (en) | Methods for Agrobacterium-mediated transformation of dandelion | |
| CN104513831B (en) | Method for promoting plant growth | |
| CN114634941B (en) | Upland cotton GhPP2Cs gene and application thereof in plant dwarfing | |
| CN116897961B (en) | Plant branching regulator and application thereof | |
| CN108410869B (en) | Specific expression promoter for cultured solanaceous pulp | |
| KR100496029B1 (en) | Method for Producing Transgenic Perilla Plants, and Herbicide-Resistent Perilla Plants by the Method | |
| CN112899274B (en) | Application of miR1432 in regulation and control of rice bacterial leaf blight resistance | |
| CN110423753B (en) | Root knot specific promoter T106-P induced by root knot nematode and application | |
| CN114990119A (en) | Long-chain non-coding RNA gene of rape and application thereof in increasing grain weight of rape seeds |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |