CN116769773A - Promoter of MYBL2 gene of brassica napus and application thereof - Google Patents

Promoter of MYBL2 gene of brassica napus and application thereof Download PDF

Info

Publication number
CN116769773A
CN116769773A CN202211614232.7A CN202211614232A CN116769773A CN 116769773 A CN116769773 A CN 116769773A CN 202211614232 A CN202211614232 A CN 202211614232A CN 116769773 A CN116769773 A CN 116769773A
Authority
CN
China
Prior art keywords
promoter
gene
plant
pbnmybl2
mybl2
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202211614232.7A
Other languages
Chinese (zh)
Inventor
许本波
田港
翟璐
谢伶俐
沈思思
张学昆
徐劲松
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Yangtze University
Original Assignee
Yangtze University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yangtze University filed Critical Yangtze University
Priority to CN202211614232.7A priority Critical patent/CN116769773A/en
Publication of CN116769773A publication Critical patent/CN116769773A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8205—Agrobacterium mediated transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance

Abstract

The invention discloses a promoter of a cabbage type rape MYBL2 gene and application thereof, belonging to the fields of biotechnology and plant genetic engineering, and the nucleotide sequence of the promoter is shown as SEQ ID No. 1. The invention clones the promoter PBnMYBL2 of MYBL2 gene from the rape variety 'double No. 9', and performs sequence analysis and function verification on the promoter PBnMYBL 2. Experiments prove that the PBnMYBL2 promoter sequence consists of a 2000bp upstream sequence of ATG, the promoter not only can promote the expression of exogenous gene GUS in Arabidopsis thaliana or tobacco, but also can induce or inhibit the transcriptional activation activity of the promoter when being subjected to various abiotic adversity stresses, unlike a common stress-induced promoter. The invention uses the promoter to replace a constitutive promoter to obtain a binary expression vector of an inducible promoter; the gene is introduced into a plant genome by utilizing a genetic transformation technology, so that the directional operation of a target gene can be realized, and a transgenic plant capable of inducing and inhibiting the expression of the target gene can be obtained.

Description

Promoter of MYBL2 gene of brassica napus and application thereof
Technical Field
The invention relates to the technical fields of biotechnology and plant genetic engineering, in particular to a promoter of a MYBL2 gene of brassica napus and application thereof.
Background
The plants can be subjected to abiotic stress brought by different environments in the growing and developing process, namely, normal growth of the plants is affected under abiotic conditions, such as cold injury, drought, high salt, high temperature, heavy metal poisoning and the like. These extreme environmental conditions have a different degree of negative effect at each stage of plant growth, resulting in stunted plant growth and affecting crop yield. Especially for overwintering crops such as rape, although the overwintering crops are mainly distributed in the Yangtze river basin, uneven rainfall and freeze injury in winter cause a large amount of crop yield reduction, so that the agricultural development of China is greatly hindered.
A promoter is a DNA sequence located upstream of the 5' end of a gene that can overactivate RNA polymerase and which can bind exactly to the template DNA, either stimulating or inhibiting transcription of the gene. In addition, it can regulate transcription initiation time and gene expression abundance, and is one core regulating element for gene expression. Promoters can be classified into three types, constitutive, tissue-specific, and inducible, depending on the gene expression. In transgenic plants, the exogenous gene is usually overexpressed by using a constitutive promoter, and under normal conditions, the overexpression of the exogenous gene affects the growth and development of the plant, so that the continuous overexpression of the exogenous gene by the constitutive promoter hinders the growth of the plant and reduces its yield. Therefore, the novel stress-resistant crop variety is cultivated by a method of using a stress-induced plant promoter to express or inhibit expression of an exogenous gene under stress, not only the objective product is obtained, the predetermined objective is achieved, but also no side effect is generated.
By developing an expression cassette using a novel promoter and a stress-resistance related gene, the stress response ability of plants can be improved to a great extent. However, the research on inducible promoters is relatively late in comparison with constitutive promoters, the most commonly used prior plant transgenic engineering is the 35S promoter of CaMV cauliflower mosaic virus, and in various researches, the constitutive promoters can drive the expression of exogenous stress related genes under common conditions, but a large amount of gene functional redundancy can be caused, resource waste caused by competition among genes can be caused, even the normal growth of transformed plants can be directly influenced, such as negative phenotypes of dwarf stems, leaf curl and the like are frequently generated in the transformed plants, the inducible promoters exactly compensate the defects, the inducible promoters do not show transcriptional activation activity under the condition of no stress, and the transcription of downstream genes can be driven only in abiotic adverse conditions such as drought, cold, saline alkali and the like, so that the adverse effects are minimized while the improvement of plant stress resistance is ensured.
In the research of rape BnMYBL2 gene, MYBL2 can inhibit bHLH transcription factor through competition, so that the BnMYBL2 can be inhibited to become a transcription activation compound of TTG1 and PAP1/PAP2, and the cold injury tolerance of plants is reduced; MYBL2 can also bind to DFR promoters and inhibit normal transcriptional activation of DFR genes; in addition, the research shows that MYBL2 also has the function of TLLLFR inhibitor, and the carboxyl terminal end of the TLLLFR inhibitor can interact with TOPLESS family inhibitor; MYBL2 may also reduce the cold tolerance of plants by inhibiting anthocyanin synthesis, all of which may be associated with transcriptional activation activity of promoters upstream of the MYBL2 gene.
At present, in the research of plant genetic engineering, the most widely applied is a CAMV35S constitutive promoter which can drive exogenous genes to express in different tissues and under different conditions of plants. In conclusion, the development and utilization of the novel inducible promoter have very important significance for research on plant physiology and biochemistry and directional improvement of crop genetic breeding.
Disclosure of Invention
The invention provides an inducible promoter which is cloned from rape and responds to various stress conditions.
A promoter having a nucleotide sequence as shown in SEQ ID No. 1. The promoter is obtained by cloning from a rape variety 'double No. 9', and is named as a promoter PBnMYBL2, and the promoter is an inducible promoter.
Expression cassettes, recombinant expression vectors, transgenic cell lines, recombinant bacteria and transgenic plants containing the DNA molecules also belong to the scope of protection of the invention.
The recombinant expression vector is obtained by replacing a promoter on a plant expression vector with the promoter PBnMYBL 2. When the transgenic plant with the recombinant expression vector is in a stress condition, the transcription level of a downstream gene is induced or inhibited, and the stress resistance of the plant is improved. The plant low temperature response negative regulation gene can be a transcription inhibitor such as MYB15, JAZ1, JAZ4, DEAR1 or RAP2.1 and the like and a low temperature sensitive gene (Liu Hui, li Dejun, deng Zhi. Plant transcription regulation network research progress [ J ]. Chinese agricultural science, 2014, (18): 3523-3533) responding to low temperature stress.
The invention also provides a transformant containing the recombinant expression vector.
The host cell of the transformant is Agrobacterium tumefaciens. The cells in the agrobacterium tumefaciens and the agrobacterium rhizogenes respectively contain Ti plasmid and Ri plasmid, a section of T-DNA is arranged on the Ti plasmid and the Ri plasmid, after the agrobacterium is infected by a plant wound to enter the cells, the plant wound part can be induced to generate crown-infant tumor, the T-DNA is inserted into a plant genome, then the progeny is inherited through stable meiosis, the transfer and integration of exogenous genes to plant cells are realized by means of the infection of the agrobacterium, and then transgenic plants are regenerated through cell and tissue culture technology.
The invention also provides application of the promoter in cultivation of salt-tolerant or low-temperature-tolerant transgenic plants. Preferably, the plant is a dicotyledonous plant such as canola.
The nucleotide sequence of SEQ ID No.1 according to the present invention is as follows:
the promoter is an inducible promoter obtained from rape, can control the low-temperature expression of genes and respond to various stress conditions, is used for carrying out genetic modification on crop varieties, and can improve the stress resistance of plants by controlling downstream target genes, so that transgenic plant varieties with excellent stress resistance can be cultivated.
Drawings
FIG. 1 is a graph showing the effect of low temperature, PEG, salt and ABA stress treatments on GUS gene transcription levels at various time points in 4 week old transgenic tobacco seedlings in examples of the present invention;
FIG. 2 is a graph showing the results of fluorescent quantitative RT-PCR detection in example 6 of the present invention.
Detailed Description
The present invention will be described in further detail with reference to fig. 1.
Example 1: and (3) separating and identifying the promoter PBnMYBL 2.
(1) Obtaining the promoter sequence of the MYBL2 gene of rape
And (3) performing NCBI BLAST analysis on the PBnMYBL2 sequence, and searching in the whole genome sequence to obtain a promoter sequence at the upstream of the MYBL2 gene.
(2) Primer design
And (3) designing primers and adding proper enzyme cutting sites according to the obtained promoter sequence and the characteristic analysis of the selected vector. The primer sequences were as follows:
upstream primer FPBnMYBL2:
5’-AGTCGACCCGAAATCCGAACCGAAGTAGC-3’
downstream primer RPBnMYBL2:
5’-ACCATGGGGTGATGCTTCCACTGACCC-3’
wherein the upstream primer carries a SalI cleavage site (GTCGAC) and the downstream primer carries an NcoI cleavage site (CCATGG).
(3) Cloning of promoter PBnMYBL2
The double 9 genome DNA in rape is used as a template, and an upstream primer and a downstream primer are used for PCR amplification of a promoter PBnMYBL2, wherein the PCR amplification conditions are as follows: pre-denaturation at 94℃for 2min; denaturation at 94℃for 30s, annealing at 54℃for 30s, elongation at 72℃for 30s,35 cycles; extending at 72℃for 2min.
After the PCR amplification product was confirmed by 1% agarose gel electrophoresis, the target fragment was recovered and ligated into the cloning vector pEasy Blunt (available from Transgen Biotech Co.). The cloning vector plasmid with the target fragment is transformed into the competent cells of the escherichia coli DH5 alpha, after the cells containing the cloning vector plasmid are cultured, single colony is selected for bacterial liquid expansion culture, and positive clones are screened by bacterial liquid PCR. The identified positive clone bacterial liquid is delivered to the Wohanoaceae biotechnology Co-Ltd for sequencing, and the result shows that: the amplified sequence is a PBnMYBL2 promoter sequence, and the nucleotide sequence is shown in SEQ ID NO: 1.
Example 2: and (5) constructing a recombinant expression vector.
The PBnMYBL2 promoter after sequencing verification is digested from a plasmid by SalI and NcoI, and is connected into a vector skeleton pCAMBIA1305 which is digested by SalI and NcoI by using T4 ligase (purchased from Transgen Biotech company), the original 35S promoter in the vector is replaced, a connection product is transformed into escherichia coli DH5 alpha competent cells, cells containing cloning vector plasmids are cultured, single colony is selected for bacterial solution expansion culture, PCR verification is carried out, the corresponding positive cloning plasmids are extracted, the corresponding positive cloning plasmids are named PBnMYBL2-pCAMBIA1305, and no other promoter is arranged on the upstream of GUS genes in the vector, and only inserted DNA fragments are provided.
Example 3: transformation of Agrobacterium tumefaciens.
Plasmids PBnMYBL2-pCAMBIA1305 and pCAMBIA1305 are respectively transferred into agrobacterium tumefaciens LBA4404 strain (purchased from Shanghai-Vibrio Biotechnology Co., ltd.) by using a heat shock method, and monoclonal shaking culture is selected, and positive clones are screened by PCR verification.
Example 4: agrobacterium-mediated genetic transformation of tobacco leaf discs.
1) Sterilizing mature seeds of tobacco variety K326 in 75% alcohol for 30s-1min, and washing with sterile water for 2-3 times; then 5% NaClO is added for sterilization for 8min, sterile water is used for washing for 3-5 times, a small amount of water is remained for the last time, a pipetting gun is used for sucking out, and the mixture is uniformly coated on a flat plate containing 1/2MS culture medium. Culturing in dark at 25deg.C for 2d, culturing with light, transferring the aseptic tobacco seedling to MS culture medium after 2w, and culturing in tissue culture at 25deg.C for about 30d with light.
2) Inoculating the bacterial liquid onto 100-200mL double-antibody liquid culture medium containing Kan (50 mg/L) and Rif (20 mg/L), placing on a shaking table at 28deg.C and 200rpm, and culturing to OD 600 0.6-0.8.
3) Leaves of the sterile tobacco seedlings were cut into leaf discs of 1 cm. Times.1 cm and pre-cultured in a pre-culture medium (MS+6-BA (2.0 mg/L) +3% sucrose+0.8% agar) for 2d.
4) Putting the pre-cultured leaf discs into a shaking bacterial liquid, and carrying out shaking culture at 200rpm for infection for 20min; the leaf was removed, the bacterial solution was blotted with sterile filter paper and placed on a co-culture medium (MS+6-BA (2.0 mg/L) +3% sucrose+0.8% agar) and incubated in an incubator at 28℃for 3d in the dark.
5) The co-cultured explants were soaked and washed 3 times with sterile water with added cephalosporin (final concentration 500 mg/L) for 10min each time, then the leaf surfaces were blotted with filter paper and transferred to a screening medium (MS+6-BA (2.0 mg/L) +3% sucrose+0.8% agar+Hyg (20 mg/L) +Cef (500 mg/L)) for culture, and tissue culture room at 25℃for about 15d until callus formation.
6) The tobacco leaves forming the callus are transferred into a new screening culture medium and are cultured for about 2 weeks to form a large number of cluster buds.
7) And transplanting the resistant seedlings into a 1/2MS rooting culture medium for rooting culture for 2 weeks.
8) Extracting genome DNA of transgenic plants, amplifying GUS gene fragments by PCR, and identifying and screening positive plants, wherein the primer sequences are as follows:
upstream primer GUSA-F AACCGACGAACTAGTCTGTACCC
Downstream primer GUSA-R ATTGAAGTCGGTCACAACCG
The amplification conditions were: pre-denaturation at 95℃for 3min; denaturation at 95℃for 15s, annealing at 52℃for 15s, elongation at 72℃for 1min,35 cycles; extending at 72℃for 5min.
Example 6: and (5) carrying out fluorescent quantitative qRT-PCR analysis on the transgenic tobacco.
In order to further determine whether the promoter PBnMYBL2 is a stress induction inhibitor, real-time fluorescent quantitative RT-PCR analysis is carried out on PBnMYBL2: GUS transgenic tobacco, and total RNA of plant leaves after being subjected to cold treatment at 9 ℃ for 0-24 hours is respectively extracted and reversely transcribed into cDNA. And analyzing the expression condition of the GUS reporter gene driven by the PBnMYBL2 promoter in transgenic tobacco by taking the reverse transcribed cDNA as a template and the tobacco ACTIN gene as an internal reference.
Wherein, the detection primer of GUS reporter gene is:
upstream primer GUS-F CGAAGCGAGCAATGTGATGG
Downstream primer GUS-R GATCCGCAAGACGCATCAAC
The detection primers of the tobacco reference gene ACTIN are as follows:
the upstream primer NtACTIN-F: AAGGGATGCGAGGATGGA
Downstream primer NtACTIN-R CAAGGAAATCACCGCTTTGG
The real-time fluorescent quantitative RT-PCR detection instrument is iQ5, bio-Rad, USA, and the detection kit is purchased from Vazyme (Nanjing). The detection system and the program are as follows:
2×SYBR Premix Ex Taq 10μL
10. Mu.M upstream primer 0.4. Mu.L
10. Mu.M downstream primer 0.4. Mu.L
cDNA1.2μL
ddH2O 8μL
PCR reaction conditions: pre-denaturation at 94 ℃ for 30s; denaturation at 94℃for 5s, annealing at 30s, elongation at 72℃for 45s,40 cycles; extending at 72℃for 5min.
The results of the fluorescent quantitative RT-PCR are shown in FIG. 2.
The present embodiment is only for explanation of the present invention and is not to be construed as limiting the present invention, and modifications to the present embodiment, which may not creatively contribute to the present invention as required by those skilled in the art after reading the present specification, are all protected by patent laws within the scope of claims of the present invention.

Claims (6)

1. A plant multiple stress response promoter is characterized in that: the nucleotide sequence of the promoter is shown as SEQ ID No. 1.
2. An expression cassette comprising the promoter of claim 1.
3. A recombinant expression vector comprising the promoter of claim 1.
4. A recombinant expression vector according to claim 3, characterized in that: the recombinant expression vector is a plant expression vector obtained by replacing the related expression vector promoter with the promoter in claim 1.
5. A transformant comprising the recombinant expression vector of any one of claims 3 to 4, characterized in that: the host cell of the transformant is escherichia coli, agrobacterium tumefaciens or a plant.
6. Use of the promoter according to claim 1 for breeding stress transgenic plants.
CN202211614232.7A 2022-12-15 2022-12-15 Promoter of MYBL2 gene of brassica napus and application thereof Pending CN116769773A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202211614232.7A CN116769773A (en) 2022-12-15 2022-12-15 Promoter of MYBL2 gene of brassica napus and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202211614232.7A CN116769773A (en) 2022-12-15 2022-12-15 Promoter of MYBL2 gene of brassica napus and application thereof

Publications (1)

Publication Number Publication Date
CN116769773A true CN116769773A (en) 2023-09-19

Family

ID=87990293

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202211614232.7A Pending CN116769773A (en) 2022-12-15 2022-12-15 Promoter of MYBL2 gene of brassica napus and application thereof

Country Status (1)

Country Link
CN (1) CN116769773A (en)

Similar Documents

Publication Publication Date Title
US10072269B2 (en) Synthetic promoter and methods of use thereof
Priya et al. Molecular cloning and characterization of the rubber elongation factor gene and its promoter sequence from rubber tree (Hevea brasiliensis): A gene involved in rubber biosynthesis
Yamchi et al. Proline accumulation in transgenic tobacco as a result of expression of Arabidopsis Δ 1-pyrroline-5-carboxylate synthetase (P5CS) during osmotic stress
CN112501182A (en) Poplar ERF transcription factor gene and application thereof
CN103667339B (en) Application of rice-derived protein OsMKK4 and related biological material thereof to regulation and control of plant panicle types
CN110938617A (en) Lilium regale LrPAL-1 gene and application thereof
US20230058847A1 (en) Enhancer
WO2019129145A1 (en) Flowering time-regulating gene cmp1 and related constructs and applications thereof
CN106987591B (en) Photoinduction type promoter gene and application thereof
CN116769773A (en) Promoter of MYBL2 gene of brassica napus and application thereof
JP2004528854A (en) New constitutive plant promoter
JP4452823B2 (en) Promoter with callus and seed embryo specific expression activity
Li et al. The effects of increased expression of an Arabidopsis HD-ZIP gene on leaf morphogenesis and anther dehiscence
JP4505626B2 (en) Promoter with pollen-specific expression activity
CN104087587A (en) Plant drought stress induction expression promoter and application thereof
CN114561387B (en) Peanut promoter and application thereof
JP4474540B2 (en) Shoot vascular bundle-specific expression promoter
US20230313212A1 (en) Plastid transformation by complementation of nuclear mutations
JP4505627B2 (en) Promoter with green tissue specific expression activity
US7199235B2 (en) Plant promoters
JP4474541B2 (en) Vascular bundle-specific expression promoter
JP4474542B2 (en) Constitutive expression promoter
KR101677073B1 (en) Gene enhancing root-growth derived from Oryza sativa and uses thereof
CN114645019A (en) Stress-induced expression gene promoter KT626 and application thereof
CN115725575A (en) miR204 derived from tumorous stem mustard and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination