JP4474541B2 - Vascular bundle-specific expression promoter - Google Patents

Description

  The present invention relates to a promoter for specifically expressing a target gene in a vascular bundle and use thereof.

  By introducing a fusion gene in which a gene encoding a target protein to be expressed downstream of a promoter capable of functioning in a plant cell is linked to the plant cell, and regenerating the obtained plant cell by a normal plant tissue culture technique An improved plant having a desired character has been produced. Examples of promoters generally used in plants include cauliflower mosaic virus (CaMV) 35S RNA gene promoter, Agrobacterium Ti plasmid-derived nopaline synthase gene promoter (Pnos), maize-derived ubiquitin gene promoter, rice-derived actin Gene promoters are known. These promoters are known to constitutively express a target protein in plant cells, and are widely used.

However, when plants are improved, effective improvements may be achieved by, for example, local expression of the target protein, and as a part of developing new types of highly functional plants by such improvements, tissue specific It is desired to search for plant promoters that bring about specific expression.
So far, as a promoter capable of tissue-specific expression of a target protein in a plant, rice is taken as an example, a rice cake-specific promoter RA8 (Patent Document 1), a rice cake or pollen-specific promoter CatA (Patent Document 2) ), Stamen-specific promoters T72, T23, T42, T155, E1 (patent document 3), flower organ-specific promoter RPC213 (patent document 4), mesophyll cell-specific promoter rbcS (non-patent document 1), endosperm-specific promoter GluB-1, GluA-2 (Non-patent Documents 2 and 3), callus-specific promoter PRO3 (Patent Document 5) and the like have been reported.

  Plants produce sugars (carbohydrates) in the leaves by photosynthesis and absorb nutrients such as moisture and nitrogen sources from the roots. Plants use these substances as materials or energy sources to create and grow new organs one after another, and when matured, they are redistributed to storage organs for storage in the next generation and stored as various storage substances . In this way, the transport (commutation) and redistribution of assimilated / absorbed substances are functions that serve as the basis for plant growth and life activity maintenance as well as photosynthesis. A vascular bundle is a continuous structure of a plant that penetrates roots, stems, and leaves, and plays an important role as a passage for assimilated and absorbed substances.

  On the other hand, the vascular system is also important from the viewpoint of plant pathology. That is, phytopathogenic bacteria (such as rice white leaf blight fungus, solanaceae plant blight fungus, tomato scab fungus, etc.) enter the vascular system after invading through the leaves and root wounds of the plant and proliferate in the conduit. Causes disease and eventually kills the plant. In addition, plant growth is significantly affected by environmental stresses such as dryness, high salt concentration, and low temperature. Environmental stress causes various biochemical and physiological responses to plants. Plants acquire responsiveness and adaptability to environmental stresses in order to survive under these environmental stress conditions. Genes that are expressed in vascular bundles such as roots in response to environmental stress are also known, and functional analysis and expression control of such stress-inducible genes are aimed at creating plants with enhanced environmental stress resistance. Is important.

  Therefore, it is specific to the vascular bundle to control the transport and distribution of substances in plants, elucidate the mechanism of transport and distribution of substances in plants, improve the productivity of useful substances, impart disease and environmental stress resistance, and control the growth of plants. Development and practical application of promoters that bring about specific expression are strongly desired.

Special table 2002-528125 International Publication WO00 / 58454 Special table hei 06-504910 International publication WO99 / 43818 JP2003-265182 Plant Physiol. 102, 991-1000 (1993) Plant Mol. Biol. 30, 1207-1221 (1996) Plant J. 4, 357-366 (1993)

  Accordingly, an object of the present invention is to provide a DNA having promoter activity for specifically expressing a target gene in a vascular bundle, a recombinant plasmid that enables a gene containing the DNA to be specifically expressed in a vascular bundle, It aims at providing the transformed plant body which introduce | transduced the recombinant vector.

  In order to solve the above problems, the present inventors refer to rice genome sequence information, rice EST appearance frequency information, rice full-length cDNA sequence information, etc. (http://www.dna.affrc.go.jp/). As a result of extensive research, we selected about 100 rice genes that are expected to have expression patterns specific to various tissues, and polymerase chain reaction (PCR) was performed on the 5 'upstream region of each selected gene. From the amplified fragments, the present inventors have succeeded in obtaining a DNA fragment having a promoter activity that specifically expresses the target protein in the vascular bundle, thereby completing the present invention.

That is, the present invention includes the following inventions.
(1) DNA which can function as a promoter, as shown in the following (a), (b) or (c).
(A) DNA consisting of the base sequence shown in SEQ ID NO: 1 in the sequence listing
(B) a promoter activity consisting of a base sequence in which one or several bases are deleted, substituted or added in the base sequence shown in SEQ ID NO: 1 in the sequence listing and specifically expressing the target gene in the vascular bundle; DNA
(C) DNA comprising a part of the base sequence shown in SEQ ID NO: 1 in the sequence listing and having a promoter activity for specifically expressing the target gene in the vascular bundle
(2) A DNA having a promoter activity that hybridizes with a DNA comprising a base sequence complementary to the DNA according to (1) under stringent conditions and specifically expresses a target gene in a vascular bundle.
(3) A recombinant vector containing the DNA according to (1) or (2).
(4) A recombinant vector containing the DNA according to (1) or (2) and a gene encoding a target protein.
(5) A transformed plant into which the recombinant vector according to (3) or (4) has been introduced.

  According to the present invention, DNA having a promoter activity that specifically expresses a target gene in a vascular bundle is provided. By using DNA with this promoter activity, control of transport (translocation) and absorption of water, nutrients, and sugars in the vascular bundle, and enlargement (growth) of fruits, tubers, tuberous roots, seeds, etc., which are storage organs for photosynthetic products ), Imparting and improving environmental stress resistance by expressing an environmental stress resistance gene, and imparting and improving disease resistance by expressing a disease resistant insect gene.

1. Promoter and Isolation thereof DNA capable of functioning as a promoter according to the present invention (hereinafter referred to as “promoter”) is a DNA comprising the base sequence shown in SEQ ID NO: 1.

  The DNA of the present invention induces the expression of the target gene in the vascular bundle by inserting it on the 5 ′ side of the translation start point of the gene encoding the target protein (hereinafter referred to as “target gene”), or The gene can be expressed at high levels in the vascular bundle.

  In addition, the DNA of the present invention comprises a promoter comprising a nucleotide sequence in which one or more bases are substituted, deleted, added or inserted in the nucleotide sequence shown in SEQ ID NO: 1, and which specifically expresses a target gene in a vascular bundle Active DNA is also included. Here, the number of bases that may be substituted, deleted, added or inserted is not particularly limited, but is preferably 1 to several. For example, 1 to 10, preferably 1 to 5 bases of the nucleotide sequence shown in SEQ ID NO: 1 may be deleted, and 1 to 10, preferably 1 to 5 nucleotide sequences shown in SEQ ID NO: 1. May be added, or 1 to 10, preferably 1 to 5 bases of the base sequence shown in SEQ ID NO: 1 may be substituted with other bases.

Furthermore, the DNA of the present invention includes a DNA consisting of a part of the base sequence shown in SEQ ID NO: 1 and having a promoter activity for specifically expressing the target gene in the vascular bundle.
The essential part of the promoter activity in the DNA consisting of the base sequence shown in SEQ ID NO: 1 is a variety of deletions of the DNA, for example, DNA fragments deficient in various lengths from the 5 ′ upstream side to beta-glucuronidase (GUS ) It can be identified by introducing a plasmid fused with a reporter gene such as a gene into a host and measuring the promoter activity. Techniques for identifying such an active moiety are known to those skilled in the art.

  Such a mutant DNA only needs to have a promoter activity for specifically expressing the target gene in the vascular bundle (hereinafter referred to as "vascular bundle-specific promoter activity"), and the magnitude of the activity is particularly limited. However, it is preferable that the vascular bundle-specific promoter activity of the DNA consisting of the base sequence shown in SEQ ID NO: 1 is substantially retained. “Substantially retains the vascular-specific promoter activity of DNA consisting of the base sequence shown in SEQ ID NO: 1” means that the DNA consisting of the base sequence shown in SEQ ID NO: 1 in the actual usage mode using the promoter activity. And that the activity is maintained to the extent that the same use is possible under the same conditions.

In the present invention, “vascular bundle-specific promoter activity” refers to an activity that preferentially and highly expresses a target gene in a vascular bundle over at least one other tissue or organ of the same plant.
The “vascular bundle” generally refers to a continuous structure of a plant that penetrates roots, stems, and leaves, and the “vascular bundle” of the present invention includes a plant subsurface tissue such as a root. Vascular system, and vascular system of terrestrial tissues (shoots) such as stems and veins are included.

  The introduction of gene mutation for obtaining mutant DNA as described above can be carried out by a known technique such as the Kunkel method or the Gapped duplex method or a method analogous thereto, for example, mutation using site-directed mutagenesis. Kits for introduction (for example, Mutant-K (manufactured by TAKARA) or Mutant-G (manufactured by TAKARA)) and LA PCR in vitro Mutagenesis series kits by TAKARA can be used.

  Furthermore, those skilled in the art can use the DNA consisting of all or part of the base sequence shown in SEQ ID NO: 1 and use the same function as the DNA consisting of the base sequence shown in SEQ ID NO: 1, ie, vascular-specific promoter activity. It is also easy to newly obtain and use DNA consisting of other base sequences having For obtaining such a DNA consisting of another base sequence, for example, it is hybridized under stringent conditions with a DNA consisting of a base sequence complementary to the DNA consisting of all or part of the base sequence shown in SEQ ID NO: 1. It can be performed by hybridization, PCR using a part of the base sequence as a primer, or the like. Here, stringent conditions refer to conditions under which so-called specific hybrids are formed and non-specific hybrids are not formed. For example, a highly homologous nucleic acid, that is, a complementary strand of DNA consisting of a nucleotide sequence having a homology of 90% or more, preferably 95% or more, with the nucleotide sequence shown in SEQ ID NO: 1 hybridizes and has a lower homology. A condition in which the complementary strand of the nucleic acid does not hybridize is mentioned. More specifically, the sodium concentration is 10 to 300 mM, preferably 15 to 75 mM, and the temperature is 25 ° C to 70 ° C, preferably 42 ° C to 55 ° C.

Whether the mutant DNA obtained as described above or the homolog obtained by hybridization has activity as a promoter depends on various reporter genes such as beta glucuronidase (GUS), luciferase (LUC), green fluorescent protein (GFP ),
A vector in which genes such as chloramphenicol acetyltransferase (CAT), beta galactosidase (LacZ), nopaline synthase (NOS), octopine synthase (OCS), etc. are linked to the downstream region of the above promoter is prepared, It can be confirmed by measuring the expression of the reporter gene after insertion into the genome of a plant cell by various transformation methods (to be described later) that have been well known and conventionally used.

  For example, when the reporter gene is GUS, the promoter activity in the host cell is determined by (i) a method by histochemical GUS staining (EMBO J. 6, 3901-3907 (1987)) and / or (ii) ) GUS activity was measured according to the Castle & Morris method (Plant Molecular Biology Manual, B5, 1-16 (1994); SBGelvin & RASchilperoort, Kluwer Academic Publishers) using a fluorescent substrate, and Bradford's method (Anal. Biochem. 72). , 248-254 (1976)), and the GUS activity can be confirmed by converting the GUS activity per protein amount (calculated as nmole 4-MU / min / mg protein).

  The promoter of the present invention is a rice gene [DDBJ (http: //www.ddbj.nig) encoding a MYB-like transcription factor having the amino acid sequence shown in SEQ ID NO: 3 that is present in the chromosome 1 genome of rice (Nipponbare). .ac.jp): accession number AP003452] based on the base sequence (SEQ ID NO: 2), the 5 ′ upstream genomic region (or sequence) of the gene (hereinafter referred to as “rice MYB gene” in the present specification) It can be obtained by releasing. The method for isolating the promoter region is not particularly limited, and examples thereof include inverse PCR, a method for isolating from a genomic DNA library, and the like.

  In the case of inverse PCR, a pair of primers is synthesized based on the above-mentioned rice MYB gene base sequence information, PCR is performed using these paired primers and genomic DNA fragments that have been treated with a predetermined restriction enzyme and then self-ligated. Can be used to amplify the upstream region of the rice MYB gene. Thereafter, by cloning the upstream region of the rice MYB gene and determining the base sequence, the promoter region of the rice MYB gene can be isolated and the base sequence (SEQ ID NO: 1) can be determined.

  In the case of isolation from a genomic DNA library, genomic DNA containing rice MYB gene is screened from a genomic DNA library prepared according to a conventional method using cDNA containing rice MYB gene as a probe. Thereafter, by determining the base sequence of the screened genomic DNA, the promoter region existing in the upstream region of the rice MYB gene can be identified. Further, only the promoter region is amplified by PCR or the like and cloned. Can be separated.

  Once the base sequence of the promoter of the present invention has been determined, the subsequent synthesis is carried out by chemical synthesis or by using a DNA consisting of a part of the base sequence as a primer, and using the rice total DNA as a template. It can be easily obtained by PCR.

  Further, by measuring the promoter activity using a part of the isolated promoter region (SEQ ID NO: 1), the region contributing to the promoter activity in the isolated promoter region (SEQ ID NO: 1) is specified. Can do. A part of the promoter region can be obtained by appropriately using a method in which a part of the promoter region is amplified by PCR, a method in which the promoter region is treated with a predetermined restriction enzyme, and fragmented.

  A part of the obtained promoter region can be incorporated upstream of a gene whose expression level can be quantified, and the promoter activity can be measured by quantifying the expression level of the gene. That is, it can be obtained by constructing a recombinant vector incorporating a part of the obtained promoter region and a predetermined gene, and quantifying the expression level of the gene in cells transformed with the recombinant vector. Promoter activity in a part of the promoter region can be measured.

2. Recombinant vector The recombinant vector of the present invention comprises the above-mentioned 1. The gene can be constructed by introducing a gene in which the target gene is linked to the above promoter into an appropriate vector. Here, as a vector, a target gene can be introduced into a plant via Agrobacterium, pBI system, pPZP system (Hajdukiewicz P, Svab Z, Maliga P .: The small, versatile pPZP family of Agrobacterium binary vectors for plant transformation., Plant Mol Biol., 25: 989-94, 1994), pCAMBIA (http://www.cambia.org/main/r_et_camvec.htm), pSMA vectors, and the like are preferably used. In particular, pBI binary vectors or intermediate vector systems are preferably used, and examples thereof include pBI121, pBI101, pBI101.2, pBI101.3 and the like. A binary vector is a shuttle vector that can replicate in Escherichia coli and Agrobacterium. When a plant is infected with Agrobacterium that holds the binary vector, it is a border sequence consisting of LB and RB sequences on the vector. It is possible to incorporate the enclosed DNA into plant nuclear DNA (EMBO Journal, 10 (3), 697-704 (1991)). On the other hand, a pUC vector can directly introduce a gene into a plant, and examples thereof include pUC18, pUC19, and pUC9. Plant virus vectors such as cauliflower mosaic virus (CaMV), kidney bean mosaic virus (BGMV), and tobacco mosaic virus (TMV) can also be used.

  In order to insert a target gene into a vector, first, a method in which the purified DNA is cleaved with an appropriate restriction enzyme, inserted into an appropriate vector DNA restriction enzyme site or a multicloning site, and then ligated to the vector is employed. The

  The target gene refers to any gene that is an endogenous gene in a target plant or a foreign gene, and expression of the gene product is desired in the vascular bundle. Such genes include transporter genes such as sugars, nitrogen sources and ions, useful substance (pharmaceuticals, pigments, aromatic components, etc.) production genes, plant growth control (promotion / suppression) genes, sugar metabolism-related genes, pest resistance [ Insect food damage resistance, mold (fungi) and bacterial disease resistance, virus (disease) resistance, etc.) genes, environmental stress (low temperature, high temperature, dryness, salt, light damage, ultraviolet light) resistance genes, etc. These are not limited.

  The target gene described above needs to be incorporated into a vector so that the function of the gene is exhibited. Therefore, the promoter, enhancer, intron, poly A addition signal, 5′-UTR sequence, selectable marker gene and the like of the present invention can be linked to the vector upstream, inside, or downstream of the target gene.

  Examples of the enhancer include an enhancer region that is used to increase the expression efficiency of the target gene and includes an upstream sequence in the CaMV35S promoter.

  The terminator may be any sequence that can terminate transcription of the gene transcribed by the promoter, and examples thereof include nopaline synthase (NOS) gene terminator, octopine synthase (OCS) gene terminator, CaMV 35S terminator and the like. It is done.

Examples of the selection marker gene include a hygromycin resistance gene, a kanamycin resistance gene, a bialaphos resistance gene, a blasticidin S resistance gene, an acetolactate synthase gene, and the like.
Alternatively, the selection marker gene may be prepared by ligating the same gene together with the target gene as described above to prepare a recombinant vector, or alternatively, a recombinant vector obtained by linking the selection marker gene to a plasmid, A recombinant vector obtained by ligating the target gene to a plasmid may be prepared separately. When prepared separately, each vector is co-transfected (co-introduced) into the host.

3. Transformed plant body 2. Using the recombinant vector prepared in Step 1, a target plant can be transformed to prepare a transformed plant body.
In preparing a transformed plant body, various methods already reported and established can be used as appropriate. Preferred examples thereof include the Agrobacterium method, the PEG-calcium phosphate method, the electroporation method, Examples include the liposome method, particle gun method, and microinjection method. When the Agrobacterium method is used, there are a case where a protoplast is used, a case where a tissue piece is used, and a case where a plant body itself is used (in planta method). When using protoplasts, co-culture with Agrobacterium with Ti plasmid, fusing with spheroplasted Agrobacterium (spheroplast method), and when using tissue fragments, aseptic culture of the target plant It can be performed by infecting leaf pieces (leaf discs) or infecting callus. In addition, when the in planta method using seeds or plants is applied, that is, in systems that do not involve tissue culture with the addition of plant hormones, for direct treatment of Agrobacterium to water-absorbing seeds, seedlings (plant seedlings), potted plants, etc. Can be implemented.

  Whether or not a gene has been incorporated into a plant can be confirmed by PCR, Southern hybridization, Northern hybridization, Western blotting, or the like. For example, DNA is prepared from a transformed plant, PCR is performed by designing a DNA-specific primer. After PCR, the amplified product is subjected to agarose gel electrophoresis, polyacrylamide gel electrophoresis, capillary electrophoresis, etc., stained with ethidium bromide, SYBR Green solution, etc., and the amplified product is detected as a single band. By doing so, it can confirm that it transformed. Moreover, PCR can be performed using a primer previously labeled with a fluorescent dye or the like to detect an amplification product. Furthermore, the amplification product may be bound to a solid phase such as a microplate, and the amplification product may be confirmed by fluorescence or enzymatic reaction.

  Plants used for transformation in the present invention include monocotyledonous plants such as rice, wheat, corn, leek, lily, orchid, soybean, rapeseed, tomato, potato, chrysanthemum, rose, carnation, petunia, gypsophila, cyclamen and the like. Plants such as dicotyledonous plants can be mentioned, and are not particularly limited. Preferably, plants of the family Gramineae from which the DNA of the present invention has been isolated, for example, plants such as rice, barley, wheat, corn, sugarcane, buckwheat, sorghum, millet and millet.

  In the present invention, examples of plant materials to be transformed include roots, stems, leaves, seeds, embryos, ovules, ovaries, shoot tips (growth points at the tips of plant buds), buds, pollen and the like. Examples thereof include plant tissue cells and slices thereof, undifferentiated callus, and plant cultured cells such as proplasts obtained by removing the cell wall by enzyme treatment. In the case of applying the in planta method, water-absorbing seeds or the entire plant body can be used.

  In the present invention, the transformed plant body means the whole plant body, plant organ (eg, root, stem, leaf, petal, seed, seed, fruit, etc.), plant tissue (eg, epidermis, phloem, soft tissue, xylem). And vascular bundles) and plant cultured cells.

  When plant cultured cells are targeted, in order to regenerate a transformant from the obtained transformed cells, an organ or an individual may be regenerated by a known tissue culture method. Such an operation can be easily performed by those skilled in the art by a method generally known as a method for regenerating plant cells from plant cells. Regeneration from plant cells to plants can be performed, for example, as follows.

  First, when plant materials or protoplasts are used as plant materials to be transformed, these are inorganic elements, vitamins, carbon sources, sugars as energy sources, plant growth regulators (plant hormones such as auxin and cytokinin) And so on, and cultured in a sterilized callus formation medium to form dedifferentiated callus that grows irregularly (hereinafter referred to as “callus induction”). The callus thus formed is transferred to a new medium containing a plant growth regulator such as auxin, and further grown (subcultured).

  When callus induction is performed in a solid medium such as agar and subculture is performed in, for example, liquid culture, each culture can be performed efficiently and in large quantities. Next, callus grown by the above subculture is cultured under appropriate conditions to induce organ redifferentiation (hereinafter referred to as “redifferentiation induction”), and finally regenerates a complete plant body. . Redifferentiation induction can be performed by appropriately setting the types and amounts of various components such as plant growth regulators such as auxin and cytokinin, carbon sources, and the like, light, temperature and the like in the medium. By such redifferentiation induction, somatic embryos, adventitious roots, adventitious shoots, adventitious foliage, etc. are formed and further grown into complete plants. Alternatively, storage or the like may be performed in a state before becoming a complete plant body (for example, encapsulated artificial seeds, dried embryos, freeze-dried cells and tissues).

  The transformed plant body of the present invention is not only the “T1 generation” which is the regenerated generation after the transformation treatment, but also the “T2 generation” which is a progeny obtained from the seed of the plant, the drug selection or the Southern method, etc. This includes progeny plants such as the next generation (T3 generation) obtained by self-pollination of "T2 generation" plants that have been found to be transgenic by analysis.

  EXAMPLES Hereinafter, the present invention will be described more specifically with reference to examples, but these examples do not limit the present invention.

Example 1 Isolation of rice MYB gene promoter sequence and introduction into transformation vector (1) Isolation of promoter
Genomic isolation of a promoter sequence located in the 5 'upstream region of the rice MYB gene (DDBJ (http://www.ddbj.nig.ac.jp): accession number AP003452) having the base sequence shown in SEQ ID NO: 2 PCR was performed. DDBJ (http://www.ddbj.nig.ac.jp: Accession number) Using genomic DNA extracted from green leaves of rice (variety: Nipponbare) plantlets using DNeasy Plant Mini Kit (Qiagen) as a template AP003452) Primer MYB-5 [5'-TGC AAGCTT CTGACCATGATTTAGTACAG -3 '(underlined part is HindIII restriction enzyme recognition site) designed from rice genome sequence information: SEQ ID NO: 4] and MYB-3 [5' -PCR was performed using ATGC CCATGG CGCCGGCCTCGTACCAAT-3 '(underlined is the NcoI restriction enzyme recognition site): SEQ ID NO: 5] as a primer. If the position of A in the translation start codon ATG predicted from the genomic sequence information of the MYB gene is +1 and the position of the previous base is -1, the primer is positioned from the -2143 position to the -3 position of the MYB gene. Designed to amplify the sequence of 2141 base pairs [corresponds to the base from position 7 (SEQ ID NO: 1 is HindIII recognition sequence) to base 2147 (position 2148-2153 is NcoI recognition sequence)] did. In addition, in order to facilitate cloning of the amplified fragment, a unique HindIII and NcoI restriction enzyme recognition site was introduced into the 5 ′ end (MYB-5) and 3 ′ end (MYB-3) of the amplified fragment, respectively.

After PCR, the amplified fragment (about 2.1 kb) is treated with Ex Taq polymerase (Takara) in the presence of dATP at 72 ° C for 5 minutes to add A to the end, and using Promega pGEM-T easy vector system And cloned into the pGEM-T easy vector.
After cloning, the base sequence of the insert was decoded and confirmed to be the same as the above registered rice genome sequence information. SEQ ID NO: 1 shows the base sequence. In the nucleotide sequence of SEQ ID NO: 1, the nucleotide sequence from position 1 to position 6 and the nucleotide sequence from position 2148 to position 2153 are the restriction enzyme sites used for cloning.
The cloning procedure of the rice gene promoter sequence described above is shown in FIG.

(2) Construction of Binary Ti Plasmid Vector for Plant Transformation In order to introduce the above promoter sequence into rice, a binary Ti plasmid vector pSMAHdN627-M2GUS for plant transformation was constructed (FIG. 2). As shown in FIG. 2, this binary vector has an Agrobacterium Ti plasmid-derived Nos (nopaline synthase gene) promoter :: E. coli-derived HPT (hygromachine resistance) gene as a plant selection marker gene on T-DNA. The coding region of :: Ti plasmid-derived TiaaM (tryptophan monooxygenase gene) terminator was placed so that the transformed plant body was resistant to hygromycin B. In addition, a chimeric gene composed of a beta glucuronidase (GUS) gene coding region :: Ti plasmid-derived Nos terminator is placed in the adjacent site, and a multicloning site is inserted so that a promoter sequence can be inserted 5 'upstream of the GUS gene. Was provided. Also, outside of the left border (LB) and right border (RB) sequences, a spectinomycin resistance (Sp ^R ) gene that can function in microbial cells, a pBR322-derived (ColE1 type) replication initiation region that functions in E. coli The sequence Sta for stably maintaining the plasmid in Agrobacterium cells and the replication initiation region Rep were provided.

(3) Introduction of promoter sequence into binary vector
The pGEM-T easy vector was double-digested with HindIII and NcoI to excise the rice MYB gene promoter fragment and cloned into the corresponding site of the pSMAHdN627-M2GUS vector constructed in (2). The resulting plasmid was named pSMAHdN627-MYBGUS, and was electroporated using a Biorad E. coli pulsar (0.2 cm cuvette, pulse conditions: 2.4 kV / cm, 25 μF, 200Ω) by Agrobacterium EHA105 It was introduced into the system.

(Example 2) Rice transformation Rice was transformed by an ultra-rapid transformation method (see WO 01/06844 A1 (2001)). Rice (variety: Nipponbare) seeds are sterilized with 70% ethanol followed by sodium hypochlorite, rinsed with sterile distilled water, drained, and N6D agar medium [N6 salts and vitamins so that the embryos face up (Chu CC, CSWang, CCSun, C. Hsu, KC Yin, CY Chu, Establishment of an efficient medium for anther culture of rice through comparative experiments on the nitrogen sources, Sci. Sinica, 18, 659-668 (1975)), 30 g / L sucrose, 0.3 g / L casamino acid, 2.8 g / L proline, 2 mg / L 2,4-D, 2 g / L gellite, pH 5.7) at 30 ° C under bright conditions For 5 days.

  On the other hand, the Agrobacterium EHA105 strain carrying the plasmid pSMAHdN627-MYBGUS with the rice MYB gene promoter fragment inserted was LB containing 25 mg / L chloramphenicol, 25 mg / L rifampicin, and 100 mg / L spectinomycin. The cells were cultured on an agar medium at 28 ° C. for 3 days. Subsequently, the grown cells are scraped in a small amount with microspatel, and AAM liquid medium containing 20 mg / L acetosyringone [Hiei, Y., Ohta, S., Komari, T., Kumashiro, T., Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA, Plant J., 6, 271-282 (1994)]. Rice seeds cultured for 5 days in N6D medium were immersed in this Agrobacterium suspension, and the bacterial solution was thoroughly cut off, then placed on an AAM agar medium containing 20 mg / L acetosyringone and darkened at 25 ° C. Cultivation was performed under conditions for 3 days (co-culture). Wash the rice germinated seeds after co-cultivation with sterilized water, followed by sterilized water containing 500 mg / L carbenicillin. It was placed on an N6D agar medium containing 30 mg / L hygromycin B and cultured for 14 days under light conditions at 30 ° C. Thereafter, the grown shoot base was transformed into a recombinant redifferentiation and selective medium [plant regeneration medium: MS salts and vitamins (Murashige, T., Skoog, F., A revised medium for rapid growth and bioassays with tobacco tissue. cultures, Physiol. Plant, 15, 473-497 (1962)), 30 g / l sucrose, 30 g / l sorbitol, 2 g / l casamino acid, 0.02 mg / l NAA, 2 mg / l kinetin, 2 g / l Gelrite, pH 5.8] with 300 mg / L carbenicillin + 30 mg / L hygromycin B added; Toki, S., 1997, Rapid and Efficient Agrobacterium-mediated transformation of rice, Plant Mol Biol. Rep. , 15: 16-21], and cultured for 14 days at 30 ° C. and in light conditions, and this operation was repeated once more to redifferentiate plants having hygromycin resistance. The redifferentiated individuals thus obtained were transplanted to MS hormone-free agar medium [MS salts and vitamins (Murashige, T. et al., Supra), 30 g / l sucrose, 4 g / l gellite, pH 5.8]. It was grown for 1 to 2 weeks at 30 ° C. under light conditions to promote the elongation of the shoot (aboveground part) and the rooting and elongation. When the length of the shoots and roots of the transformants reached about 10 cm or more in a petri dish (9 cm in diameter), they were transplanted to the culture soil and clarified in the growth chamber for growing the recombinants. Further growth was carried out in a cycle of 14 hours (30 ° C.)-dark 10 hours (25 ° C.).

(Example 3) Preparation of plant tissue section and observation of transgene expression by GUS staining In order to observe the activity of the rice MYB gene promoter introduced into rice, histochemical staining of GUS enzyme activity was performed. Of the plant tissue materials used in the experiment, callus, flower organs, and roots were directly immersed in the reaction solution after being cut from rice individuals or callus (cultured cells). For leaf blades, the developed leaves were cut to a width of 5-10 mm, embedded in 5% agar, and 80 μm-thick sections were prepared using a microslicer (Dosaka EM, DTK1000). 4 281-285 (1992)]. For the heel base, cut 5-10 mm of tissue from the root of the cut potato (cane: a term representing the stem of the grass family), and for the shoot apex, the portion immediately above the heel base is 10 mm. A section having a thickness of 80 μm was prepared in the same manner as the blade. The plant material thus prepared was used as a reaction solution for measuring GUS activity (50 mM sodium phosphate buffer (pH 7.0), 1 mM 5-bromo-4-chloro-3-indolyl-β-D-glucuronide (X-Gluc), 5% (v / v) methanol, 10 μg / ml cycloheximide, 1 mM dithiothreitol] and placed at 37 ° C. with gentle shaking for 24 hours. Thereafter, the reaction solution was replaced with 100% ethanol to stop the reaction, and the mixture was further allowed to stand for 24 hours to remove chlorophyll from the cells of the green tissue. Next, after replacing ethanol with pure water, the staining pattern was observed with a stereomicroscope or an optical microscope.
As a result, activity was observed in the vascular bundle at the heel base, leaf blades, and roots. Activity was also observed in callus and bud flowers (anther, the ovary part of the central pillar). (Figure 3).

The cloning procedure of the rice gene promoter of this invention is shown. The structure of a binary Ti plasmid vector for plant transformation: pSMAHdN627-M2GUS is shown. The GUS dyeing | staining result in each plant material prepared from the plant which introduce | transduced the rice MYB gene promoter is shown.

Claims (4)

A promoter comprising the DNA shown in the following (a) or (b) and specifically expressing a target gene in a vascular bundle.
(A) DNA consisting of the base sequence shown in SEQ ID NO: 1 in the sequence listing
(B) in the nucleotide sequence shown in SEQ ID NO: 1, one or several bases are deleted, ing substituted or added in the nucleotide sequence DNA A recombinant vector containing the promoter according to claim 1 . A recombinant vector comprising the promoter according to claim 1 and a gene encoding a target protein. A transformed plant into which the recombinant vector according to claim 2 or 3 is introduced.

Images