CN100366743C - Plant-disease-resistance related protein and genes encoding same and use thereof - Google Patents

Abstract

The present invention discloses a protein relevant to plant disease resistance, a coded gene thereof and an application thereof. The protein relevant to plant disease resistance of the present invention has an SEQ ID No. 4 amino acid residue sequence in a sequence list or an SEQ ID No. 4 derivative amino acid residue sequence which is used for substituting, deleting or adding one or a plurality of amino acid residues of the SEQ ID No. 4 amino acid residue sequence and has the same activity with an SEQ ID No. 4 limited protein. The present invention also provides a coded gene of the protein relevant to plant disease resistance, namely a genome gene of the protein relevant to plant disease resistance, a cDNA gene thereof and a method for enhancing the disease resistance of rice by the coded gene. The coded gene of the protein relevant to plant disease resistance of the present invention can be widely used for enhancing the disease resistance of plants, such as rice, etc.

Description

One plant disease resistance-related and encoding gene thereof and application

Technical field

The present invention relates to a plant disease resistance-related and encoding gene and application in the biological technical field, particularly the method for a plant disease resistance-related and encoding gene thereof and raising paddy disease-resistant.

Background technology

Plant pest often makes agriculture production suffer heavy losses, and 1/3rd of crop yield loss is attributable to disease.Cultivate and the cultivation disease-resistant variety, use agricultural chemicals, high-caliber production management technology etc. is the important measures that prevent and treat crop pest.But it is longer to obtain disease resistance crop varieties seed selection course by the conventional breeding means, has the resistant lose problem, lacks parent's resource of disease resistance; A large amount of agricultural chemicals that use can produce problems such as pesticide residue, pathogen develop immunity to drugs.The crop varieties of cultivating disease resistance that develops into of plant genetic engineering provides new means.

The disease-resistant mode of plant has intrinsic resistance (passive resistance) and pathogeny evoked resistance (initiatively resistance).The intrinsic resistance of plant is divided inherent structure resistance and inherent chemoresistance again.Wax stratum corneum, perithelium, epidermal hair and the Gen Mao of inherent structure resistance such as plant, epidermic cell, natural aperture, wound etc.; Inherent chemoresistance such as unsaturated lactone, sulfocompound, phenolic compound such as saponin(e Secondary Metabolism of Plant products such as (saponin).The active resistance of plant is also divided inductive structure resistance and inductive chemoresistance.The formation of callose in the formation of inductive structure resistance such as mastoid process, the vascular bundle, milky spot formation, the lignifying of cell walls, cell walls are rich in the crosslinked reinforcement of accumulation of oxyproline glycoprotein and cell walls etc.The increase of inductive chemoresistance such as aldehydes matter content, the generation of plant protecting chemical and accumulation, pathogenesis-related proteins (pathogenesis-related protein) are as generation, glucosides oxidation generation toxic substance such as the HCN of chitinase, dextranase etc., the generation of proteinase inhibitor, various active oxygen (O ^2-, H ₂O ₂) and supersensitivity necrocytosis reaction etc. (Dixon RA, Harrison MJ, Lamb CJ.1994.Earlyevents in the activation of plant defense response.Annu.Rev Phytopathol.32:479～501) takes place.Flor (Flor.1971.Current status of the gene for gene concept.Annu.Rev.Phytopathol.9:275-296.) according to his research to microspecies specificity resistance between flax and flax rust bacterium (Melampsoralini), has proposed gene pairs gene (gene-for-gene) hypothesis.This hypothesis thinks that the host is contained susceptible gene (r) respectively and disease-resistant gene (R), pathogen contain virulent gene (vir) and nontoxic gene (avr) respectively, have only when the plant with corresponding disease-resistant gene meets with the cause of disease with corresponding nontoxic gene, just can excite the disease resistance response of plant, plant shows as disease-resistant, otherwise host plant shows as susceptible.The clone of present a plurality of plant disease resistance genes and pathogen nontoxic gene has confirmed the exactness of this hypothesis.

Anaphylaxis (Hypersensitive Response, HR) be the modal disease-resistant manifestation of plant, it almost always is looked at as disease-resistant sign, but not all disease resistance response all shows HR (KeenNT.1992.The molecular biology of disease resistance.Plant MolBiol.19:109-114).In the cell sudden death of pathogenic bacteria p of E and surrounding tissue, limited pathogenic bacteria deciding in vivo and grown and expand.It is that system obtains resistance (systemic acquired resistance that this some situation of partial anaphylaxis also can excite the disease resistance of the non-specialization of whole plant, hereinafter to be referred as SAR) expression, this moment, whole plant had resistance to pathogen widely.SAR be plant be subjected to the biological or chemical factor whole strain show in effect back, a part to the resistance of pathogenic micro-organism (virus, bacterium, fungi) more widely, and this resistance often can continue the long period.SAR is the particularly result that expressed by system induction of PR protein gene of plant defense gene.

Paddy rice (Oryza sativa L.) is China's important crops.Disease is important restraining factors of Rice Production, the annual control that needs input great amount of manpower and material resources and financial resources to be used for rice disease.Rice blast and bacterial leaf-blight are paddy rice two big main diseases.Paddy rice osmanthus 99 plants the hybridisation rice system of recovering commonly used for Guangxi is main, it is a long-grained nonglutinous rice, and is anti-during rice blast, bacterial leaf-blight are all shown as.

The innovation and creation content

An object of the present invention is to provide a plant disease resistance-related and encoding gene thereof.

Plant disease resistance-related protein provided by the present invention, name is called SDKB, derive from paddy rice rice variety osmanthus 99, have SEQ ID № in the sequence table: 4 amino acid residue sequence or have № SEQ ID: 4 amino acid residue sequence through replacement, disappearance or the interpolation of one or several amino-acid residue and with SEQ ID №: 4 protein that limit have identical active by SEQ ID №: 4 deutero-amino acid residue sequences.

SEQ ID № in the sequence table: 4 are made up of 582 amino-acid residues, 55-194 amino acids residue from the N end is BTB functional domain (Broad-complex, Tramtrack and Bric a brac), 269-297,298-328 and 332-361 amino acids residue from the N end are three successive ankyrin repeats (ankyrin repeats) functional domains, and these two functional domains may be all relevant with protein interaction.

The encoding gene of above-mentioned plant disease resistance-related protein, its cDNA sequence has one of following nucleotide sequence:

1) polynucleotide of sequence 3 in the sequence table;

2) SEQ ID № in the code sequence tabulation: the polynucleotide of april protein sequence;

3) with sequence table in the nucleotide sequence that limits of sequence 3 have 90% above homology, and the proteinic nucleotide sequence of identical function of encoding;

4) under the rigorous condition of height can with the SEQ ID № in the sequence table: the nucleotide sequence of the 3 dna sequence dnas hybridization that limit.

The rigorous condition of described height for hybridization back with contain 0.1 * SSPE (or 0.1 * SSC), the solution of 0.1%SDS washes film under 65 ℃.

Sequence 3 in the sequence table is made up of 1826 bit bases, the encoding sequence of this cDNA sequence be in the sequence table sequence 3 from 5 ' end 16-1764 bit base.

The genomic gene of the described plant disease resistance-related protein corresponding with described cDNA sequence has one of following nucleotide sequence:

1) polynucleotide of sequence 5 in the sequence table;

2) SEQ ID № in the code sequence tabulation: the DNA of april protein sequence;

3) with sequence table in the nucleotide sequence that limits of sequence 5 have 90% above homology, and the proteinic nucleotide sequence of identical function of encoding;

4) under the rigorous condition of height can with the SEQ ID № in the sequence table: the nucleotide sequence of the 5 dna sequence dnas hybridization that limit.

The rigorous condition of described height for hybridization back with contain 0.1 * SSPE (or 0.1 * SSC), the solution of 0.1%SDS washes film under 65 ℃.

Sequence 5 in the sequence table is made up of 4241 bit bases, 1-561 bit base from 5 ' end is first exon of this genomic gene, 2284-3031 bit base from 5 ' end is second exon of this genomic gene, 3240-3440 bit base from 5 ' end is the 3rd exon of this genomic gene, 4003-4241 bit base from 5 ' end is the 4th exon of this genomic gene, from 5 ' the 1-3 bit base of end be the initiator codon ATG of this genomic gene, from 5 ' the 4239-4241 bit base held is the terminator codon TGA of this genomic gene; 562-2283 bit base from 5 ' end is first intron of this genomic gene, from 5 ' the 3032-3239 bit base of end be second intron of this genomic gene, from 5 ' the 3441-4002 bit base held is the 3rd intron of this genomic gene.

5 of the genomic gene of described plant disease resistance-related protein ' end and 3 ' end is connected with non-coding region, is the DNA of nucleotide sequence with the sequence 1 in the sequence table.

Sequence 1 in the sequence table is by 7417 based compositions, 2365-2925 bit base from 5 ' end is first exon of the genomic gene of plant disease resistance-related protein, 4648-5395 bit base from 5 ' end is second exon of this genomic gene, 5604-5804 position Nucleotide from 5 ' end is the 3rd exon of this genomic gene, 6367-6605 position Nucleotide from 5 ' end is the 4th exon of this genomic gene, from 5 ' the 2365-2367 position Nucleotide of end be the initiator codon ATG of this genomic gene, from 5 ' the 6603-6605 position Nucleotide held is the terminator codon TGA of this genomic gene; 2926-4647 bit base from 5 ' end is first intron of this genomic gene, from 5 ' the 5396-5603 bit base of end be second intron of this genomic gene, from 5 ' the 5805-6366 bit base held is the 3rd intron of this genomic gene.

Contain carrier, clone and the host bacterium of plant disease resistance-related protein encoding gene of the present invention,, all belong to protection scope of the present invention as plasmid pGXN7410.

Second purpose of the present invention provides a kind of method that improves paddy disease-resistant.

The method of raising paddy disease-resistant provided by the present invention is that above-mentioned plant disease resistance-related protein encoding gene is imported in the paddy rice.

Described plant disease resistance-related protein encoding gene can import in the paddy rice as agrobacterium mediation converted method, particle gun mediated transformation method or pollen tube passage method according to the ordinary method in the plant genetic engineering field.

The paddy rice TP309 of genomic gene that experimental results show that the SDKB of the justice of becoming a full member significantly strengthens the resistance of bacterial blight of rice and rice blast, paddy rice osmanthus 99 plant of the genomic gene of the SDKB of antisense significantly reduce the resistance of bacterial blight of rice, illustrate that this gene is relevant with the paddy rice broad-spectrum disease resistance.Plant disease resistance-related protein encoding gene of the present invention can be widely used in the disease resistance that strengthens plants such as paddy rice.

Description of drawings

Fig. 1 is the PCR product of the inside 228bp sequence of SDKB gene

Fig. 2 is for the sequence of the inside 228bp of SDKB gene and hybridization collection of illustrative plates through the paddy rice osmanthus of different digestion with restriction enzyme 99 total DNA

Fig. 3 is that the positive colony that in situ hybridization obtains is carried out in the part library in probe and osmanthus 99 for the sequence with the inside 228bp of SDKB gene

The enzyme of the positive clone of Fig. 4 pGXN7410 is cut banding pattern

Fig. 5 is that the enzyme of recombinant plasmid that contains 3 ' RACE product of SDKB gene is cut banding pattern

Fig. 6 is that the enzyme of recombinant plasmid that contains 5 ' RACE product of SDKB gene is cut banding pattern

Fig. 7 is the physical map of the paddy rice expression vector pCambia 1301-UbiN of structure

Fig. 8 is the physical map of the paddy rice expression vector pCambia 1301-UbiN-4408 of structure

Fig. 9 is the physical map of the paddy rice expression vector pCambia 1301-UbiN-400 of structure

Figure 10 a is the pcr analysis in TP309 plant T1 generation of genomic gene of SDKB of justice of becoming a full member

Figure 10 b is the Southern hybridization analysis of PCR product in TP309 plant T1 generation of genomic gene of SDKB of justice of becoming a full member

Figure 11 is the sequencing analysis result of PCR product in TP309 plant T1 generation of genomic gene of SDKB of justice of becoming a full member

Figure 12 is that the become a full member T1 of TP309 of genomic gene of SDKB of justice detects collection of illustrative plates for the Southern of plant hybridization

Figure 13 is that the osmanthus 99T1 of genomic gene of the SDKB of antisense identifies collection of illustrative plates for the PCR of plant

Figure 14 is that the become a full member TP309T1 of genomic gene of SDKB of justice detects photo for plant to the resistance of bacterial blight of rice

Figure 15 is that the become a full member TP309T1 of genomic gene of SDKB of justice detects photo for plant to the resistance of rice blast

Figure 16 is that the osmanthus 99T1 of genomic gene of the SDKB of antisense detects photo for plant to the resistance of bacterial blight of rice

Figure 17 is a probe and the hybridization banding pattern of the different total DNA of rice varieties that cuts through the EcoRI enzyme for the sequence with the inside 228bp of the genomic gene of SDKB

Embodiment

Used in an embodiment of the present invention material comprises: intestinal bacteria (Escherichia coli) strain is JM109, available from 3 ' the RACE test kit (3 ' RACE System for RapidAmplification of cDNA Ends, catalog number (Cat.No.) 18373-027) of Invitrogen company and 5 ' RACE test kit (SMART of Clontech company ^TMRACE eDNA Amplification kit, catalog number (Cat.No.) K1811-1), available from reagent such as the restriction enzyme of Promega, Stratagene, TaKaRa, Sigma, Qiagen, modifying enzymes.

The clone of the genomic gene of embodiment 1, plant disease resistance-related protein SDKB

The synthetic a pair of primer (primer sequence RiF2:5 ' CTTGAAAACCGAGTTGCT 3 ' of design; RiR2:5 ' TTTCCCGAGCTCCACTGT 3 '), with this to primer, according to ordinary method to through benzene (1,2,3) thiadiazole-(benzo (1 for 7-carbothioic acid carbothiolic acid S-methyl esters, 2,3) thiadiazole-7-carbothioc acid S-methyl ester, be called for short BTH) handle that (treatment process is: adding BTH is to the about 0.3mM of final concentration in watering of potted plant osmanthus 99 in 3 weeks of growing poured water, handle the blade in paddy rice osmanthus 99 with the BTH spraying of 0.3mM simultaneously, handle and gathered rice leaf in back 48 hours) total RNA in paddy rice osmanthus 99 carry out RT-PCR, the result obtains the PCR product (Fig. 1) of an about 200bp, with this PCR product cloning in the pGEM-3Zf (+) that cuts through the SmaI enzyme (available from Promega company), two-way two strands has been measured the segmental dna sequence dna of insertion of two transformants, the result shows that these two clones' the sequence of foreign DNA is identical, size is 228bp and GenBank call number AP002537, AP002746, NM_189701, NM_188219, AK120715, corresponding sequence 100% in the AY323485 sequence is identical.Among Fig. 1,1 for 100bp ladder (clip size is followed successively by from big to small: 3kb, 2kb, 1.5kb, 1.2kb, 1kb, 900bp, 800bp, 700bp, 600bp, 500bp, 400bp, 300bp, 200bp, 100bp); 2 is the PCR product.

Make probe and respectively through osmanthus 99 total DNA hybridization that EcoRI, BamHI or BamHI/EcoRI enzyme are cut, the result shows the hybrid belt that obtains about 25kb, a 11kb and 7.4kb respectively as shown in Figure 2 with this PCR product.Among Fig. 2,1 for λ/EcoRI (clip size is followed successively by from big to small: 21.2kb, 7.4kb, 5.8kb, 5.6kb, 4.9kb, 3.5kb); 2-4 is the electrophorogram that osmanthus 99 total DNA cut through EcoRI, BamHI, EcoRI/BamHI enzyme respectively; 5-7 be osmanthus 99 total DNA respectively through EcoRI, BamHI, EcoRI/BamHI enzyme cut and electrophoresis after with the hybridization banding pattern of probe.Cut osmanthus 99 total DNA with the dual enzyme of BamHI/EcoRI, reclaim the dna fragmentation about 7.4kb, clone these fragments structures with the pGEM-3Zf (+) that cuts through the BamHI/EcoRI enzyme and obtain the portion gene library, screen about 12000 transformants with bacterium colony in situ hybridization, the result obtains 1 positive colony pGXN7410 as shown in Figure 3.Two-way two strands has been measured the dna sequence dna of this positive colony, the result shows that this BamHI/EcoRI clip size is the 7417bp (sequence 1 in the sequence table, Fig. 4), contain a complete gene above, it is the genomic gene of plant disease resistance-related protein SDKB of the present invention, size is 4241bp (sequence 5 in the sequence table), infer that it contains four exons, three introns, 1-561 bit base from 5 ' end is first exon of this genomic gene, 2284-3031 bit base from 5 ' end is second exon of this genomic gene, 3240-3440 bit base from 5 ' end is the 3rd exon of this genomic gene, 4003-4241 bit base from 5 ' end is the 4th exon of this genomic gene, from 5 ' the 1-3 bit base of end be the initiator codon ATG of this genomic gene, from 5 ' the 4239-4241 bit base held is the terminator codon TGA of this genomic gene; 562-2283 bit base from 5 ' end is first intron of this genomic gene, from 5 ' the 3032-3239 bit base of end be second intron of this genomic gene, from 5 ' the 3441-4002 bit base held is the 3rd intron of this genomic gene.

The 7417bp BamHI/EcoRI that obtains that clones segmental from 5 ' end the 2365-2925 bit base be first exon of the genomic gene of SDKB, 4648-5395 bit base from 5 ' end is second exon of the genomic gene of SDKB, 5604-5804 bit base from 5 ' end is the 3rd exon of the genomic gene of SDKB, 6367-6605 bit base from 5 ' end is the 4th exon of the genomic gene of SDKB, 2365-2367 bit base from 5 ' end is the initiator codon ATG of the genomic gene of SDKB, is the terminator codon TGA of the genomic gene of SDKB from 5 ' the 6603-6605 bit base of holding.

One of said gene group genes encoding contains 582 amino acid whose protein (sequence 4 in the sequence table), the mRNA of this gene of inferring and the mRNA homology of Arabidopis thaliana NPR1 gene are 57.2%, encoded protein matter product and the proteinic similarity of Arabidopis thaliana NPR1 are 66%, and wherein 48% amino acid is identical.Among Fig. 4,1 for 1kb ladder (clip size is followed successively by from big to small: 10.0kb, 8.0kb, 6.0kb, 5.0kb, 4.0kb, 3.5kb, 3.0kb, 2.5kb, 2.0kb, 1.5kb, 1kb); 2 is pGXN7410/EcoRI+BamHI.

Full Length cDNA Cloning and the order-checking of embodiment 2, coded plant disease-resistance-related protein SDKB

Two nested primers (primer RACE3-1:5 ' GAGCCCTTGACTCTGACG 3 ' of the 2nd exon sequence design according to the genomic gene of the plant disease resistance-related protein SDKB that obtains among the embodiment 1; RACE3-2:5 ' GATGCTGCTCACTGAAGG 3 '), use the method (3 ' RACE System for RapidAmplification of cDNA Ends) of 3 ' RACE, utilization is available from 3 ' RACE test kit (3 ' the RACE System for Rapid Amplification of cDNA Ends of Invitrogen company, catalog number (Cat.No.) 18373-027) clone has obtained the cDNA sequence in primer RACE3-2 downstream and has been connected pBluescript M13 KS (+) that (its physical map is seen " molecular cloning experiment guide " (second edition) (female Brooker of J. Sa, E.F. Ritchie not, T. Manny A Disi is outstanding, Jin Dongyan, Li Mengfeng etc. translate, 1992, Science Press, Beijing) the 16th page) the EcoRV site, cut the recombinant plasmid of acquisition with the HindIII/EcoRI enzyme, the result as shown in Figure 5, recombinant plasmid provides and expects the consistent external source fragment of size (about 1.2kb), shows that the recombinant plasmid structure is correct.Among Fig. 5,1 for 1kb ladder (clip size is followed successively by from big to small: 10.0kb, 8.0kb, 6.0kb, 5.0kb, 4.0kb, 3.5kb, 3.0kb, 2.5kb, 2.0kb, 1.5kb, 1kb); 2 is the recombinant plasmid of cutting with the HindIII/EcoRI enzyme.CDNA fragments sequence determination and analysis to this clone shows that this fragment length is 1182bp (a sequence table sequence 2), 3 ' end has the poly (A) of 17 bases, the corresponding sequence 100% of the nucleotide sequence of all the other 1165 based compositions and SDKB gene is consistent, the nucleotide sequence that contains 449 based compositions in exon 2 downstream (sequence 1 in the sequence table is from 5 ' end 4947-5395 bit base), 3 ' end non-coding sequence of the exon 3 of total length and exon 4 and 276 bases.

According to the sequences Design in the terminator codon downstream in 3 ' the RACE product 2 nested primers (primer sequence RiFuR1:5 ' GGGGGGCAATTGACAGAACGCAACCATCAGGTG 3 '; 3 ' END:5 ' GGTGAGTAGCTCCAGGAGGACAG TTAGCTATCAA 3 '), use the method for SMART (Switch Mechanism Atthe 5 ' end of RNA Transcript) 5 ' RACE, utilize 5 ' RACE test kit (SMART of Clontech company ^TMRACE cDNA Amplification kit, catalog number (Cat.No.) K1811-1), the full-length cDNA that synthesizes this gene with downstream primer RiFuR1 specifically, upstream nested primers and 3 ' the END primer that provides with test kit carries out pcr amplification again, the SmaI site of extension amplification outcome to pUC19, cut the recombinant plasmid that obtains with the BamHI/EcoRI enzyme, the result as shown in Figure 6, recombinant plasmid provides and expects the consistent external source fragment of size (about 1.8kb), show that the recombinant plasmid structure is correct, obtain the full-length cDNA of this gene.Among Fig. 6,1 for 1kb ladder (clip size is followed successively by from big to small: 10.0kb, 8.0kb, 6.0kb, 5.0kb, 4.0kb, 3.5kb, 3.0kb, 2.5kb, 2.0kb, 1.5kb, 1kb); 2 is the recombinant plasmid of cutting with the BamHI/EcoRI enzyme.3 clones of picking check order and with the sequence that obtains and clone's 7417bp EcoRI/BamHI sequence relatively, the result shows has 1 to be cloned in the PCR process and not make mistakes, the full length cDNA sequence (sequence 3 in the sequence table) of coding SDKB is consistent with the corresponding sequence 100% of the genomic gene of coding SDKB, the result proves that this gene is the gene of truly expressed in paddy rice osmanthus 99, and four exons, the position of three introns of prediction all are correct.Sequence 3 total lengths in the sequence table are 1826bp, the encoding sequence that to contain a length be 1749 bases, this encoding sequence be sequence 3 from 5 ' end 16-1764 bit base, the 1-15 bit base belongs to 5 ' non-coding region of this gene, and the 1765-1826 bit base belongs to 3 ' non-coding region of this gene.

The structure of embodiment 3, SDKB gene justice and antisense paddy rice expression vector

The structure of paddy rice expression vector

Total DNA with corn is a template, pcr amplification corn Ubiquitin (ubiquitin) promotor, the primer is UbiF (5 ' ACTAAGCTTCTGCAGTGCAGCGTGACCCG 3 ', contain the HindIII restriction enzyme site at its 5 ' end) and UbiR (5 ' GACGGATCCCTGCAGAAGTAACACCAAACAA 3 ' contains the BamHI restriction enzyme site at its 5 ' end).Corn Ubiquitin promotor is cloned on the multiple clone site HindIII and BamHI of plant expression vector pCambia-1301 (its details and physical map are asked for an interview http://www.cambia.org.au/main/r et 1300 1301.htm).Be template again with pCambia-1301, pcr amplification NOS (3 ' of rouge alkali synthetase gene-end transcription termination sequence) terminator, the primer is nosF (5 ' AGCGGTACCCGTTCAAACATTTGGCAATAAAGTT 3 ', contain the KpnI restriction enzyme site at its 5 ' end) and nosR (5 ' GTCGAGCTCCCCGATCTAGTAACATAGATGACACC 3 ', contain the SacI restriction enzyme site at its 5 ' end), the NOS terminator is cloned on the KpnI and SacI of the pCambia-1301 that connects corn Ubiquitin promotor, obtain paddy rice expression vector pCambia1301-UbiN, as shown in Figure 7, the T-DNA structure of pCambia1301-UbiN carrier comprises: T Border (L) (T-DNA left margin); T Border (R) (right margin of T-DNA); The Ubiquitin promotor; The NOS terminator; HYG (R) (hygromycin B phosphotransferase (hygromycin Bphosphotransferase) gene); GUS (glucuronic acid Glycosylase gene has an intron sequences in the gus gene, gus gene is only expressed in transgenic plant cells).

1, the structure of the genomic gene of SDKB justice paddy rice expression vector

Cut pGXN7410 with the XbaI/XhoI enzyme, reclaim 4842bp XbaI/XhoI fragment (sequence 1 in the sequence table is from 5 ' end 1956-6797 bit base) behind the electrophoresis, (its physical map is seen " molecular cloning experiment guide " (second edition) (female Brooker of J. Sa to the XbaI/XhoI fragment subclone that contains total length SDKB genomic gene that recovery is obtained to pBluescript M13 KS (+), E.F. Ritchie not, T. Manny A Disi is outstanding, Jin Dongyan, Li Mengfeng etc. translate, 1992, Science Press, Beijing) the 16th page) XbaI and the XhoI site on, obtain recombinant plasmid pGXN4834, (template is pGXN7410 to the genomic gene initiator codon ATG of pcr amplification SDKB, and primer is NPR1-S:5 ' AATCTAGAATGGAGCCGCCGACCAGCCA 3 ' to the sequence of the SmaI site 188bp of first exon again; NPR1-A:5 ' CCCGGGACGGCGATGCGCGC 3 '), added the XbaI site at 5 of amplified production ' end, the XbaI/SmaI fragment that replaces the 597bp on the pGXN4834 with the amplified production after the XbaI/SmaI enzyme is cut that reclaims, obtain recombinant plasmid pGXN4821, and then the downstream in the XbaI site of this recombinant plasmid is exactly the ATG as the initiator codon of the genomic gene of total length SDKB like this.Behind XbaI and XhoI double digestion pGXN4821, reclaim the external source fragment of 4439bp, with the T of Dalian (treasured) bio-engineering corporation ₄Archaeal dna polymerase reclaims after mending flat two ends, again with the SmaI site of this fragment cloning to paddy rice expression vector pCambia1301-UbiN, cutting recombinant plasmid with restriction enzyme HindIII enzyme is inserted into the clone in Ubiquitin promotor downstream with the genomic gene of screening SDKB with just direction (genomic gene of SDKB is if should discharge the fragment of a treaty 3kb after being cloned in Ubiquitin promotor downstream then the HindIII enzyme is cut with just direction, if the downstream enzyme that is cloned in promotor with antisense orientation should discharge the fragment of a treaty 5.5kb after cutting), obtain the genomic gene total length justice paddy rice expression vector pCambia1301-UbiN-4408 (Fig. 8) of osmanthus 99 SDKB.Use method (the Rogers SG that three parents engage, Horsch RB, Fraley RT.1986.Gene transfer in plants:production of transformed plantsusing Ti-plasmid vectors.Methods Enzymol.118:627-640) recombinant plasmid pCambia1301-UbiN-4408 is imported among the agrobacterium tumefaciens EHA105.

2, the structure of the genomic gene antisense paddy rice expression vector of SDKB

Cut pGXN4821 with XbaI and SalI enzyme, reclaim the 456bp small segment, this fragment contains first exon of genomic gene of SDKB from the initial 56bp sequence of initiator codon ATG.T with Dalian (treasured) bio-engineering corporation ₄Archaeal dna polymerase is mended the SmaI site that is connected to paddy rice expression vector pCambia1301-UbiN behind the flat two ends, screening (is at first cut recombinant plasmid with the EcoRI enzyme and is identified whether connect 456bp external source fragment with the recombinant plasmid that antisense orientation is inserted into Ubiquitin promotor downstream, the BNA fragment that discharges about 1.4kb after cutting as enzyme then illustrates has cloned the 456bp dna fragmentation, cloned the recombinant plasmid of 456bp dna fragmentation more with the EcoRI/SacI double digestion, discharge the dna fragmentation that two sizes are respectively about 1kb and 400bp after cutting as enzyme, illustrate that then the external source fragment is cloned into Ubiquitin promotor downstream with just direction; Discharge the dna fragmentation that two sizes are respectively about 680bp and 720bp after cutting as enzyme, illustrate that then the external source fragment is cloned into Ubiquitin promotor downstream with antisense orientation).Structure obtains antisense paddy rice expression vector pCambia1301-UbiN-400, and it contains the sequence of the genomic gene of paddy rice SDKB from the initial 456bp of initiator codon ATG, and closure is antisense (Fig. 9).The method of using three parents joint imports to recombinant plasmid pCambia1301-UbiN-400 among the agrobacterium tumefaciens EHA105.

Genetic transformation of embodiment 4, paddy rice and resistance are identified

The substratum of tissue culture and conversion is listed in table 1.

Table 1. is used for the substratum of tissue culture and conversion

Substratum	Composition
		NB	N6 is a large amount of, B5 trace, B5 VITAMIN ..., 30g/L sucrose, 2mg/L 2,4-D, 500mg/L proline(Pro), 250mg/L caseinhydrolysate, 2.8g/L phytagel (plant gel)
MSF	MS inorganic salt and VITAMIN, 30g/L sucrose, 2mg/L kinetin, 0.5mg/L NAA, 500mg/l proline(Pro), 250mg/L caseinhydrolysate, 2.8g/L phytagel (plant gel), sorbyl alcohol 30g/L, pH5.8
		1/2MS	1/2MS inorganic salt and VITAMIN, 30g/L sucrose, 8g/L agar pH5.8

1, the genetic transformation of paddy rice

(1) sterilization of rice paddy seed

To go the seed in the paddy rice TP309 (the paddy rice Taibei 309) of shell and osmanthus 99 earlier with 70% ethanol surface sterilization 2min, again with 0.1% mercuric chloride solution sterilization 15-20min, use aseptic water washing 6-7 time at last, soaked 3-4 hour with sterilized water again, then it is inoculated on the NB substratum (pH 5.8), in 26 ± 1 ℃ of dark cultivations about 8 days.

(2) subculture of callus

After the callus that length is good removed bud and seed, forwarding NB substratum (pH 5.8) to carried out succeeding transfer culture 14 days, infected in order to agrobacterium tumefaciens.

(3) cultivation of agrobacterium tumefaciens

Transform at callus and just to begin a few days ago that (every liter contains peptone 5g, extractum carnis 5g, MgSO with the YEB substratum ₄1g, yeast extract paste 1g, sucrose 5g, pH 7.0) cultivation bacterial strain EHA105/pCambia-UbiN-4408 (containing just paddy rice expression vector) or EHA105/pCambia1301-UbiN-400 (containing antisense paddy rice expression vector), add Rifampin (Rif), kantlex (Km) (final concentration is 25 μ g/ml) simultaneously, in 28 ℃ of shaking table overnight incubation, the second day big bottle of switching YEB substratum, contain the microbiotic of same concentration and the Syringylethanone (AS) of 100 μ mol/L in the big flask culture base, cultivate OD ₆₀₀Collected thalline at=0.5 o'clock, again with isopyknic AMM substratum that contains 100 μ mol/L Syringylethanones (AA is a large amount of, AA amino acid, MS is organic, caseinhydrolysate (Casamino acid), 500mg/L; Sucrose, 68.5g/L; PH5.2) the suspension thalline is in order to transforming.

(4) cultivate altogether

Get callus to be transformed in the sterilization triangular flask, the callus of the agrobacterium tumefaciens bacterium liquid rice transformation TP309 that contains just paddy rice expression vector pCambia1301-UbiN-4408 that gets ready more than the adding, the callus that contains the agrobacterium tumefaciens bacterium liquid rice transformation osmanthus 99 of antisense paddy rice expression vector pCambia1301-UbiN-400, soak and remove bacterium liquid after 20 minutes, callus is poured in the sterile petri dish, blot unnecessary bacterium liquid with aseptic filter paper again, be transferred to and place the NB substratum (to contain 100 μ mol/L Syringylethanones, pH5.2) on the aseptic filter paper on, 28 ℃ of dark cultivations 3 days.

(5) screening and culturing

The callus of cultivating altogether after 3 days is transferred in containing cephamycin (cefotaxime, 300 μ g/ml) and the NB substratum of Totomycin (the Totomycin final concentration of TP309 and osmanthus 99 screenings is respectively 30 μ g/ml and 25 μ g/ml, pH5.8) go up 4 weeks of screening and culturing (per two weeks are changed a subculture), resistant calli is transferred go up 4 weeks of screening and culturing (per two weeks are changed a subculture) again in the NB substratum that contains cephamycin (300 μ g/ml) and high density Totomycin (the Totomycin final concentration of TP309 and osmanthus 99 screenings is respectively 50 μ g/ml and 40 μ g/ml).

(6) differentiation of resistant calli

Get the embryo resistant calli and transfer on MSF substratum (pH5.8), 26 ℃ of illumination (illumination every day 14 hours, intensity of illumination are 3000Lux) are cultivated and 2-3 week are grown up to seedling.

(7) the taking root of resistance seedling, hardening and transplanting

The seedling that bears is again transferred on 1/2MS substratum (pH5.8), continue 26 ℃ of illumination cultivation to take root.Root is grown good resistance seedling move and in Glass tubing that contains 1/2MS substratum (pH5.8) or bottle, continue 26 ℃ of illumination open culture 3 days, be transplanted to then (soil is potted plant) in the greenhouse with hardening.

(8) plant is identified

Obtained 113 strains of hygromycin resistance differentiation seedling with recombinant plasmid pCambia1301-UbiN-4408 rice transformation TP309, whole transplant survivals, gathered in the crops at present obtain 62 transgenic lines T1 for seed.The plant that survives is carried out PCR and dna sequencing and Southern hybridization identifies.

1. be template with the not transgenosis TP309 plant (negative control) of extracting and total DNA and the plasmid pCambia 1301-UbiN-4408 DNA (positive control) of genetically modified TP309 plant according to ordinary method, use primers F SDKB1:5 ' TGAATAGGTAGCCTAGTTAATCTTTCTTGGGGTGC 3 ', and RNOS:5 ' GCGGGACTCTAATCATAAAAACCCATCTCATAAAT 3 ' carries out pcr amplification, the result shows that transfer-gen plant to be detected has all provided the PCR fragment onesize with positive control shown in Figure 10 a.With what checked order is that the PCR product of correct positive control is made probe the TP309 T1 that changes the SDKB genomic gene is done Southern hybridization for the PCR product of plant by analysis, the result is shown in Figure 10 b, show all PCR products can both and probe hybridization, the PCR product that confirmation obtains is the correct product of specificity, thereby proves that they all are transfer-gen plants.Among Figure 10 a and Figure 10 b, M be 1kb ladder (clip size is followed successively by from big to small: 10.0kb, 8.0kb, 6.0kb, 5.0kb, 4.0kb, 3.5kb, 3.0kb, 2.5kb, 2.0kb, 1.5kb, 1kb, 750bp, 500bp, 250bp); 1 positive contrast (is the PCR product of template with pCambia 1301-UbiN-4408); 2 negative contrasts (not transgenosis TP309 plant); 3-28 is that the T1 of TP309 strain system of genomic gene of 26 adopted SDKB that become a full member is for plant.

2. get the become a full member T1 of TP309 of genomic gene of adopted SDKB of 3 strains of step in 1. at random and carry out two-way double-stranded order-checking for the PCR product of plant, the result as shown in figure 11, it is all identical to show that each PCR product all records nucleotide sequence and the sequence of 738bp, and wherein the 1-602 bit base is the genomic gene 3 ' terminal sequence (band underscore-----nucleotide sequence) of SDKB; The 603-612 bit base is carrier sequence (band underscore-nucleotide sequence); 613-738 bit base (band underscore-nucleotide sequence) is the upstream sequence of NOS terminator.The PCR product sequence that records all and the pCambia1301-UbiN-4408 that records with same primer to go up corresponding sequence in full accord, the sequence that further proves the PCR product thus all is correct, the transfer-gen plant that is all the genomic gene that changes SDKB of the positive plant of pcr analysis.

3. extract not total DNA of transgenosis TP309 plant (negative control) and genetically modified TP309 plant according to ordinary method, utilize restriction enzyme HindIII enzyme to cut above-mentioned total DNA, 3.1kbEcoRV/XhoI fragment (sequence 1 holds the 3606-6797 bit base from 5 ' in the sequence table) with plasmid pGX4821 is a probe, carry out Southern hybridization according to ordinary method, the result as shown in figure 12, show that all plant all have the endogenous hybrid belt of a 3.9kb, and transfer-gen plant is except having endogenous hybrid belt, also have more at least one hybrid belt that varies in size, the genomic gene that the SDKB in osmanthus 99 is described has been directed among the TP309 really and has been incorporated on the genomic different positions of TP309.Among Figure 12,1 is not genetically modified TP309; 2-9 is a transfer-gen plant.

Obtained 50 strains of hygromycin resistance differentiation seedling with recombinant plasmid pCambia1301-UbiN-400 rice transformation osmanthus 99, transplant survival 32 strains, gathered in the crops at present obtain 29 transgenic lines T1 for seed.PCR detects and shows that these 32 strain systems are transfer-gen plant, and all transfer-gen plants have all provided the PCR fragment onesize with positive control, illustrate that antisense SDKB gene has imported to paddy rice osmanthus 99 (Figure 13).Wherein, PCR identifies that the primer is UBRNF (5 ' TGCATATACATGATGGCATATGCAGCATCTATTC 3 ') and RNOS (5 ' GCGGGACTCTAATCATAAAAACCCATCTCATAAA 3 ').Among Figure 13, M be 1kb ladder (clip size is followed successively by from big to small: 10.0kb, 8.0kb, 6.0kb, 5.0kb, 4.0kb, 3.5kb, 3.0kb, 2.5kb, 2.0kb, 1.5kb, 1kb, 750bp, 500bp, 250bp); 1 positive contrast (is template with plasmid pCambia1301-Ubi-400); 2 are not genetically modified paddy rice osmanthus 99; 3-14 is a transfer-gen plant.

2, transfer-gen plant detects the resistance of bacterial blight of rice, rice blast

(1) uses the leaf-cutting inoculation method and detected the TP309T1 of genomic gene of SDKB of the justice of becoming a full member of 21 strain systems for the resistance of plant to bacterial blight of rice, the rice leaf spot bacteria of inoculation is the pathogenic Chinese bacterial strain 13751 of mutation (Xanthomonas oryzae pv.oryzae) of rice Xanthomonas paddy rice, inoculum density is OD600=0.001, inoculate back 14 days and measure scab length, the result contrasts not that the average scab length of genetically modified TP309 is 9.21cm, and the average scab length of the plant of the genomic gene of the SDKB of the justice of becoming a full member all is shorter than 2.5cm (table 2, Figure 14), show that TP309 has obtained that the resistance to bacterial blight of rice significantly strengthens behind the just SDKB genomic gene.Among Figure 14,1 is not genetically modified TP309; 2-9 for the T1 of the TP309 that changes the SDKB genomic gene for plant.

The become a full member TP309 T1 of SDKB genomic gene of justice of table 2. detects the cause a disease resistance of mutation 13751 of rice Xanthomonas paddy rice for plant

Strain system	Average scab length (cm)	Standard error	Standard deviation	Significance
					CK(TP309)	9.21	1.05	2.96
484	1.97	0.135	0.751	Extremely remarkable
					486	1.41	0.154	0.511	Extremely remarkable
488	1.09	0.11	0.33	Extremely remarkable
					490	1.39	0.118	0.486	Extremely remarkable
492	1.98	0.165	0.719	Extremely remarkable
					494	1.6	0.13	0.7	Extremely remarkable
495	1.55	0.088	0.424	Extremely remarkable
					498	1.45	0.108	0.417	Extremely remarkable
574	1.95	0.275	1.291	Extremely remarkable
					742	2.49	0.299	1.583	Extremely remarkable
743	1.03	0.277	0.677	Extremely remarkable
					744	1.875	0.305	1.493	Extremely remarkable
746	2.36	0.569	2.131	Extremely remarkable
					750	1.23	0.131	0.572	Extremely remarkable
753	1.28	0.119	0.582	Extremely remarkable
					755	1.27	0.138	0.689	Extremely remarkable
758	1.46	0.273	0.611	Extremely remarkable
					820	0.8	0.095	0.401	Extremely remarkable
862	0.89	0.098	0.324	Extremely remarkable
					865	1.39	0.118	0.529	Extremely remarkable
866	0.9	0.115	0.474	Extremely remarkable

(2) use spraying spore inoculating method and detected the TP309T2 of genomic gene of SDKB of the justice of becoming a full member of 20 strain systems for the resistance of plant to rice blast, the Pyricularia oryzae of inoculation is a CHL0742 China bacterial strain, inoculum density is each visual field 30-50 spore, inoculate back 8 days investigation incidences, the result shows that the average disease index of not genetically modified TP309 (contrast) is 52.63, and the genomic gene plant that changes SDKB has the average disease index of 12 strain systems all below 30, the average disease index that 7 strain systems are arranged is between 30-40, the average disease index that has only 1 strain system is more than 50, be 51.85 (table 3, Figure 15).Illustrate that susceptible TP309 has obtained that the resistance to rice blast significantly strengthens behind the just SDKB genomic gene.Among Figure 15,1 is not genetically modified TP309; 2 for changeing the TP309 of SDKB genomic gene.

The become a full member TP309T2 of genomic gene of SDKB of justice of table 3. detects the resistance of Pyricularia oryzae CHL0742 for plant

Strain is a disease index

CK(TP309) 52.63

487 24.84

488 26.92

490 17.78

744 29.41

749 31.37

753 23.33

862 22.22

869 33.33

873 24.34

875 30.56

876 33.33

878 23.81

885 32.68

888 21.85

892 33.33

893 37.3

901 51.85

923 23.23

924 29.17

966 26.26

(3) use the leaf-cutting inoculation method and detected osmanthus 99 T1 of genomic gene of SDKB of antisense of 26 strain systems for the resistance of plant to bacterial blight of rice, the rice leaf spot bacteria of inoculation is the pathogenic mutation of rice Xanthomonas paddy rice China bacterial strain 13751, inoculum density is OD600=0.001, inoculate back 14 days and measure scab length, the result shows that the average scab length in not genetically modified osmanthus 99 (contrast) is 4.03cm, in the antisense SDKB genomic gene plant, the average scab length that 10 strain systems are arranged is greater than 5.7cm, resistance to bacterial blight of rice significantly weaken (table 4, Figure 16).Thereby illustrate that osmanthus 99 has obtained to make behind the antisense sequences of genomic gene of SDKB the SDKB expression of gene of self to be suppressed its resistance to bacterial blight of rice is weakened.

Osmanthus 99 T1 of table 4. antisense SDKB genomic gene detect for the resistance of plant to the pathogenic mutation 13751 of rice Xanthomonas paddy rice

Strain system

Average scab length (cm)

Standard error

Standard deviation

Significance

CK (osmanthus 99)	4.03	0.334	1.4932
					H 1	3.658	0.328	1.1354	Not remarkable
H 2	3.69	0.323	1.0225	Not remarkable
					H 3	7.8	0.647	1.7108	Extremely remarkable
H 3-1	6.675	0.144	0.2872	Extremely remarkable
					H 3-2	5.729	0.72	1.9041	Significantly
H 4	6.2	0.57	1.3971	Extremely remarkable
					H 4-2	5.257	0.524	1.3855	Not remarkable
H 5	7.64	0.903	2.0182	Extremely remarkable
					H 6	6.263	0.807	2.2822	Extremely remarkable
H 8	4.393	0.173	0.6462	Not remarkable
					H 11	3.86	0.195	0.6472	Not remarkable
H 12	4.87	0.196	0.6201	Not remarkable
					H 14	6.789	0.666	1.9978	Extremely remarkable
H 15	6.743	0.542	1.4339	Extremely remarkable
					H 16	6.536	0.373	1.2355	Significantly
H 18	3.075	0.39	0.7805	Not remarkable
					H 20	4.013	0.386	1.0921	Not remarkable
H
	22	9	1.4	1.9799	Extremely remarkable
H 23						2.367	0.353	0.611	Not remarkable
	H 25	3.371	0.524	1.3853	Not remarkable
H 26						4.838	0.336	0.9501	Not remarkable
	H 27	4.733	0.632	1.5488	Not remarkable
H 28						3.614	0.304	0.805	Not remarkable
	H 29	3.5	0.267	1.0344	Not remarkable
H 30						3.525	0.183	0.6355	Not remarkable
	H 32	5.74	0.699	1.563	Significantly

Ubiquity SDKB in embodiment 5, the paddy rice

The PCR product of the 228bp that obtains with RT-PCR among the embodiment 1 makes probe and 7 rice varieties cutting through the EcoRI enzyme (838, K17B, ZSP selects 1, P702B, rich B, ZSP517, total DNA hybridization IR36).Total DNA with the osmanthus 99 of cutting through the EcoRI enzyme compares.IR36 blast resisting, bacterial leaf-blight, ZSP517 blast resisting but sense bacterial leaf-blight, other 5 rice varieties (838, K17B, ZSP selects 1, P702B, rich B) are all felt this two kinds of diseases.These 7 rice varieties and osmanthus 99 all provide the hybrid belt (Figure 17) of an identical about 25kb as a result.SDKB gene ubiquity in paddy rice is described.M is λ DNA/HindIII; 1 is IR36/EcoRI, and 2 is D702B/EcoRI; 3 is K17B/EcoRI; 4 select 1/EcoRI for ZSP; 5 is ZSP517/EcoRI; 6 are rich IIR/EcoRI; 7 is 838/EcoRI; 8 is osmanthus 99/EcoRI.

Sequence table

<160>5

<210>1

<211>7417

<212>DNA

＜213〉Oryza paddy rice (Oryza sativa L.)

<220>

<221>exon

<222>(2365)..(2925)

<220>

<221>Intron

<222>(2926)..(4647)

<220>

<221>exon

<222>(4648)..(5395)

<220>

<221>Intron

<222>(5396)..(5603)

<220>

<221>exon

<222>(5604)..(5804)

<220>

<221>Intron

<222>(5805)..(6366)

<220>

<221>exon

<222>(6367)..(6605)

<400>1

ggatccaact ggtagagtcc atagccaaac acaataaaat tatgggtaca catccaaggc 60

gaaaaagcaa gtcattaatc tttcttcaca tcgacgtgta gatgtgatct cttctttgtc 120

aatctttgtt ttttcacttt ctttaatacg ggcagcttcg ttttgcaatt tggtcctttc 180

agttcctgga aaatatagag taaacactcc tgcgtgtggt gaactggtga caagtgacaa 240

ctccttttat ctcttcttta attggagctg tttattactt tattgtaaaa ctaatataag 300

ttaactactc ccactatttc ataatataaa acatggtcaa atttggtaca atctccaaca 360

ctaatgttta gcttataatt tctcatataa ggtttgtagc aatcaaatta tagacatatg 420

aaagtaaatt taaatctcaa actaatgata taattcttag caaataaaat tcatttcata 480

ttatactaag tgttggtcaa atgttttaaa tgttgattct tgaaatacgt gcgcgcctta 540

tattatggga tggagggagt ataatcttgt atgaaaagga tagaggaaga aaattaagaa 600

atgttaactc ttatgtactg agctaactgt atattccatt ctttagtttt tccaaagtcc 660

tatttgtagt caataagtgc taaattaaat tgttagttgg aacccaagaa gccattctat 720

tactttttcg ttggagtatc acacagtgaa taaattaatt gcttcttagt cttggtgaaa 780

agaaatagat tttagacttt tggaaggagg cagttcatgc ttcaaggtaa atatattaat 840

tacataggtg agaggaaaag agaaaaataa ttagatgcac cctcagagta agtttaatag 900

tatagctcac tactaactcc aatttattta taaccaatct agtagtcaat ttatacaata 960

gttgcctact atactattaa tatatgattc tacttgtcat acacatactg cgtcttgtag 1020

tccgtactgc agctggctac agatctgtag cccgctggtc ttctctctta tcttttatct 1080

cattaaaata tacttatagc tggctaatag tctgctattg tacttgctct catagctaat 1140

atattatata tgttcgtatt aatactactt tatgattgat ttgtaattat tttactacta 1200

gtattaaatt taaatttgct cttactccag ttcatactac ttcctctgtc caccaatgca 1260

agagatttaa acttaaaatt atccataaac atgtttagag tgtatacagc ttcaccgacc 1320

cactggtagt ttagtcattt ggcttttcag taagcacttg attaattaat tattaattac 1380

tataaatttg aaaataaatt tatttaatat tgtgaaacct tttatttaga aaaactaaaa 1440

cacactattt agatgttttg gagtttgtta ataaaaacga gggagttatc atcctaatat 1500

gcaaaaataa actaagcctt aggggcataa cttcaacctt aaactttgct aatagcctac 1560

tcctttcatt ataaaatata ctagtaggtc tttactacaa aacaaatata tgataaaaac 1620

atatttaatg ttagatttaa taaaactaat ttgatatttt aaatagtact aaattattct 1680

ataaatttgg tcaaacttaa caagtttgac aaaagaaaag ttaaacgact cataatataa 1740

aacataggag tataggttat tacaattgag aagaaaatat ctgggtgtca catgagaact 1800

tgttggggtg agaggctagg gtaagataaa aagaaattta aaaagaggat gagggaggct 1860

agagtataac acatagtatt atgaatactc cttccatcct aaaaaagctg acctagttag 1920

ggatagaaga taacatagta cgatgaatat tcatgtctag acttgctaag ttaggttgtg 1980

ttccatcctt attttatttt tttttatgaa gggaataatt tctctcggaa gagaggaggt 2040

gtgtaagcca ttatttgtgt ggaagcaaga ggtatttacg tttgttggct ttcacgaggc 2100

accaccaatt gtgaattgtc agttactcca gtctggtcaa cgaaggaatg accttgtaaa 2160

atccctaaat ctacaggtgc aatgtgcaaa attgcggttt gcacctcact cctcgtttta 2220

ctactccatc cctttcgcct tcgacttcct cgcgccttcc caccagctcg ggcgggaggc 2280

ctcctcctcg cctcgcctcg ccacgccgcg ccgcgacgcg acgcgccgtg gtcagctggt 2340

cgccggtgcg ggtgcgggtg cgcaatggag ccgccgacca gccacgtcac caacgcgttc 2400

tccgactcgg acagcgcgtc cgtggaggag ggggacgccg acgcggacgc cgacgtggag 2460

gcgctccgcc gcctctccga caacctcgcc gcggcgttcc gctcgcccga ggacttcgcg 2520

ttcctcgccg acgcgcgcat cgccgtcccg ggcggcggcg gcggcggcgg cgacctgcgg 2580

gtgcaccgct gcgtgctctc cgcgcggagc cccttcctgc gcggcgtctt cgcgcgccgc 2640

gccgccgccg ccgcaggcgg cggcggcgag gatggcagcg agaggctgga gctccgggag 2700

ctcctcggcg gcggcggcga ggaggtggag gtcgggtacg aggcgctgcg gctggtgctc 2760

gactacctct acagcggccg cgtcggcgac ctgcccaagg cggcgtgcct ctgcgtcgac 2820

gaggactgcg cccacgtcgg gtgccacccc gccgtcgcgt tcatggcgca ggtcctcttc 2880

gccgcctcca ccttccaggt cgccgagctc accaacctct tccaggtccg cctcttcgca 2940

gctgcctctc cttttcccct tccattcgcg atgctcatgt catgccagtt catctcttcc 3000

ctgtgcttgc ttggatgcgt attgctcata gaagtggggg tttaaagatg cattttttta 3060

gttgcgcgcg tggagctttg ctttaggcgg caaaatgaac tacttctgaa ggagagggga 3120

gatggtctga actgaatcac tcctaatcac gttaatcatt gcaatttgga ttactgcaat 3180

tggaggcctg tgataattgc attgtgatta acttgctgtc atattggcga tgaacagtat 3240

tcaggtttag ttgtttgcga ttttggggat tcacgtgtgc ttggtgctgt atgcattgca 3300

gagaaaaaca aaagcttaca gttgtatgaa cgtgtggatg cgactccctg cttcaattgg 3360

aaatcgtcca aaaagctagt acatcttaag ccattaatca actcagatca tgcactgtta 3420

catcggttat gtttgatcca atcctcctaa tcagtttatt ctaatgtctg aatcgaactg 3480

cctggctaac tgtccttatc taacatgttg ctgcttactg atcttggggg tgcttgccgt 3540

tctcgttgtt atttatcgga ttcttcttgg tcatgttgac gcgaaaatgg aagttaactg 3600

tgtttgatat ccagcaagag ttgtgctgat atagtaaagg tgtttcttaa ccttttcttt 3660

tcttgcaaaa gagcagttcc ttattgaagt atcttcagat aaggcgattg gactgtgcac 3720

catcctattc taggctgctt caagtacaca tgtttcactc aattgtacca tgatagggac 3780

atactcacat accgcacatt atccttccaa atttgtcaat gctgcattaa tgtgacagtg 3840

atatttatgc acagaaagca caatcatatg ttttccactt aaacttgact gtatctcagt 3900

gtttttaaat tgaaatgtca cacatattcg aagcaataat aaacgaacaa caaaaaaaaa 3960

tatgcatgta tcttatggta aaatttgcct tggctatatt acagggggaa aatgagtggc 4020

tacactccaa tcacagcatg tttatccaag aacacaaaag gaaatttcaa aattttaaat 4080

gtaaaagcct aaggtcacta atgtttatat atatatcaac ttttattctc tttacagtct 4140

ttggaagttg tttttaggag ttatgggggt tgtttttcag taattctgtc tcaagattat 4200

attgcttgcg tggctgcgcc atacgtgcca atctgacaag aaccaaacat gattgtacta 4260

attgtatata tagcctagct tcctttggtc caattgatgg ccctcagcct tgtatttata 4320

tttataaatc ttctggcgtt aacattactc tacattgaac ttgctatttc aagtattatg 4380

ttggtgtttg gcttgtaata ttttggtttc taaaaagaat taaaaccagg aagtttcctt 4440

ttctaataaa aaatgggcct tgatgctact tgcttttgtt gacctttgtt ttagaacgtg 4500

gtactgtttt tttcagataa ggctgttcca tactgaatcc attaattatt gctagcccaa 4560

tgcatgtcag tcggttatcg tttgtaatgt ttcactattt taagaagcca gaaccaaagc 4620

aatgatatat tcttcttttt catgcagcgg cgtctccttg atgtccttga taaggttgaa 4680

gtagataacc ttctattgat cttatctgtt gccaacttat gcaacaaatc ttgcatgaaa 4740

ctgcttgaaa gatgccttga tatggtagtc cggtcaaacc ttgacatgat tactcttgag 4800

aagtcattgc ctccagatgt tatcaagcag attattgatg cacgcctaag cctcggatta 4860

atttcaccag aaaacaaggg atttcctaac aaacatgtga ggaggataca cagagccctt 4920

gactctgacg atgtagagct agtcaggatg ctgctcactg aaggacagac aaatcttgat 4980

gatgcgtttg cactgcacta cgccgtcgaa cattgtgact ccaaaattac aaccgagctt 5040

ttggatctcg cacttgcaga tgttaatcat agaaacccaa gaggttatac tgttcttcac 5100

attgctgcga ggcgaagaga gcctaaaatc attgtctccc ttttaaccaa gggggctcga 5160

ccagcagatg ttacattcga tgggagaaaa gcggttcaaa tctcaaaaag actaacaaaa 5220

caaggggatt actttggggt taccgaagaa ggaaaacctt ctccaaaaga taggttatgt 5280

attgaaatac tggagcaagc tgaaagaagg gacccacaac tcggagaagc atcagtttct 5340

cttgcaatgg caggtgagag tctacgagga aggttgctgt atcttgaaaa ccgaggtaac 5400

cttcacatat attataatgg gttcataatg ctggtttctt tggaattaac tgtttttggt 5460

cttggcaaca aaaggaaggt tacatttcag tttagtgtgt ttcatgcaga gtgcagtttc 5520

aagagtttcc cagtgcccat tttttagaac ttccattttg ttatgaagtt gtatcttgat 5580

attatagttt ttgtacgatg tagttgcttt ggcaaggatt atgtttccga tggaggcaag 5640

agtagcaatg gatattgctc aagtggatgg aactttggaa tttaacctgg gttctggtgc 5700

aaatccacct cctgaaagac aacggacaac tgttgatcta aatgaaagtc ctttcataat 5760

gaaagaagaa cacttagctc ggatgacagc actctccaaa acaggtaata cacggcactc 5820

tgtttattca cactgcctcc aagcgatgta tattttgaat ctaatgctac aaacttgtgt 5880

ggcacactgc tacacatgca aatatttttg atttttcata ttttctgatg gaagctaaaa 5940

ctatagatgc tcccattttg actgataggt tcactgttga ataccctgag aggtttatgc 6000

aatgttgcat atcttttagc tctaacactg tcaatgtgaa ccatggacaa ttttgctctt 6060

ttttgttcat tcagaatgat agttcatact acctgaagat taaataattg acaaagatat 6120

gtacacttta ctgtggtaat ttctaatttt aatctggtct tgaataggta gcctagttaa 6180

tctttcttgg ggtgcatgtg ttgtctatag acttttgtgg ttgaaaaatc tttgtacatc 6240

aagagcacag aatatactta ggtatatcta taggaacaac tgcttgagat tcatcacaga 6300

agttgcaaag acattacatt ctcttaattg gacatagact aattgcaagc tgaatgtgta 6360

taccagtgga gctcgggaaa cgctttttcc cgcgatgttc gaacgtgctc gacaagatca 6420

tggatgatga aactgatccg gtttccctcg gaagagacac gtccgcggag aagaggaaga 6480

ggtttcatga cctgcaggat gttcttcaga aggcattcca cgaggacaag gaggagaatg 6540

acaggtcggg gctctcgtcg tcgtcgtcat cgacatcgat cggggccatt cgaccaagga 6600

gatgaacacc attgctccca aatagttgcc atattgatag ctaactgtcc tcctggagct 6660

actcacctga tggttgcctt ctgtcaattg ccccccaaat atattctcaa tggtttaggc 6720

ttgtacagta ttagttctta cagctattgc cccgtcaatt gtgaaacgca gaagtttcac 6780

tagtgcttgt actcgaggtg taatacaagt gcttgaattt tgagttgtac ttggaatttc 6840

cagtggtttg ctcgtaaaaa tgagatgatt tcttggctcc caaatctgat agactgatga 6900

aatagactct ctgcttgcta gtggtcacca gagatggctg aaggccactg aagcatctac 6960

tctaccagag atgcactaaa aactacactg tacttgttac atctggatga agcagtagaa 7020

cagtaaactc atctctttac tgttccctct gccatgtcga gtggtaaaaa tacaaaatta 7080

catgatggat caaactctgt tctttactgc tctctgtttc aagtttcaac tactaccaaa 7140

ctgtggccaa atgccgttaa tgcgaggcaa ggacctcctc ctgaatactg aatgcagcag 7200

ctagcagacg aatgcagcat aggaactcca aaaagcttga gccctttttc ctaaatcagc 7260

tccaatcctg gcgcgtagga ggagtagcct tttggcgcgc aaccactggt ccatcgcatt 7320

tgcatgcgtt ggtgtcaacc acctggaaat tgcactgatc gtcgccattg cagcagcaag 7380

aaggcaagga aacctcatcc aagaaatctc tgaattc 7417

<210>2

<211>1182

<212>DNA

＜213〉Oryza paddy rice (Oryza sativa L.)

<400>2

gatgctgctc actgaaggac agacaaatct tgatgatgcg tttgcactgc actacgccgt 60

cgaacattgt gactccaaaa ttacaaccga gcttttggat ctcgcacttg cagatgttaa 120

tcatagaaac ccaagaggtt atactgttct tcacattgct gcgaggcgaa gagagcctaa 180

aatcattgtc tcccttttaa ccaagggggc tcgaccagca gatgttacat tcgatgggag 240

aaaagcggtt caaatctcaa aaagactaac aaaacaaggg gattactttg gggttaccga 300

agaaggaaaa ccttctccaa aagataggtt atgtattgaa atactggagc aagctgaaag 360

aagggaccca caactcggag aagcatcagt ttctcttgca atggcaggtg agdgtctacg 420

aggaaggttg ctgtatcttg aaaaccgagt tgctttggca aggattatgt ttccgatgga 480

ggcaagagta gcaatggata ttgctcaagt ggatggaact ttggaattta acctgggttc 540

tggtgcaaat ccacctcctg aaagacaacg gacaactgtt gatctaaatg aaagtccttt 600

cataatgaaa gaagaacact tagctcggat gacagcactc tccaaaacag tggagctcgg 660

gaaacgcttt ttcccgcgat gttcgaacgt gctcgacaag atcatggatg atgaaactga 720

tccggtttcc ctcggaagag acacgtccgc ggagaagagg aagaggtttc atgacctgca 780

ggatgttctt cagaaggcat tccacgagga caaggaggag aatgacaggt cggggctctc 840

gtcgtcgtcg tcatcgacat cgatcggggc cattcgacca aggagatgaa caccattgct 900

cccaaatagt tgccatattg atagctaact gtcctcctgg agctactcac ctgatggttg 960

ccttctgtca attgcccccc aaatatattc tcaatggttt aggcttgtac agtattagtt 1020

cttacagcta ttgccccgtc aattgtgaaa cgcagaagtt tcactagtgc ttgtactcga 1080

ggtgtaatac aagtgcttga attttgagtt gtacttggaa tttccagtgg tttgctcgta 1140

aaaatgagat gatttcttgg ctcccaaaaa aaaaaaaaaa aa 1182

<210>3

<211>1826

<212>DNA

＜213〉Oryza paddy rice (Oryza sativa L.)

<220>

<221>CDS

<222>(16)..(1764)

<400>3

gggtgcgggt gcgcaatgga gccgccgacc agccacgtca ccaacgcgtt ctccgactcg 60

gacagcgcgt ccgtggagga gggggacgcc gacgcggacg ccgacgtgga ggcgctccgc 120

cgcctctccg acaacctcgc cgcggcgttc cgctcgcccg aggacttcgc gttcctcgcc 180

gacgcgcgca tcgccgtccc gggcggcggc ggcggcggcg gcgacctgcg ggtgcaccgc 240

tgcgtgctct ccgcgcggag ccccttcctg cgcggcgtct tcgcgcgccg cgccgccgcc 300

gccgcaggcg gcggcggcga ggatggcagc gagaggctgg agctccggga gctcctcggc 360

ggcggcggcg aggaggtgga ggtcgggtac gaggcgctgc ggctggtgct cgactacctc 420

tacagcggcc gcgtcggcga cctgcccaag gcggcgtgcc tctgcgtcga cgaggactgc 480

gcccacgtcg ggtgccaccc cgccgtcgcg ttcatggcgc aggtcctctt cgccgcctcc 540

accttccagg tcgccgagct caccaacctc ttccagcggc gtctccttga tgtccttgat 600

aaggttgaag tagataacct tctattgatc ttatctgttg ccaacttatg caacaaatct 660

tgcatgaaac tgcttgaaag atgccttgat atggtagtcc ggtcaaacct tgacatgatt 720

actcttgaga agtcattgcc tccagatgtt atcaagcaga ttattgatgc acgcctaagc 780

ctcggattaa tttcaccaga aaacaaggga tttcctaaca aacatgtgag gaggatacac 840

agagcccttg actctgacga tgtagagcta gtcaggatgc tgctcactga aggacagaca 900

aatcttgatg atgcgtttgc actgcactac gccgtcgaac attgtgactc caaaattaca 960

accgagcttt tggatctcgc acttgcagat gttaatcata gaaacccaag aggttatact 1020

gttcttcaca ttgctgcgag gcgaagagag cctaaaatca ttgtctccct tttaaccaag 1080

ggggctcgac cagcagatgt tacattcgat gggagaaaag cggttcaaat ctcaaaaaga 1140

ctaacaaaac aaggggatta ctttggggtt accgaagaag gaaaaccttc tccaaaagat 1200

aggttatgta ttgaaatact ggagcaagct gaaagaaggg acccacaact cggagaagca 1260

tcagtttctc ttgcaatggc aggtgagagt ctacgaggaa ggttgctgta tcttgaaaac 1320

cgagttgctt tggcaaggat tatgtttccg atggaggcaa gagtagcaat ggatattgct 1380

caagtggatg gaactttgga atttaacctg ggttctggtg caaatccacc tcctgaaaga 1440

caacggacaa ctgttgatct aaatgaaagt cctttcataa tgaaagaaga acacttagct 1500

cggatgacag cactctccaa aacagtggag ctcgggaaac gctttttccc gcgatgttcg 1560

aacgtgctcg acaagatcat ggatgatgaa actgatccgg tttccctcgg aagagacacg 1620

tccgcggaga agaggaagag gtttcatgac ctgcaggatg ttcttcagaa ggcattccac 1680

gaggacaagg aggagaatga caggtcgggg ctctcgtcgt cgtcgtcatc gacatcgatc 1740

ggggccattc gaccaaggag atgaacacca ttgctcccaa atagttgcca tattgatagc 1800

taactgtcct cctggagcta ctcacc 1826

<210>4

<211>582

<212>PRT

＜213〉Oryza paddy rice (Oryza sativa L.)

<400>4

Met Glu Pro Pro Thr Ser His Val Thr Ash Ala Phe Ser Asp Ser Asp

1 5 10 15

Ser Ala Ser Val Glu Glu Gly Asp Ala Asp Ala Asp Ala Asp Val Glu

20 25 30

Ala Leu Arg Arg Leu Ser Asp Asn Leu Ala Ala Ala Phe Arg Ser Pro

35 40 45

Glu Asp Phe Ala Phe Leu Ala Asp Ala Arg Ile Ala Val Pro Gly Gly

50 55 60

Gly Gly Gly Gly Gly Asp Leu Arg Val His Arg Cys Val Leu Ser Ala

65 70 75 80

Arg Ser Pro Phe Leu Arg Gly Val Phe Ala Arg Arg Ala Ala Ala Ala

85 90 95

Ala Gly Gly Gly Gly Glu Asp Gly Ser Glu Arg Leu Glu Leu Arg Glu

100 105 110

Leu Leu Gly Gly Gly Gly Glu Glu Val Glu Val Gly Tyr Glu Ala Leu

115 120 125

Arg Leu Val Leu Asp Tyr Leu Tyr Ser Gly Arg Val Gly Asp Leu Pro

130 135 140

Lys Ala Ala Cys Leu Cys Val Asp Glu Asp Cys Ala His Val Gly Cys

145 150 155 160

His Pro Ala Val Ala Phe Met Ala Gln Val Leu Phe Ala Ala Ser Thr

165 170 175

Phe Gln Val Ala Glu Leu Thr Asn Leu Phe Gln Arg Arg Leu Leu Asp

180 185 190

Val Leu Asp Lys Val Glu Val Asp Asn Leu Leu Leu Ile Leu Ser Val

195 200 205

Ala Asn Leu Cys Asn Lys Ser Cys Met Lys Leu Leu Glu Arg Cys Leu

210 215 220

Asp Met Val Val Arg Ser Asn Leu Asp Met Ile Thr Leu Glu Lys Ser

225 230 235 240

Leu Pro Pro Asp Val Ile Lys Gln Ile Ile Asp Ala Arg Leu Ser Leu

245 250 255

Gly Leu Ile Ser Pro Glu Asn Lys Gly Phe Pro Asn Lys His Val Arg

260 265 270

Arg Ile His Arg Ala Leu Asp Ser Asp Asp Val Glu Leu Val ArgMet

275 280 285

Leu Leu Thr Glu Gly Gln Thr Asn Leu Asp Asp Ala Phe Ala Leu His

290 295 300

Tyr Ala Val Glu His Cys Asp Ser Lys Ile Thr Thr Glu Leu Leu Asp

305 310 315 320

Leu Ala Leu Ala Asp Val Asn His Arg Asn Pro Arg Gly Tyr Thr Val

325 330 335

Leu His Ile Ala Ala Arg Arg Arg Glu Pro Lys Ile Ile Val Ser Leu

340 345 350

Leu Thr Lys Gly Ala Arg Pro Ala Asp Val Thr Phe Asp Gly Arg Lys

355 360 365

Ala Val Gln Ile Ser Lys Arg Leu Thr Lys Gln Gly Asp Tyr Phe Gly

370 375 380

Val Thr Glu Glu Gly Lys Pro Ser Pro Lys Asp Arg Leu Cys Ile Glu

385 390 395 400

Ile Leu Glu Gln Ala Glu Arg Arg Asp Pro Gln Leu Gly Glu Ala Ser

405 410 415

Val Ser Leu Ala Met Ala Gly Glu Ser Leu Arg Gly Arg Leu Leu Tyr

420 425 430

Leu Glu Asn Arg Val Ala Leu Ala Arg Ile Met Phe Pro Met Glu Ala

435 440 445

Arg Val Ala Met Asp Ile Ala Gln Val Asp Gly Thr Leu Glu Phe Asn

450 455 460

Leu Gly Ser Gly Ala Asn Pro Pro Pro Glu Arg Gln Arg Thr Thr yal

465 470 475 480

Asp Leu Asn Glu Ser Pro Phe Ile Met Lys Glu Glu His Leu Ala Arg

485 490 495

Met Thr Ala Leu Ser Lys Thr Val Glu Leu Gly Lys Arg Phe Phe Pro

500 505 510

Arg Cys Ser Asn Val Leu Asp Lys Ile Met Asp Asp Glu Thr Asp Pro

515 520 525

Val Ser Leu Gly Arg Asp Thr Ser Ala Glu Lys Arg Lys Arg Phe His

530 535 540

Asp Leu Gln Asp Val Leu Gln Lys Ala Phe His Glu Asp Lys Glu Glu

545 550 555 560

Asn Asp Arg Ser Gly Leu Ser Ser Ser Ser Ser Ser Thr Ser Ile Gly

565 570 575

Ala Ile Arg Pro Arg Arg

580

<210>5

<211>4241

<212>DNA

＜213〉Oryza paddy rice (Oryza sativa L.)

<220>

<221>exon

<222>(1)..(561)

<220>

<221>Intron

<222>(562)..(2283)

<220>

<221>exon

<222>(2284)..(3031)

<220>

<221>Intron

<222>(3032)..(3239)

<220>

<221>exon

<222>(3240)..(3440)

<220>

<221>Intron

<222>(3441)..(4002)

<220>

<221>exon

<222>(4003)..(4241)

<400>5

atggagccgc cgaccagcca cgtcaccaac gcgttctccg actcggacag cgcgtccgtg 60

gaggaggggg acgccgacgc ggacgccgac gtggaggcgc tccgccgcct ctccgacaac 120

ctcgccgcgg cgttccgctc gcccgaggac ttcgcgttcc tcgccgacgc gcgcatcgcc 180

gtcccgggcg gcggcggcgg cggcggcgac ctgcgggtgc accgctgcgt gctctccgcg 240

cggagcccct tcctgcgcgg cgtcttcgcg cgccgcgccg ccgccgccgc aggcggcggc 300

ggcgaggatg gcagcgagag gctggagctc cgggagctcc tcggcggcgg cggcgaggag 360

gtggaggtcg ggtacgaggc gctgcggctg gtgctcgact acctctacag cggccgcgtc 420

ggcgacctgc ccaaggcggc gtgcctctgc gtcgacgagg actgcgccca cgtcgggtgc 480

caccccgccg tcgcgttcat ggcgcaggtc ctcttcgccg cctccacctt ccaggtcgcc 540

gagctcacca acctcttcca ggtccgcctc ttcgcagctg cctctccttt tccccttcca 600

ttcgcgatgc tcatgtcatg ccagttcatc tcttccctgt gcttgcttgg atgcgtattg 660

ctcatagaag tgggggttta aagatgcatt tttttagttg cgcgcgtgga gctttgcttt 720

aggcggcaaa atgaactact tctgaaggag aggggagatg gtctgaactg aatcactcct 780

aatcacgtta atcattgcaa tttggattac tgcaattgga ggcctgtgat aattgcattg 840

tgattaactt gctgtcatat tggcgatgaa cagtattcag gtttagttgt ttgcgatttt 900

ggggattcac gtgtgcttgg tgctgtatgc attgcagaga aaaacaaaag cttacagttg 960

tatgaacgtg tggatgcgac tccctgcttc aattggaaat cgtccaaaaa gctagtacat 1020

cttaagccat taatcaactc agatcatgca ctgttacatc ggttatgttt gatccaatcc 1080

tcctaatcag tttattctaa tgtctgaatc gaactgcctg gctaactgtc cttatctaac 1140

atgttgctgc ttactgatct tgggggtgct tgccgttctc gttgttattt atcggattct 1200

tcttggtcat gttgacgcga aaatggaagt taactgtgtt tgatatccag caagagttgt 1260

gctgatatag taaaggtgtt tcttaacctt ttcttttctt gcaaaagagc agttccttat 1320

tgaagtatct tcagataagg cgattggact gtgcaccatc ctattctagg ctgcttcaag 1380

tacacatgtt tcactcaatt gtaccatgat agggacatac tcacataccg cacattatcc 1440

ttccaaattt gtcaatgctg cattaatgtg acagtgatat ttatgcacag aaagcacaat 1500

catatgtttt ccacttaaac ttgactgtat ctcagtgttt ttaaattgaa atgtcacaca 1560

tattcgaagc aataataaac gaacaacaaa aaaaaatatg catgtatctt atggtaaaat 1620

ttgccttggc tatattacag ggggaaaatg agtggctaca ctccaatcac agcatgttta 1680

tccaagaaca caaaaggaaa tttcaaaatt ttaaatgtaa aagcctaagg tcactaatgt 1740

ttatatatat atcaactttt attctcttta cagtctttgg aagttgtttt taggagttat 1800

gggggttgtt tttcagtaat tctgtctcaa gattatattg cttgcgtggc tgcgccatac 1860

gtgccaatct gacaagaacc aaacatgatt gtactaattg tatatatagc ctagcttcct 1920

ttggtccaat tgatggccct cagccttgta tttatattta taaatcttct ggcgttaaca 1980

ttactctaca ttgaacttgc tatttcaagt attatgttgg tgtttggctt gtaatatttt 2040

ggtttctaaa aagaattaaa accaggaagt ttccttttct aataaaaaat gggccttgat 2100

gctacttgct tttgttgacc tttgttttag aacgtggtac tgtttttttc agataaggct 2160

gttccatact gaatccatta attattgcta gcccaatgca tgtcagtcgg ttatcgtttg 2220

taatgtttca ctattttaag aagccagaac caaagcaatg atatattctt ctttttcatg 2280

cagcggcgtc tccttgatgt ccttgataag gttgaagtag ataaccttct attgatctta 2340

tctgttgcca acttatgcaa caaatcttgc atgaaactgc ttgaaagatg ccttgatatg 2400

gtagtccggt caaaccttga catgattact cttgagaagt cattgcctcc agatgttatc 2460

aagcagatta ttgatgcacg cctaagcctc ggattaattt caccagaaaa caagggattt 2520

cctaacaaac atgtgaggag gatacacaga gcccttgact ctgacgatgt agagctagtc 2580

aggatgctgc tcactgaagg acagacaaat cttgatgatg cgtttgcact gcactacgcc 2640

gtcgaacatt gtgactccaa aattacaacc gagcttttgg atctcgcact tgcagatgtt 2700

aatcatagaa acccaagagg ttatactgtt cttcacattg ctgcgaggcg aagagagcct 2760

aaaatcattg tctccctttt aaccaagggg gctcgaccag cagatgttac attcgatggg 2820

agaaaagcgg ttcaaatctc aaaaagacta acaaaacaag gggattactt tggggttacc 2880

gaagaaggaa aaccttctcc aaaagatagg ttatgtattg aaatactgga gcaagctgaa 2940

agaagggacc cacaactcgg agaagcatca gtttctcttg caatggcagg tgagagtcta 3000

cgaggaaggt tgctgtatct tgaaaaccga ggtaaccttc acatatatta taatgggttc 3060

ataatgctgg tttctttgga attaactgtt tttggtcttg gcaacaaaag gaaggttaca 3120

tttcagttta gtgtgtttca tgcagagtgc agtttcaaga gtttcccagt gcccattttt 3180

tagaacttcc attttgttat gaagttgtat cttgatatta tagtttttgt acgatgtagt 3240

tgctttggca aggattatgt ttccgatgga ggcaagagta gcaatggata ttgctcaagt 3300

ggatggaact ttggaattta acctgggttc tggtgcaaat ccacctcctg aaagacaacg 3360

gacaactgtt gatctaaatg aaagtccttt cataatgaaa gaagaacact tagctcggat 3420

gacagcactc tccaaaacag gtaatacacg gcactctgtt tattcacact gcctccaagc 3480

gatgtatatt ttgaatctaa tgctacaaac ttgtgtggca cactgctaca catgcaaata 3540

tttttgattt ttcatatttt ctgatggaag ctaaaactat agatgctccc attttgactg 3600

ataggttcac tgttgaatac cctgagaggt ttatgcaatg ttgcatatct tttagctcta 3660

acactgtcaa tgtgaaccat ggacaatttt gctctttttt gttcattcag aatgatagtt 3720

catactacct gaagattaaa taattgacaa agatatgtac actttactgt ggtaatttct 3780

aattttaatc tggtcttgaa taggtagcct agttaatctt tcttggggtg catgtgttgt 3840

ctatagactt ttgtggttga aaaatctttg tacatcaaga gcacagaata tacttaggta 3900

tatctatagg aacaactgct tgagattcat cacagaagtt gcaaagacat tacattctct 3960

taattggaca tagactaatt gcaagctgaa tgtgtatacc agtggagctc gggaaacgct 4020

ttttcccgcg atgttcgaac gtgctcgaca agatcatgga tgatgaaact gatccggttt 4080

ccctcggaag agacacgtcc gcggagaaga ggaagaggtt tcatgacctg caggatgttc 4140

ttcagaaggc attccacgag gacaaggagg agaatgacag gtcggggctc tcgtcgtcgt 4200

cgtcatcgac atcgatcggg gccattcgac caaggagatg a 4241

Claims (13)

1. plant disease resistance-related protein, be the amino acid residue sequence of SEQ ID NO:4 in the sequence table or replacement, disappearance or the interpolation through one or several amino-acid residue of the amino acid residue sequence of SEQ IDNO:4 obtained that the protein that limits with SEQ ID NO:4 has identical active by SEQID NO:4 deutero-amino acid residue sequence.

2. the cDNA sequence of the described plant disease resistance-related protein of claim 1 is one of following nucleotide sequence:

1) polynucleotide shown in the SEQ ID NO:3;

2) polynucleotide of SEQID NO:4 protein sequence in the code sequence tabulation.

3. cDNA sequence according to claim 2 is characterized in that: the reading frame of described cDNA sequence is that SEQ ID NO:3 is from 5 ' end 16-1764 bit base.

4. the genomic gene of the described plant disease resistance-related protein of claim 1 is one of following nucleotide sequence:

1) polynucleotide shown in the SEQ ID NO:5;

2) polynucleotide of SEQ ID NO:4 protein sequence in the code sequence tabulation.

5. genomic gene according to claim 4 is characterized in that: 5 of described gene ' end and 3 ' end also is connected with non-coding region, is SEQ ID №: the polynucleotide shown in 1.

6. the carrier that contains the cDNA sequence of the plant disease resistance-related protein described in claim 2 or 3.

7. the transgenic cell line that contains the cDNA sequence of the plant disease resistance-related protein described in claim 2 or 3.

8. the host bacterium that contains the cDNA sequence of the plant disease resistance-related protein described in claim 2 or 3.

9. the carrier that contains the genomic gene of the plant disease resistance-related protein described in claim 4 or 5.

10. the transgenic cell line that contains the genomic gene of the plant disease resistance-related protein described in claim 4 or 5.

11. contain the host bacterium of the genomic gene of the plant disease resistance-related protein described in claim 4 or 5.

12. a method that improves paddy disease-resistant is the cDNA sequence with the plant disease resistance-related protein described in claim 2 or 3, or the genomic gene of the plant disease resistance-related protein described in claim 4 or 5 imports in the paddy rice.

13. the cDNA sequence of the plant disease resistance-related protein described in claim 2 or 3, and the application of the genomic gene of the plant disease resistance-related protein described in the claim 4 or 5 in strengthening disease resistance of plant.

Images