CN115976051A - Potato StRTP7 gene and application thereof in disease-resistant breeding - Google Patents
Potato StRTP7 gene and application thereof in disease-resistant breeding Download PDFInfo
- Publication number
- CN115976051A CN115976051A CN202211459529.0A CN202211459529A CN115976051A CN 115976051 A CN115976051 A CN 115976051A CN 202211459529 A CN202211459529 A CN 202211459529A CN 115976051 A CN115976051 A CN 115976051A
- Authority
- CN
- China
- Prior art keywords
- gene
- potato
- strtp7
- seq
- strtp7a
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 108090000623 proteins and genes Proteins 0.000 title claims abstract description 115
- 244000061456 Solanum tuberosum Species 0.000 title claims abstract description 110
- 235000002595 Solanum tuberosum Nutrition 0.000 title claims abstract description 89
- 238000009395 breeding Methods 0.000 title claims abstract description 15
- 230000001488 breeding effect Effects 0.000 title claims abstract description 15
- 201000010099 disease Diseases 0.000 title abstract description 17
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 title abstract description 17
- 239000012634 fragment Substances 0.000 claims abstract description 37
- 241000233622 Phytophthora infestans Species 0.000 claims abstract description 35
- 239000002773 nucleotide Substances 0.000 claims abstract description 28
- 125000003729 nucleotide group Chemical group 0.000 claims abstract description 28
- 230000033228 biological regulation Effects 0.000 claims abstract description 4
- 241000196324 Embryophyta Species 0.000 claims description 25
- 230000030279 gene silencing Effects 0.000 claims description 21
- 238000000034 method Methods 0.000 claims description 10
- 235000012015 potatoes Nutrition 0.000 claims description 8
- 238000009825 accumulation Methods 0.000 claims description 6
- 108091027974 Mature messenger RNA Proteins 0.000 claims description 2
- 230000002401 inhibitory effect Effects 0.000 claims 1
- 238000012228 RNA interference-mediated gene silencing Methods 0.000 abstract description 10
- 230000009368 gene silencing by RNA Effects 0.000 abstract description 10
- 108091028043 Nucleic acid sequence Proteins 0.000 abstract description 4
- 238000005516 engineering process Methods 0.000 abstract description 4
- 241000233614 Phytophthora Species 0.000 description 12
- 208000035240 Disease Resistance Diseases 0.000 description 8
- 238000004458 analytical method Methods 0.000 description 8
- 238000012226 gene silencing method Methods 0.000 description 7
- 230000001105 regulatory effect Effects 0.000 description 6
- 238000000692 Student's t-test Methods 0.000 description 5
- 244000052616 bacterial pathogen Species 0.000 description 5
- 230000003902 lesion Effects 0.000 description 5
- 238000003753 real-time PCR Methods 0.000 description 5
- 238000011160 research Methods 0.000 description 5
- 238000012353 t test Methods 0.000 description 5
- GLNADSQYFUSGOU-GPTZEZBUSA-J Trypan blue Chemical compound [Na+].[Na+].[Na+].[Na+].C1=C(S([O-])(=O)=O)C=C2C=C(S([O-])(=O)=O)C(/N=N/C3=CC=C(C=C3C)C=3C=C(C(=CC=3)\N=N\C=3C(=CC4=CC(=CC(N)=C4C=3O)S([O-])(=O)=O)S([O-])(=O)=O)C)=C(O)C2=C1N GLNADSQYFUSGOU-GPTZEZBUSA-J 0.000 description 4
- 230000012010 growth Effects 0.000 description 4
- 230000009466 transformation Effects 0.000 description 4
- 239000013598 vector Substances 0.000 description 4
- 241000233654 Oomycetes Species 0.000 description 3
- 238000011529 RT qPCR Methods 0.000 description 3
- 238000012258 culturing Methods 0.000 description 3
- 238000001514 detection method Methods 0.000 description 3
- 210000001339 epidermal cell Anatomy 0.000 description 3
- 235000013305 food Nutrition 0.000 description 3
- 230000002068 genetic effect Effects 0.000 description 3
- 238000011081 inoculation Methods 0.000 description 3
- 230000009456 molecular mechanism Effects 0.000 description 3
- 230000017074 necrotic cell death Effects 0.000 description 3
- 238000010186 staining Methods 0.000 description 3
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Chemical compound O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 3
- 241000219194 Arabidopsis Species 0.000 description 2
- 102100036945 Dead end protein homolog 1 Human genes 0.000 description 2
- 241000526118 Fusarium solani f. radicicola Species 0.000 description 2
- 101000950194 Homo sapiens Dead end protein homolog 1 Proteins 0.000 description 2
- 108091092195 Intron Proteins 0.000 description 2
- 241000208292 Solanaceae Species 0.000 description 2
- 238000003556 assay Methods 0.000 description 2
- 210000004027 cell Anatomy 0.000 description 2
- 230000003828 downregulation Effects 0.000 description 2
- 230000000694 effects Effects 0.000 description 2
- 238000010353 genetic engineering Methods 0.000 description 2
- 230000003832 immune regulation Effects 0.000 description 2
- 230000001965 increasing effect Effects 0.000 description 2
- 208000015181 infectious disease Diseases 0.000 description 2
- 230000003993 interaction Effects 0.000 description 2
- 238000004519 manufacturing process Methods 0.000 description 2
- 239000011159 matrix material Substances 0.000 description 2
- 230000002438 mitochondrial effect Effects 0.000 description 2
- 244000052769 pathogen Species 0.000 description 2
- 230000008569 process Effects 0.000 description 2
- 238000003762 quantitative reverse transcription PCR Methods 0.000 description 2
- 108091008025 regulatory factors Proteins 0.000 description 2
- 102000037983 regulatory factors Human genes 0.000 description 2
- 230000002441 reversible effect Effects 0.000 description 2
- 239000002689 soil Substances 0.000 description 2
- 239000008223 sterile water Substances 0.000 description 2
- 239000000126 substance Substances 0.000 description 2
- 238000012360 testing method Methods 0.000 description 2
- 241000589158 Agrobacterium Species 0.000 description 1
- 235000010585 Ammi visnaga Nutrition 0.000 description 1
- 244000153158 Ammi visnaga Species 0.000 description 1
- 101100223980 Arabidopsis thaliana DMR6 gene Proteins 0.000 description 1
- 101100288015 Arabidopsis thaliana HSK gene Proteins 0.000 description 1
- 239000002028 Biomass Substances 0.000 description 1
- 101150000533 CCM1 gene Proteins 0.000 description 1
- 229920000742 Cotton Polymers 0.000 description 1
- 241000195493 Cryptophyta Species 0.000 description 1
- 108090000790 Enzymes Proteins 0.000 description 1
- 102000004190 Enzymes Human genes 0.000 description 1
- 108700024394 Exon Proteins 0.000 description 1
- 241000233866 Fungi Species 0.000 description 1
- 206010061217 Infestation Diseases 0.000 description 1
- 101100206738 Mus musculus Tiam2 gene Proteins 0.000 description 1
- 241000233679 Peronosporaceae Species 0.000 description 1
- 101100273578 Schizosaccharomyces japonicus (strain yFS275 / FY16936) dmr1 gene Proteins 0.000 description 1
- 101100273579 Schizosaccharomyces pombe (strain 972 / ATCC 24843) ppr3 gene Proteins 0.000 description 1
- 238000012300 Sequence Analysis Methods 0.000 description 1
- 230000001580 bacterial effect Effects 0.000 description 1
- 238000009412 basement excavation Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000008827 biological function Effects 0.000 description 1
- 230000005540 biological transmission Effects 0.000 description 1
- 238000003776 cleavage reaction Methods 0.000 description 1
- 238000010367 cloning Methods 0.000 description 1
- 239000002299 complementary DNA Substances 0.000 description 1
- 108091036078 conserved sequence Proteins 0.000 description 1
- 238000010276 construction Methods 0.000 description 1
- 230000001276 controlling effect Effects 0.000 description 1
- 230000007423 decrease Effects 0.000 description 1
- 230000003247 decreasing effect Effects 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 230000001419 dependent effect Effects 0.000 description 1
- 238000013461 design Methods 0.000 description 1
- 230000001066 destructive effect Effects 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 230000002708 enhancing effect Effects 0.000 description 1
- 238000001976 enzyme digestion Methods 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 239000013604 expression vector Substances 0.000 description 1
- 230000007614 genetic variation Effects 0.000 description 1
- 238000010362 genome editing Methods 0.000 description 1
- 239000001963 growth medium Substances 0.000 description 1
- 239000005556 hormone Substances 0.000 description 1
- 229940088597 hormone Drugs 0.000 description 1
- 230000008076 immune mechanism Effects 0.000 description 1
- 229940124644 immune regulator Drugs 0.000 description 1
- 230000007365 immunoregulation Effects 0.000 description 1
- 230000005764 inhibitory process Effects 0.000 description 1
- 230000002045 lasting effect Effects 0.000 description 1
- 239000007788 liquid Substances 0.000 description 1
- 230000005923 long-lasting effect Effects 0.000 description 1
- 230000007246 mechanism Effects 0.000 description 1
- 230000001404 mediated effect Effects 0.000 description 1
- 239000002609 medium Substances 0.000 description 1
- 244000005700 microbiome Species 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 230000003020 moisturizing effect Effects 0.000 description 1
- 230000001338 necrotic effect Effects 0.000 description 1
- 235000015097 nutrients Nutrition 0.000 description 1
- 230000001717 pathogenic effect Effects 0.000 description 1
- 230000003950 pathogenic mechanism Effects 0.000 description 1
- 239000000575 pesticide Substances 0.000 description 1
- 230000008635 plant growth Effects 0.000 description 1
- 230000002265 prevention Effects 0.000 description 1
- 108091008146 restriction endonucleases Proteins 0.000 description 1
- 230000007017 scission Effects 0.000 description 1
- 230000019491 signal transduction Effects 0.000 description 1
- 241000894007 species Species 0.000 description 1
- 231100000331 toxic Toxicity 0.000 description 1
- 230000002588 toxic effect Effects 0.000 description 1
- 230000001988 toxicity Effects 0.000 description 1
- 231100000419 toxicity Toxicity 0.000 description 1
- 238000011426 transformation method Methods 0.000 description 1
- 230000009261 transgenic effect Effects 0.000 description 1
- 210000003462 vein Anatomy 0.000 description 1
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention provides a potato StRTP7 gene and a specific gene fragment contained in the same, wherein the potato StRTP7 contains two homologous genes in a potato genome, which are respectively named as StRTP7a and StRTP7b, and the nucleotide sequences are respectively shown as SEQ ID NO:1 and SEQ ID NO:2, respectively. Homologous genes StRTP7a and StRTP7b have common specificity fragments, and the nucleotide sequence is shown as SEQ ID NO:3, respectively. The invention also provides the potato StRTP7 gene and the application of the common specificity fragment in potato disease-resistant breeding. The StRTP7 gene is silenced in the Atlantic potato cultivar by using an RNA interference technology, so that the resistance of the potato cultivar to phytophthora infestans can be obviously improved. The StRTP7 gene can also be used for the height regulation of potato plants. The invention provides a certain theoretical and practical basis for applying the gene to potato disease-resistant breeding.
Description
Technical Field
The invention belongs to the technical field of genetic engineering, relates to a plant immune regulation mechanism, and particularly relates to a StRTP7 gene and application thereof in potato disease-resistant breeding.
Background
In the affinity interaction process of plants and pathogenic bacteria, the pathogenic bacteria successfully realize infection and colonization by means of a series of nutrient transmission, molecular exchange and hormone signal transduction processes participated by plant regulatory factors. When plants are devoid of the negative immune regulators necessary for the infestation by these pathogens, the plants can be made to exhibit a broad-spectrum and long-lasting resistance to the pathogens. Therefore, the immune negative regulatory factor is knocked out in the plant by a biotechnology means to improve the lasting resistance of the plant to pathogenic bacteria, and the method becomes a new strategy for crop breeding.
Phytophthora (Phytophtora) belongs to the genus Oomycota (Oomycotes), and is a group of eukaryotic microorganisms that are similar in morphology to fungi, but are of the same kingdom as algae. Phytophthora is an important plant pathogenic oomycete, can infect various food and economic crops, often causes destructive crop diseases, and seriously threatens food production. The problem of loss of disease resistance of crop varieties is obvious due to strong genetic variation and toxic evolution capability of phytophthora, so that the prevention and control difficulty of the phytophthora of crops is high and the phytophthora of the crops is highly dependent on chemical pesticides. Therefore, the understanding of the genetic basis of the plant on phytophthora infection, the exploration of new disease-resistant strategies, the identification of the immune regulation and control gene and the analysis of the molecular mechanism have important significance for molecular design of new disease-resistant genes, crop disease-resistant breeding and food safety guarantee.
At present, the immune negative regulatory factor has been preliminarily explored in the aspect of enhancing the potato resistance: the resistance of the potato to phytophthora is enhanced by silencing orthologous genes of immune negative regulatory factors of other species. 2016 Sun et al, through reverse genetics on potato, silenced six known orthologous genes of plant immune negative regulators including DMR1 and DMR6, respectively, in potato by RNAi technology, increased resistance of potato to Phytophthora infestans (Sun et al, 2016. Cloning of six competent genes in genetic resistance. Transgenic Res,25 (5): 731-742.). Silencing of homologous genes of Arabidopsis DND1 in potato can increase its resistance to Phytophthora infestans and downy mildew (Sun et al 2016.Down-regulation of Arabidopsis DND1 porting and bottom leads to broad-spectrum resistance and delivery mile Res,25 (2): 123-138.). Therefore, the excavation and immune mechanism research of the negative oomycete immune regulatory factor can be carried out more quickly by combining a forward or reverse genetics means. Meanwhile, identification and research on the plant immune negative regulation factor can not only improve the understanding of human on pathogenic bacteria pathogenic mechanism, but also have important application value.
Disclosure of Invention
The problem that the resistance of the plant variety is lost due to strong toxicity variation capability of phytophthora is prominent, so that the molecular mechanism of plant-phytophthora interaction is explored, and a new plant immunoregulation gene is excavated, thereby having important guiding significance for plant disease resistance breeding. The invention aims to improve the disease resistance of potatoes by means of molecular biology and genetic engineering, explore a functional gene for regulating the disease resistance of potatoes and expand the application of the functional gene in improving the disease resistance of potatoes.
In order to achieve the technical purpose of the invention, the invention provides a potato StRTP7 gene. The StRTP7 gene and the common specificity fragment are silenced, and the potato plant shows stronger resistance to phytophthora infestans. The StRTP7 gene has two homologous genes StRTP7a and StRTP7b in the potato genome, and the nucleotide sequence of the StRTP7a gene is shown as SEQ ID NO:1, the nucleotide sequence of the StRTP7b gene is shown as SEQ ID NO:2, respectively. The homologous genes StRTP7a and StRTP7b have a common specificity fragment, and the nucleotide sequence of the common specificity fragment is shown as SEQ ID NO:3, respectively. The invention provides a certain theoretical and practical basis for applying the gene to potato disease-resistant breeding.
Further molecular mechanism research shows that the StRTP7 gene is involved in splicing of Stnad7 intron, and the accumulation amount of Stnad7 mature transcripts is reduced. The nucleotide sequence of Stnad7 is shown as SEQ ID NO:4, respectively.
Based on the description of the invention, the invention firstly provides the application of the potato StRTP7 gene and the common specificity fragment in potato disease-resistant breeding. Specifically, silencing the StRTP7 gene (or reducing the expression level of the StRTP7 gene by other feasible means) enhances the resistance of the potato to phytophthora infestans. In another preferred embodiment, silencing a consensus-specific fragment of the StRTP7 gene (isogenes StRTP7a and StRTP7 b), the nucleotide sequence of which is set forth in SEQ ID NO:3, respectively. Based on the description of the invention, the expression abundance (expression amount) of the StRTP7 gene and the common specificity fragment is reduced, so that the resistance of the potato plant to the phytophthora infestans can be enhanced.
Furthermore, the present invention provides a method for increasing the resistance of potatoes to phytophthora infestans. It should be noted that the invention does not limit the specific implementation manner of cultivating the disease-resistant potato plant, and based on the StRTP7 gene and the common specific fragment disclosed by the invention, a person skilled in the art can easily realize the cultivation of the disease-resistant potato plant by combining the prior art. The method of the invention comprises silencing the potato StRTP7 gene, or silencing the consensus specific fragment of the potato StRTP7 gene (homologous genes StRTP7a and StRTP7 b). The nucleotide sequence of the StRTP7a gene is shown as SEQ ID NO:1, the nucleotide sequence of the StRTP7b gene is shown as SEQ ID NO:2, respectively. The homologous genes StRTP7a and StRTP7b have a common specificity fragment, and the nucleotide sequence of the common specificity fragment is shown in SEQ ID NO:3, respectively.
As described above, the method for improving the disease resistance of potatoes and obtaining the phytophthora root rot resistant potato plants based on the StRTP7 gene and the common specificity fragment provide an effective technical path for solving the difficult problems of the research on the disease resistance breeding of potatoes, so that the method is the most economic, effective, green and durable method for preventing and treating the phytophthora root rot of potatoes so far, and simultaneously effectively overcomes the technical defects of the method for preventing and treating the phytophthora root rot of potatoes mainly based on agricultural control and chemical control.
In addition, the invention provides the application of the StRTP7 gene and the common specificity fragment in the regulation and control of potato growth (plant height). Experiments show that the height of potato plants can be reduced by silencing the potato StRTP7 gene (or reducing the expression level of the StRTP7 gene in other feasible ways). In another preferred embodiment, the potato plant height is reduced by silencing a consensus-specific fragment of the potato StRTP7 gene, the nucleotide sequence of which is set forth in SEQ ID NO:3, respectively. The present invention surprisingly found that silencing the potato StRTP7 gene, or a consensus-specific fragment of the silencing potato StRTP7 gene, has a specific effect on the growth of potato plants, manifested as inhibition of internode elongation of potato plants.
Compared with the prior art, the potato StRTP7 gene and the application thereof in disease-resistant breeding have the following beneficial effects or advantages:
1) The invention discloses two homologous genes StRTP7a and StRTP7b of a potato StRTP7 gene in a potato genome for the first time, and the nucleotide sequences of the two homologous genes are respectively shown as SEQ ID NO:1 and SEQ ID NO:2, respectively. Homologous genes StRTP7a and StRTP7b have common specificity fragments, and the nucleotide sequence is shown as SEQ ID NO:3, respectively. The potato plant shows stronger resistance to phytophthora infestans by regulating and controlling the expression of the potato StRTP7 gene. The invention provides an effective technical scheme for solving the problem of the research on potato disease-resistant breeding, and can provide technical support for creating new potato disease-resistant germplasm.
2) The invention has great significance in improving the disease resistance of potato plants to phytophthora infestans. By means of gene engineering technology and through potato StRTP7 gene silencing, the resistance of potato plant to phytophthora infestans can be improved.
3) The invention further discloses that the potato StRTP7 gene and the specific fragment thereof have a certain regulation and control effect on the plant height of the potato, and show that the internode elongation of the potato plant is inhibited, but the size of the leaves of the potato plant is not influenced.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings referred to in the embodiments of the present invention are briefly described below, and it is obvious that the listed drawings are only a part of the content of the embodiments of the present invention.
FIG. 1 is a structural diagram of the potato mitochondrial Stnad7 gene. In fig. 1, intron2, and Intron3 denote introns, and Exon1, exon2, exon3, and Exon4 denote exons, respectively.
FIG. 2 is a semi-quantitative PCR assay for accumulation of Stnad7 gene mature transcripts in RiSt lines and Atlantic potato leaves. In FIG. 2, stEF 1. Alpha. Was used as a reference gene to show that the amount of the gene was uniform, atlantic indicates an Atlantic potato variety, and RiSt-1, riSt-2, riSt-3, and RiSt-4 respectively indicate potato StRTP7 gene-silencing lines.
FIG. 3 shows the RT-qPCR detection of the expression level of StRTP7 gene in RiSt strain and Atlantic potato leaf. In FIG. 3, atlantic represents Atlantic potato varieties, riSt-1, riSt-2, riSt-3, and RiSt-4 represent potato StRTP7 gene-silencing lines, respectively. Figure 3 results are expressed as mean ± sem of 3 biological replicates, and statistical significance analysis was performed by t-test, P <0.01 and P <0.001.
FIG. 4 is a qPCR assay of splicing efficiency of RiSt line and Atlantic potato leaves Stnad7 intron1 and intron 3. In FIG. 4, atlantic represents Atlantic potato varieties, riSt-1, riSt-2, riSt-3, riSt-4 represent potato StRTP7 gene-silencing lines, respectively. Figure 4 results are expressed as mean ± sem of 3 biological replicates, and statistical significance analysis was performed with t-test,. P <0.001.
FIG. 5 is a graph showing the results of spot diameter observation and trypan blue staining of Atlantic potato leaves 3 days after inoculation with Phytophthora infestans. In FIG. 5, atlantic represents Atlantic potato variety, and RiSt-1 and RiSt-2 represent potato StRTP7 gene-silencing lines, respectively.
FIG. 6 shows statistics of Phytophthora infestans lesion diameter in StRTP7 silenced plants. Figure 6 lesion diameter results are expressed as mean ± sem from at least 5 leaf lesions, statistically significant analysis by t-test,. P <0.001.
FIG. 7 shows quantitative PCR detection of the amount of colonization by potato infected leaves by pathogenic bacteria. Figure 7 results are expressed as mean ± sem of 3 biological replicates, statistical significance analysis was performed with t-test, P <0.05.
FIG. 8 is a graph showing the count of Phytophthora infestans sporangia on3 days after the P.infestans inoculation. Fig. 8 sporangial statistics are expressed as mean ± sem of 3 biological replicates, and statistical significance analysis was performed with t-test, P <0.001.
FIG. 9 is a photograph showing Trypan blue staining of Phytophthora infestans leaves of StRTP 7-silenced plants. In FIG. 9, atlantic represents Atlantic potato cultivars, riSt-1 and RiSt-2 represent potato StRTP7 gene-silencing lines, respectively. In FIG. 9A, riSt-1 and RiSt-2 silenced plant leaves in which epidermal cells infected with Phytophthora infestans show stronger cell necrosis, black arrows indicate haustorium-like structures, and asterisks indicate necrotic cells. In FIG. 9B, phytophthora infested the leaf sporangia, and the black arrows indicate sporangia.
FIG. 10 is a phenotype of RiSt plant growth after 4 weeks of culture in matrix soil. In FIG. 10, atlantic represents Atlantic potato variety, riSt-1 and RiSt-2 represent potato StRTP7 gene-silencing lines, respectively.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention will be further described in detail with reference to the following embodiments and a technical scheme shown in fig. 1. It should be understood that the specific embodiments described herein are merely illustrative of the invention and do not limit the scope of the invention.
Example 1
By utilizing the genome information website of solanaceae plants (https:// solgenomics. Net /), genome alignment analysis shows that the StRTP7 gene contains two homologous genes with highly similar nucleotide sequences in a potato genome and the two homologous genes are named as StRTP7a (gene number: PGSC0003DMC 400008531) and StRTP7b (gene number: PGSC0003DMC 400052354), respectively. In view of the similarity of the nucleotide sequences of the two genes as high as 94%, the two genes are regarded as test genes and are considered to have similar biological functions. Coding (CDS) sequences of homologous genes StRTP7a and StRTP7b are available from the Solanaceae plant genomic information website (https:// solgenomics.
The potato mitochondrial Stnad7 gene sequence is available from NCBI queries with gene numbers GenBank: MF989958.1. The nucleotide sequence of Stnad7 is shown as SEQ ID NO:4, respectively.
Example 2
In order to provide a more exact theoretical and practical basis for applying the gene to potato disease-resistant breeding, the experimental result of the participation of the potato StRTP7 gene in the splicing of the intron of Stnad7 is shown in the embodiment.
Since the sequences of StRTP7a and StRTP7b are highly similar and there may be functional redundancy, the two genes are co-silenced by selecting a segment with similar nucleotide sequence as the silencing segment. The gene fragment shared by StRTP7a and StRTP7b with 470bp length and highly conserved sequence is selected (in the invention, the specific fragment and the common specific fragment are the same meaning as the expression), the sequence similarity of the fragment in StRTP7a and StRTP7b genes is as high as 94.89%, and only a small amount of single nucleotide difference exists, so that the fragment is considered to realize the co-silencing of StRTP7a and StRTP7b genes. And sequence comparison proves that the fragment is unique to StRTP7 gene, and the nucleotide sequence is shown as SEQ ID NO:3, respectively.
Designing a specific primer, amplifying the StRTP7 gene specific fragment by taking potato cDNA as a template, and respectively carrying out enzyme digestion on the fragment by utilizing different enzyme cleavage sites to connect the fragment to two ends of a pKANNIBAL vector (intermediate vector) Intron so as to form a hairpin structure. The primer sequences designed in this example are as follows:
RiStRTP7-F1:CCGCTCGAGTTCGACAACAGTGAAGTCCACAA；
RiStRTP7-R1:CGGAATTCTCAAAGACTCAGCTTTAGCAGTG；
RiStRTP7-F2:GCTCTAGATTCGACAACAGTGAAGTCCACAA；
RiStRTP7-R2:CGGGATCCTCAAAGACTCAGCTTTAGCAGTG。
the correct pKANNIBAL vector was sequenced using Not1 restriction endonuclease and ligated into the pART27 plant expression vector.
The StRTP7 gene was silenced in the atlantic potato cultivar using RNA interference (RNAi) technology. Potato stem segments cultured for about 4-5 weeks are adopted, and an agrobacterium-mediated stable transformation system is utilized for potato transformation, and the specific transformation method refers to published documents (Orausianglan 2021. Genetic transformation of potato and construction of gene editing vector of immune-related gene StCAD 7. [ Shuoshi ]. China. Yangling: northwest university of agriculture and forestry). Four transformants (designated RiSt-1 to 4) were finally obtained by stable transformation of potato.
The expression level of the StRTP7 gene was significantly down-regulated in all four RNAi lines as detected by real-time fluorescent quantitative PCR (fig. 1-4), with an expression level of about 20% of the atlantic potato leaves.
The number and position of introns of Stnad7 are obtained by sequence analysis of Stnad7 gene, which is shown in FIG. 1. RT-qPCR was used to detect the intron splicing levels of Stnad7 intron1 and intron3 in leaves of RiSt-1-4 RNAi strains. The experimental results show (FIG. 4) that the intron splicing efficiency of Stnad7 intron1 and intron3 decreased significantly to around 15% of the control group in all four RiSt lines. Meanwhile, the accumulation amount of Stnad7 mature transcripts in the RiSt strain is detected by semi-quantitative PCR, and the result shows that the accumulation amount of Stnad7 mature transcripts is also obviously reduced in RiSt plant leaves (FIG. 2 and FIG. 3). The above results indicate that the StRTP7 gene is involved in splicing of the intron of Stnad7 and causes a decrease in the accumulation of the mature transcript of Stnad 7.
Example 3
This example describes the expression of resistance of RNAi plants of potato StRTP7 to Phytophthora infestans. The phytophthora infestans (p.infestans) used in this example was 88069 strain.
And (3) culturing phytophthora infestans: using a sterile toothpick to scratch a phytophthora infestans block with the side length of about 0.5cm, transferring the phytophthora infestans block to a new rye culture medium plate, and inversely culturing the phytophthora infestans block in a dark place for 10 to 15 days at the temperature of 16 ℃.
Production of phytophthora infestans zoospores: 4mL of sterile water was added to the dish and the surface of the medium was gently rubbed with a blue tip. After 1 hour of treatment at 4 ℃ and 30 minutes of standing on ice, a large amount of zoospores were produced.
And (3) phytophthora infestans inoculation: cutting completely flat potato leaves, wrapping the petioles on the cotton strips soaked in sterile water, and moisturizing. A drop of phytophthora infestans zoospore liquid (about 800 zoospores) is respectively inoculated at the widest central point of the left and right leaves of the main vein. Culturing at 18 deg.C in dark for 2-3 days, measuring the diameter of lesion and counting.
The leaves of the two StRTP7 lines RiSt-1 and RiSt-2 were subjected to Phytophthora infestans test analysis. Experimental results show that lesion diameters of both RiSt-1 and RiSt-2 RNAi strains are significantly smaller than those of Atlantic potato leaves (FIG. 5). The quantitative PCR detection of hypha colonization further indicates that the phytophthora infestans biomass of RiSt-1 and RiSt-2 plant leaves is significantly lower than that of Atlantic (FIGS. 6-8). Counting of the diseased leaf phytophthora infestans sporangia found that the number of phytophthora infestans sporangia on both lines of leaves, riSt-1, riSt-2, was significantly lower than in the atlantic (fig. 8). Staining and observing the inoculated bacterial leaves by trypan blue, and finding that a large amount of sporangia are generated on the Atlantic leaves; few aerial hyphae and sporangia were observed on the leaves of RiSt-1; a small number of aerial hyphae and sporangia were visible in the RiSt-2 leaves (FIG. 9). When trypan blue stained leaves were observed, it was found that a large amount of necrosis of the epidermal cells of the RiSt-1 and RiSt-2 leaves infected with Phytophthora infestans occurred, but almost no necrosis of the epidermal cells was observed in the Atlantic ocean (FIG. 9). The above results show that the StRTP7 RNAi strain exhibits a stronger resistance to Phytophthora infestans.
Example 4
This example describes the growth of two StRTP7 lines RiSt-1 and RiSt-2.
RiSt-1 and RiSt-2 plants grew phenotypically after 4 weeks of culture in matrix soil as shown in FIG. 10. Further observations found that the RNAi plants of StRTP7 were shorter than the atlantic potato plants, but did not affect leaf size. The results of the example show that the StRTP7 gene can regulate the growth of the potato and inhibit the internode elongation of the potato plants.
The above description is only for the purpose of illustrating the present invention and the appended claims are not to be construed as limiting the scope of the invention, which is intended to cover all modifications, equivalents and improvements that are within the spirit and scope of the invention as defined by the appended claims.
Claims (10)
1. The potato StRTP7 gene is characterized in that two homologous genes StRTP7a and StRTP7b exist in a potato genome in the StRTP7 gene, and the nucleotide sequence of the StRTP7a gene is shown as SEQ ID NO:1, the nucleotide sequence of the StRTP7b gene is shown as SEQ ID NO:2, respectively.
2. The StRTP7 gene as claimed in claim 1, wherein the homologous genes StRTP7a and StRTP7b have a common specificity fragment, and the nucleotide sequence of the common specificity fragment is shown as SEQ ID NO:3, respectively.
3. The StRTP7 gene according to claim 1, wherein the StRTP7 gene is involved in splicing of an intron of Stnad7 and reduces the accumulation of a mature transcript of Stnad7, and the nucleotide sequence of Stnad7 is shown as SEQ ID NO:4, respectively.
4. The application of the StRTP7 gene of the potato in the breeding of phytophthora infestans resistance of the potato is characterized in that the StRTP7 gene has two homologous genes StRTP7a and StRTP7b in a potato genome, and the nucleotide sequence of the StRTP7a gene is shown as SEQ ID NO:1, the nucleotide sequence of the StRTP7b gene is shown as SEQ ID NO:2, respectively.
5. The use of claim 4, wherein the expression level of StRTP7 gene is reduced, or the common specificity fragment of two homologous genes StRTP7a and StRTP7b of StRTP7 gene is silenced to enhance the phytophthora infestans resistance of potato, and the nucleotide sequence of the specificity fragment is shown as SEQ ID NO:3, respectively.
6. A method for improving phytophthora infestans resistance of potatoes is characterized by reducing the expression level of a StRTP7 gene or silencing a common specificity fragment of two homologous genes StRTP7a and StRTP7b of the StRTP7 gene of the potatoes, wherein the nucleotide sequence of the StRTP7a gene is shown as SEQ ID NO:1, the nucleotide sequence of the StRTP7b gene is shown as SEQ ID NO:2, the nucleotide sequence of the common specificity fragment is shown as SEQ ID NO:3, respectively.
7. The application of the potato StRTP7 gene in the height regulation of potato plants is characterized in that the StRTP7 gene has two homologous genes StRTP7a and StRTP7b in a potato genome, and the nucleotide sequence of the StRTP7a gene is shown in SEQ ID NO:1, the nucleotide sequence of the StRTP7b gene is shown as SEQ ID NO:2, respectively.
8. The use of claim 7, wherein silencing the potato StRTP7 gene reduces potato plant height.
9. The use of claim 7, wherein the homologous genes StRTP7a and StRTP7b have a consensus specific fragment, and the nucleotide sequence of the consensus specific fragment is shown as SEQ ID NO:3, silencing the common specificity fragment and reducing the height of the potato plant.
10. Use according to claim 8 or 9, wherein inhibiting internode elongation in a potato plant reduces plant height.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211459529.0A CN115976051B (en) | 2022-11-16 | 2022-11-16 | Potato StRTP gene and application thereof in disease-resistant breeding |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211459529.0A CN115976051B (en) | 2022-11-16 | 2022-11-16 | Potato StRTP gene and application thereof in disease-resistant breeding |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115976051A true CN115976051A (en) | 2023-04-18 |
| CN115976051B CN115976051B (en) | 2024-04-30 |
Family
ID=85957066
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211459529.0A Active CN115976051B (en) | 2022-11-16 | 2022-11-16 | Potato StRTP gene and application thereof in disease-resistant breeding |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115976051B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116987730A (en) * | 2023-09-22 | 2023-11-03 | 西北农林科技大学深圳研究院 | Application of thioredoxin StCDSP32 in plant disease resistance |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104583409A (en) * | 2012-08-08 | 2015-04-29 | Kws种子股份有限公司 | Transgenic plant of the species solanum tuberosum with resistance to phytophthora |
| CN110938637A (en) * | 2019-11-26 | 2020-03-31 | 西北农林科技大学 | Homologous gene of phytophthora resistance negative regulatory factor StMKK1 and application thereof |
| CN116515861A (en) * | 2023-06-27 | 2023-08-01 | 西北农林科技大学深圳研究院 | Gene StLTPa and application of encoding protein thereof in disease resistance of potatoes |
| CN116987730A (en) * | 2023-09-22 | 2023-11-03 | 西北农林科技大学深圳研究院 | Application of thioredoxin StCDSP32 in plant disease resistance |
| CN117660478A (en) * | 2023-11-17 | 2024-03-08 | 重庆市农业科学院 | Gene for improving resistance of potatoes to late blight and application thereof |
-
2022
- 2022-11-16 CN CN202211459529.0A patent/CN115976051B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104583409A (en) * | 2012-08-08 | 2015-04-29 | Kws种子股份有限公司 | Transgenic plant of the species solanum tuberosum with resistance to phytophthora |
| CN110938637A (en) * | 2019-11-26 | 2020-03-31 | 西北农林科技大学 | Homologous gene of phytophthora resistance negative regulatory factor StMKK1 and application thereof |
| CN116515861A (en) * | 2023-06-27 | 2023-08-01 | 西北农林科技大学深圳研究院 | Gene StLTPa and application of encoding protein thereof in disease resistance of potatoes |
| CN116987730A (en) * | 2023-09-22 | 2023-11-03 | 西北农林科技大学深圳研究院 | Application of thioredoxin StCDSP32 in plant disease resistance |
| CN117660478A (en) * | 2023-11-17 | 2024-03-08 | 重庆市农业科学院 | Gene for improving resistance of potatoes to late blight and application thereof |
Non-Patent Citations (7)
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116987730A (en) * | 2023-09-22 | 2023-11-03 | 西北农林科技大学深圳研究院 | Application of thioredoxin StCDSP32 in plant disease resistance |
| CN116987730B (en) * | 2023-09-22 | 2023-12-01 | 西北农林科技大学深圳研究院 | Application of thioredoxin StCDSP32 in plant disease resistance |
Also Published As
| Publication number | Publication date |
|---|---|
| CN115976051B (en) | 2024-04-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111235165B (en) | Lily susceptible fungal gene LrWRKY-S1 and application thereof | |
| CN113234729B (en) | Gene GauRev2 capable of obviously improving verticillium wilt resistance of cotton and application thereof | |
| CN108588041B (en) | Gossypium barbadense cytochrome P450 gene, and coding protein and application thereof | |
| CN115976051A (en) | Potato StRTP7 gene and application thereof in disease-resistant breeding | |
| CN106554964B (en) | Application of cotton GbABR1 gene in verticillium wilt resistance | |
| CN108034662B (en) | Application of wheat stripe rust PSTG _06025 gene in stripe rust prevention and treatment and cultivation method of stripe rust resistant wheat | |
| CN108559753B (en) | Application of wheat stripe rust PSTG _17694 gene in stripe rust prevention and treatment and stripe rust resistant wheat cultivation method | |
| CN108251435B (en) | Wild downy grape Shang-24 disease-resistant gene VqJAZ4 and application thereof | |
| CN114480395B (en) | Application of miR164h-5p in regulation of maize head smut resistance | |
| CN102584973B (en) | Rice plant type related protein LPA1 and coding gene and application thereof | |
| CN112029775B (en) | Cabbage mustard BoWRKY33 gene and application thereof | |
| CN115305252A (en) | Receptor kinase gene OsIFBR1 for regulating and controlling rice resistance | |
| CN115261386A (en) | Double-stranded RNA molecule of targeted silent phytophthora capsici oxysterol binding protein 1 and application | |
| CN114989283A (en) | Application of TCP19 protein in regulation and control of rice sheath blight resistance | |
| CN106434694B (en) | Application of cotton GbDREB gene in verticillium wilt resistance | |
| CN100549028C (en) | Plant against disease relevant protein RAR 1 and encoding gene thereof and application | |
| CN100366743C (en) | Plant-disease-resistance related protein and genes encoding same and use thereof | |
| CN117363629B (en) | Citrus CsGATA gene and method for enhancing citrus canker resistance by using same | |
| CN110499322B (en) | Peanut gene AhYP for improving disease resistance of peanuts and application thereof | |
| CN112813075B (en) | Cabbage mustard BoaWRKY4 gene and application thereof | |
| CN116426541B (en) | Target gene segment, dsRNA and nano pesticide composition for preventing and treating verticillium wilt of crops | |
| CN111961122B (en) | Dominant allele of cotton TBL34 gene and encoding protein and application thereof | |
| CN115976052A (en) | Wheat stem basal rot resistance gene TaHSP18.6, expression product, recombinant vector and application thereof | |
| CN116334098A (en) | Application of cotton GhNAC104 gene in aspect of resisting cotton verticillium wilt | |
| CN118028347A (en) | GhHIT4 gene for regulating cotton plant height and resisting verticillium wilt and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |