CN116334098A - Application of cotton GhNAC104 gene in aspect of resisting cotton verticillium wilt - Google Patents

Abstract

The invention discloses an application of cotton GhNAC104 gene in resisting cotton verticillium wilt, which obtains plants with higher verticillium wilt resistance than target plants by inhibiting the expression of the GhNAC104 gene in target plants or knocking out the GhNAC104 gene. The GhNAC104 gene can be applied to prevention and treatment of verticillium wilt of cotton, and can be particularly applied to genetic improvement of verticillium wilt resistance of cotton or molecular breeding, such as cultivation of verticillium wilt-resistant cotton varieties, thereby providing a new way for cultivation of verticillium wilt-resistant cotton plants.

Description

Application of cotton GhNAC104 gene in aspect of resisting cotton verticillium wilt

Technical Field

The invention belongs to the technical field of biology, and particularly relates to application of cotton GhNAC104 genes in resisting cotton verticillium wilt, and more particularly relates to application of inhibiting expression of cotton GhNAC104 genes or knocking out cotton GhNAC104 genes in improving cotton verticillium wilt resistance.

Background

Cotton (Gossypium spp.) is one of important economic crops and crops in China, and is extremely vulnerable to diseases and insect pests, so that the yield of the cotton is reduced, while verticillium is called as cotton cancer, and the yield and the fiber quality of the cotton are seriously endangered. In recent years, verticillium wilt occurs in successive years, and becomes one of main obstacles restricting high and stable cotton yield in China. The verticillium wilt of cotton is a soil-borne vascular bundle disease caused by verticillium dahliae, at present, no specific and specific chemical agent exists, the biological control cost is high, the effect is not ideal, and therefore, the breeding of disease-resistant varieties is a main way for controlling the disease.

However, due to the limited resources of the existing verticillium-resistant strains, it is challenging to cultivate resistant varieties using traditional methods. In recent years, the study of candidate genes for cotton resistance based on genetic engineering has become another strategy for alleviating verticillium invasion. Therefore, the research on the pathogenic mechanism of cotton verticillium wilt and the functional analysis of disease resistance genes is very important for cotton production by searching resistance genes and cultivating resistance varieties.

At present, research on the verticillium wilt resistance gene of cotton is gradually increased, for example, chinese patent publication No. CN113637678A discloses application of a gene GhSWEET42 in preventing and treating verticillium wilt of cotton, chinese patent publication No. CN110923250A discloses application of a verticillium wilt resistance related gene GhSDH1-1, chinese patent publication No. CN110499318A discloses application of a verticillium wilt resistance related gene GhDEK of cotton.

GhNAC104 belongs to the NAC family, which is a very large family of transcription factors, and is widely found in plants. It has been reported in the literature that 117 NAC transcription factors have been found in arabidopsis thaliana, and 151 NACs have been identified in rice (Nuruzzaman et al, 2010). No report has been made about the relationship between GhNAC104 gene and verticillium wilt resistance of cotton.

Disclosure of Invention

The invention aims to provide an application of cotton GhNAC104 gene in resisting cotton verticillium wilt, mainly in inhibiting the expression of cotton GhNAC104 gene or knocking out cotton GhNAC104 gene to improve cotton verticillium wilt resistance.

In order to achieve the above object, the technical scheme of the present invention is summarized as follows:

the cotton GhNAC104 gene has a nucleotide sequence shown in SEQ ID NO.1, a coding sequence length of 588bp, and an amino acid sequence shown in SEQ ID NO.1 and comprises 195 amino acids.

The invention mainly protects the application of the GhNAC104 gene, in particular to the application of inhibiting the expression of the cotton GhNAC104 gene or knocking out the cotton GhNAC104 gene in improving the verticillium wilt resistance of cotton. More specifically, the coding sequence of the GhNAC104 gene can be changed by CRISPR gene editing technology to obtain cotton resistant to verticillium wilt.

The functions of the genes protected by the invention not only comprise the GhNAC104 genes, but also comprise the functions of homologous genes with higher homology (such as homology higher than 90%) with the GhNAC104 genes in terms of verticillium wilt resistance.

In order to improve the excellent properties of plants, the invention also protects a novel plant breeding method, in particular to a method for obtaining plants with higher verticillium wilt resistance than target plants by inhibiting the expression of GhNAC104 genes in the target plants.

The plant of interest is preferably cotton. As used herein, the term "plant" includes whole plants, parent and progeny plants thereof, and various parts of plants, including seeds, fruits, shoots, stems, leaves, roots (including tubers), flowers, tissues and organs, in which the gene or nucleic acid of interest is found. Reference herein to "plant" also includes plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen and microspores, again wherein each of the foregoing comprises the gene/nucleic acid of interest.

The present invention includes any plant cell, or any plant obtained or obtainable by a method therein, as well as all plant parts and propagules thereof. The present patent also encompasses transfected cells, tissues, organs or whole plants obtained by any of the foregoing methods. The only requirement is that the sub-representations exhibit the same genotypic or phenotypic characteristics, and that the progeny obtained using the methods of this patent have the same characteristics.

The invention also extends to harvestable parts of a plant as described above, but not limited to seeds, leaves, fruits, flowers, stems, roots, rhizomes, tubers and bulbs. And further to other derivatives of the plants after harvest, such as dry granules or powders, oils, fats and fatty acids, starches or proteins. The invention also relates to a food or food additive obtained from the relevant plant.

The invention has the advantages that:

(1) The invention firstly defines the function of the GhNAC104 gene in resisting verticillium in cotton, and provides a new target gene for preventing and treating verticillium infection of cotton.

(2) The GhNAC104 gene discovered by the invention can be applied to prevention and treatment of verticillium wilt of cotton, and can be particularly applied to genetic improvement of verticillium wilt resistance of cotton or molecular breeding, such as cultivation of verticillium wilt-resistant cotton varieties, thereby providing a new way for breeding verticillium wilt-resistant plants of cotton.

Drawings

FIG. 1 shows the analysis of GhNAC104 gene transcriptional activity.

FIG. 2 is a graph showing the phenotype of plants inoculated with verticillium after gene silencing; ( FIG. 2A shows the resistance phenotype of plants after verticillium inoculation; FIG. 2B shows the detection of GhNAC104 gene expression in interfering plants; FIG. 2C shows the recovery culture of the stalks of verticillium after plant onset. )

FIG. 3 shows the disease index of cotton seedlings after the inoculation of the genetically silenced plants and the control plants with verticillium (FIG. 3A shows the amount of verticillium in the cotton stems at 14 days of verticillium inoculation; FIG. 3B shows the morbidity and index of the cotton seedlings at 14 days of verticillium inoculation.)

FIG. 4 shows identification of field verticillium wilt resistance of GhNAC104 gene-edited plants; ( FIG. 4A shows photographs of the whole strains of nac104 and WT; FIG. 4B shows leaf blight identification of nac104 and WT affected plants; FIG. 4C shows the identification of nac104 and WT field populations for disease resistance; fig. 4D shows the nac104 and WT field population morbidity statistics. )

Detailed Description

The present invention will be described in detail with reference to specific examples. These embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.

The technical means used in the examples are conventional means well known to those skilled in the art unless otherwise indicated. The test methods in the following examples are conventional methods unless otherwise specified. The reagents and materials employed, unless otherwise indicated, are commercially available.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In addition, any methods and materials similar or equivalent to those described herein can be used in the present invention. The preferred methods and materials described herein are presented for illustrative purposes only.

The practice of the present invention will employ, unless otherwise indicated, conventional techniques of botanicals, microorganisms, tissue culture, molecular biology, chemistry, biochemistry, DNA recombination, and bioinformatics, which will be apparent to one of skill in the art. These techniques are fully explained in the published literature, and the methods of DNA extraction, phylogenetic tree construction, gene editing method, gene editing vector construction, gene editing plant acquisition, etc. used in the present invention can be realized by the methods disclosed in the prior art except the methods used in the examples described below.

The terms "nucleic acid", "nucleic acid sequence", "nucleotide", "nucleic acid molecule" or "polynucleotide" as used herein are meant to include isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), natural types, mutant types, synthetic DNA or RNA molecules, DNA or RNA molecules composed of nucleotide analogs, single-or double-stranded structures. Such nucleic acids or polynucleotides include, but are not limited to, gene coding sequences, antisense sequences, and regulatory sequences of non-coding regions. These terms include a gene. "Gene" or "gene sequence" is used broadly to refer to a functional DNA nucleic acid sequence. Thus, a gene may include introns and exons in genomic sequences, and/or coding sequences in cDNA, and/or cDNA and regulatory sequences thereof. In particular embodiments, for example in relation to isolated nucleic acid sequences, it is preferred that they are cDNA.

Example 1 construction of TRV: ghNAC104 virus interference vector and VIGS-mediated transformation

Construction of VIGS expression vector: the construction is carried out by adopting an enzyme digestion and enzyme ligation method, and the following primers are designed according to the nucleotide sequence of the GhNAC104, and the sequences of the primers are shown as follows: the forward primer GhNAC104-VIGS-F (5'-AGGACGCAAAACAGGAACACC-3') and the reverse primer GhNAC104-VIGS-R (5 ' -ATCGACTACTGGAGCTGGAATCAG). The gene is cloned from a cDNA library of cotton, the gene is connected to a T carrier plasmid by a one-step cloning method, and the fluorescent quantitative primers are designed according to the gene sequence and CDS sequence of GhNAC 104:

GhNAC104-RT-F：GCAATGTTAATCTGCCACCG；

GhNAC104-RT-R：TTCCCCAATGTAGAAAACGAAGT；

and then carrying out PCR amplification by taking a T carrier plasmid containing GhNAC104 sequence as a template to obtain a product and pTRV: the RNA2 plasmid was double digested with restriction enzymes BamH1 and Kpn1 (available from NEB, china), respectively. And (3) the digested PCR product is subjected to digestion and the recovered pTRV is subjected to digestion: the RNA2 plasmid fragments were ligated with T4 ligase (purchased from Invitrogen, usa) and the ligation product was the viral silencing vector TRV: ghNAC104. The vector is subjected to heat shock transformation, transferred into escherichia coli TOP10 (purchased from Tian Gen Biochemical technologies Co., ltd.), partial monoclonal is selected for positive detection, primers GhNAC104-VIGS-F and GhNAC104-VIGS-R are used for detection, the detected positive clone is subjected to sequencing by a company, after the sequence comparison is correct, the positive clone is amplified, the plasmid is extracted, and then agrobacterium GV3101 (purchased from Tian Gen Biochemical technologies Co., ltd.) is transformed, and positive bacterial liquid is stored at the temperature of minus 80 ℃ for standby.

The constructed pTRV: ghNAC104 and pTRV2 carrier plasmid are transformed into agrobacterium GV3101, the strain is inoculated into YEP culture medium according to the proportion of 1:10, 180rpm and about 10-12h are carried out, bacterial liquid is activated to OD600 to 1.0-1.2, bacterial liquid is collected into an EP tube, bacterial bodies are suspended by heavy suspension, and OD600 to 0.8-1.0 is adjusted. Taking light/darkness: cotton with flattened cotyledons was grown for about 16h/8h, and pTRV2 strain solution, pTRV: the GhNAC104 and pTRV1 bacterial liquid are mixed uniformly according to the ratio of 1:1, the injection is carried out on the back of cotton cotyledon, the injection area is more than 90%, and after the injection is finished, the cotton cotyledon is covered by a black cover and is uncovered after being processed for 12 hours in a shading way.

EXAMPLE 2 transcriptional Activity analysis of GhNAC104

The CDS sequence of the GhNAC104 gene is constructed on a pGBKT7 vector by a one-step cloning method and is used for verifying the transcriptional activity of the GhNAC104 gene. The specific steps of the transcription activity verification are as follows: 1mL of the activated Y2H strain was inoculated into 100mL of YPDA liquid medium, and cultured under shaking at 250rpm at 30℃to OD ₆₀₀ =0.4-0.6. Centrifuging at 25deg.C for 10min at 4,500rpm, discarding supernatant, and washing the bacterial precipitate twice with sterile water. The cells were resuspended with 1mL of 1 XTE/LiAc and 100. Mu.L of yeast competent cells were obtained per tube. Co-transforming pGBKT7, pGBKT7-GhNAC104 and pGADT7 into Y2H competent cells, respectively; pGADT7-T and pGBKT7-53, pGADT7-T and pGBKT7-Lam were co-transformed into Y2H competent cells as positive and negative controls, respectively. The transformed bacterial liquid is coated on a solid culture medium of DDO (-Trp-Leu), and the culture dish is placed in a constant temperature incubator at 30 ℃ for 3-5d. After white transformant clones with the diameter of about 2mm are grown on the culture medium, different clones are selected for bacterial liquid PCR identification. The correct clones were inoculated onto solid media of QDO (-Trp-Leu-Ade-His) and QDO/X-a-Gal, respectively, and the dishes were placed in a constant temperature incubator at 30℃for 2-3d to observe colony growth and bluing and photographed with a camera.

On QDO/X-alpha-Gal solid medium, positive control T+53 yeast plaques grew normally, negative control T+Lam yeast plaques did not grow, indicating normal yeast transformation, and GhNAC104-BD+AD plaques grew normally, compared to no-load control, indicating transcriptional activity of GhNAC104 (FIG. 1).

Example 3 TRV: identification of verticillium wilt resistance of GhNAC104 interference material (VIGS technology)

Obtaining verticillium spore suspension: uniformly coating verticillium spores frozen at-80 ℃ on a potato agarose (PDA) plate in a sterile workbench, culturing in the dark at a constant temperature of 25 ℃ for 5-7d, adding 5mL of sterile water on the plate when mycelia grow over the whole plate, and scraping the spores by using a sterile inoculating needle. The obtained spore suspension can be used after being subjected to double-layer gauze filtration to identify the number of spores under an optical microscope and then diluted to the target concentration.

The formula of the potato dextrose agar medium is as follows: 200g of potato is weighed, washed, peeled and sliced, and 800mL ddH is added ₂ Boiling O for 15min, filtering with 2 layers of medical gauze, adding 15g glucose and 15g agar powder, constant volume to 1L, autoclaving at 121deg.C for 15min, packaging in culture dish, and standing at room temperature.

Control plants TRV were taken approximately 4 weeks after VIGS intervention: 00 and gene interference plants TRV: RNA was extracted from the stem of GhNAC104, and 3 plants were obtained for each material. qRT-PCR was performed with GhNAC104-RT-F and GhNAC104-RT-R primers to detect the interference efficiency of gene GhNAC104, while primers UB7-F and UB7-F were used to amplify the cotton Ubi7 gene as an internal reference, TRV: the expression level of GhNAC104 was reduced to 1/5 of that of the control plants (FIG. 2B). Selecting cotton seedlings with consistent growth and development period for root injury method inoculation of spore suspension of verticillium wilt, observing appearance of verticillium wilt symptoms every day after beginning to attack plants, and counting morbidity and disease fingers, wherein the result shows that: compared to control plants, the gene-interfered plants grew better, had fewer fallen leaves (fig. 2A), and had lower morbidity and disease index (fig. 3B). The statistical method refers to national standard "detection and identification of verticillium wilt of cotton" (GB/T22101.5-2009 technical Specification for evaluating disease and insect resistance of cotton part 5: verticillium wilt of cotton). After the typical verticillium wilt disease features appear in cotton, cotton seedlings which can represent the disease conditions of control plants and gene interference plants are respectively selected, the same parts of the stems are subjected to free-hand beveling, and the browning degree of the stems is observed under a stereoscopic microscope, so that the fixed planting quantity of the verticillium wilt bacteria in the stems of the interference materials is less (figure 3A). Cutting the rest of the stems into small pieces of 0.3cm, sterilizing in 0.1% mercuric chloride4min, sterilized dd H ₂ After washing 5-7 times with O, the cells were placed in PDA plates, which were added with cephalosporin (50. Mu.g/mL), and incubated in dark at 25℃to observe the growth of verticillium. Larger and more verticillium hyphae grew on the plates of the control material, while less verticillium hyphae grew on the plates of the gene interference material (fig. 2C), and it was seen that the gene interference plants had better verticillium resistance than the control plants.

Example 4 creation of GhNAC104 Gene CRISPR/Cas9 Material and identification of verticillium wilt resistance

CRISPR/Cas9 expression vector construction: the target site of the target gene is analyzed by CRISPR direct (http:// CRISPR. Dbcls. Jp /) on-line analysis software, and finally the target sequence of 5'-CCTTCAACGTAAGGCCGCCCTCT-3' is used for constructing a vector. Cloning a sgRNA expression cassette containing a target sequence by utilizing a PCR technology, and then serially assembling the sgRNA expression cassette containing the target gene sequence and the Cas9 gene on a pYLCRISPR/Cas9P35S-N expression vector. The connection system is as follows: 10 XCutsmart buffer 1.5. Mu.L, 10mM ATP 1.5. Mu.L, pYLCRISPR/Cas9P35S-N plasmid 1. Mu.L (50 ng), sgRNA expression cassette 1. Mu.L, bsaI-HF endonuclease 0.5. Mu.L, T4 DNA ligase 0.1. Mu.L, ddH ₂ O was made up to 15. Mu.L. The above system was mixed uniformly and then carried out in a PCR apparatus according to the following procedure: 37 ℃/10min,10 ℃/5min,20 ℃/5min, this condition being carried out for 3 cycles; 37 ℃/3min,10 ℃/5min,20 ℃/5min, this condition being carried out for 10 cycles; 37 ℃/5min,4 ℃/5min, and 1 cycle of this condition, and the product after the reaction was subjected to a heat shock transformation experiment to transform the strain into DH5a. The transformed monoclonal is subjected to PCR identification, sequencing and sequence comparison, then the correct plasmid is transferred into agrobacterium LBA4404 by an electric shock transformation method, the hypocotyl of the cotton yellowing seedling is transformed by an agrobacterium-mediated genetic transformation method, and finally the gene editing plant is obtained through a series of processes of cell dedifferentiation, induced callus, somatic embryo induction, plant regeneration and the like.

Wild-type material WT and gene editing material nac104 were planted in the nursery of the experimental field, and it was found that wild-type material WT exhibited typical growth conditions infected with verticillium, such as: the leaves turn yellow and curl, the plant height is short, and growth is inhibited (fig. 4A). The leaves of WT and CRISPR cotton plants in the disease nursery were compared and observed to find that the leaves of WT plants become yellow, withered, curled and other verticillium infected, while most of the leaves of CRISPR cotton plants were normal, and only a small number of leaves had slight disease symptoms (FIG. 4B). CRISPR also exhibited a more disease resistant phenotype compared to the overall onset of WT and CRISPR cotton plants in the nursery (fig. 4C). Statistics on the morbidity of the WT and CRISPR materials show that the overall morbidity of the WT material is up to 80%, but only a very small amount of leaves of the nac104 material yellow, and the overall growth condition is good, which indicates that the nac104 material has strong verticillium wilt resistance (figure 4D).

The above-mentioned embodiments are merely preferred embodiments of the present invention, which are not intended to limit the scope of the present invention, and other embodiments can be easily made by those skilled in the art through substitution or modification according to the technical disclosure in the present specification, so that all changes and modifications made in the principle of the present invention shall be included in the scope of the present invention.

Claims (5)

1. The application of inhibiting the expression of cotton GhNAC104 gene in improving verticillium wilt resistance of cotton is characterized in that the nucleotide sequence of cotton GhNAC104 gene is shown as SEQ ID NO. 1.

2. The application of the knockout cotton GhNAC104 gene in improving the verticillium wilt resistance of cotton is characterized in that the nucleotide sequence of the cotton GhNAC104 gene is shown as SEQ ID NO. 1.

3. The use according to claim 2, wherein the knockout is a modification of the coding sequence of the GhNAC104 gene by CRISPR gene editing techniques to obtain a verticillium wilt resistant cotton.

4. A plant breeding method is characterized in that the plant with higher verticillium wilt resistance than a target plant is obtained by inhibiting the expression of a GhNAC104 gene in the target plant or knocking out the GhNAC104 gene of cotton, and the nucleotide sequence of the GhNAC104 gene is shown as SEQ ID NO. 1.

5. The method of plant breeding according to claim 4, wherein the plant of interest is cotton.

Images