CN101805398B - Gene related to plant cold resistance and disease resistance as well as encoding protein and application thereof - Google Patents

Abstract

The invention discloses a gene related to plant cold resistance and disease resistance as well as an encoding protein and application thereof. The protein belongs to the protein with the SEQ ID No.: 2 amino acid residue sequence in a sequence table, or the protein which is obtained through substitution or lack or addition of SEQ ID No.: 2 amino acid residue sequence by one or a plurality of amino acid residues, has the same activity as the SEQ ID No.: 2 amino acid residue sequence and is derived from the SEQ ID No.: 2. The gene of the invention can be used for culturing the novel variety of cold resistance plants and/or disease resistance plants, and has significant meaning.

Description

Gene and proteins encoded and the application relevant with plant winter hardiness and disease resistance

Technical field

The present invention relates to a kind of and the disease-resistant relevant gene of plant winter hardiness and proteins encoded and application, the particularly disease-resistant relevant gene of a kind of and winter hardiness of Arabidopis thaliana and the application of proteins encoded thereof in the bioengineering field.

Background technology

Food problem is one of several hang-ups of facing of the world today.Through improve per unit area yield or enlarge cultivated area, the approach such as improve the low and medium-yield farmland of increasing investment in agriculture increases grain yield and all can run into and need overcome the adverse circumstance restriction or alleviate the problem of adverse circumstance harm.Therefore, the understanding plant is improved the resistance of plant to the reaction mechanism of adverse circumstance, has become the further important foundation research of raising the output of agricultural, and extremely countries in the world government and scientist's concern also is the focus of current life science.

Along with the mankind's Economic development and population expansion, people are also more and more serious to environment damage, thereby caused the variation of weather, such as southern snow ice, and the great change in a short time of boreal climate, these factors have seriously influenced agriculture prodn.

At present, vegetables in the winter time all are to adopt the booth technology, have increased the peasants'production cost; And increased the usage quantity of agricultural chemicals; Influenced the edible safety of vegetables, improved the resistance of vegetables itself low temperature and pathogenic bacteria through genetic engineering technique, very useful and be necessary.

Arabidopis thaliana is a kind of typical model plant, and its effect is suitable with experimental rats, is widely used in plant genetics, developmental biology and molecular biological research.Most of genes of Arabidopis thaliana can both find in other plant, and any discovery of relevant Arabidopis thaliana can both be applied to other plant research, and the expert points out, will help scientist to find the method for raising crop yield to the research of Arabidopis thaliana.

Arabidopis thaliana has about 1.3 hundred million base pairs, 2.9 ten thousand genes.The function of most gene is not clear at present, utilizes mutating technology research gene function to become a kind of effective ways.As far as dicotyledons (mainly being Arabidopis thaliana), EMS mutagenesis is main path, and has obtained a large amount of EMS mutagenesis two mutants.Through research to two mutants, known the function of some adverse circumstance genes, like ICE1 (cold-resistant), SOS1 (salt is responsive), SNC1 (disease-resistant), LEW2 (drought resisting) etc.

The innovation and creation content

The purpose of this invention is to provide a kind of albumen and encoding sox and the application relevant with plant winter hardiness and disease resistance.

Provided by the invention and plant winter hardiness and the relevant albumen of disease resistance, name is called CHS3m, derives from the inferior ecotypic Arabidopis thaliana (Arabidopis thaliana atchs3 two mutants) of taxi driver brother's rival after the EMS mutagenesis, is following 1) or 2) described protein:

1) amino acid residue sequence of the SEQ ID № .2 in the sequence table;

2) with the SEQ ID № .2 amino acid residue sequence in the sequence table through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have SEQ ID №: the identical active protein of 2 amino acid residue sequence.

The protein that sequence 2 amino acid residue sequences are made up of 1422 amino-acid residues in the sequence table.

The proteic encoding sox relevant with disease resistance provided by the invention with plant winter hardiness, its nucleotide sequence is one of following nucleotide sequences:

1) SEQ ID № in the sequence table: 1 dna sequence dna;

2) SEQ ID № in the code sequence tabulation: the polynucleotide of 2 protein sequences;

3) with sequence table in SEQ ID №: 1 dna sequence dna that limits has 90% above homology, and the identical function protein DNA sequence of encoding.

Sequence SEQ ID № in the sequence table: 1 dna sequence dna is by 5339 based compositions, and the reading frame of this gene is to contain 9 introns from 5 ' the 1st at end to the 5339th bit base, is respectively from 5 ' and holds the 417th to the 762nd bit base; Hold the 1889th to the 1978th bit base from 5 '; Hold the 2276th to the 2360th bit base from 5 '; Hold the 3132nd to the 3228th bit base from 5 '; Hold the 4332nd to the 4420th bit base from 5 '; Hold the 4542nd to the 4650th bit base from 5 '; Hold the 4732nd to the 4827th bit base from 5 '; Hold the 4945th to the 5029th bit base from 5 '; Hold the 5243rd to the 5315th bit base from 5 '.

The above-mentioned proteic encoding sox relevant with disease resistance with plant winter hardiness, the nucleotide sequence of its cDNA gene is one of following nucleotide sequences:

1) SEQ ID № in the sequence table: 5 dna sequence dna;

2) SEQ ID № in the code sequence tabulation: the polynucleotide of 2 protein sequences;

3) with sequence table in SEQ ID №: 5 dna sequence dnas that limit have 90% above homology, and the identical function protein DNA sequence of encoding.

SEQ ID № in the sequence table: the protein sequence shown in the sequence 1 in the tabulation of 5 code sequences.

Contain among expression carrier of the present invention, clone and the amplification CHS3m arbitrary segmental primer to all belonging to protection scope of the present invention.

3) and primer 2 the right sequence of arbitrary segmental primer can be primer 1:5 ' GTC GAC GAGATG GAACCA CCA GCT GCT C 3 ' (SEQ ID №:: 5 ' GGA TCC TCA TAA CTTTGAATA TTG TGG AGT C, 3 ' (SEQ ID №: 4) among the amplification CHS3m

For the ease of transgenic plant cells or plant being identified and screening, can process employed carrier, like the antibiotic marker thing that adds the alternative mark of plant or have resistance.By the plant transformed host both can be monocotyledons, also can be dicotyledons.

Experiment showed, that albumen of the present invention and its encoding sox have cold-resistant and disease-resistant function, can be used for cultivating freeze proof and/or disease-resistant plants new variety and freeze proof disease-resistant plants new variety, significant.

Below in conjunction with accompanying drawing and specific embodiment the present invention is described further.

Description of drawings

Fig. 1 is the phenotype analytical of WT and chs3 two mutants

Fig. 2 is the map based cloning of CHS3

Fig. 3 is the checking and the phenotype analytical of 35S:CHS3m transfer-gen plant

Embodiment

Clone and the functional verification thereof of the gene C HS3 that embodiment 1, plant winter hardiness and disease resistance are relevant

One, the gene C HS3 that plant winter hardiness and disease resistance are relevant and the acquisition of proteins encoded thereof

1, the winter hardiness of two mutants chs3 and disease resistance analysis

Arabidopis thaliana atchs3 two mutants is buy to obtain (Stock No:CS8000) from Arabidopsis Biological Resource Center (ABRC) the earliest, according to following method the shape and the wild-type Arabidopis thaliana (Col) of two mutants is compared analysis:

With the wild-type Arabidopis thaliana (Col, ABRC) with the seed of two mutants chs3 through after the sterilization of Youxiaolin, be layered on the 1/2MS substratum, put into 22 ℃ and 16 ℃ of incubators respectively and grow.

The result is as shown in Figure 1; The result shows that plant wild-type and the two mutants of 22 ℃ of direct growth after two weeks has no difference (Figure 1A), and 16 ℃ of direct growth plant wild-type growths after three weeks are normal; It is short and small that the two mutants plant has demonstrated plant, the phenotype (Figure 1B) that leaf curls downwards.Col among Figure 1A and Figure 1B representes the wild-type Arabidopis thaliana, and chs3 is two mutants atchs3.

With wild-type (Col) and two mutants chs3 (in this paper two mutants chs3, chs3-1 the be Arabidopis thaliana atchs3 two mutants) plant of 16 ℃ of direct growth after three weeks, move into cryogenic refrigerator (model is RuMED4001, the temperature difference ± 0.5 ℃) and carry out the frost resistance analysis.Uncap for 4 ℃ and place water droplet surperficial in the 2-3h furnace pot with plant; Per hour once fell from-1 ℃ of beginning afterwards and be cooled to-6 ℃ and take out after placing 2h-4h; Recover to cultivate at 4 ℃ of dark 12h; Behind the normal cultured condition 4d, calculate survival rate (whether blade has green to be positioned standard alive) and photograph then.The result compares the back with the surviving rate of wild-type and two mutants atchs3 and finds that two mutants is obviously freeze proof shown in C among Fig. 1 and D.Col among Fig. 1 among C and the D representes the wild-type Arabidopis thaliana, and chs3-1 is two mutants atchs3.

The seed of wild-type (Col) and two mutants atchs3 through after the sterilization of Youxiaolin, is layered on the 1/2MS, puts into 22 ℃ of incubators respectively and grow and seedling is moved into soil after a week, put into 22 ℃ respectively and connect bacterium after 10 days with 16 ℃ of greenhouses growths and test.Concrete grammar is: will be cultured to OD ₆₀₀Be 0.2 pathogenic strains Pseudomonassyringae pv tomato (Pst) DC3000 (Dong X; Mindrinos M; Davis KR; Ausubel FM (1991) Induction of Arabidopsis defense genes by virulent and avirulent Pseudomonas syringaestrains and by a cloned avirulence gene.Plant Cell 3:61-72) inserts the wild-type of 22 ℃ and 16 ℃ cultivations and the plant of two mutants through the method for being stained with seedling, get Pseudomonas syringae pv tomato (Pst) the DC3000 number in the plant grinding dilution metering plant that meets 0d and 3d behind the bacterium respectively.The result is shown in E among Fig. 1, and what evident difference 22 ℃ the wild-type and the disease resistance of two mutants do not have, and 16 ℃ two mutants has tangible disease resistance with respect to wild-type.Col among Fig. 1 among C and the D representes the wild-type Arabidopis thaliana, and chs3-1 is two mutants atchs3.

The acquisition of the gene that 2, plant winter hardiness and disease resistance are relevant

With obtaining F2 generation after two mutants atchs3 and the wild-type Ler hybridization, select the colony that 16 ℃ of short and small plant that grow down make up map based cloning.The Primary Location of process map based cloning obtains this mutator gene and is positioned the 5th chromosomal top; Further positioning analysis through the SSLP mark is positioned mutator gene further to enlarge colony between nga139 and the nga151; This assignment of genes gene mapping between MP17-2 and MCM23; Find that through sequencing analysis mutating alkali yl is positioned at the 5314th (Fig. 2 A) of at5g17890 gene, become A by G, this site mutation occurs in the junction of the 9th intron of CHS3 and exon; Cause shearing unusually, thereby produce a PROTEIN C HS3m who blocks.This albumen has the aminoacid sequence of sequence 2 in the sequence table, is plant winter hardiness and disease resistance GAP-associated protein GAP.Fig. 2 A representes the map based cloning of CHS3 gene, and in the drawings, (a) that the arrow top is marker, and horizontal line is represented the 5th a chromosomal part, the chromosomal position of below digitized representation (kb); (b) reorganization of the digitized representation in bracket number/sum; (c) the CHS3 gene is positioned between the 5th karyomit(e) MP17 and two BAC of MCM23, and (d) gene that contains of this zone is from At5g17850 to At5g17960; (e) CHS3 gene structure synoptic diagram, black box is represented exon, and black line is represented intron, and arrow indication place is the mutational site.

Obtain this plant winter hardiness and the relevant gene C HS3m of disease resistance according to following method:

Extracting total DNA of two mutants atchs3, is template with this total DNA, is primer with primer 1 with primer 2, carries out pcr amplification.Primer sequence is primer 1:5 ' GTC GAC GAG ATG GAA CCA CCA GCT GCT C3 ' (SEQ ID №: 3); Primer 2: 5 ' GGATCC TCATAACTT TGAATATTG TGGAGTC3 ' (SEQ ID №: 4).

The seed of two mutants atchs3 through after the sterilization of Youxiaolin, is layered on the 1/2MS substratum, puts into 22 ℃ of incubators 10d that grows, get one to two strain plant of two mutants and put into genomic DNA extraction buffer (the 200mM Tris-HCl pH7.4 that the 1.5ml centrifuge tube adds 250ul; 250mM NaCl, 25mM EDTApH8.0,0.7 ‰ (v/v) 3-mercaptoethanol), it is fully broken to be ground to blade; Add 35ul SDS (heating fusion in advance), among 65 ℃ of incubation 15min, add 75ul 5M KOAC, up and down mixing behind the mixing; Be placed on 5min on ice, centrifugal, 12000rpm, 10min; Pour supernatant into new 1.5ml centrifuge tube, add 30ul NaOAC and 300ul Virahol, mixing-20 ℃ 20min; Centrifugal, 12000rpm, 20min; With 70% ethanol washing and precipitating, room temperature is dried, and the EB buffer (10mM Tris-HCl pH8.0) that is melted into 200ul obtains Genome DNA.

The pcr amplification reaction system is:

The Genome DNA 5ul of said extracted, 10 * Pyrobest buffer II 5ul, dNTP Mixture (each 2.5mM) 4ul, primer 1 (10uM) 2ul, primer 2 (10uM) 2ul, Pyrobest DNA Polymerase (5U/ul) 25ul, ddH ₂O 32ul.

At BIO-RAD MyCycler ^TMThe enterprising performing PCR of thermalcycler.Pyrobest DNA Polymerase purchases the company in TaKaRa, and primer is synthetic in three rich polygala root companies.

The pcr amplification reaction program is:

94 ℃ of preparatory sex change 10min, 94 ℃ of 1min, 56 ℃ of 1min, 72 ℃ of 6min amount to 30 circulations; 72 ℃ are extended 10min, with the PCR product that obtains, do 1% agarose gel electrophoresis.

Result's amplification obtains the fragment of about 5350bp, is the relevant gene of plant winter hardiness of the present invention and disease resistance, with its called after CHS3m.Order-checking shows that this fragment has the nucleotide sequence shown in the sequence 1 in the sequence table; The dna sequence dna of sequence 1 is by 5339 based compositions in the sequence table; The reading frame of this gene is to contain 9 introns from 5 ' the 1st at end to the 5339th bit base, is respectively from 5 ' and holds the 417th to the 762nd bit base; Hold the 1889th to the 1978th bit base from 5 '; Hold the 2276th to the 2360th bit base from 5 '; Hold the 3132nd to the 3228th bit base from 5 '; Hold the 4332nd to the 4420th bit base from 5 '; Hold the 4542nd to the 4650th bit base from 5 '; Hold the 4732nd to the 4827th bit base from 5 '; Hold the 4945th to the 5029th bit base from 5 '; Hold the 5243rd to the 5315th bit base from 5 '.This genes encoding has SEQ ID № in the sequence table: the protein of 2 amino acid residue sequences, the proteins encoded CHS3m of promptly freeze proof disease-resistant related gene CHS3m.

The acquisition of the cDNA of the gene that 3, plant winter hardiness and disease resistance are relevant

The seed of two mutants atchs3 through after the sterilization of Youxiaolin, is layered on the 1/2MS substratum, put into 22 ℃ with the incubator 10d that grows, the plant of getting 0.1g uses liquid nitrogen in mortar, to grind fragmentation; Move in the 1.5ml centrifuge tube, add 1ml Trizol, room temperature extracting 5min, 4 ℃ are centrifugal, 12000rpm; 8min, supernatant move into new pipe, add the 200ul chloroform, violent mixing, and room temperature is placed 3min; 4 ℃ are centrifugal, 12000rpm, and 8min draws 500ul upper strata water and puts into new pipe, adds the 500ul Virahol; Put upside down mixing for several times, precipitation at room temperature 10min, 4 ℃ are centrifugal, 12000rpm, 15min; DEPC ethanol washing and precipitating twice with 70% siphons away unnecessary liquid in the pipe, when RNA slightly does in waiting to manage, adds 50ul DEPC ddH ₂O.(using the Trizol of Invitrogen company)

Get 2ul RNA, 2ul (10uM) oligodT, 8ul DEPC ddH ₂O, 70 ℃ of 5min, 5min adds 5ul DEPC dNTP on ice, 5ul M-MLV 5 * buffer, 1ul M-MLV, 42 ℃ of 1h, 94 ℃ of 10min, this is reflected on BIO-RAD MyCyclerTM thermalcycler and carries out, and obtains the cDNA of two mutants.(using the M-MLV of Promega company).3) and primer 2 with this cDNA is template, and primer sequence is: primer 1:5 ' GTC GACGAG ATG GAA CCA CCA GCT GCT C 3 ' (SEQ ID №:: 5 ' GGA TCCTCA TAA CTT TGAATA TTG TGG AGTC, 3 ' (SEQ ID №: 4); Carry out pcr amplification.

The PCR reaction system is: 1ul cDNA, 5ul 10 * Pyrobest bufferII, 4ul dNTP Mixture (each 2.5mM), 2ul primer 1 (10uM), 2ul primer 2 (10uM), 25ul Pyrobest DNA Polymerase (5U/ul), 36ul ddH ₂O.(Pyrobest DNA Polymerase purchases the company in TaKaRa, and primer is synthetic in three rich polygala root companies).At BIO-RAD MyCycler ^TMThermalcycler is last to carry out following PCR.

The PCR response procedures does

94 ℃ of preparatory sex change 10min, 94 ℃ of 1min, 56 ℃ of 1min, 72 ℃ of 5min amount to 30 circulations; 72 ℃ are extended 10min, with the PCR product that obtains, do 1% agarose gel electrophoresis, obtain the cDNA of mutator gene CHS3m.The result shows that amplification obtains the cDNA that total length is 4.3kb CHS3m, shows that through order-checking this cDNA has the nucleotide sequence of sequence 5 in the sequence table.

Two, the relevant proteic transgenic functional verification of plant winter hardiness of the present invention and disease resistance

Utilize Sal I and BamH I restriction endonuclease to carry out the cDNA PCR product that enzyme is cut above-mentioned amplification, be connected to binary vector pGreen0029 (this plasmid available from Http:// www.pgreen.ac.uk/a pls fr.htm) Xho I and BamH I restriction enzyme site, the exactness of sequence verification sequence, called after 35S:CHS3m.

This 35S:CHS3m carrier is imported Agrobacterium GV3101 (Koncz C; Schell J (1986) The promoter ofTL-DNA gene 5 controls the tissue-specific expression of chimaeric genes carried bv anovel type of Agrobacterium binary vector.Mol Gen Genet 204:383-396.); Utilization is dipped in colored method and is changed the 35S:CHS3m carrier over to AtCHS3 deletion mutant or wild-type Ler plant (Arabidopsis BiologicalResource Center (ABRC)) then; Adopt the Basta screening of 10mg/L to obtain changeing 35S:CHS3m two mutants plant and change 35S:CHS3m wild-type Ler plant; Because 35S:CHS3m two mutants plant is closely similar with the phenotype of changeing 35S:CHS3m wild-type Ler plant, so following description is an example to change 35S:CHS3m wild-type Ler plant (be called for short and change the 35S:CHS3m plant) all.

After identifying that male changes the seed process sterilization of Youxiaolin of 35S:CHS3m plant, be layered on the 1/2MS substratum, put into 16 ℃ of incubators respectively and grow.After three weeks; Checking phenotype, is contrast to be grown in 16 ℃ of not genetically modified wild-type Ler plant, and the result shows; The wild-type Ler Arabidopis thaliana plant strain growth that is grown under 16 ℃ is comparatively normal; Demonstrate growth inhibiting phenotype, the wild-type Ler Arabidopis thaliana the when WT among Fig. 3 among the A representes 16 ℃, the commentaries on classics 35S:CHS3m wild-type Ler Arabidopis thaliana plant when 35S:CHS3m is 16 ℃ and change the 35S:CHS3m plant.

Two strain systems of the positive plant that phenotype is arranged that extraction screens change 35S:CHS3m wild-type Ler Arabidopis thaliana strain system and corresponding wild type Ler, get the plant tissue of 0.1g respectively, and it is broken to use liquid nitrogen in mortar, to grind, and moves in the 1.5ml centrifuge tube, adds 1ml Trizol (Invitrogen company); Room temperature extracting 5min, 4 ℃ are centrifugal, 12000rpm, 8min, supernatant move into new pipe; Add the 200ul chloroform, violent mixing, room temperature is placed 3min, and 4 ℃ are centrifugal, 12000rpm; 8min draws 500ul upper strata water and puts into new pipe, adds the 500ul Virahol, puts upside down mixing for several times; Precipitation at room temperature 10min, 4 ℃ are centrifugal, 12000rpm, 15min; DEPC ethanol washing and precipitating twice with 70% siphons away unnecessary liquid in the pipe, when RNA slightly does in waiting to manage, adds 50ul DEPC ddH ₂O.

Use the M-MLV of Promega company to carry out reverse transcription acquisition cDNA, concrete grammar is: get 2ul RNA, 2ul (10uM) oligodT, 8ul DEPC ddH ₂O, 70 ℃ of 5min, 5min adds 5ul DEPC dNTP on ice; 5ul M-MLV 5 * buffer, 1ul M-MLV, 42 ℃ of 1h; 94 ℃ of 10min, this is reflected on BIO-RADMyCyclerTM thermalcycler and carries out, and obtains the cDNA of transfer-gen plant and corresponding wild-type.

With the above-mentioned cDNA that obtains, dilute 10 times, as template, get 2ul cDNA; 1,5ul 10 * PCR buffer, 1.2ul dNTP Mixture (each 2.5mM), 0.6ul primer 3 (10uM); 0.6ul primer 4 (10uM), 0.2ultaq E (5U/ul, taq E purchase the company in TaKaRa), 9ul ddH ₂O.At BIO-RAD MyCycler ^TMThe last sxemiquantitative PCR that carries out of thermalcycler.The PCR primer is: primer 3:5 '-TTTAAATGTGCACGAGGCTCTG-3 ' and primer 4:5 '-TGAATGCATCGTGTTTGACATC 3 '; Do interior mark with TUB8; Primer is TUB8-F:5 ' GAGTCAATG TCTACTACAACG 3 ', TUB8-R:5 ' CTCTGTATTGCTGTGATCCAC3 '.

Response procedures is: 94 ℃ of preparatory sex change 3min, and 94 ℃ of 0.5min, 56 ℃ of 0.5min, 72 ℃ of 1min amount to 30 circulations; 72 ℃ are extended 3min.

With the PCR product that obtains; Do 1% agarose gel electrophoresis; (B among Fig. 3) can find out on the glue figure that obtains, and the expression amount of the TUB8 in transfer-gen plant and the wild-type plant does not have evident difference, and in changeing the 35S:CHS3m plant; The expression amount of CHSm is apparently higher than wild-type, so this gene has obtained overexpression really in the transfer-gen plant.Among Fig. 3 B, WT representes wild-type Ler Arabidopis thaliana, and #1 and #2 are two changes 35S:CHS3m wild-type Ler strain system (#1 and #2 are two respectively independently changes 35S:CHS3m wild-type Ler strain system).

With the wild-type Ler Arabidopis thaliana (WT) of above-mentioned 16 ℃ of direct growth after three weeks, change the 35S:CHS3m plant, move into cryogenic refrigerator (model is RuMED4001, the temperature difference ± 0.5 ℃) and carry out the frost resistance analysis.Uncap for 4 ℃ and place water droplet surperficial in the 2-3h furnace pot with plant; Per hour once fell from-1 ℃ of beginning afterwards and be cooled to-6 ℃ and take out after placing 2-4h; Recover to cultivate at 4 ℃ of dark 12h, behind the normal cultured condition 4d, calculate survival rate (whether blade has green to be positioned standard alive) and photograph then.Change the 35S:CHS3m plant and have tangible frost resistance (C among Fig. 3), change the surviving rate of 35S:CHS3m plant after-6 ℃ of processing and be significantly higher than D among wild-type Ler Fig. 3).WT among Fig. 3 C-D representes wild-type Ler Arabidopis thaliana, and 35S:CHS3m is for changeing the 35S:CHS3m plant.

Wild-type (WT) and the seed that changes the 35S:CHS3m plant through after the sterilization of Youxiaolin, are layered on the 1/2MS, put into 22 ℃ of incubators respectively and grow and seedling is moved into soil after a week, put into 22 ℃ respectively and connect bacterium after 10 days with 16 ℃ of greenhouses growths and test.Concrete grammar is: will be cultured to OD ₆₀₀Be 0.2 pathogenic strains Pseudomonassyringae pv tomato (Pst) the DC3000 wild-type that inserts 22 ℃ and 16 ℃ cultivations through the method for being stained with seedling and change the 35S:CHS3m plant, get Pseudomonassyringae pv tomato (Pst) the DC3000 number in the plant grinding dilution metering plant that meets 0d and 3d behind the bacterium respectively.

Concrete experimental technique: with wild-type Ler Arabidopis thaliana (WT) with after changeing the seed process sterilization of Youxiaolin of 35S:CHS3m wild-type Ler Arabidopis thaliana; Be layered on the 1/2MS; Put into 22 ℃ of incubators respectively and grow and seedling is moved into soil after a week, put into 22 ℃ and 16 ℃ of greenhouses growths respectively and connect the bacterium experiment after 10 days.Picking Pseudomonas syringae pv tomato (Pst) DC3000 draws plate in the KB of the kantlex that is added with 50mg/L solid medium (Bacto ^TMProteose Peptone No.329g/l, K ₂HPO ₄3H ₂O 1.96g/L, glycerine 8ml/L, MgSO ₄7H ₂O 1.52g/L, agar 15g/L; Substratum is purchased the company in BD) on, 28 ℃, cultivated 2 days; Scrape on the slave plate and get some Pseudomonas syringae pv tomato (Pst) DC3000; In the liquid KB substratum (the KB solid medium does not add agar) that is suspended at 1ml, draw on the KB solid medium that 100ul is coated onto a kantlex that newly is added with 50mg/L 28 ℃; Cultivated 2 days, and added 5ml 10mM MgCl ₂Wash the bacterium on the plate in the centrifuge tube that moves into a 50ml, use 10mM MgCl ₂Be diluted to finite concentration and measure OD600, add 0.025%Silwet L-77 until being diluted to OD600=0.2, will add good bacterium liquid and pour petridish into, infect plant respectively, cover 1h, open film, get the plant of 0d and 3d, 10mM MgCl is used in the grinding of weighing ₂Do gradient dilution, be coated on the KB solid medium of kantlex of 50mg/L, 28 ℃, cultivate 40h, the number of thalline calculates the log (10) of thalline with EXCEL, and carries out mapping analysis on the number substratum.

The result is shown in Fig. 3 E; The result shows; 22 ℃ wild-type Ler Arabidopis thaliana does not have any evident difference with the disease resistance of changeing 35S:CHS3m wild-type Ler Arabidopis thaliana; And the number of the intravital Pseudomonassyringae pv of 16 ℃ transfer-gen plant tomato (Pst) DC3000 is starkly lower than wild-type, explains that transfer-gen plant has tangible disease resistance.WT among Fig. 3 E representes the wild-type Arabidopis thaliana, and 35S:CHS3m is for changeing the 35S:CHS3m plant.

Sequence table

<160>5

<210>1

<211>5339

<212>GENOME DNA

< 213>Arabidopsis Arabidopis thaliana (Arabidopsis thaliana (L.) HEYNH.)

<400>1

atggaaccac cagctgctcg tgtaacgccg tcgattaagg ccgactgtag tcacagcgtc 60

aacatcatct gcgaggaaac agtactgcac tcccttgtca gccacctctc ggccgcttta 120

cgccgggaag gcatatctgt gtttgtggat gcgtgcggat tgcaggaaac caagttcttc 180

tccattaaac agaatcagcc gttgacagat ggggctaggg ttttggtggt ggttatttcc 240

gacgaggtgg agttctacga tccttggttt cctaagttct taaaggttat ccagggttgg 300

caaaacaacg gccacgtggt ggttccagtc ttctacggcg tcgattcgtt gacccgagtt 360

tacgggtggg ccaatagttg gctggaggcc gaaaaattaa ccagccacca atcaaagttc 420

gtatacatta tacttttttc ttttgtcaaa aacaagtaaa tgtactaatc atataaaccg 480

ctagacttat atcatatgtg tatatataat taggcaatca aattttgaat aatccaagtg 540

aaactcagat aattttggag ttatgtgatg aactaaagac acctttacat tttcattgct 600

ggaattgttg ttaagagatt actttgtgta tatgcattga tttgaaattt ttttggttaa 660

atttttagtt tgttgttcaa ttaaaagact ttagttgaaa taaaacatat ttgaagtgat 720

tgttgaataa tagagggtag ttgtttttcc tttcttgggc aggatcttaa gcaataatgt 780

actcacggac tccgaactag tggaagagat cgtcagagat gtttatggga agctttatcc 840

tgcagaacga gttggaattt acgcgaggct actagagata gaaaagttgc tttacaagca 900

acatagggac atccgaagca taggaatttg gggtatgcct ggcataggca agacgacgct 960

tgctaaagca gtctttaatc acatgtccac tgattatgat gcttcttgct tcatcgagaa 1020

ctttgatgaa gcttttcata aggagggact ccaccgtttg ctcaaagaaa gaattggtaa 1080

aattctaaag gatgagtttg acatagaaag ttcgtatatt atgagaccga ccctccatag 1140

ggacaaatta tacgataaaa ggattcttgt tgttttagat gatgtgcgcg attcccttgc 1200

tgcagagtcc ttccttaaaa ggcttgattg gtttggttcc ggaagcctta taatcataac 1260

ctccgttgat aaacaagtgt ttgccttttg tcagatcaat caaatataca cggttcaagg 1320

tttaaatgtg cacgaggctc tgcagctttt ctcccaaagc gtatttggaa taaacgagcc 1380

agagcagaat gacaggaaac tgtcaatgaa ggtgattgac tatgttaatg gaaacccgtt 1440

agctctcagc atttacggcc gagagctaat ggggaagaag tcagaaatgg agactgcatt 1500

cttcgagctc aagcattgtc ctcccttaaa gattcaggat gtgctaaaaa acgcttatag 1560

tgcacttagc gacaatgaga agaacattgt tttggacatt gcttttttct tcaagggaga 1620

aactgtcaat tatgtgatgc agctgcttga ggaatctcat tactttccac gtcttgcaat 1680

agatgttctt gtggacaagt gtgtgttaac tatctcagaa aacacagtgc aaatgaataa 1740

tttgatccaa gacacctgcc aagaaatctt caatggagaa attgagacct gcaccagaat 1800

gtgggaacct tccagaatca gatatctgct agaatatgat gaacttgaag gaagtggaga 1860

aaccaaagca atgcctaaat ctggtctggt ctgtcaaatt ctactatatg cattacctga 1920

gttgttctat taaggcgagc ctaacttatt gatctatcaa tttctcttgt tctctcaggt 1980

cgctgaacac atcgaaagca tattcctgga cacttcaaac gtgaaatttg atgtcaaaca 2040

cgatgcattc aagaatatgt ttaatctcaa attcctaaag atatacaatt catgctctaa 2100

atatatttct ggactcaatt ttccaaaggg cctcgattct ctgccttatg agctaaggct 2160

cctccactgg gagaactacc ctttgcaatc cttgcctcaa gattttgact ttggacacct 2220

tgttaagctc agtatgcctt acagccagct tcataaactc gggacaagag tcaaggtagg 2280

ctgactaagt ctgggtattt atctgcaact tcgcttataa cattactgtt tcattcattt 2340

tcaatttttt atattttcag gaccttgtga tgttaaagag gctcattctt tctcattctt 2400

tacagctagt tgaatgtgac atactaatat atgctcaaaa tatcgagcta attgatcttc 2460

aaggctgtac aggattgcaa agatttccag acacgagtca attacagaat ctccgggtag 2520

taaatctctc aggttgcaca gagatcaaat gtttctcagg ggttccacca aatattgagg 2580

aattacatct ccaaggaact cgtataaggg aaataccaat attcaatgcg acccatcccc 2640

ccaaggttaa gctggaccgg aaaaagcttt ggaatcttct agaaaacttc tcggatgttg 2700

agcatatcga tttggagtgt gtaacaaatc tagctacagt tacctcaaat aatcatgtta 2760

tgggcaagct tgtctgcttg aatatgaaat attgttccaa tttgcgaggc cttcctgaca 2820

tggtcagttt agaatctctc aaagttcttt atctgtcggg ctgttcagag cttgagaaaa 2880

ttatgggttt cccgagaaac ttgaaaaaac tatatgttgg tggaaccgcc atacgagaat 2940

tgccacagct tcccaacagt ctagaattcc tgaatgctca tggttgtaag catctgaagt 3000

caattaattt ggattttgag cagcttccta ggcacttcat cttcagtaat tgttatagat 3060

tttcttcaca agtgatcgct gagttcgtag agaaaggtct tgtagcaagt ttagcaagag 3120

caaaacaaga ggttttttac ctttctctcg ctctctatcg cacgttcatt tattctcatg 3180

cacacagcac acaggttaac taattaattt tggcctttgc ttgaacagga actcatcaaa 3240

gcacctgaag tcatcatctg tattcctatg gacacacggc agagatcctc ctttcgcttg 3300

caagcaggtc gaaatgcaat gacagactta gttccgtgga tgcaaaaacc tatctcaggc 3360

ttttctatgt cagttgtagt atcatttcaa gatgattacc acaatgatgt aggtcttcgc 3420

attaggtgtg taggtacatg gaagacctgg aacaaccagc ctgatagaat agttgagaga 3480

ttttttcaat gttgggctcc taccgaagct ccaaaagttg tagcggatca catttttgtc 3540

ttgtatgata ccaaaatgca tcctagtgat agtgaagaaa accacatcag tatgtgggct 3600

catgaagtca aatttgaatt ccacacagtg agtggggaaa acaatcctct aggtgctagt 3660

tgcaaggtga ctgaatgtgg tgtcgaggta attacagctg caacaggtga tactagtgtt 3720

agtggaatta taagagaaag tgaaactata actattatcg agaaggagga tactattatt 3780

gatgaggagg atactcctct tttgtccaga aagccagagg aaacgaatcg ttctcgttca 3840

tctagcgaat tacagaagct ttctagtacg tcaagtaagg taagatctaa gggaaatgtg 3900

ttttggaagt ggttaggttg ttttcccctg cagccaaaaa acttgagatc tagaagtagg 3960

cgcacaacag cgttagaaga agcgttagaa gaagcattaa aagaaagaga aaaattagag 4020

gacaccagag agttacaaat agcattaata gagtcaaaga agataaaaaa aataaagcaa 4080

gcagacgaaa gggatcaaat aaagcacgca gacgaaaggg aacaaagaaa gcattccaaa 4140

gatcatgagg aagaagaaat agagtcaaat gagaaagaag aaagaaggca ttccaaagat 4200

tatgtgatag aagaattagt gttaaagggg aaaggtaaaa gaaagcaact ggatgatgat 4260

aaagccgacg aaaaggaaca aataaagcat tccaaagatc atgtggaaga agaagtgaat 4320

cctcctctta ggtaacgctt ttatgtgctt ctgtaagtgt gtataaggaa ttcttggatt 4380

ttacgtttac ttgctcagat catatctatt ttacttgtag caaatgcaag gattgcaaat 4440

ctgcaattga agatggaata tctatcaatg cctacggttc tgtttggcat cctcaatgtt 4500

tctgttgcct tcgttgtcgg gagcctattg ctatgaacga ggtttttaac catataaata 4560

ccagcttgaa attgattgct actttaatgt gattactgct tgactcttgt acattttgtt 4620

ttctgatgca aaacatatat aactcgttag atttcagact taagaggaat gtatcacaaa 4680

ccttgctaca aggagctccg tcatccgaat tgctatgtct gcgaaaaaaa ggtaagtata 4740

ttctcatgag ttgggttttg gacaatgaaa ctacaaaaga attggtcgta gtgtatgtaa 4800

aatgtaatag tatattattt ctttcagatt cctcgtactg cggaaggttt aaagtaccat 4860

gagcatccgt tctggatgga aacatactgc ccttctcatg atggtgatgg aactcccaaa 4920

tgttgtagct gtgaaagatt agaggtcctt aattatagtt ctttgactag attagatgaa 4980

tattgaaaca gagaaacctt ctggtttgac ttgttatagt tctgtgcagc attgcggaac 5040

acagtatgta atgcttgcag attttcgatg gctatgtcga gaatgtatgg acagcgcgat 5100

tatggattct gatgaatgcc aacctttgca ctttgaaatc cgtgaattct ttgagggctt 5160

acacatgaag attgaggaag aatttcctgt ttatttggtg gagaaaaatg ctctgaataa 5220

agctgagaag gaagagaaga ttgtgagtac atttcccaaa ctaaaacttc ctgatttctc 5280

tatctctctc tctcactctc ttcgtatgtc tcaagacaaa cagggggatc agtgtctga 5339

<210>2

<211>1422

<212>PRT

< 213>Arabidopsis Arabidopis thaliana (Arabidopsis thaliana (L.) HEYNH.)

<400>2

Met Glu Pro Pro Ala Ala Arg Val Thr Pro Ser Ile Lys Ala Asp Cys

1 5 10 15

Ser His Ser Val Asn Ile Ile Cys Glu Glu Thr Val Leu His Ser Leu

20 25 30

Val Ser His Leu Ser Ala Ala Leu Arg Arg Glu Gly Ile Ser Val Phe

35 40 45

Val Asp Ala Cys Gly Leu Gln Glu Thr Lys Phe Phe Ser Ile Lys Gln

50 55 60

Asn Gln Pro Leu Thr Asp Gly Ala Arg Val Leu Val Val Val Ile Ser

65 70 75 80

Asp Glu Val Glu Phe Tyr Asp Pro Trp Phe Pro Lys Phe Leu Lys Val

85 90 95

Ile Gln Gly Trp Gln Asn Asn Gly His Val Val Val Pro Val Phe Tyr

100 105 110

Gly Val Asp Ser Leu Thr Arg Val Tyr Gly Trp Ala Asn Ser Trp Leu

115 120 125

Glu Ala Glu Lys Leu Thr Ser His Gln Ser Lys Ile Leu Ser Asn Asn

130 135 140

Val Leu Thr Asp Ser Glu Leu Val Glu Glu Ile Val Arg Asp Val Tyr

145 150 155 160

Gly Lys Leu Tyr Pro Ala Glu Arg Val Gly Ile Tyr Ala Arg Leu Leu

165 170 175

Glu Ile Glu Lys Leu Leu Tyr Lys Gln His Arg Asp Ile Arg Ser Ile

180 185 190

Gly Ile Trp Gly Met Pro Gly Ile Gly Lys Thr Thr Leu Ala Lys Ala

195 200 205

Val Phe Asn His Met Ser Thr Asp Tyr Asp Ala Ser Cys Phe Ile Glu

210 215 220

Asn Phe Asp Glu Ala Phe His Lys Glu Gly Leu His Arg Leu Leu Lys

225 230 235 240

Glu Arg Ile Gly Lys Ile Leu Lys Asp Glu Phe Asp Ile Glu Ser Ser

245 250 255

Tyr Ile Met Arg Pro Thr Leu His Arg Asp Lys Leu Tyr Asp Lys Arg

260 265 270

Ile Leu Val Val Leu Asp Asp Val Arg Asp Ser Leu Ala Ala Glu Ser

275 280 285

Phe Leu Lys Arg Leu Asp Trp Phe Gly Ser Gly Ser Leu Ile Ile Ile

290 295 300

Thr Ser Val Asp Lys Gln Val Phe Ala Phe Cys Gln Ile Asn Gln Ile

305 310 315 320

Tyr Thr Val Gln Gly Leu Asn Val His Glu Ala Leu Gln Leu Phe Ser

325 330 335

Gln Ser Val Phe Gly Ile Asn Glu Pro Glu Gln Asn Asp Arg Lys Leu

340 345 350

Ser Met Lys Val Ile Asp Tyr Val Asn Gly Asn Pro Leu Ala Leu Ser

355 360 365

Ile Tyr Gly Arg Glu Leu Met Gly Lys Lys Ser Glu Met Glu Thr Ala

370 375 380

Phe Phe Glu Leu Lys His Cys Pro Pro Leu Lys Ile Gln Asp Val Leu

385 390 395 400

Lys Asn Ala Tyr Ser Ala Leu Ser Asp Asn Glu Lys Asn Ile Val Leu

405 410 415

Asp Ile Ala Phe Phe Phe Lys Gly Glu Thr Val Asn Tyr Val Met Gln

420 425 430

Leu Leu Glu Glu Ser His Tyr Phe Pro Arg Leu Ala Ile Asp Val Leu

435 440 445

Val Asp Lys Cys Val Leu Thr Ile Ser Glu Asn Thr Val Gln Met Asn

450 455 460

Asn Leu Ile Gln Asp Thr Cys Gln Glu Ile Phe Asn Gly Glu Ile Glu

465 470 475 480

Thr Cys Thr Arg Met Trp Glu Pro Ser Arg Ile Arg Tyr Leu Leu Glu

485 490 495

Tyr Asp Glu Leu Glu Gly Ser Gly Glu Thr Lys Ala Met Pro Lys Ser

500 505 510

Gly Leu Val Ala Glu His Ile Glu Ser Ile Phe Leu Asp Thr Ser Asn

515 520 525

Val Lys Phe Asp Val Lys His Asp Ala Phe Lys Asn Met Phe Asn Leu

530 535 540

Lys Phe Leu Lys Ile Tyr Asn Ser Cys Ser Lys Tyr Ile Ser Gly Leu

545 550 555 560

Asn Phe Pro Lys Gly Leu Asp Ser Leu Pro Tyr Glu Leu Arg Leu Leu

565 570 575

His Trp Glu Asn Tyr Pro Leu Gln Ser Leu Pro Gln Asp Phe Asp Phe

580 585 590

Gly His Leu Val Lys Leu Ser Met Pro Tyr Ser Gln Leu His Lys Leu

595 600 605

Gly Thr Arg Val Lys Asp Leu Val Met Leu Lys Arg Leu Ile Leu Ser

610 615 620

His Ser Leu Gln Leu ValGlu Cys Asp Ile Leu Ile Tyr Ala Gln Asn

625 630 635 640

Ile Glu Leu Ile Asp Leu Gln Gly Cys Thr Gly Leu Gln Arg Phe Pro

645 650 655

Asp Thr Ser Gln Leu Gln Asn Leu Arg Val Val Asn Leu Ser Gly Cys

660 665 670

Thr Glu Ile Lys Cys Phe Ser Gly Val Pro Pro Asn Ile Glu Glu Leu

675 680 685

His Leu Gln Gly Thr Arg Ile Arg Glu Ile Pro Ile Phe Asn Ala Thr

690 695 700

His Pro Pro Lys Val Lys Leu Asp Arg Lys Lys Leu Trp Asn Leu Leu

705 710 715 720

Glu Asn Phe Ser Asp Val Glu His Ile Asp Leu Glu Cys Val Thr Asn

725 730 735

Leu Ala Thr Val Thr Ser Asn Asn His Val Met Gly Lys Leu Val Cys

740 745 750

Leu Asn Met Lys Tyr Cys Ser Asn Leu Arg Gly Leu Pro Asp Met Val

755 760 765

Ser Leu Glu Ser Leu Lys Val Leu Tyr Leu Ser Gly Cys Ser Glu Leu

770 775 780

Glu Lys Ile Met Gly Phe Pro Arg Asn Leu Lys Lys Leu Tyr Val Gly

785 790 795 800

Gly Thr Ala Ile Arg Glu Leu Pro Gln Leu Pro Asn Ser Leu Glu Phe

805 810 815

Leu Asn Ala His Gly Cys Lys His Leu Lys Ser Ile Asn Leu Asp Phe

820 825 830

Glu Gln Leu Pro Arg His Phe Ile Phe Ser Asn Cys Tyr Arg Phe Ser

835 840 845

Ser Gln Val Ile Ala Glu Phe Val Glu Lys Gly Leu Val Ala Ser Leu

850 855 860

Ala Arg Ala Lys Gln Glu Glu Leu Ile Lys Ala Pro Glu Val Ile Ile

865 870 875 880

Cys Ile Pro Met Asp Thr Arg Gln Arg Ser Ser Phe Arg Leu Gln Ala

885 890 895

Gly Arg Asn Ala Met Thr Asp Leu Val Pro Trp Met Gln Lys Pro Ile

900 905 910

Ser Gly Phe Ser Met Ser Val Val Val Ser Phe Gln Asp Asp Tyr His

915 920 925

Asn Asp Val Gly Leu Arg Ile Arg Cys Val Gly Thr Trp Lys Thr Trp

930 935 940

Asn Asn Gln Pro Asp Arg Ile Val Glu Arg Phe Phe Gln Cys Trp Ala

945 950 955 960

Pro Thr Glu Ala Pro Lys Val Val Ala Asp His Ile Phe Val Leu Tyr

965 970 975

Asp Thr Lys Met His Pro Ser Asp Ser Glu Glu Asn His Ile Ser Met

980 985 990

Trp Ala His Glu Val Lys Phe Glu Phe His Thr Val Ser Gly Glu Asn

995 1000 1005

Asn Pro Leu Gly Ala Ser Cys Lys Val Thr Glu Cys Gly Val Glu

1010 1015 1020

Val Ile Thr Ala Ala Thr Gly Asp Thr Ser Val Ser Gly Ile Ile

1025 1030 1035

Arg Glu Ser Glu Thr Ile Thr Ile Ile Glu Lys Glu Asp Thr Ile

1040 1045 1050

Ile Asp Glu Glu Asp Thr Pro Leu Leu Ser Arg Lys Pro Glu Glu

1055 1060 1065

Thr Asn Arg Ser Arg Ser Ser Ser Glu Leu Gln Lys Leu Ser Ser

1070 1075 1080

Thr Ser Ser Lys Val Arg Ser Lys Gly Asn Val Phe Trp Lys Trp

1085 1090 1095

Leu Gly Cys Phe Pro Leu Gln Pro Lys Asn Leu Arg Ser Arg Ser

1100 1105 1110

Arg Arg Thr Thr Ala Leu Glu Glu Ala Leu Glu Glu Ala Leu Lys

1115 1120 1125

Glu Arg Glu Lys Leu Glu Asp Thr Arg Glu Leu Gln Ile Ala Leu

1130 1135 1140

Ile Glu Ser Lys Lys Ile Lys Lys Ile Lys Gln Ala Asp Glu Arg

1145 1150 1155

Asp Gln Ile Lys His Ala Asp Glu Arg Glu Gln Arg Lys His Ser

1160 1165 1170

Lys Asp His Glu Glu Glu Glu Ile Glu Ser Asn Glu Lys Glu Glu

1175 1180 1185

Arg Arg His Ser Lys Asp Tyr Val Ile Glu Glu Leu Val Leu Lys

1190 1195 1200

Gly Lys Gly Lys Arg Lys Gln Leu Asp Asp Asp Lys Ala Asp Glu

1205 1210 1215

Lys Glu Gln Ile Lys His Ser Lys Asp His Val Glu Glu Glu Val

1220 1225 1230

Asn Pro Pro Leu Ser Lys Cys Lys Asp Cys Lys Ser Ala Ile Glu

1235 1240 1245

Asp Gly Ile Ser Ile Asn Ala Tyr Gly Ser Val Trp His Pro Gln

1250 1255 1260

Cys Phe Cys Cys Leu Arg Cys Arg Glu Pro Ile Ala Met Asn Glu

1265 1270 1275

Ile Ser Asp Leu Arg Gly Met Tyr His Lys Pro Cys Tyr Lys Glu

1280 1285 1290

Leu Arg His Pro Asn Cys Tyr Val Cys Glu Lys Lys Ile Pro Arg

1295 1300 1305

Thr Ala Glu Gly Leu Lys Tyr His Glu His Pro Phe Trp Met Glu

1310 1315 1320

Thr Tyr Cys Pro Ser His Asp Gly Asp Gly Thr Pro Lys Cys Cys

1325 1330 1335

Ser Cys Glu Arg Leu Glu His Cys Gly Thr Gln Tyr Val Met Leu

1340 1345 1350

Ala Asp Phe Arg Trp Leu Cys Arg Glu Cys Met Asp Ser Ala Ile

1355 1360 1365

Met Asp Ser Asp Glu Cys Gln Pro Leu His Phe Glu Ile Arg Glu

1370 1375 1380

Phe Phe Glu Gly Leu His Met Lys Ile Glu Glu Glu Phe Pro Val

1385 1390 1395

Tyr Leu Val Glu Lys Asn Ala Leu Asn Lys Ala Glu Lys Glu Glu

1400 1405 1410

Lys Ile Thr Asn Arg Gly Ile Ser Val

1415 1420

<210>3

<211>28

<212>DNA

< 213>artificial sequence

<220>

<223>

<400>3

gtcgacgaga tggaaccacc agctgctc 28

<210>4

<211>31

<212>DNA

< 213>artificial sequence

<220>

<223>

<400>4

ggatcctcat aactttgaat attgtggagt c 31

<210>5

<211>4269

<212>cDNA

< 213>Arabidopsis Arabidopis thaliana (Arabidopsis thaliana (L.) HEYNH.)

<400>5

atggaaccac cagctgctcg tgtaacgccg tcgattaagg ccgactgtag tcacagcgtc 60

aacatcatct gcgaggaaac agtactgcac tcccttgtca gccacctctc ggccgcttta 120

cgccgggaag gcatatctgt gtttgtggat gcgtgcggat tgcaggaaac caagttcttc 180

tccattaaac agaatcagcc gttgacagat ggggctaggg ttttggtggt ggttatttcc 240

gacgaggtgg agttctacga tccttggttt cctaagttct taaaggttat ccagggttgg 300

caaaacaacg gccacgtggt ggttccagtc ttctacggcg tcgattcgtt gacccgagtt 360

tacgggtggg ccaatagttg gctggaggcc gaaaaattaa ccagccacca atcaaagatc 420

ttaagcaata atgtactcac ggactccgaa ctagtggaag agatcgtcag agatgtttat 480

gggaagcttt atcctgcaga acgagttgga atttacgcga ggctactaga gatagaaaag 540

ttgctttaca agcaacatag ggacatccga agcataggaa tttggggtat gcctggcata 600

ggcaagacga cgcttgctaa agcagtcttt aatcacatgt ccactgatta tgatgcttct 660

tgcttcatcg agaactttga tgaagctttt cataaggagg gactccaccg tttgctcaaa 720

gaaagaattg gtaaaattct aaaggatgag tttgacatag aaagttcgta tattatgaga 780

ccgaccctcc atagggacaa attatacgat aaaaggattc ttgttgtttt agatgatgtg 840

cgcgattccc ttgctgcaga gtccttcctt aaaaggcttg attggtttgg ttccggaagc 900

cttataatca taacctccgt tgataaacaa gtgtttgcct tttgtcagat caatcaaata 960

tacacggttc aaggtttaaa tgtgcacgag gctctgcagc ttttctccca aagcgtattt 1020

ggaataaacg agccagagca gaatgacagg aaactgtcaa tgaaggtgat tgactatgtt 1080

aatggaaacc cgttagctct cagcatttac ggccgagagc taatggggaa gaagtcagaa 1140

atggagactg cattcttcga gctcaagcat tgtcctccct taaagattca ggatgtgcta 1200

aaaaacgctt atagtgcact tagcgacaat gagaagaaca ttgttttgga cattgctttt 1260

ttcttcaagg gagaaactgt caattatgtg atgcagctgc ttgaggaatc tcattacttt 1320

ccacgtcttg caatagatgt tcttgtggac aagtgtgtgt taactatctc agaaaacaca 1380

gtgcaaatga ataatttgat ccaagacacc tgccaagaaa tcttcaatgg agaaattgag 1440

acctgcacca gaatgtggga accttccaga atcagatatc tgctagaata tgatgaactt 1500

gaaggaagtg gagaaaccaa agcaatgcct aaatctggtc tggtcgctga acacatcgaa 1560

agcatattcc tggacacttc aaacgtgaaa tttgatgtca aacacgatgc attcaagaat 1620

atgtttaatc tcaaattcct aaagatatac aattcatgct ctaaatatat ttctggactc 1680

aattttccaa agggcctcga ttctctgcct tatgagctaa ggctcctcca ctgggagaac 1740

taccctttgc aatccttgcc tcaagatttt gactttggac accttgttaa gctcagtatg 1800

ccttacagcc agcttcataa actcgggaca agagtcaagg accttgtgat gttaaagagg 1860

ctcattcttt ctcattcttt acagctagtt gaatgtgaca tactaatata tgctcaaaat 1920

atcgagctaa ttgatcttca aggctgtaca ggattgcaaa gatttccaga cacgagtcaa 1980

ttacagaatc tccgggtagt aaatctctca ggttgcacag agatcaaatg tttctcaggg 2040

gttccaccaa atattgagga attacatctc caaggaactc gtataaggga aataccaata 2100

ttcaatgcga cccatccccc caaggttaag ctggaccgga aaaagctttg gaatcttcta 2160

gaaaacttct cggatgttga gcatatcgat ttggagtgtg taacaaatct agctacagtt 2220

acctcaaata atcatgttat gggcaagctt gtctgcttga atatgaaata ttgttccaat 2280

ttgcgaggcc ttcctgacat ggtcagttta gaatctctca aagttcttta tctgtcgggc 2340

tgttcagagc ttgagaaaat tatgggtttc ccgagaaact tgaaaaaact atatgttggt 2400

ggaaccgcca tacgagaatt gccacagctt cccaacagtc tagaattcct gaatgctcat 2460

ggttgtaagc atctgaagtc aattaatttg gattttgagc agcttcctag gcacttcatc 2520

ttcagtaatt gttatagatt ttcttcacaa gtgatcgctg agttcgtaga gaaaggtctt 2580

gtagcaagtt tagcaagagc aaaacaagag gaactcatca aagcacctga agtcatcatc 2640

tgtattccta tggacacacg gcagagatcc tcctttcgct tgcaagcagg tcgaaatgca 2700

atgacagact tagttccgtg gatgcaaaaa cctatctcag gcttttctat gtcagttgta 2760

gtatcatttc aagatgatta ccacaatgat gtaggtcttc gcattaggtg tgtaggtaca 2820

tggaagacct ggaacaacca gcctgataga atagttgaga gattttttca atgttgggct 2880

cctaccgaag ctccaaaagt tgtagcggat cacatttttg tcttgtatga taccaaaatg 2940

catcctagtg atagtgaaga aaaccacatc agtatgtggg ctcatgaagt caaatttgaa 3000

ttccacacag tgagtgggga aaacaatcct ctaggtgcta gttgcaaggt gactgaatgt 3060

ggtgtcgagg taattacagc tgcaacaggt gatactagtg ttagtggaat tataagagaa 3120

agtgaaacta taactattat cgagaaggag gatactatta ttgatgagga ggatactcct 3180

cttttgtcca gaaagccaga ggaaacgaat cgttctcgtt catctagcga attacagaag 3240

ctttctagta cgtcaagtaa ggtaagatct aagggaaatg tgttttggaa gtggttaggt 3300

tgttttcccc tgcagccaaa aaacttgaga tctagaagta ggcgcacaac agcgttagaa 3360

gaagcgttag aagaagcatt aaaagaaaga gaaaaattag aggacaccag agagttacaa 3420

atagcattaa tagagtcaaa gaagataaaa aaaataaagc aagcagacga aagggatcaa 3480

ataaagcacg cagacgaaag ggaacaaaga aagcattcca aagatcatga ggaagaagaa 3540

atagagtcaa atgagaaaga agaaagaagg cattccaaag attatgtgat agaagaatta 3600

gtgttaaagg ggaaaggtaa aagaaagcaa ctggatgatg ataaagccga cgaaaaggaa 3660

caaataaagc attccaaaga tcatgtggaa gaagaagtga atcctcctct tagcaaatgc 3720

aaggattgca aatctgcaat tgaagatgga atatctatca atgcctacgg ttctgtttgg 3780

catcctcaat gtttctgttg ccttcgttgt cgggagccta ttgctatgaa cgagatttca 3840

gacttaagag gaatgtatca caaaccttgc tacaaggagc tccgtcatcc gaattgctat 3900

gtctgcgaaa aaaagattcc tcgtactgcg gaaggtttaa agtaccatga gcatccgttc 3960

tggatggaaa catactgccc ttctcatgat ggtgatggaa ctcccaaatg ttgtagctgt 4020

gaaagattag agcattgcgg aacacagtat gtaatgcttg cagattttcg atggctatgt 4080

cgagaatgta tggacagcgc gattatggat tctgatgaat gccaaccttt gcactttgaa 4140

atccgtgaat tctttgaggg cttacacatg aagattgagg aagaatttcc tgtttatttg 4200

gtggagaaaa atgctctgaa taaagctgag aaggaagaga agattacaaa cagggggatc 4260

agtgtctga 4269

Claims (7)

1. albumen, the protein of forming by the amino acid residue sequence of the SEQ ID № .2 in the sequence table.

2. the said proteic encoding sox of claim 1.

3. according to the said encoding sox of claim 2, the nucleotide sequence of its genomic gene is one of following nucleotide sequences:

1) SEQ ID № in the sequence table: 1 dna sequence dna;

2) SEQ ID № in the code sequence tabulation: the polynucleotide of 2 protein sequences.

4. encoding sox according to claim 2, the nucleotide sequence of its cDNA gene is one of following nucleotide sequences:

1) SEQ ID № in the sequence table: 5 dna sequence dna;

2) SEQ ID № in the code sequence tabulation: the polynucleotide of 2 protein sequences.

5. the recombinant expression vector, recombinant bacterial strain or the transgenic cell line that contain any said gene among the claim 2-4.

6. the primer of any said gene is right among the amplification claim 2-4, and said primer is to be SEQ ID №: 3 and SEQ ID №: 4.

7. the application of any said gene in the transgenic plant of cultivating the disease resistance raising among the claim 2-4; Said plant is an Arabidopis thaliana; Said disease resistance is the disease resistance of disease that Pseudomonas syringae pv tomato is caused.

Images