CN1635156A - Process for detecting Enterobacter sakazakii by employing fluorescence PCR technology - Google Patents
Process for detecting Enterobacter sakazakii by employing fluorescence PCR technology Download PDFInfo
- Publication number
- CN1635156A CN1635156A CNA2004100728528A CN200410072852A CN1635156A CN 1635156 A CN1635156 A CN 1635156A CN A2004100728528 A CNA2004100728528 A CN A2004100728528A CN 200410072852 A CN200410072852 A CN 200410072852A CN 1635156 A CN1635156 A CN 1635156A
- Authority
- CN
- China
- Prior art keywords
- sequence
- probe
- sakazakii
- fluorescence
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an Enterobacter sakazakii detection method by using the fluorescence PCR technology which belongs to the bacteria detection technology. The technical project includes designing specific oligonucleotide primers and probes by means of Enterobacter sakazakii specific DNA sequences, amplifying bacteria target genes directly from the sample by respectively using excision enzyme probe fluorescence PCR and fluorescent dye chimeric PCR technologies. The invention includes six specific oligonucleotide sequences of the designed Enterobacter sakazakii, two reporter plasmid amplification sequences for comparison, and the suited fluorescence PCR reaction conditions. The invention provides a standard method to detect the Enterobacter sakazakii in foodstuff and clinical samples. The invention can save time because of omitting the repeated culture of the bacteria and electrophoresis observation, in addition, the method has higher sensitivity, quicker detection speed, and capability of quantitative analysis.
Description
Technical field
The present invention relates to the bacteriologic test technology, specifically use fluorescent PCR to react and detect malignant bacteria, particularly E.sakazakii.
Background technology
E.sakazakii (Enterobacter sakazakii) is a gram negative bacterium, belongs to the enterobacteriaceae enterobacter.Before being named as E.sakazakii in 1980, this bacterium is called as product yellow pigment enterobacter cloacae.It is rarely found clinically pathogenic bacteria, its meningitis that causes, septicemia, necrotizing enterocolitis all have report in worldwide, and the trend of being on the increase is arranged, and most of cases occur in the infant, and the course of disease is short, and case fatality rate can reach 80% sometimes.Though the contagium of E.sakazakii is not really clear, infant formula powder has played the effect of communication media.2002 No. 120 bulletin of State General Administration for Quality Supervision's issue on November 26th, 2002, its inspection declaration that to the effect that suspends the formula milk of some lot number of handling the production of U.S. Wyeth is open to the custom and relevant inspection and quarantine formality, the related products of import exercised supervision destroy, reason is that FDA Food and Drug Administration (FDA) detects E.sakazakii in the said products; March 6 in 2003, the Japan-US minister company that praises was also because of finding to contain E.sakazakii in a series of milk powder, initiatively regained the baby milk powder of some product batch number.
China does not still have the food neutralization to detect the standard method of E.sakazakii clinically at present, and U.S. FDA separates method of counting at the E.sakazakii of in August, 2002 issue, has still continued to use " three pipes " enrichment and has detected E.sakazakii.Its weak point is to need to detect object bacteria through before increasing the classical method of inspection such as bacterium, separation and Culture, biochemical identification, and not only test period is long, and sensitivity and specificity are all relatively low.
Summary of the invention
At above-mentioned situation, the present invention has overcome shortcoming of the prior art, a kind of method of using fluorescent PCR technology for detection E.sakazakii is provided, specifically, by detecting the fluorescent signal that is sent in the chimeric PCR reaction of reaction of excision enzyme probe PCR or fluorescence dye, whether contain E.sakazakii in the judgement sample.
Technical scheme of the present invention is as follows:
1, detect E.sakazakii by excision enzyme probe PCR reaction (the Taqman probe method is hereinafter to be referred as probe method), the sequence of the primer of its use, probe and reporter plasmid amplified fragments is as follows:
Primer:
Probe method primer sequence 1:CCGGAACAAGCTGAAAATTCT
Probe method primer sequence 2:GTCTTCGTGCTGCGATTAC
Probe:
Probe method probe sequence 1:ACTCTGACACCGCGCATTCCTG
Probe method probe sequence 2:CCTTTGGCGTTTCCCGATGTCCGT
The amplified fragments of probe method reporter plasmid: GGAGGGATTGCAGCGTGTTTTTAATGAGGTCATCAC
GGGATCCCATGTGCGTGACGGACATCGGGAAACGCCAAAGGAGATT
Also comprise derive out by above-mentioned five oligonucleotide sequences, difference is not more than the oligonucleotide sequence of 8 bases and the antisense complementary sequence of each sequence, or their variant, or their partial sequence.
The component of PCR reaction system:
Constituent concentration application of sample amount
2 times of 12.5 μ L of PCR system premixture
Probe method primer sequence 1 10 μ mol/L 0.5 μ L
Probe method primer sequence 2 10 μ mol/L 0.5 μ L
Probe method probe sequence 13 μ mol/L 1 μ L
Probe method probe sequence 23 μ mol/L 1 μ L
Distilled water 7.5 μ L
The pcr amplification program:
(1) 95 ℃ 10 seconds
(2) 95 ℃ 5 seconds
(3) 62 ℃ 20 seconds
(4) got back to for (2) step, repeat 45 times.
Testing process:
(1) design specific oligonucleotide primer, probe with the probe sequence 1 usefulness FAM fluorophor mark of probe method, with the probe sequence 2 usefulness HEX fluorophor marks of probe method, are used for excision enzyme fluorescence probe PCR and detect;
(2) structure can use probe method primer sequence 1 and 2 amplifications of probe method primer sequence, and the reporter plasmid of its amplified production energy and 2 hybridization of probe method probe sequence, as the positive control plasmid, prevents false negative result.
(3) with probe method primer sequence 1 and probe method primer sequence 2 as primer, be template with the E.sakazakii genomic dna, carry out the specific amplification of goal gene;
(4) use the fluorescent PCR instrument to carry out the real-time fluorescence luminous intensity measurement in the amplification procedure, and data transmission crossed software kit analysis to the computer expert, can observe the FAM fluorescent signal that E.sakazakii is carried out the specific wavelength of specific amplification generation, prove to have E.sakazakii in the testing sample; As the HEX fluorescent signal of only observing another wavelength and there is not the FAM fluorescent signal, then prove not have E.sakazakii in the testing sample; Then show check failure this time as not observing any fluorescent signal, can not determine whether there is E.sakazakii, need check again.
The present invention by the reaction of excision enzyme probe PCR, can be observed the specificity fluorescent signal with the Auele Specific Primer of E.sakazakii gene, tested 30 kinds do not belong to together or other malignant bacteria of generic in all do not find false positive results.
2, by the method (being called for short the chimeric method of fluorescence) of the chimeric PCR reaction detection of fluorescence dye E.sakazakii, the sequence of the primer sequence of its use and reporter plasmid amplified fragments is as follows:
The chimeric method primer sequence of fluorescence 1:GGGTTGTCTGCGAATCGCTT
The chimeric method primer sequence of fluorescence 2:GTCTTCGTGCTGCGTCAAAC
The amplified fragments of the chimeric method reporter plasmid of fluorescence: TCCGTTCTTCTTCGTCATAACTTAATGTTTTTAT
TTAAAATACCCTCTGAAAAGAAAGGA
Also comprise derive out by above-mentioned three oligonucleotide sequences, difference is not more than the oligonucleotide sequence of 8 bases and the antisense complementary sequence of each sequence, or their variant, or their partial sequence.
The component of PCR reaction system:
Constituent concentration application of sample amount
2 times of 12.5 μ L of PCR system premixture
The chimeric method the primer of fluorescence sequence 1:10 μ mol/L 0.5 μ L
The chimeric method the primer of fluorescence sequence 2:10 μ mol/L 0.5 μ L
Distilled water 9.5 μ L
The pcr amplification program:
(1) 95 ℃ 10 seconds
(2) 95 ℃ 5 seconds
A certain temperature between (3) 58 ℃ to 65 ℃ 20 seconds
(4) got back to for (2) step, repeat 45 times.
(5) 95 ℃ 2 minutes
(6) gradient increased temperature is 55 ℃ to 95 ℃, rises 1 ℃ in per 25 seconds.
Testing process:
(1) design specific oligonucleotide primer is used for the chimeric fluorescent PCR detection of fluorescence dye;
(2) make up the reporter plasmid that can use chimeric method primer sequence 1 of fluorescence and chimeric method primer sequence 2 amplifications of fluorescence,, prevent false negative result as the positive control plasmid.
(3) with the chimeric method primer sequence of the chimeric method primer sequence 1 of fluorescence and fluorescence 2 as primer, be template with the E.sakazakii genomic dna, carry out the specific amplification of goal gene;
(4) use the fluorescent PCR instrument to carry out the real-time fluorescence luminous intensity measurement in the amplification procedure, and finish the back in the PCR reaction and measure the segmental melting temperature (Tm) of institute's synthetic DNA.Data transmission is crossed software kit analysis to the computer expert, can observe E.sakazakii is carried out the fluorescence that specific amplification produces, and obtain the peculiar melting curve of specific fragment (87.1 ℃ ± 0.5 ℃ of main peak that E.sakazakii is increased and produces; 85.0 ± 0.5 ℃ of secondary peaks), then prove and have E.sakazakii in the testing sample; As only observing fluorescent signal, and melting curve does not meet the distinctive melting curve of E.sakazakii, and can observe the fluorescent signal of reporter plasmid and the peculiar melting curve that specific fragment produced (79.0 ± 0.5 ℃ of peak values) of amplification reporter plasmid, then prove not have E.sakazakii in the testing sample; As other results occur and then show check failure this time, can not determine whether there is E.sakazakii, need check again.
The present invention detects E.sakazakii with the Auele Specific Primer of E.sakazakii gene by the chimeric PCR report of fluorescence fluorescent signal, tested 30 kinds do not belong to together or other malignant bacteria of generic in all do not find false positive results.
3, the E.sakazakii cultural method in the testing sample:
(1) configure dedicated substratum: Tryptones 20g, lactose 5g, K
2HPO
42.75g, KH
2PO
42.75g, NaCl 34.22g, Sodium Lauryl Sulphate BP/USP 0.1g, vancomycin 10mg adds sterilized water to 1 liter, adjust pH to 6.8 ± 0.2;
(2) get 100g testing sample powder, dissolve or be suspended in 1 liter the special culture media 37 ℃ of overnight incubation;
(3) get the above-mentioned testing sample culture 2mL that obtains, add in the 50mL brain heart infusion, 37 ℃ of per minute 200 commentaries on classics on shaking table, shaking culture 3 hours.
Compared with prior art, the invention has the beneficial effects as follows: the authentication method based on fluorescent PCR is applicable to directly amplified target gene from clinical samples such as patient's mycetome liquid, food and body fluid culture, thereby detects E.sakazakii.Fluorescence PCR method have detect accurately, high specificity, highly sensitive characteristics, can identify special target bacteria quickly and accurately.It has avoided cultivating repeatedly with the method amplification bacterium target gene of PCR, saves time; The PCR authentication method is not subjected to the influence of culture condition and bacterium physiological status, and is more accurate than the Physiology and biochemistry authentication method.The fluorescent PCR technology is compared with the regular-PCR technology, does not need electrophoresis observation, so have the advantages that sensitivity is higher, detection speed is faster and can carry out quantitative analysis.The present invention has filled up the blank that detects E.sakazakii by fluorescence PCR method.
Description of drawings
Fig. 1: certain powdered milk sample excision enzyme fluorescence probe PCR detected result (FAM fluorescence signal intensity)
Fig. 2: certain powdered milk sample excision enzyme fluorescence probe PCR reporter plasmid detected result (FAM fluorescence signal intensity)
Fig. 3: certain powdered milk sample excision enzyme fluorescence probe PCR reporter plasmid detected result (HEX fluorescence signal intensity)
Fig. 4: the chimeric fluorescent PCR detected result of certain powdered milk sample fluorescence dye (fluorescence signal intensity)
Fig. 5: the melting temperature (Tm) peak value of the chimeric fluorescent PCR testing sample of certain powdered milk sample fluorescence dye DNA cloning product
Fig. 6: the fluorescence signal intensity of the chimeric fluorescent PCR reporter plasmid of fluorescence dye in certain powdered milk sample
Fig. 7: the melting temperature (Tm) peak value of the chimeric fluorescent PCR reporter plasmid of fluorescence dye amplified production in certain powdered milk sample
Fig. 8: the FAM fluorescence signal intensity of non-E.sakazakii DNA in excision enzyme fluorescence probe PCR
Fig. 9: the HEX fluorescence signal intensity of non-E.sakazakii DNA in excision enzyme fluorescence probe PCR
Figure 10: the fluorescence signal intensity of non-E.sakazakii DNA in the chimeric PCR of fluorescence dye
Figure 11: in the chimeric PCR of fluorescence dye, the increase melting temperature (Tm) of reporter plasmid amplified fragments of non-E.sakazakii DNA
Embodiment
Below in conjunction with accompanying drawing and embodiment the present invention is described in further detail.
Sample: certain import brand infant formula powder.Detect the doubtful bacterium colony of E.sakazakii with conventional physiology, biochemical method, detect E.sakazakii by fluorescent signal excision enzyme probe PCR then:
1. sample cultivation
(1) configure dedicated substratum: Tryptones 20g, lactose 5g, K
2HPO
42.75g, KH
2PO
42.75g, NaCl 34.22g, Sodium Lauryl Sulphate BP/USP 0.1g, vancomycin 10mg adds sterilized water to 1 liter, adjust pH to 6.8 ± 0.2;
(2) get in the special culture media that 100g milk powder is dissolved in 1 liter 37 ℃ of overnight incubation;
(3) get the above-mentioned testing sample culture 2mL that obtains, add in the 50mL brain heart infusion, 37 ℃, 200 rev/mins, shaking table shaking culture 3 hours.
2.DNA extracting
Get brain heart infusion enrichment liquid 1mL, left standstill in the ice bath 5 minutes, at room temperature 12000 rev/mins then, centrifugal 5 minutes, abandon supernatant liquor, add 100 μ L lysozyme solns, 37 ℃ of insulations 10 minutes are added TE damping fluid 500 μ L, the vibration mixing.Add with the saturated phenol of volume Tris (pH8.0), strong vibration, 12000 rev/mins, centrifugal 3 minutes, get supernatant liquor, repeat the phenol extracting.Get supernatant liquor, add the sodium acetate (2mol/L) of 0.1 times of volume, mixing, add isopyknic ice ethanol again, stand at low temperature is 30 minutes behind the mixing, 12000 rev/mins, centrifugal 5 minutes, abandon supernatant, add 70% cold washing with alcohol once, following 12000 rev/mins of room temperature, centrifugal 5 minutes, abandon supernatant, add 50 μ L TE solution, put-20 ℃ of preservations.
3.PCR amplification
The PCR reaction system:
Constituent concentration application of sample amount
2 times of 12.5 μ L of PCR system premixture
Probe method the primer sequence 1 10 μ mol/L 0.5 μ L
Probe method the primer sequence 2 10 μ mol/L 0.5 μ L
The used probe sequence 13 μ mol/L of probe method 1 μ L
The used probe sequence 23 μ mol/L of probe method 1 μ L
Distilled water 7.5 μ L
The pcr amplification program:
(1) 95 ℃ 10 seconds
(2) 95 ℃ 5 seconds
(3) 62 ℃ 20 seconds
(4) got back to for (2) step, repeat 45 times.
Carry out 7 pipe PCR experiments altogether, wherein the DNA sample is respectively: E.sakazakii reference culture ATCC12868 positive control; Original content DNA sample; 10 times of dilution DNA samples; 10
2Times dilution DNA sample; 10
3Times dilution DNA sample; 10
4Times dilution DNA sample; The negative control that the reporter plasmid no sample is only arranged.
4. detected fluorescent PCR collection of illustrative plates is observed
Can observe reference culture positive control and each concentration sample in the fluorescent PCR process respectively 18.36; 22.25; 25.83; 29.75; 33.5; 36.5 circulation has produced tangible FAM fluorescence, the results are shown in Figure 1.
Fig. 1: certain powdered milk sample excision enzyme fluorescence probe PCR detected result (FAM fluorescence signal intensity)
The FAM fluorescence intensity signals of each the bar curve representative among the figure is respectively:
1. E.sakazakii reference culture ATCC12868;
2. original content DNA sample;
3.10 dilution DNA sample doubly;
4.10
2Times dilution DNA sample;
5.10
3Times dilution DNA sample;
6.10
4Times dilution DNA sample;
In the PCR process, do not produce FAM fluorescence in the negative control, the results are shown in Figure 2.
Fig. 2: certain powdered milk sample excision enzyme fluorescence probe PCR reporter plasmid detected result (FAM fluorescence signal intensity)
The FAM fluorescence intensity signals of the curve representative among the figure is:
1. the negative control that the reporter plasmid no sample is only arranged.
But produced the HEX fluorescence of reporter plasmid in 34.19 circulations, the results are shown in Figure 3.
Fig. 3: certain powdered milk sample excision enzyme fluorescence probe PCR reporter plasmid detected result (HEX fluorescence signal intensity)
The HEX fluorescence intensity signals of the curve representative among the figure is:
1. the negative control that the reporter plasmid no sample is only arranged.
More than experiment shows, contains E.sakazakii in the sample.
After 2 days, prove that the purpose bacterium colony of being checked 98% is E.sakazakii, one of them bacterial strain called after gq103 by conventional microorganism culturing and biochemistry detection.Fluorescent signal excision enzyme probe PCR assay is consistent with the biochemistry detection result.
Sample: certain domestic brand infant formula powder.Detect the doubtful bacterium colony of E.sakazakii with conventional physiology, biochemical method, detect E.sakazakii by the chimeric approach of fluorescent signal fluorescence dye then:
1. sample cultivation:
With embodiment 1.
2.DNA extracting
With embodiment 1.
3.PCR amplification
Each component composition is as follows in the PCR reaction system:
Constituent concentration application of sample amount
2 times of 12.5 μ L of PCR system premixture
The chimeric method the primer of fluorescence sequence 1:10 μ mol/L 0.5 μ L
The chimeric method the primer of fluorescence sequence 2:10 μ mol/L 0.5 μ L
Distilled water 9.5 μ L
The melting temperature (Tm) program of amplification program and mensuration amplified fragments is in the PCR method:
(1) 95 ℃ 10 seconds
(2) 95 ℃ 5 seconds
A certain temperature between (3) 58 ℃ to 65 ℃ 20 seconds
(4) got back to for (2) step, repeat 45 times.
(5) 95 ℃ 2 minutes
(6) gradient increased temperature is 55 ℃ to 95 ℃, rises 1 ℃ in per 25 seconds.
Carry out 7 pipe PCR experiments altogether, wherein the DNA sample is respectively: E.sakazakii reference culture ATCC29004 positive control; Original content DNA sample; 10 times of dilution DNA samples; 10
2Times dilution DNA sample; 10
3Times dilution DNA sample; 10
4Times dilution DNA sample; The negative control that the reporter plasmid no sample is only arranged.
4. detected fluorescent PCR collection of illustrative plates is observed and melting curve is observed
Can observe the reference culture positive control in the fluorescent PCR process and each concentration sample has produced tangible fluorescence, see Fig. 4.
Fig. 4: the chimeric fluorescent PCR detected result of certain powdered milk sample fluorescence dye (fluorescence signal intensity)
The fluorescence intensity signals of each the bar curve representative among the figure is respectively:
1. E.sakazakii reference culture ATCC29004;
2. original content DNA sample;
3.10 dilution DNA sample doubly;
4.10
2Times dilution DNA sample;
5.10
3Times dilution DNA sample;
6.10
4Times dilution DNA sample;
Its melting temperature (Tm) meets the characteristic of E.sakazakii, sees Fig. 5.
Fig. 5: the melting temperature (Tm) peak value of the chimeric fluorescent PCR testing sample of certain powdered milk sample fluorescence dye DNA cloning product
The peak value of many curves among the figure overlaps, and the meaning of representative is respectively:
1. the melting temperature (Tm) of reporter plasmid amplified fragments
2. E.sakazakii melting temperature (Tm) secondary peak
3. E.sakazakii melting temperature (Tm) main peak
Reporter plasmid has also produced the fluorescence result in the PCR process in the negative control, sees Fig. 6.
Fig. 6: the fluorescence signal intensity of the chimeric fluorescent PCR reporter plasmid of fluorescence dye in certain powdered milk sample
The fluorescence intensity signals of the curve representative among the figure is:
1. the negative control that the reporter plasmid no sample is only arranged.
Its melting temperature (Tm) meets the plasmid characteristic, sees Fig. 7.
Fig. 7: the melting temperature (Tm) of the curve representative in certain powdered milk sample among the melting temperature (Tm) peak value figure of the chimeric fluorescent PCR reporter plasmid of fluorescence dye amplified production is:
1. the melting temperature (Tm) of reporter plasmid amplified fragments
Above-mentioned experiment shows, contains E.sakazakii in the sample.
After 2 days, prove that the purpose bacterium colony of being checked 98% is E.sakazakii, one of them bacterial strain called after gq105 by conventional microorganism culturing and biochemistry detection.The chimeric PCR assay of fluorescence dye is consistent with the biochemistry detection result.
Sample: 5 kinds and the nearer bacterial classification of E.sakazakii sibship in the enterobacteriaceae are cultivated, and bacterial strain uses therefor is intestinal bacteria, enterobacter cloacae, enteroaerogen, Citrobacter freundii and hafnia alvei.
1.DNA extracting
Get enrichment liquid 1mL and in ice bath, left standstill 5 minutes, at room temperature 12000 rev/mins then, centrifugal 5 minutes, abandon supernatant liquor, add 100 μ L lysozyme solns, 37 ℃ of insulations 10 minutes are added TE damping fluid 500 μ L, the vibration mixing.Add with the saturated phenol of volume Tris (pH8.0), strong vibration, 12000 rev/mins centrifugal 3 minutes, get supernatant liquor, repeat the phenol extracting.Get supernatant liquor, add the sodium acetate (2mol/L) of 0.1 times of volume, mixing, add isopyknic ice ethanol again, stand at low temperature is 30 minutes behind the mixing, 12000 rev/mins, centrifugal 5 minutes, abandon supernatant, add 70% cold washing with alcohol once, following 12000 rev/mins of room temperature, centrifugal 5 minutes, abandon supernatant, add 50 μ L TE solution, put-20 ℃ of preservations.
2. the fluorescent PCR amplification is respectively by two kinds of approach report fluorescent signals
(1) by excision enzyme probe approach report fluorescent signal, each component composition is as follows in its PCR reaction system:
Constituent concentration application of sample amount
2 times of 12.5 μ L of PCR system premixture
Probe method the primer sequence 1 10 μ mol/L 0.5 μ L
Probe method the primer sequence 2 10 μ mol/L 0.5 μ L
The used probe sequence 13 μ mol/L of probe method 1 μ L
The used probe sequence 23 μ mol/L of probe method 1 μ L
Distilled water 7.5 μ L
The pcr amplification program:
(1) 95 ℃ 10 seconds
(2) 95 ℃ 5 seconds
(3) 62 ℃ 20 seconds
(4) got back to for (2) step, repeat 45 times.
Carry out 5 pipe PCR experiments altogether, wherein the DNA sample is respectively: intestinal bacteria, enterobacter cloacae, enteroaerogen, Citrobacter freundii and hafnia alvei.The fluorescent PCR collection of illustrative plates that detected sample is carried out shows, does not produce FAM fluorescence, the results are shown in Figure 8.
Fig. 8: the FAM fluorescence signal intensity of non-E.sakazakii DNA in excision enzyme fluorescence probe PCR
The FAM fluorescence intensity signals of the curve representative among the figure is: five fluorescent signals that coincide together are 0 curve.But all near 35 circulations, produced the HEX fluorescence of reporter plasmid, the results are shown in Figure 9.
Fig. 9: the HEX fluorescence signal intensity of non-E.sakazakii DNA in excision enzyme fluorescence probe PCR
The HEX fluorescence intensity signals of the curve representative among the figure is: five approximate HEX fluorescence intensity signals that reporter plasmid produced that overlap, proving in institute's test sample product does not have E.sakazakii.Experiment shows, detects by excision enzyme fluorescence probe PCR, can not produce the E.sakazakii positive signal to these five kinds of bacteriums.
(2) by the chimeric PCR reaction of fluorescence dye report fluorescent signal, the PCR reaction system is as follows:
Constituent concentration application of sample amount
2 times of 12.5 μ L of PCR system premixture
The chimeric method the primer of fluorescence sequence 1 10 μ mol/L 0.5 μ L
The chimeric method the primer of fluorescence sequence 2 10 μ mol/L 0.5 μ L
Distilled water 9.5 μ L
The melting temperature (Tm) program of amplification program and mensuration amplified fragments in the PCR method:
(1) 95 ℃ 10 seconds
(2) 95 ℃ 5 seconds
(3) 62 ℃ 20 seconds
(4) got back to for (2) step, repeat 45 times.
(5) 95 ℃ 2 minutes
(6) gradient increased temperature is 55 ℃ to 95 ℃, rises 1 ℃ in per 25 seconds.
Carry out 6 pipe PCR experiments altogether, wherein the DNA sample is respectively intestinal bacteria; Escherichia coli O 157 H7; Enterobacter cloacae; Enteroaerogen; Citrobacter freundii; Hafnia alvei.Detected sample carried out the fluorescent PCR collection of illustrative plates is observed and melting curve is observed, the result shows, can observe in the fluorescent PCR process that reporter plasmid produces HEX fluorescence in each negative bacterium in the PCR process, the results are shown in Figure 10.
Figure 10: the fluorescence signal intensity of non-E.sakazakii DNA in the chimeric PCR of fluorescence dye
The fluorescence intensity signals of the curve representative among the figure is: the fluorescent signal overlapping curve that reporter plasmid produced in each negative bacterium experiment.But melting temperature (Tm) meets the plasmid characteristic, sees Figure 11.
Figure 11: in the chimeric PCR of fluorescence dye, the increase melting temperature (Tm) of reporter plasmid amplified fragments of non-E.sakazakii DNA
The curve representative is the melting temperature (Tm) of reporter plasmid amplified fragments among the figure.Experiment shows that chimeric PCR detects by fluorescence dye, can not produce the E.sakazakii positive signal to these five kinds of bacteriums.
Sequence list
SEQUENCE?LISTING
<110〉Tianjin Exit-Entrance Check and Guarantine Bureau
<120〉method of utilization fluorescent PCR technology for detection E.sakazakii
<130>041122
<160>8
<170>PatentIn?version?3.1
<210>1
<211>21
<212>DNA
<213〉synthetic
<220>
<221>primer_bind
<222>(1)..(21)
<223>
<400>1
ccggaacaag?ctgaaaattc?t 21
<210>2
<211>19
<212>DNA
<213〉synthetic
<220>
<221>primer_bind
<222>(1)..(19)
<223>
<400>2
gtcttcgtgc?tgcgattac 19
<210>3
<211>22
<212>DNA
<213〉synthetic
<220>
<221>misc_structure
<222>(1)..(22)
<223>
<400>3
actctgacac?cgcgcattcc?tg 22
<210>4
<211>24
<212>DNA
<213〉synthetic
<220>
<221>misc_structure
<222>(1)..(24)
<223>
<400>4
cctttggcgt?ttcccgatgt?ccgt 24
<210>5
<211>82
<212>DNA
<213〉synthetic
<220>
<221>misc_difference
<222>(1)..(82)
<223>
<400>5
ggagggattg?cagcgtgttt?ttaatgaggt?catcacggga?tcccatgtgc?gtgacggaca 60
tcgggaaacg?ccaaaggaga?tt 82
<210>6
<211>20
<212>DNA
<213〉synthetic
<220>
<221>misc_difference
<222>(1)..(20)
<223>
<400>6
gggttgtctg?cgaatcgctt 20
<210>7
<211>20
<212>DNA
<213〉synthetic
<220>
<221>misc_difference
<222>(1)..(20)
<223>
<400>7
gggttgtctg?cgaatcgctt 20
<210>8
<211>60
<212>DNA
<213〉synthetic
<220>
<221>misc_structure
<222>(1)..(60)
<223>
<400>8
tccgttcttc?ttcgtcataa?cttaatgttt?ttatttaaaa?taccctctga?aaagaaagga 60
Claims (9)
1. use the method for fluorescent PCR technology for detection E.sakazakii, it is characterized in that, one of fluorescent PCR technology is to detect the method (abbreviation probe method) of E.sakazakii by the fluorescent signal that the reaction of excision enzyme probe PCR is sent, and the primer of its use, probe sequence and reporter plasmid extension increasing sequence are as follows:
Primer:
Probe method primer sequence 1:CCGGAACAAGCTGAAAATTCT
Probe method primer sequence 2:GTCTTCGTGCTGCGATTAC
Probe:
Probe method probe sequence 1:ACTCTGACACCGCGCATTCCTG
Probe method probe sequence 2:CCTTTGGCGTTTCCCGATGTCCGT
Probe method reporter plasmid extension increasing sequence: GGAGGGATTGCAGCGTGTTTTTAATGAGGTCATCACGG
GATCCCATGTGCGTGACGGACATCGGGAAACGCCAAAGGAGATT
2. the method for utilization fluorescent PCR technology for detection E.sakazakii according to claim 1, it is characterized in that, also comprise derive out by above-mentioned 5 oligonucleotide sequences, difference is not more than the oligonucleotide sequence of 8 bases and the antisense complementary sequence of each sequence, or their variant, or their partial sequence.
3. the method for utilization fluorescent PCR technology for detection E.sakazakii according to claim 1 is characterized in that, each component composition is as follows in the PCR reaction system:
Constituent concentration application of sample amount
2 times of 12.5 μ L of PCR system premixture
Probe method primer sequence 1 10 μ mol/L 0.5 μ L
Probe method primer sequence 2 10 μ mol/L 0.5 μ L
Probe method probe sequence 13 μ mol/L 1 μ L
Probe method probe sequence 23 μ mol/L 1 μ L
DNA sample 1 μ L
Reporter plasmid 10
3Individual/μ L 1 μ L
Distilled water 7.5 μ L
Cumulative volume 25 μ L
4. the method for utilization fluorescent PCR technology for detection E.sakazakii according to claim 1 is characterized in that amplification program is in the PCR method
(1) 95 ℃ 10 seconds
(2) 95 ℃ 5 seconds
(3) 62 ℃ 20 seconds
(4) got back to for (2) step, repeat 45 times.
5. use the method for fluorescent PCR technology for detection E.sakazakii, it is characterized in that, two of fluorescent PCR technology is to detect the method (being called for short the chimeric method of fluorescence) of E.sakazakii by the fluorescent signal that is sent in the chimeric PCR reaction of detection fluorescence dye, and its primer sequence and reporter plasmid extension increasing sequence are as follows:
The chimeric method primer sequence of fluorescence 1:GGGTTGTCTGCGAATCGCTT
The chimeric method primer sequence of fluorescence 2:GTCTTCGTGCTGCGTCAAAC
The chimeric method reporter plasmid of fluorescence extension increasing sequence: TCCGTTCTTCTTCGTCATAACTTAATGTTTTTAT
TTAAAATACCCTCTGAAAAGAAAGGA
6. the method for utilization fluorescent PCR technology for detection E.sakazakii according to claim 5, it is characterized in that, also comprise derive out by above-mentioned 3 oligonucleotide sequences, difference is not more than the oligonucleotide sequence of 8 bases and the antisense complementary sequence of each sequence, or their variant, or their partial sequence.
7. the method for utilization fluorescent PCR technology for detection E.sakazakii according to claim 5 is characterized in that, each component composition is as follows in the PCR reaction system:
Constituent concentration application of sample amount
2 times of 12.5 μ L of PCR system premixture
The chimeric method primer sequence of fluorescence 1:10 μ mol/L 0.5 μ L
The chimeric method primer sequence of fluorescence 2:10 μ mol/L 0.5 μ L
DNA sample 1 μ L
Reporter plasmid 10
3Individual/μ L 1 μ L
Distilled water 9.5 μ L
Cumulative volume 25 μ L
8. the method for utilization fluorescent PCR technology for detection E.sakazakii according to claim 5 is characterized in that, the melting temperature (Tm) program of amplification program and mensuration amplified fragments is in the PCR method:
(1) 95 ℃ 10 seconds
(2) 95 ℃ 5 seconds
A certain temperature between (3) 58 ℃ to 65 ℃ 20 seconds
(4) got back to for (2) step, repeat 45 times.
(5) 95 ℃ 2 minutes
(6) gradient increased temperature is 55 ℃ to 95 ℃, rises 1 ℃ in per 25 seconds.
9. the method for utilization fluorescent PCR technology for detection E.sakazakii according to claim 8 is characterized in that, the melting temperature (Tm) program of amplification program and mensuration amplified fragments is in the PCR method:
(1) 95 ℃ 10 seconds
(2) 95 ℃ 5 seconds
(3) 62 ℃ 20 seconds
(4) 95 ℃ 5 seconds, repeat 45 times
(5) 95 ℃ 2 minutes
(6) gradient increased temperature is 55 ℃ to 95 ℃, rises 1 ℃ in per 25 seconds.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNB2004100728528A CN1281763C (en) | 2004-11-22 | 2004-11-22 | Process for detecting Enterobacter sakazakii by employing fluorescence PCR technology |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNB2004100728528A CN1281763C (en) | 2004-11-22 | 2004-11-22 | Process for detecting Enterobacter sakazakii by employing fluorescence PCR technology |
Publications (2)
Publication Number | Publication Date |
---|---|
CN1635156A true CN1635156A (en) | 2005-07-06 |
CN1281763C CN1281763C (en) | 2006-10-25 |
Family
ID=34846793
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CNB2004100728528A Expired - Fee Related CN1281763C (en) | 2004-11-22 | 2004-11-22 | Process for detecting Enterobacter sakazakii by employing fluorescence PCR technology |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN1281763C (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101368204B (en) * | 2008-09-16 | 2011-08-31 | 中国计量学院 | Fast detection primer and reagent kit for enterobacter sakazakii hymenial veil mediated isothermality amplification technique |
CN103484557A (en) * | 2013-10-15 | 2014-01-01 | 上海市计量测试技术研究院 | Plasmid standard molecule applicable to real-time fluorescence quantification PCR (Polymerase Chain Reaction) detection of enterobacter sakazakii |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101419169B (en) * | 2008-01-11 | 2010-11-10 | 华南农业大学 | Method for identifying bentgrass nematode by real time fluorescent PCR technology |
-
2004
- 2004-11-22 CN CNB2004100728528A patent/CN1281763C/en not_active Expired - Fee Related
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101368204B (en) * | 2008-09-16 | 2011-08-31 | 中国计量学院 | Fast detection primer and reagent kit for enterobacter sakazakii hymenial veil mediated isothermality amplification technique |
CN103484557A (en) * | 2013-10-15 | 2014-01-01 | 上海市计量测试技术研究院 | Plasmid standard molecule applicable to real-time fluorescence quantification PCR (Polymerase Chain Reaction) detection of enterobacter sakazakii |
Also Published As
Publication number | Publication date |
---|---|
CN1281763C (en) | 2006-10-25 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN1711357A (en) | One step real-time RT PCR kits for the universal detection of organisms in industrial products | |
CN1840693A (en) | Method for detecting drug resistant gene of gramnegative bacterium and its special chip and kit | |
CN1798851A (en) | Detection of herpes simplex virus types 1 and 2 by nucleic acid amplification | |
CN1718742A (en) | Nucleic acid hybrid film strip and reagent box used for diagnosing beta mediterranean sea thalassemia | |
CN1303216C (en) | Multiplex PCR primer set for human glucokinase gene amplification | |
CN1304599C (en) | Medicine and bacterium resistant detection chip, method for preparation and application thereof | |
CN101054603A (en) | Method for quick determination of cytokeratin 19 (CK19) and primers and probes therefore | |
CN1828299A (en) | Nucleotide sequence, reagent kit and checking method for detecting fowl influenza virus | |
CN1635159A (en) | M.tuberculosis drug resistant gene detection reagent kit and process for preparation | |
CN1281763C (en) | Process for detecting Enterobacter sakazakii by employing fluorescence PCR technology | |
CN1745177A (en) | Method for the detection of pathogenic gram positive bacteria selected from the genera staphylococcus, enterococcus and streptococcus | |
CN1680593A (en) | Norovirus detection reagent | |
CN1205340C (en) | Transgenic agricultural product detection kit | |
CN1537954A (en) | Expressing genetic analysis method and probe reagent box for expressing genetic analysng | |
CN1693473A (en) | Method of prepairing peltoglucose syrup and high temperature resistant glucose isomerase mutant | |
CN1274850C (en) | Turbot reddish body iridovirus virus polymerase chain reaction detection method | |
CN1944677A (en) | Method for identifying Chinese cabbage variety and inspecting seed purity by using SCAR marker | |
CN1247796C (en) | Quantitative measuring transgene component in transgene rapeseed and processed product | |
CN100351395C (en) | Norwalk virus expression detecting kit and its special primer and probe | |
CN1670220A (en) | Primer and probe series for real time fluorescent RT-PCR detection of bird flu of H7 subtype | |
CN1754001A (en) | Method of detecting chlamydia trachomatis and kit therefor | |
CN1174104C (en) | Artificial sequence template primer collection and its use | |
CN1664112A (en) | Method for detecting Enterobacter sakazakii by using polymerase chain reaction technology | |
CN1772903A (en) | New-type froctosan saccharase gene and its use | |
CN1514022A (en) | Detection of main pathogenic microorganism in medicine |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
C19 | Lapse of patent right due to non-payment of the annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee | ||
C17 | Cessation of patent right | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20061025 |