CN1664112A - Method for detecting Enterobacter sakazakii by using polymerase chain reaction technology - Google Patents
Method for detecting Enterobacter sakazakii by using polymerase chain reaction technology Download PDFInfo
- Publication number
- CN1664112A CN1664112A CN200410072707XA CN200410072707A CN1664112A CN 1664112 A CN1664112 A CN 1664112A CN 200410072707X A CN200410072707X A CN 200410072707XA CN 200410072707 A CN200410072707 A CN 200410072707A CN 1664112 A CN1664112 A CN 1664112A
- Authority
- CN
- China
- Prior art keywords
- sequence
- sakazakii
- pcr
- dna
- seconds
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for detecting Enterobacter sakazakii by applying PCR technique, belonging to bacteria control check technique, particularly the technique for detecting pathogenic bacteria by applying PCR. The technical project is to take advantage of newly found special DNA sequence in Enterobacter sakazakii, design special primer using method of bioinformation, augmenting bacteria target gene with PCR directly from sample. The invention comprises newly found special DNA sequence in Enterobacter sakazakii and four piece of oligonucleotide sequence of PCR primer designed and sifted from the said DNA sequence above and the mating PCR reaction condition. The invention solves the problem of standard method for detecting Enterobacter sakazakii from food and clinical exemplar. The invention is characterized in that it augments the bacteria target gene by using the method of PCR, which saves the sifting process in bacterial culture and saves time; it is immune to the influence of culture condition and the physiologic status of bacteria, and is more accurate than the physiological and biochemistry determination method.
Description
Technical field
The present invention relates to a kind of bacteriologic test technology, specifically use PCR to react and detect malignant bacteria, particularly the technology of E.sakazakii.
Background technology
E.sakazakii (Enterobacter sakazakii) is a gram negative bacterium, belongs to the enterobacteriaceae enterobacter.Before being named as E.sakazakii in 1980, this bacterium is called as product yellow pigment enterobacter cloacae.It is rarely found clinically pathogenic bacteria, its meningitis that causes, septicemia, necrotizing enterocolitis all have report in worldwide, and the trend of being on the increase is arranged, and most of cases occur in the infant, and the course of disease is short, and case fatality rate can reach 80% sometimes.Though the contagium of E.sakazakii is not really clear, infant formula powder has played the effect of communication media.2002 No. 120 bulletin of State General Administration for Quality Supervision's issue on November 26th, 2002, its inspection declaration that to the effect that suspends the formula milk of some lot number of handling the production of U.S. Wyeth is open to the custom and relevant inspection and quarantine formality, the related products of import exercised supervision destroy, reason is that FDA Food and Drug Administration (FDA) detects E.sakazakii in the said products.
China does not still have the food neutralization to detect the standard method of E.sakazakii clinically at present, and the E.sakazakii of U.S. FDA in August, 2002 issue separates method of counting, has still continued to use " three pipes " enrichment and has detected E.sakazakii.Its weak point is to need to detect object bacteria through before increasing the classical method of inspection such as bacterium, separation and Culture, biochemical identification, and not only test period is long, and sensitivity and specificity are all relatively low.
Summary of the invention
At above-mentioned situation, the present invention has overcome shortcoming of the prior art, provides a kind of utilization round pcr to detect the method for E.sakazakii (Enterobacter sakazakii).The present invention includes with newfound E.sakazakii specific specificity dna sequence dna, its sequence is as follows:
Sequence one:
CACCATGGGTAGTGGGTTGCAAAAGAAGTAGGTAGCTTAACCTTCGGGAGGGCGCTTACCACTTTGTGATTCATGACTGGGGTGAAGTCGTAACAAGGTAACCGTAGGGGAACCTGCGGTTGGATCACCTCCTTACCTGCAAGATACAACCCCGCGTGCTCACACACATTGTCTGATAGAAAGTAAAGAAGCAAAACCTCTACAGGCTTGTAGCTCAGGTGGTTAGAGCGCACCCCTGATAAGGGTGAGGTCGGTGGTTCAAGTCCACTCAGGCCTACCAACTCCGCAGGAGTTGAAGAGGTTTAACTACGATGGGGCTATAGCTCAGCTGGGAGAGCGCCTGCTTTGCACGCAGGAGGTCTGCGGTTCGATCCCGCATAGCTCCACCATCACTTCGGAGTGTACTCAGTGAGTATACTGCGAAGTATTTGCTCTTTAACAATCCGGAACAAGCTGAAAATTGAAACAGACACGCTGCTGTATTTCTCCGTAATCAGGAATGCGCGGTGTGTCAGAGTCTCTCAAACTCGCAGCACGAAGACTTCTTCGGGTTGTGAGGTTAAGCGAACAAGCGTACACGGTGGATGCCCTGGCAGTCAGAGGCGATGAAGGACGTGCTAATCTGCGAAAAGCGCCGGTAAGGTGATATGAACCGTTATAACCGGCGATTTCCGAACGGGGGGTACCCAA
Sequence two:
GGAGTGGGTTGCAAAAGAAGTAGGTAGCTTAACCTTCGGGAGGGCGCTTACCACTTTGTGATTCATGACTGGGGTGAAGTCGTAACAAGGTAACCGTAGGGGAACCTGCGGTTGGATCACCTCCTTACCTGCAAGATACAACCTCGCGTGCTCACACAGATTGTCTGATAGAAAGTAAAGAAGCAGGGTTGTCTGCGAAAGCGAAGTCCCTTTCGTCTAGAGGCCCAGGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGAATCCCCTAAGGGACGCCACCTGCTGGTAATGAGTGAAAGGCGTTACCGATTAATATCTCAAAACTGACTGTAAAGTCACGTTTGAGATATTTGCTCTTTAACAATCCGGAACAAGCTGAAAATTGAAACAGACACGCTGCTGCATTTCTCCGTAATAAGGAATGCGCGGTGTGTCAGAGTCTCTCAAACTCGCAGCACGAAGACTTCTTCGGGTTGTGAGGTTAAGCGAACAAGCGTACACGGTGGATGCCCTGGCAGTCAGAGGCGATGAAGGACGTGCTAATCTGCGAAAAGCGCCGGTAAGGTGATATGAACCGTTATAACCGGCGATTTCCGAACGGGGGGACCCAAA
The present invention also comprises four specific oligonucleotide primers of designed screening, and its sequence is as follows:
First pair of primer:
Sequence one: GCAGGAGTTGAAGACCAAAT
Sequence two: GTGCTGCGAGTTTGAGTCTGAG
Second pair of primer:
Sequence three: GGGTTGTCTGCGAATCGCTT
Sequence four: GTCTTCGTGCTGCGTCAAAC
And derive out by above-mentioned four primers, difference is not more than the oligonucleotide sequence of 8 bases and the antisense complementary sequence of each sequence, or their variant, or their partial sequence.
Also comprise supporting with it PCR reaction conditions.The present invention has filled up the blank that detects E.sakazakii by DNA analysis.
The present invention is achieved by the following technical solutions:
(1) 16s and the intergenic dna fragmentation of 23s rRNA of amplification E.sakazakii carry out nucleotide sequencing;
(2) design specific oligonucleotide primer is used for PCR and detects;
(3) with this oligonucleotide sequence as primer, be template with the E.sakazakii genomic dna, carry out the specific amplification of target DNA fragment;
(4) amplified production carries out electrophoresis with 0.8% sepharose, uses ethidium bromide staining then;
(5) electrophoresis result is observed under uv analyzer, can find E.sakazakii is carried out the dna fragmentation that specific amplification produces, increase and to obtain the specific fragment of 250bp with sequence one, sequence two, can obtain the specific fragment of 280bp with sequence three, sequence four amplifications.
The present invention produces specific fragment with the Auele Specific Primer of E.sakazakii dna sequence dna by PCR method, does not all find false positive results in tested 30 kinds of other malignant bacterias of the same race or not of the same race.
Among the present invention in the PCR reaction system each component composition as follows:
Constituent concentration application of sample amount
10 times of 5 μ L of PCR damping fluid
MgCl
2 20mmol/L 5μL
Taq archaeal dna polymerase 5u/ μ L 0.3 μ L
Primer sequence one 10 μ mol/L 2 μ L
Primer sequence 2 10 μ mol/L 2 μ L
Every kind of 10mmol/L of dNTPs 0.5 μ L
DNA sample 2 μ L
Distilled water 33.2 μ L
Cumulative volume 50 μ L
Amplification program is in the PCR method
(1) 95 ℃ 10 minutes
(2) 95 ℃ 30 seconds
A certain specified temp between (3) 50 ℃ to 61 ℃ 20 seconds
(4) 72 ℃ 30 seconds
(5) 95 ℃ 30 seconds, repeat 25 times
(6) 72 ℃ 2 minutes.
The method of inspection of its PCR product is as follows:
(1) amplified production is carried out using ethidium bromide staining behind the electrophoresis with 0.8% sepharose.
(2) electrophoresis result is observed under uv analyzer, can find E.sakazakii is carried out the dna fragmentation that specific amplification produces.
Compared with prior art, the invention has the beneficial effects as follows: be applicable to directly from clinical samples such as patient's mycetome liquid, food and body fluid culture with the PCR method target DNA that increases based on the authentication method of DNA, thereby detect E.sakazakii.PCR method have detect accurately, the characteristics of high specificity, can identify special target bacteria quickly and accurately.With the method amplification bacterium target gene of PCR, avoided cultivating repeatedly, save time; The PCR authentication method is not subjected to the influence of culture condition and bacterium physiological status, and is more accurate than the Physiology and biochemistry authentication method.
Description of drawings
The pcr amplification product of Fig. 1 import brand infant formula powder
The pcr amplification product of Fig. 2 brand outlet fish powder
The pcr amplification product of Fig. 3 brand milk powder
The control experiment of Fig. 4 E.sakazakii and other bacterium
Embodiment
Below in conjunction with accompanying drawing and embodiment the present invention is described in further detail.
Sample: certain import brand infant formula powder.Detect the doubtful bacterium colony of E.sakazakii with conventional physiology, biochemical method, carry out following PCR method then and detect:
1.DNA extracting
Get enrichment liquid 1mL and in ice bath, left standstill 5 minutes, at room temperature 12000 rev/mins then, centrifugal 5 minutes, abandon supernatant liquor, add 100 μ L lysozyme solns, 37 ℃ of insulations 10 minutes are added TE damping fluid 500 μ L, the vibration mixing.Add with the saturated phenol of volume Tris (pH8.0), strong vibration, 12000 rev/mins, centrifugal 3 minutes, get supernatant liquor, repeat the phenol extracting.Get supernatant liquor, add the sodium acetate (2mol/L) of 0.1 times of volume, mixing, add isopyknic ice ethanol again, stand at low temperature is 30 minutes behind the mixing, 12000 rev/mins, centrifugal 5 minutes, abandon supernatant, add 70% cold washing with alcohol once, following 12000 rev/mins of room temperature, centrifugal 5 minutes, abandon supernatant, add 50 μ L TE solution, put-20 ℃ of preservations.
2.PCR amplification
(1) PCR reaction mixture composition
Constituent concentration application of sample amount
10 times of 5 μ L of PCR damping fluid
MgCl
2 20mmol/L 5μL
Taq archaeal dna polymerase 5u/ μ L 0.3 μ L
Primer sequence one 10 μ mol/L 2 μ L
Primer sequence 2 10 μ mol/L 2 μ L
Every kind of 10mmol/L of dNTPs 0.5 μ L
DNA sample 2 μ L
Distilled water 33.2 μ L
Cumulative volume 50 μ L
(2) amplification program in the PCR method
(1) 95 ℃ 10 minutes
(2) 95 ℃ 30 seconds
(3) 51 ℃ 20 seconds
(4) 72 ℃ 30 seconds
(5) 95 ℃ 30 seconds, repeat 29 times
(6) 72 ℃ 2 minutes.
3. detected sample purpose pcr amplification and electrophoresis check
The PCR product carries out using ethidium bromide staining behind the electrophoresis with 1.5% sepharose.Electrophoresis result is observed under uv analyzer, can find E.sakazakii is carried out the dna fragmentation that specific amplification produces, and be the specific fragment that primer amplification can obtain 250bp wherein with sequence one and sequence two, result such as Fig. 1.
Each swimming lane among Fig. 1 is respectively:
1. E.sakazakii reference culture ATCC12868;
2. E.sakazakii reference culture ATCC29004;
3. E.sakazakii reference culture ATCC29544;
4. molecular weight standard;
5. testing sample fps3;
6. negative control;
Experiment shows and contains E.sakazakii in the sample.
After 2 days, prove that the purpose bacterium colony of being checked 98% is E.sakazakii, one of them bacterial strain called after fps3 by conventional microorganism culturing and biochemistry detection.The PCR assay is consistent with the biochemistry detection result.
Embodiment 2
Sample: certain brand outlet fish powder, detect the doubtful bacterium colony of E.sakazakii with conventional physiology, biochemical method, carry out PCR method then and detect:
1.DNA extracting
Get enrichment liquid 1mL and in ice bath, left standstill 5 minutes, at room temperature 12000 rev/mins then, centrifugal 5 minutes, abandon supernatant liquor, add 100 μ L lysozyme solns, 37 ℃ of insulations 10 minutes are added TE damping fluid 500 μ L, the vibration mixing.Add with the saturated phenol of volume Tris (pH8.0), strong vibration, 12000 rev/mins, centrifugal 3 minutes, get supernatant liquor, repeat the phenol extracting.Get supernatant liquor, add the sodium acetate (2mol/L) of 0.1 times of volume, mixing, add isopyknic ice ethanol again, stand at low temperature is 30 minutes behind the mixing, 12000 rev/mins, centrifugal 5 minutes, abandon supernatant, add 70% cold washing with alcohol once, following 12000 rev/mins of room temperature, centrifugal 5 minutes, abandon supernatant, add 50 μ L TE solution, put-20 ℃ of preservations.
2.PCR amplification
(1) PCR reaction mixture composition
Constituent concentration application of sample amount
10 times of 5 μ L of PCR damping fluid
MgCl
2 20mmol/L 5μL
Taq archaeal dna polymerase 5u/ μ L 0.3 μ L
Primer sequence 3 10 μ mol/L 2 μ L
Primer sequence 4 10 μ mol/L 2 μ L
Every kind of 10mmol/L of dNTPs 0.5 μ L
DNA sample 2 μ L
Distilled water 33.2 μ L
Cumulative volume 50 μ L
(2) amplification program in the PCR method
(1) 95 ℃ 10 minutes
(2) 95 ℃ 30 seconds
(3) 57 ℃ 20 seconds
(4) 72 ℃ 30 seconds
(5) 95 ℃ 30 seconds, repeat 25 times
(6) 72 ℃ 2 minutes.
3. the pcr amplification of detected sample and electrophoresis check
The PCR product is carried out using ethidium bromide staining behind the electrophoresis at 1.5% sepharose.Electrophoresis result is observed under uv analyzer, can find E.sakazakii is carried out the dna fragmentation that specific amplification produces, and be the specific DNA fragment that primer amplification can obtain 280bp wherein with sequence three and sequence four, result such as Fig. 2.
Each swimming lane is respectively among Fig. 2:
1. E.sakazakii reference culture ATCC12868;
2. E.sakazakii reference culture ATCC29004;
3. E.sakazakii reference culture ATCC29544;
4. molecular weight standard;
5. testing sample fs3;
6. negative control;
Experiment shows and contains E.sakazakii in the sample.
After 2 days, prove that the purpose bacterium colony of being checked 98% is E.sakazakii, one of them bacterial strain called after fs3 by conventional microorganism culturing and biochemistry detection.The PCR assay is consistent with the biochemistry detection result.
Embodiment 3
Sample: certain brand milk powder, detect the doubtful bacterium colony of E.sakazakii with conventional physiology, biochemical method primary dcreening operation, carry out PCR method then and detect:
1.DNA extracting
Get enrichment liquid 1mL and in ice bath, left standstill 5 minutes, at room temperature 12000 rev/mins then, centrifugal 5 minutes, abandon supernatant liquor, add 100 μ L lysozyme solns, 37 ℃ of insulations 10 minutes are added TE damping fluid 500 μ L, the vibration mixing.Add with the saturated phenol of volume Tris (pH8.0), strong vibration, 12000 rev/mins, centrifugal 3 minutes, get supernatant liquor, repeat the phenol extracting.Get supernatant liquor, add the sodium acetate (2mol/L) of 0.1 times of volume, mixing, add isopyknic ice ethanol again, stand at low temperature is 30 minutes behind the mixing, 12000 rev/mins, centrifugal 5 minutes, abandon supernatant, add 70% cold washing with alcohol once, following 12000 rev/mins of room temperature, centrifugal 5 minutes, abandon supernatant, add 50 μ L TE solution, put-20 ℃ of preservations.
2.PCR amplification
(1) PCR reaction mixture composition
Constituent concentration application of sample amount
10 times of 5 μ L of PCR damping fluid
MgCl
2 20mmol/L 5μL
Taq archaeal dna polymerase 5u/ μ L 0.3 μ L
Primer sequence 3 10 μ mol/L 2 μ L
Primer sequence 4 10 μ mol/L 2 μ L
Every kind of 10mmol/L of dNTPs 0.5 μ L
DNA sample 2 μ L
Distilled water 33.2 μ L
Cumulative volume 50 μ L
(2) amplification program in the PCR method
(1) 95 ℃ 10 minutes
(2) 95 ℃ 30 seconds
(3) 61 ℃ 20 seconds
(4) 72 ℃ 30 seconds
(5) 95 ℃ 30 seconds, repeat 25 times
(6) 72 ℃ 2 minutes.
3. the pcr amplification of detected sample and electrophoresis check
The PCR product is carried out using ethidium bromide staining behind the electrophoresis at 0.8% sepharose.Electrophoresis result is observed under uv analyzer, does not find E.sakazakii is carried out the dna fragmentation that specific amplification produces, result such as Fig. 3.
Each swimming lane among Fig. 3 is respectively:
1. E.sakazakii reference culture ATCC12868;
2. E.sakazakii reference culture ATCC29004;
3. E.sakazakii reference culture ATCC29544;
4. molecular weight standard;
5. testing sample dot1;
6. negative control;
Show and do not contain E.sakazakii in the sample.
After 2 days, show through conventional microorganism culturing and biochemistry detection, the purpose bacterium colony of checking 100% be reunion enterobacteria, one of them bacterial strain called after dot1.This negative findings that shows the PCR check is believable.
Embodiment 4
Sample: E.sakazakii reference culture ATCC12868, E.sakazakii reference culture ATCC29004, E.sakazakii reference culture ATCC29544, E.sakazakii wild strain fps3, E.sakazakii wild strain fs3, E.sakazakii wild strain ds1, E.sakazakii wild strain dps6; The negative control bacterium is enteroaerogen, reunion enterobacteria, enterobacter cloacae, the inferior Salmonella of honeycomb Hough Buddhist nun, proteus vulgaris, Proteus mirabilis, bacillus ceylonensis A, Salmonella enteritidis, vibrio fluvialis, Vibrio parahaemolyticus, intestinal bacteria and Escherichia coli O 157 H7 strain.
Template DNA extracts, and pcr amplification method and primer, and the electrophoresis observation of PCR product are with embodiment 3.The result shows that all E.sakazakii bacterial strains can both amplify the dna fragmentation of 280bp, but not the E.sakazakii bacterial strain all can not amplify the dna fragmentation of 280bp.See Fig. 4.
Each swimming lane among Fig. 4 is respectively:
1. molecular weight standard;
2. negative control;
3. enteroaerogen;
4. reunion enterobacteria;
5. enterobacter cloacae;
6. the inferior Salmonella of honeycomb Hough Buddhist nun;
7. proteus vulgaris;
8. Proteus mirabilis;
9. bacillus ceylonensis A;
10. Salmonella enteritidis;
11. vibrio fluvialis;
12. molecular weight standard;
13. Vibrio parahaemolyticus;
14. E.sakazakii reference culture ATCC12868;
15. E.sakazakii reference culture ATCC29004;
16. E.sakazakii reference culture ATCC29544;
17. E.sakazakii wild strain fps3;
18. E.sakazakii wild strain fs3;
19. E.sakazakii wild strain ds1;
20. E.sakazakii wild strain dps6;
21. intestinal bacteria;
22. Escherichia coli O 157 H7 strain;
It is reliable that above result's proof is carried out E.sakazakii PCR goal gene TRAP assay with the present invention.
Sequence list
SEQUENCE?LISTING
＜110〉Nankai University
＜120〉the utilization round pcr detects the method for E.sakazakii
<130>041016
<160>6
<170>PatentIn?version?3.2
<210>1
<211>690
<212>DNA
＜213〉E.sakazakii
<220>
<221>rRNA
<222>(1)..(690)
<400>1
caccatgggt?agtgggttgc?aaaagaagta?ggtagcttaa?ccttcgggag?ggcgcttacc 60
actttgtgat?tcatgactgg?ggtgaagtcg?taacaaggta?accgtagggg?aacctgcggt 120
tggatcacct?ccttacctgc?aagatacaac?cccgcgtgct?cacacacatt?gtctgataga 180
aagtaaagaa?gcaaaacctc?tacaggcttg?tagctcaggt?ggttagagcg?cacccctgat 240
aagggtgagg?tcggtggttc?aagtccactc?aggcctacca?actccgcagg?agttgaagag 300
gtttaactac?gatggggcta?tagctcagct?gggagagcgc?ctgctttgca?cgcaggaggt 360
ctgcggttcg?atcccgcata?gctccaccat?cacttcggag?tgtactcagt?gagtatactg 420
cgaagtattt?gctctttaac?aatccggaac?aagctgaaaa?ttgaaacaga?cacgctgctg 480
tatttctccg?taatcaggaa?tgcgcggtgt?gtcagagtct?ctcaaactcg?cagcacgaag 540
acttcttcgg?gttgtgaggt?taagcgaaca?agcgtacacg?gtggatgccc?tggcagtcag 600
aggcgatgaa?ggacgtgcta?atctgcgaaa?agcgccggta?aggtgatatg?aaccgttata 660
accggcgatt?tccgaacggg?gggtacccaa 690
<210>2
<211>615
<212>DNA
＜213〉E.sakazakii
<220>
<221>rRNA
<222>(1)..(615)
<400>2
ggagtgggtt?gcaaaagaag?taggtagctt?aaccttcggg?agggcgctta?ccactttgtg 60
attcatgact?ggggtgaagt?cgtaacaagg?taaccgtagg?ggaacctgcg?gttggatcac 120
ctccttacct?gcaagataca?acctcgcgtg?ctcacacaga?ttgtctgata?gaaagtaaag 180
aagcagggtt?gtctgcgaaa?gcgaagtccc?tttcgtctag?aggcccagga?caccgccctt 240
tcacggcggt?aacaggggtt?cgaatcccct?aagggacgcc?acctgctggt?aatgagtgaa 300
aggcgttacc?gattaatatc?tcaaaactga?ctgtaaagtc?acgtttgaga?tatttgctct 360
ttaacaatcc?ggaacaagct?gaaaattgaa?acagacacgc?tgctgcattt?ctccgtaata 420
aggaatgcgc?ggtgtgtcag?agtctctcaa?actcgcagca?cgaagacttc?ttcgggttgt 480
gaggttaagc?gaacaagcgt?acacggtgga?tgccctggca?gtcagaggcg?atgaaggacg 540
tgctaatctg?cgaaaagcgc?cggtaaggtg?atatgaaccg?ttataaccgg?cgatttccga 600
acggggggac?ccaaa 615
<210>3
<211>20
<212>DNA
＜213〉synthetic
<220>
<221>primer_bind
<222>(1)..(20)
<400>3
gcaggagttg?aagaccaaat 20
<210>4
<211>22
<212>DNA
＜213〉synthetic
<220>
<221>primer_bind
<222>(1)..(22)
<400>4
gtgctgcgag?tttgagtctg?ag 22
<210>5
<211>20
<212>DNA
＜213〉synthetic
<220>
<221>primer_bind
<222>(1)..(20)
<400>5
gggttgtctg?cgaatcgctt 20
<210>6
<211>20
<212>DNA
＜213〉synthetic
<220>
<221>primer_bind
<222>(1)..(20)
<400>6
gtcttcgtgc?tgcgtcaaac 20
Claims (9)
1. a method of using round pcr to detect E.sakazakii is characterized in that, amplify with round pcr two to comprise the peculiar dna sequence dna of E.sakazakii as follows:
Sequence one:
CACCATGGGTAGTGGGTTGCAAAAGAAGTAGGTAGCTTAACCTTCGGGAGGGCG
CTTACCACTTTGTGATTCATGACTGGGGTGAAGTCGTAACAAGGTAACCGTAGGGGAAC
CTGCGGTTGGATCACCTCCTTACCTGCAAGATACAACCCCGCGTGCTCACACACATTGTC
TGATAGAAAGTAAAGAAGCAAAACCTCTACAGGCTTGTAGCTCAGGTGGTTAGAGCGC
ACCCCTGATAAGGGTGAGGTCGGTGGTTCAAGTCCACTCAGGCCTACCAACTCCGCAGG
AGTTGAAGAGGTTTAACTACGATGGGGCTATAGCTCAGCTGGGAGAGCGCCTGCTTTGC
ACGCAGGAGGTCTGCGGTTCGATCCCGCATAGCTCCACCATCACTTCGGAGTGTACTCA
GTGAGTATACTGCGAAGTATTTGCTCTTTAACAATCCGGAACAAGCTGAAAATTGAAAC
AGACACGCTGCTGTATTTCTCCGTAATCAGGAATGCGCGGTGTGTCAGAGTCTCTCAAA
CTCGCAGCACGAAGACTTCTTCGGGTTGTGAGGTTAAGCGAACAAGCGTACACGGTGG
ATGCCCTGGCAGTCAGAGGCGATGAAGGACGTGCTAATCTGCGAAAAGCGCCGGTAAG
GTGATATGAACCGTTATAACCGGCGATTTCCGAACGGGGGGTACCCAA
Sequence two:
GGAGTGGGTTGCAAAAGAAGTAGGTAGCTTAACCTTCGGGAGGGCGCTTACCACT
TTGTGATTCATGACTGGGGTGAAGTCGTAACAAGGTAACCGTAGGGGAACCTGCGGTTG
GATCACCTCCTTACCTGCAAGATACAACCTCGCGTGCTCACACAGATTGTCTGATAGAAA
GTAAAGAAGCAGGGTTGTCTGCGAAAGCGAAGTCCCTTTCGTCTAGAGGCCCAGGACA
CCGCCCTTTCACGGCGGTAACAGGGGTTCGAATCCCCTAAGGGACGCCACCTGCTGGTA
ATGAGTGAAAGGCGTTACCGATTAATATCTCAAAACTGACTGTAAAGTCACGTTTGAGAT
ATTTGCTCTTTAACAATCCGGAACAAGCTGAAAATTGAAACAGACACGCTGCTGCATTT
CTCCGTAATAAGGAATGCGCGGTGTGTCAGAGTCTCTCAAACTCGCAGCACGAAGACTT
CTTCGGGTTGTGAGGTTAAGCGAACAAGCGTACACGGTGGATGCCCTGGCAGTCAGAG
GCGATGAAGGACGTGCTAATCTGCGAAAAGCGCCGGTAAGGTGATATGAACCGTTATAA
CCGGCGATTTCCGAACGGGGGGACCCAAA
2. utilization round pcr according to claim 1 detects the method for E.sakazakii, it is characterized in that, two E.sakazakii dna sequence dnas that amplify with round pcr, therefrom choose any peculiar sequence of E.sakazakii bacterial classification that is, also comprise derive out by above-mentioned sequence, difference is not more than the oligonucleotide sequence of 8 bases and the antisense complementary sequence of each sequence, or their variant, or their partial sequence.
3. utilization round pcr according to claim 1 detects the method for E.sakazakii, it is characterized in that this method may further comprise the steps:
(1) 16s and the intergenic dna fragmentation of 23srRNA of amplification E.sakazakii carry out nucleotide sequencing;
(2) design specific oligonucleotide primer is used for PCR and detects;
(3) with this oligonucleotide sequence as primer, be template with the E.sakazakii genomic dna, carry out the specific amplification of target DNA fragment;
(4) amplified production carries out electrophoresis with 0.8% sepharose, uses ethidium bromide staining then;
(5) electrophoresis result is observed under uv analyzer, can find E.sakazakii is carried out the dna fragmentation that specific amplification produces.
4. utilization round pcr according to claim 3 detects the method for E.sakazakii, it is characterized in that designed specific oligonucleotide primer sequence is as follows:
First pair of primer:
Sequence one: GCAGGAGTTGAAGACCAAAT
Sequence two: GTGCTGCGAGTTTGAGTCTGAG
Second pair of primer:
Sequence three: GGGTTGTCTGCGAATCGCTT
Sequence four: GTCTTCGTGCTGCGTCAAAC
5. the specific oligonucleotide primer sequence designed according to claim 4, it is characterized in that, also comprise derive out by above-mentioned four primers, difference is not more than the oligonucleotide sequence of 8 bases and the antisense complementary sequence of each sequence, or their variant, or their partial sequence.
6. utilization round pcr according to claim 3 detects the method for E.sakazakii, it is characterized in that each component composition is as follows in the PCR reaction system:
Constituent concentration application of sample amount
10 times of 5 μ L of PCR damping fluid
MgCl
2 20mmol/L 5μL
Taq archaeal dna polymerase 5u/ μ L 0.3 μ L
Primer sequence one 10 μ mol/L 2 μ L
Primer sequence 2 10 μ mol/L 2 μ L
Every kind of 10mmol/L of dNTPs 0.5 μ L
DNA sample 2 μ L
Distilled water 33.2 μ L
Cumulative volume 50 μ L
7. utilization round pcr according to claim 3 detects the method for E.sakazakii, it is characterized in that amplification program is in the PCR method:
(1) 95 ℃ 10 minutes
(2) 95 ℃ 30 seconds
A certain temperature between (3) 50 ℃ to 61 ℃ 20 seconds
(4) 72 ℃ 30 seconds
(5) 95 ℃ 30 seconds, repeat 25 times
(6) 72 ℃ 2 minutes
8. utilization round pcr according to claim 7 detects the method for E.sakazakii, it is characterized in that amplification program is in the PCR method:
(1) 95 ℃ 10 minutes
(2) 95 ℃ 30 seconds
(3) 57 ℃ 20 seconds
(4) 72 ℃ 30 seconds
(5) 95 ℃ 30 seconds, repeat 25 times
(6) 72 ℃ 2 minutes
9. utilization round pcr according to claim 3 detects the method for E.sakazakii, it is characterized in that its PCR product fluorescent inspection method is as follows:
(1) amplified production is carried out using ethidium bromide staining behind the electrophoresis with 0.8% sepharose.
(2) electrophoresis result is observed under uv analyzer, can find E.sakazakii is carried out the dna fragmentation that specific amplification produces.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB200410072707XA CN1316039C (en) | 2004-11-11 | 2004-11-11 | Method for detecting Enterobacter sakazakii by using polymerase chain reaction technology |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB200410072707XA CN1316039C (en) | 2004-11-11 | 2004-11-11 | Method for detecting Enterobacter sakazakii by using polymerase chain reaction technology |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1664112A true CN1664112A (en) | 2005-09-07 |
| CN1316039C CN1316039C (en) | 2007-05-16 |
Family
ID=35035422
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB200410072707XA Expired - Fee Related CN1316039C (en) | 2004-11-11 | 2004-11-11 | Method for detecting Enterobacter sakazakii by using polymerase chain reaction technology |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1316039C (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101368204B (en) * | 2008-09-16 | 2011-08-31 | 中国计量学院 | Fast detection primer and reagent kit for enterobacter sakazakii hymenial veil mediated isothermality amplification technique |
| CN102816761A (en) * | 2012-08-28 | 2012-12-12 | 无锡中德伯尔生物技术有限公司 | Highly specific gene fragment of Cronobacter spp. and its application |
| CN103497964A (en) * | 2013-10-15 | 2014-01-08 | 上海市计量测试技术研究院 | Plasmid standard molecular adaptable to sakazakii real-time fluorescent quantitation PCR (polymerase chain reaction) detection |
| CN107385102A (en) * | 2017-09-18 | 2017-11-24 | 北京勤邦生物技术有限公司 | Enterobacter sakazakii kit for detecting nucleic acid and its application |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1268668A (en) * | 1999-03-29 | 2000-10-04 | 许仁爱 | Blank card for microbial detection and its microbial detection test culture medium card |
| DE19945916A1 (en) * | 1999-09-24 | 2001-04-05 | Biotecon Diagnostics Gmbh | Nucleic acid molecules for the detection of bacteria and phylogenetic units of bacteria |
| WO2003014704A2 (en) * | 2001-08-08 | 2003-02-20 | Qualicon Inc. | Rapid and specific detection of campylobacter |
-
2004
- 2004-11-11 CN CNB200410072707XA patent/CN1316039C/en not_active Expired - Fee Related
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101368204B (en) * | 2008-09-16 | 2011-08-31 | 中国计量学院 | Fast detection primer and reagent kit for enterobacter sakazakii hymenial veil mediated isothermality amplification technique |
| CN102816761A (en) * | 2012-08-28 | 2012-12-12 | 无锡中德伯尔生物技术有限公司 | Highly specific gene fragment of Cronobacter spp. and its application |
| CN102816761B (en) * | 2012-08-28 | 2016-04-20 | 无锡中德伯尔生物技术有限公司 | The high specific gene fragment of Enterobacter sakazakii and application thereof |
| CN103497964A (en) * | 2013-10-15 | 2014-01-08 | 上海市计量测试技术研究院 | Plasmid standard molecular adaptable to sakazakii real-time fluorescent quantitation PCR (polymerase chain reaction) detection |
| CN107385102A (en) * | 2017-09-18 | 2017-11-24 | 北京勤邦生物技术有限公司 | Enterobacter sakazakii kit for detecting nucleic acid and its application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1316039C (en) | 2007-05-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1286989C (en) | Biochip for detecting pathogenesis fungus | |
| CN1711357A (en) | One step real-time RT PCR kits for the universal detection of organisms in industrial products | |
| CN1840693A (en) | Method for detecting drug resistant gene of gramnegative bacterium and its special chip and kit | |
| CN1717495A (en) | Method for universal detection of micro-organisms and reaction medium therefor | |
| CN1877328A (en) | Method for detecting aquatic animal pathogenic bacteria by using 23S ribosome gene probe array | |
| CN1612932A (en) | Nucleic acid detection method and system thereof | |
| CN1724689A (en) | Strain specificity PCR detection method of heredity modified corn strain MON863 | |
| CN1304599C (en) | Medicine and bacterium resistant detection chip, method for preparation and application thereof | |
| CN1720335A (en) | Multiplex assay detection of pathogenic organisms | |
| CN1664112A (en) | Method for detecting Enterobacter sakazakii by using polymerase chain reaction technology | |
| CN1292077C (en) | Nucleic acid primers of acid fast bacterium and method of identifying acid fast bacterium | |
| CN1852992A (en) | Primer for detecting alicyclobacillus | |
| CN1215177C (en) | Gene chip used for identifying pathogenic bacteria in blood and its making method | |
| CN1724686A (en) | Target sequence used for detecting mycoplasma pnoumoniae and reagent box | |
| CN1680593A (en) | Norovirus detection reagent | |
| CN1280429C (en) | Process for detecting Enterobacter sakazakii by employing molecular hybridization and enzyme-link coloration technology | |
| CN1195850C (en) | Genes for detecting bacteria and detection method by using the same | |
| CN1754001A (en) | Method of detecting chlamydia trachomatis and kit therefor | |
| CN1281763C (en) | Process for detecting Enterobacter sakazakii by employing fluorescence PCR technology | |
| CN100351395C (en) | Norwalk virus expression detecting kit and its special primer and probe | |
| CN1247796C (en) | Quantitative measuring transgene component in transgene rapeseed and processed product | |
| CN101074449A (en) | Gene chip for analyzing microbial group structure and function under acid environment | |
| CN1904064A (en) | Star shaped nocardia multiple PCR fast detection kit and detection method | |
| CN1514022A (en) | Detection of main pathogenic microorganism in medicine | |
| CN1877327A (en) | Method for detecting aquatic animal pathogenic bacteria by using ribosome interoperonic region probe |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C57 | Notification of unclear or unknown address | ||
| DD01 | Delivery of document by public notice |
Addressee: Jie Songfan Document name: Deemed not to advise |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C19 | Lapse of patent right due to non-payment of the annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |