CN1514022A - Detection of main pathogenic microorganism in medicine - Google Patents
Detection of main pathogenic microorganism in medicine Download PDFInfo
- Publication number
- CN1514022A CN1514022A CNA031376444A CN03137644A CN1514022A CN 1514022 A CN1514022 A CN 1514022A CN A031376444 A CNA031376444 A CN A031376444A CN 03137644 A CN03137644 A CN 03137644A CN 1514022 A CN1514022 A CN 1514022A
- Authority
- CN
- China
- Prior art keywords
- primer
- seq
- dna
- specific probe
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A process for detecting the main pathogenic microbes from medicine, such as staphylococcus aureus, Escherichia coil, salmonella, etc. features that the PCR is used to specifically amplify the particulare gene fragments of main pathogenic microbes. The probe and DNA chip for detecting the PCR products and the reagent kit containing said DNA chip are also disclosed.
Description
Technical field
The present invention relates to a kind of method of utilizing main pathogenic microbes in the technology for detection medicine of polymerase chain reaction (PCR), relate to a kind of special genes fragment of utilizing polymerase chain reaction (PCR) amplification specific amplification main pathogenic microbes especially and detect the method for main pathogenic microbes in the medicine and be used for the primer of PCR, and the test kit that relates to the probe that is used to detect the PCR product and DNA chip and comprise this DNA chip.
Background technology
The microbiology of medicine must meet the Chinese Pharmacopoeia specified standards, and this is very important for drugmaker and each medicine inspection institute.At present, the detection of The main pathogenic fungi all is to adopt traditional microorganism detection method in the medicine, and the applicant does not find to adopt gene chip to detect the method for The main pathogenic fungi as yet.China, US and European pharmacopeia are all stipulated, must not contain The main pathogenic fungi in medicine.So with regard to medicine particularly with regard to the pollution problem of some Chinese herbal product, the method that can detect clostridium tetani fast is for the generation that reduces the medicine waste product and avoid waste and be very important; Relevant medicine inspection department then can utilize the susceptibility of these class methods and specificity to guarantee national drug safety.At present, the detection of pathogenic bacteria mostly is to adopt traditional microorganism detection method in the medicine.
In existing microorganism detection technology, the detection of pathogenic bacteria mainly is culture method, biochemical reaction, serological method and a fluorescent method etc. of utilizing microorganism.For example disclose the method for measuring then of employing yolk culturing bacterium among the JP62-115296A, SU825627B discloses and has under anaerobic cultivated the clostridial method of measuring in the nutritious prod.RU2084521C discloses and has a kind ofly separated with nutrient media and detect clostridial method with starch, and this method can be used for controlling milk products processing.US6228574B discloses a kind of based on spore germination, for example clostridial method of rapid detection and definite analyte.In addition, fluorescent method is meant by microorganism cells dyeing or mark are produced the method that fluorescence detects, and for example, discloses the method for microorganism that adopts in the bioluminescent reagents mensuration humoral sample in JP11-169194.
Yet, well-known, time-consuming, the consumption power of these traditional methods, and be prone to wrong qualification result.Along with molecular biological develop rapidly, the evaluation of pathogenic micro-organism no longer is confined on the formalness structure and routine inspection such as physiological property to it, but study biomacromolecule from the molecular biology level, particularly nucleic acid construct and integral part thereof.On this basis in numerous detection techniques of Jian Liing, polymerase chain (Polymerase chainreaction, PCR) with its sensitivity, special, easy, characteristics progressively are applied to the detection of pathogenic bacteria fast.(polymerase chain reaction PCR) is the fast method that is used in external enzymatic amplification specific DNA fragments in the polymerase chain reaction.The DNA cloning of denier can be amplified millions of times by this method, be used for DNA detection and then greatly improved sensitivity, can measure the level of each cell a part DNA in theory.In addition, the DNA chip technology of PCR-based reaction with its have sensitivity, characteristics special, easy, quick and that can detect multiple pathogenic bacteria gene simultaneously are subjected to paying close attention to widely.The DNA chip technology is to carry out the acid sequence analysis by the making nucleic acid molecular hybridization principle, i.e. the pairing of the nucleic acid probe base by known array on the chip comes the check and analysis unknown nucleotide sequence, i.e. sequencing by hybridization (SBH).Because photoetching technique has very high resolving power, can on upholder, synthesize highdensity oligonucleotide probe array by design requirements, this probe array might sequence set be become by the institute of the oligonucleotide of certain-length, and the sequence of the oligonucleotide of each position all is known in the probe array, sequence to be analyzed that mark is crossed and the probe array on the chip are hybridized, the control reaction conditions, show very strong hybridization signal with the complete complementary probe of target sequence, utilize the high resolution detection device to detect hybridization signal, handle through Computer Analysis, can detect whether there is target sequence.
General introduction of the present invention
The present invention relates in the The main pathogenic fungi primer of specific amplification dna fragmentation on the gene.Therefore, these primers can be used for detecting The main pathogenic fungi.
In specific embodiments, the present invention designs following sequence fragment.
Streptococcus aureus
1, the primer of called after SAU-1, nucleotides sequence is classified as:
5’CCAGATGAGTTGCACAAATCG3’(SEQ?ID?NO.1)
2, the primer of called after SAU-2, nucleotides sequence is classified as:
5’CACCAAATAGTGACGAGTTA3’(SEQ?ID?NO.2)
Salmonella
3, the primer of called after SAl-1, nucleotides sequence is classified as:
5’GGCGAGCAGTTTGTCTGTC3’(SEQ?ID?NO.3)
4, the primer of called after SAl-3, nucleotides sequence is classified as:
5’GTTTCGCCTGGCTGATACG3’(SEQ?ID?NO.4)
Shigella
5, the primer of called after Shi-1, nucleotides sequence is classified as:
5’CAACACTGGATGATCTCAG3’(SEQ?ID?NO.5)
6, the primer of called after Shi-2, nucleotides sequence is classified as:
5’CCCCCTCAACTGCTAATA3’(SEQ?ID?NO.6)
7, the primer of called after Shi-3, nucleotides sequence is classified as:
5’TGTATCACAGATATGGCATGC3’(SEQ?ID?NO.7)
8, the primer of called after Shi-4, nucleotides sequence is classified as:
5’TCCGGAGATTGTTCCATGTG3’(SEQ?ID?NO.8)
Escherichia coli
9, the primer of called after Eco-1, nucleotides sequence is classified as:
5’ATTAACCCTCACTAAAG3’(SEQ?ID?NO.9)
10, the primer of called after Eco-2, a nucleotide sequence is:
5’CGATGAAGAACGCAGCG3’(SEQ?ID?NO.10)
Pseudomonas aeruginosa
11, the primer of called after Pae-1, nucleotides sequence is classified as:
5’GCTTCATTGATTTTAGCGGAAC?3’(SEQ?ID?NO.11)
The discriminating viable bacteria is used primer with dead bacterium
12, the primer of called after Lv-16SrR-1, nucleotides sequence is classified as:
5’GCCGCCAGTGTGCTGGAATT3’(SEQ?ID?NO.12)
13, the primer of called after Lv-16SrR-2, nucleotides sequence is classified as:
5’TAGATGCATGCTCGAGCGGC3’(SEQ?ID?NO.13)
An importance of the present invention is the method that is used for the sample of pcr amplification.After the streptococcus aureus, escherichia coli, salmonella, shigella, Pseudomonas aeruginosa cracking of energy for growth arranged, the DNA that discharges from cell can be used as the suitable template of pcr amplification.Judge by the gene fragment of size in 126-539 base pair scope whether occurring whether it exists.This fragment can by the gel electrophoresis of the agar pool and with the DNA standard molecular weight relatively come to be judged or utilize gene chip to judge to contain the The main pathogenic fungi of target sequence whether to exist.
Detailed description of the present invention
The present invention at first relates to the method for streptococcus aureus, escherichia coli, salmonella, shigella and Pseudomonas aeruginosa in the contaminated medicine of rapid detection of being used for.Nucleotide primer by PCR streptococcus aureus, escherichia coli, salmonella, shigella, Pseudomonas aeruginosa amplifies and the irrelevant gene of other kinds.Since need be in experiment matrix culturing bacterium, so reduced the required time of bacterial detection, these factors make this method can be used for on-the-spot the detection.
This method is based on the base complementrity of DNA.Two antiparallel strands that DNA is made up of Nucleotide " base " constitute.These bases comprise VITAMIN B4, guanine, cytosine(Cyt), thymus pyrimidine, form distinctive hydrogen bond mutually.VITAMIN B4 and thymus pyrimidine pairing and guanine and cytosine(Cyt) paired dna double chain can be by alkaline purification or heating the method sex change or be transformed into strand.When condition is suitable, DNA will form two strands again.The polymerase chain reaction is the PCR method is but that the target dna section is diffused into the normally used method of detection level.Recently it is used to detect many pathogenetic bacterias.In this process, the dna primer that comprises distinguished sequence with the two side areas complementary of target area guides the enzymatic of DNA synthetic by a kind of archaeal dna polymerase.Archaeal dna polymerase requires primer to start the synthetic of complementary dna chain.Primer is nucleotide fragments (18 base).In the PCR process, in annealing steps, control bootup process by temperature.The annealing conditions of primer is determined according to test, so that improve specificity.After the annealing, polymerization takes place when polysaccharase synthesizes complementary dna chain.After the polymerization, the PCR reactant is heated to and makes the double-stranded DNA sex change.By the archaeal dna polymerase that uses thermostability anneal, the circulation repeatedly of polymerization, sex change can guarantee this enzyme non-inactivation.Pcr amplification is to use the routine test method of automatic heat circulating equipment.The result can make the amplification doubly of target dna fragment index.The purpose fragment of amplification can detect by agargel electrophoresis, and maybe purpose fragment and the DNA chip with amplification reacts then and detect.
On the other hand, the invention provides the following primer that the medicine The main pathogenic fungi detects that is used for, wherein be used for streptococcus aureus:
1, the primer of called after SAU-1 (A), nucleotides sequence is classified as:
5’CCAGATGAGTTGCACAAATCG3’(SEQ?ID?NO.1)
2, the primer of called after SAU-2 (B), nucleotides sequence is classified as:
5’CACCAAATAGTGACGAGTTA3’(SEQ?ID?NO.2)
Be used to detect salmonella:
3, the primer of called after SAl-1 (C), nucleotides sequence is classified as:
5’GGCGAGCAGTTTGTCTGTC3’(SEQ?ID?NO.3)
4, the primer of called after SAl-3 (D), nucleotides sequence is classified as:
5’GTTTCGCCTGGCTGATACG3’(SEQ?ID?NO.4)
Be used to detect shigella:
5, the primer of called after Shi-1 (E), nucleotides sequence is classified as:
5’CAACACTGGATGATCTCAG3’(SEQ?ID?NO：5)
6, the primer of called after Shi-2 (F), nucleotides sequence is classified as:
5’CCCCCTCAACTGCTAATA3’(SEQ?ID?NO.6)
7, the primer of called after Shi-3 (G), nucleotides sequence is classified as:
5’TGTATCACAGATATGGCATGC3’(SEQ?ID?NO.7)
8, the primer of called after Shi-4 (H), nucleotides sequence is classified as:
5’TCCGGAGATTGTTCCATGTG3’(SEQ?ID?NO.8)
Be used to detect escherichia coli:
9, the primer of called after Eco-1 (I), nucleotides sequence is classified as:
5’ATTAACCCTCACTAAAG3’(SEQ?ID?NO.9)
10, the primer of called after Eco-2 (J), a nucleotide sequence is:
5’CGATGAAGAACGCAGCG3’(SEQ?ID?NO.10)
Be used to detect Pseudomonas aeruginosa:
11, the primer of called after Pae-1 (K), nucleotides sequence is classified as:
5’GCTTCATTGATTTTAGCGGAAC3’(SEQ?ID?NO.11)
Be used to differentiate the primer that viable bacteria and dead bacterium are used:
12, the primer of called after Lv-16SrR-1, nucleotides sequence is classified as:
5’GCCGCCAGTGTGCTGGAATT3’(SEQ?ID?NO.12)
13, the primer of called after Lv-16SrR-2, nucleotides sequence is classified as:
5’TAGATGCATGCTCGAGCGGC3’(SEQ?ID?NO.13)
14, the primer of called after Lv-16sRNA (M), nucleotides sequence is classified as:
5’GATTAGAGTTTGATCATGGC3’
And detection clostridial:
15, the forward primer of called after TTC-1 (N), nucleotides sequence is classified as:
5’TTTTTAGACCTAACAACC?3’
16, the reverse primer of called after TTC-2 (O), nucleotides sequence is classified as:
5’TTAATCATTTGTCCATCC?3’
In addition, because dead bacterium does not generally influence the safety of medicine and food, detect whether the bacterium that exists in the checking matter is viable bacteria so introduce the 16sRNA probe primer.Detection side's ratio juris is that therefore the very fast degraded of its RNA after the bacterium death can not carry out DNA cloning by transcriptive process,reversed because the transformation period of the RNA of bacterium is very short.Above-described primer is to obtain by a large amount of streptococcus aureuses, escherichia coli, salmonella, shigella, the contrast of Pseudomonas aeruginosa dna sequence dna, and the nucleotide sequence comparison software has been illustrated the high conservative region of gene.Select specific primer point and synthetic suitable primer from these zones.Decide the optimal sequence of primer by repetition test.And primer is last determines to follow following standard:
From the streptococcus aureus of identifying, escherichia coli, salmonella, shigella, Pseudomonas aeruginosa, amplify above-mentioned DNA product.
II. false single from streptococcus aureus, escherichia coli, salmonella, shigella and the verdigris identified
Other bacterial classification beyond the born of the same parents bacterium can not produce the purpose product.
III. from the isolated unidentified streptococcus aureus of drug sample, escherichia coli, salmonella,
Amplify the purpose product in shigella and the Pseudomonas aeruginosa.
Streptococcus aureus, escherichia coli, salmonella, shigella and Pseudomonas aeruginosa are measured the ability that forms the purpose product by standard method.Culture was placed 10 minutes for 80 ℃, was coated in subsequently on the growth medium, and the bacterium that can survive through Overheating Treatment has spore-bearing ability.Table 1 has been summarized the data that are used for the primer character tested at a series of different strains cultures.This primer can streptococcus aureus, amplify 126 respectively on escherichia coli, salmonella, shigella and the Pseudomonas aeruginosa
-The fragment of 539 (bp) base pair.
Table 1 has shown the ability of primer amplifying target genes from streptococcus aureus, escherichia coli, salmonella, shigella and Pseudomonas aeruginosa.The bacterium that does not contain goal gene, it can not produce the purpose band.
These primers can be used to screen the DNA that extracts from medicine, detect streptococcus aureus, escherichia coli, salmonella, shigella and Pseudomonas aeruginosa.This method and tradition are coated with plate technique and compare greatly and reduced the turnover time.
The following step makes and detects streptococcus aureus, escherichia coli, salmonella, shigella and Pseudomonas aeruginosa achieving success in the medicine.
(1 ml sample promptly was enough in 45 minutes to add 37 ℃ of placements of equal-volume pancreas beans peptone substratum in the sample
To being used to analyze liquid substance), this make streptococcus aureus, escherichia coli, salmonella,
Shigella and Pseudomonas aeruginosa growth are extracted DNA from these bacterial classifications.
II. boil sample 10 minutes with lysing cell and released dna.
III. the sample of equal portions is generally 5 microlitres, with 20 microliters of water, and PCR pearl (as U.S patent 5,593, described in 824, this paper introduces for referencial use), and the 2 microlitre primer mixtures that contain above-mentioned primer mix.
The IV.PCR thermal cycling is as follows
96 ℃ of sex change 2min; 94 ℃ of sex change 30s, 60 ℃ of renaturation 30s, 72 ℃ are extended 30s, circulate 30 times, and last 72 ℃ are extended 5min.
Sample stores dyestuff and mixes electrophoresis on 2% sepharose on V.PCR reactant and the electrophoresis.
VI. the purpose product is observed in sepharose dyeing.
Some sample may contain the material that disturbs pcr amplification, in this case, sample can be able to be overcome this interference with the dilution that pancreas beans peptone substratum carries out 10 times or 100 times.When detecting any sample, all need positive a few negative control, during electrophoresis the standard molecular weight contrast need be arranged.
Used bacterial strain and the results are shown in Table 1-5 in the test.
Table 1 streptococcus aureus detects with primer (Sau-1+Sau-2) and produces 486bp Nucleotide
The PCR test of bacterial isolates source
Streptococcus aureus ATCC25923 ATCC+
Streptococcus aureus CMCC26001 CMCC+
Streptococcus aureus CMCC26002 CMCC+
Streptococcus aureus CMCC26012 CMCC+
Clostridium tetani CMCC64001 CMCC-
Clostridium botulinum CMCC64402 CMCC-
Bacillus cereus ATCC14579 ATCC-
Subtilis ATCC6051 ATCC-
Bacillus licheniformis ATCC12759 ATCC-
Bacillus sphaericus ATCC4525 ATCC-
Aerogenesis folder film clostridium ATCC-
Staphylococcus epidermidis CMCC26069 CMCC-
Other staphylococcus CMCC26067 CMCC-
Other staphylococcus CMCC26101 CMCC-
Streptococcus pyogenes ATCC19615 ATCC-
Enterococcus faecalis ATCC29212 ATCC-
Enterococcus faecalis ATCC14506 ATCC-
Pseudomonas Pseudomallei CMCC53051 CMCC-
Acinetobacter bauamnnii-
Proteus mirabilis CMCC49003 CMCC-
Pu Luofeidengsi bacterium CMCC42001 CMCC-
Citric acid bacteria CMCC48017 CMCC-
Citric acid bacteria CMCC48019 CMCC-
Klebsiella Pneumoniae CMCC46101 CMCC-
Klebsiella Pneumoniae ATCC13883 ATCC-
CMCC is a Chinese medicine bacterium preservation administrative center; ATCC is a USS type culture collection institute
Table 2 salmonella detects with primer (Sal-1+Sal-2) and produces 539bp Nucleotide
The PCR test of bacterial isolates source
Salmonella typhimurtum CMCC47729 CMCC+
Salmonella typhimurtum CMCC50013 CMCC+
Salmonella enteritidis CMCC50040 CMCC+
Salmonella enteritidis CMCC50041 CMCC+
Salmonella typhi CMCC50038 CMCC+
Salmonella anatis CMCC50083 CMCC+
Salmonella choleraesuis CMCC47649 CMCC+
Salmonella derby CMCC50112 CMCC+
Salmonella dublin CMCC50042 CMCC+
Clostridium tetani CMCC64001 CMCC-
Clostridium botulinum CMCC64402 CMCC-
Bacillus cereus ATCC14579 ATCC-
Subtilis ATCC6051 ATCC-
Bacillus licheniformis ATCC12759 ATCC-
Bacillus sphaericus ATCC4525 ATCC-
Aerogenesis folder film clostridium ATCC-
Staphylococcus epidermidis CMCC26069 CMCC-
Other staphylococcus CMCC26067 CMCC-
Other staphylococcus CMCC26101 CMCC-
Streptococcus pyogenes ATCC19615 ATCC-
Enterococcus faecalis ATCC29212 ATCC-
Enterococcus faecalis ATCC14506 ATCC-
Pseudomonas Pseudomallei CMCC53051 CMCC-
Acinetobacter bauamnnii-
Proteus mirabilis CMCC49003 CMCC-
Pu Luofeidengsi bacterium CMCC42001 CMCC-
Citric acid bacteria CMCC48017 CMCC-
Citric acid bacteria CMCC48019 CMCC-
Klebsiella Pneumoniae CMCC46101 CMCC-
Klebsiella Pneumoniae ATCC13883 ATCC-
CMCC is a Chinese medicine bacterium preservation administrative center; ATCC is a USS type culture collection institute
Table 3 Pseudomonas aeruginosa detects with primer (Pae-1+Pae-2) and produces 435bp Nucleotide
The PCR test of bacterial isolates source
Pseudomonas aeruginosa ATCC27853 ATCC+
Pseudomonas aeruginosa ATCC27313 ATCC+
Pseudomonas aeruginosa CMCC10119 ATCC+
Pseudomonas aeruginosa CMCC10121 CMCC+
Pseudomonas aeruginosa CMCC10101 CMCC+
Clostridium tetani CMCC64001 CMCC-
Clostridium botulinum CMCC64402 CMCC-
Bacillus cereus ATCC14579 ATCC-
Subtilis ATCC6051 ATCC-
Bacillus licheniformis ATCC12759 ATCC-
Bacillus sphaericus ATCC4525 ATCC-
Aerogenesis folder film clostridium ATCC-
Staphylococcus epidermidis CMCC26069 CMCC-
Other staphylococcus CMCC26067 CMCC-
Other staphylococcus CMCC26101 CMCC-
Streptococcus pyogenes ATCC19615 ATCC-
Enterococcus faecalis ATCC29212 ATCC-
Enterococcus faecalis ATCC14506 ATCC-
Pseudomonas Pseudomallei CMCC53051 CMCC-
Acinetobacter bauamnnii-
Proteus mirabilis CMCC49003 CMCC-
Pu Luofeidengsi bacterium CMCC42001 CMCC-
Citric acid bacteria CMCC48019 CMCC-
Klebsiella Pneumoniae CMCC46101 CMCC-
Klebsiella Pneumoniae ATCC13883 ATCC-
CMCC is a Chinese medicine bacterium preservation administrative center; ATCC is a USS type culture collection institute
Table 4 escherichia coli detects with primer (Eco-1+Eco-2) and produces 126bp Nucleotide
The PCR test of bacterial isolates source
Escherichia coli CMCC44101 CMCC+
Escherichia coli CMCC44123 CMCC+
Escherichia coli CMCC44126 CMCC+
Escherichia coli CMCC44134 CMCC+
Escherichia coli CMCC44203 CMCC+
Escherichia coli CMCC44210 CMCC+
Clostridium tetani CMCC64001 CMCC-
Clostridium botulinum CMCC64402 CMCC-
Bacillus cereus ATCC14579 ATCC-
Subtilis ATCC6051 ATCC-
Bacillus licheniformis ATCC12759 ATCC-
Bacillus sphaericus ATCC4525 ATCC-
Aerogenesis folder film clostridium ATCC-
Staphylococcus epidermidis CMCC26069 CMCC-
Other staphylococcus CMCC26067 CMCC-
Other staphylococcus CMCC26101 CMCC-
Streptococcus pyogenes ATCC19615 ATCC-
Enterococcus faecalis ATCC29212 ATCC-
Enterococcus faecalis ATCC14506 ATCC-
Pseudomonas Pseudomallei CMCC53051 CMCC-
Acinetobacter bauamnnii-
Proteus mirabilis CMCC49003 CMCC-
Pu Luofeidengsi bacterium CMCC42001 CMCC-
Citric acid bacteria CMCC48017 CMCC-
Citric acid bacteria CMCC48019 CMCC-
Klebsiella Pneumoniae CMCC46101 CMCC-
Klebsiella Pneumoniae ATCC13883 ATCC-
CMCC is a Chinese medicine bacterium preservation administrative center; ATCC is a USS type culture collection institute
Table 5 shigella detects with primer (Eco-1+Eco-2) and produces 349bp Nucleotide
The PCR test of bacterial isolates source
Shigella flexneri CMCC51061 CMCC+
Shigella boydii CMCC51149 CMCC+
Will Hayes shigella CMCC51054 CMCC+
Song Nei Shi shigella CMCC51081 CMCC+
Bacterium morgani CMCC49086 CMCC+
Clostridium tetani CMCC64001 CMCC-
Clostridium botulinum CMCC64402 CMCC-
Bacillus cereus ATCC14579 ATCC-
Subtilis ATCC6051 ATCC-
Bacillus licheniformis ATCC12759 ATCC-
Bacillus sphaericus ATCC4525 ATCC-
Aerogenesis folder film clostridium ATCC-
Staphylococcus epidermidis CMCC26069 CMCC-
Other staphylococcus CMCC26067 CMCC-
Other staphylococcus CMCC26101 CMCC-
Streptococcus pyogenes ATCC19615 ATCC-
Enterococcus faecalis ATCC29212 ATCC-
Enterococcus faecalis ATCC14506 ATCC-
Pseudomonas Pseudomallei CMCC53051 CMCC-
Acinetobacter bauamnnii-
Proteus mirabilis CMCC49003 CMCC-
Pu Luofeidengsi bacterium CMCC42001 CMCC-
Citric acid bacteria CMCC48017 CMCC-
Citric acid bacteria CMCC48019 CMCC-
Klebsiella Pneumoniae CMCC46101 CMCC-
Klebsiella Pneumoniae ATCC13883 ATCC-
CMCC is a Chinese medicine bacterium preservation administrative center; ATCC is a USS type culture collection institute
In addition, the invention provides the DNA chip (PPDC) of relevant pathogenic bacteria detection special use in a kind of medicine and the method for utilizing this DNA chip detection pathogenic bacteria.The probe array design of DNA chip of the present invention is as follows: in a microscope slide surface, (5mm * 5mm), each site is by shown in Figure 1 with streptococcus aureus Sau-1, Sau-2 to make up 14 regional sites according to Fig. 1; Salmonella SAl-1, SAl-2; Shigella Shi-1, Shi-2, Shi-3, Shi-4; Escherichia coli Eco-1, Eco-1; Pseudomonas aeruginosa Pae-1 and clostridium tetani TTC-1, TTC-2 specific probe series arrangement.Can detect the pathogenic bacteria of regulation in the medicine detection so simultaneously.The point sample area of each probe is about 1.5mm * 1.5mm, and the making processes of described PPDC display is: the mode chart of elder generation's design specialized chip on slide glass.With synthesizing good specificity single-stranded dna probe in advance, be fixed on the specific site by the direct physical contact with micro-sampling pin device.
Wherein streptococcus aureus Sau-1 specific probe is: CATGTATCAGCAATAAAC (SEB gene)
Streptococcus aureus Sau-2 specific probe is: ATTAAGGACAGTAAGTTA (SEBgene)
Salmonella SAl-1 specific probe is: CTCCGCTCATGTATCGA (araC gene)
Salmonella SAl-2 specific probe is: TCTCATCACATCACTAA (araC gene)
Shigella Shi-1 specific probe is: CAACAATTCTTCCCTG (invE gene)
Shigella Shi-2 specific probe is: AAATTTGCCCCC (invE gene)
Shigella Shi-3 specific probe is: CCTAAGCATATTTCTGC (ipaH gene)
Shigella Shi-4 specific probe is: GCCAAAGCTGCCTGCA (i paH gene)
Escherichia coli Eco-1 specific probe is: TTCTCACAGATAACTGTG (uidAgene)
Escherichia coli Eco-2 specific probe is: ATGCGATCTATATCACGC (uidAgene)
Pseudomonas aeruginosa Pae-1 specific probe is: TCTCTTCCGGCAGGCCGAT (rpmH gene)
Viable bacteria detects: CATCACTTGATAGTTTAAAG
Clostridium tetani TTC-1 specific probe is: CAATAATTAGCTCTAT (Tetanustoxin C gene)
Clostridium tetani TTC-2 specific probe is: CTTTTAGGGATTTATC (Tetanustoxin C gene)
Provide a kind of detection PPDC test kit in another aspect of this invention, the consisting of of this PPDC test kit:
5 of chips
10 of hybridization cover glasses
DNTP/PCR primer series mixed solution (primer A, B, C, D, E, F, G, each 10ul
H、I、J、K、M、N、O)
2x hybridization buffer 500ul
In the PPDC test kit with the specific single-stranded dna probe stationary of synthetic streptococcus aureus, escherichia coli, salmonella, shigella, Pseudomonas aeruginosa and clostridium tetani on slide glass, checking matter carries out polymerase chain reaction (PolymeraseChain Reaction) its gene order that increases through special primer, target-gene sequence sex change after the amplification produces the DNA of sub-thread, during amplification by the Cy5 fluorescent-substance markers.The gene order of Cy5 fluorescent-substance markers and solid phase hybridization array.The detected nucleic acid amount that is combined on the probe determines with the amount that its base formation and target-probe mate.Detected nucleic acid can detect the strong and weak and distribution of hybridization signal by laser scanning confocal microscopy, and directly identifies whether to pollute in the checking matter above-mentioned pathogenic bacteria is arranged and identify which kind of pathogenic bacteria it is according to the hybridization signal intensity of every point probe molecule in the display.
Description of drawings:
Accompanying drawing 1 detects DNA chip (PPDC) synoptic diagram for the relevant pathogenic bacteria of medicine;
Accompanying drawing 2 is the electrophoresis picture of A-O primer PCR amplification, and wherein Fig. 1 is followed successively by from left to right: primer (Shi-1+Shi-2) detects Shigella flexneri CMCC51061 and produces the segmental Nucleotide of 349bp; Primer (Pae-1) detects Pseudomonas aeruginosa ATCC27853 and produces the segmental Nucleotide of 435bp; Primer (Eco-1+Eco-2) detects escherichia coli CMCC44101 and produces the segmental Nucleotide of 460bp; Primer (Sau-1+Sau-2) detects streptococcus aureus ATCC25923 and produces the segmental Nucleotide of 486bp; Primer (Sa1-1+Sa1-2) detects Salmonella typhimurtum CMCC47729 and produces 539bp Nucleotide; Primer (TTC-1+TTC-2) detects clostridium tetani CMCC64001 and produces 1536bp Nucleotide; Produce 539bp Nucleotide; The nucleic acid molecular weight object of reference: be 2000bp from top to bottom, 1000bp, 750bp, 500bp, 250bp.
Following is to further describe embodiments of the invention.These embodiment should not be considered to limitation of the present invention.It will be understood by those skilled in the art that in form with detailed content on various changes and without prejudice to the spirit and scope of the invention of in claims, indicating in detail.
Embodiment 1
The processing of medicine to be checked
Drug sample to be measured is added to obtains 1% (W/V) solution in the sterilized water.This solution forms solution or suspension after mixing.Subsequently it is mixed with isopyknic pancreas beans peptone substratum, hatched 45 minutes at 37 ℃.
Embodiment 2
Boiling lysis and pcr amplification
After streptococcus aureus, escherichia coli, salmonella, shigella and the Pseudomonas aeruginosa growth, boiled 10 minutes.The attention test tube will be opened in boiling part.5 microlitre samples join in the PCR assuagement of commercialization pre-preparation.Mixture provides the PCR reaction required reagent.Each final volume is the Tris-HCl (room temperature pH=9.0), the KCl of 50 mmoles, the MgCl2 of 1.5 mmoles, every kind of Nucleotide of 200 mmoles of the Taq archaeal dna polymerase that contains 1.5 units in the PCR reaction of 25 microlitres, 10 mmoles.Sterilized water and TTC primer are added in the PCR reaction system.The concentration of primer is 0.5 mmole.The PCR pipe is placed on and uses program described above to increase on the thermal cycler.
Embodiment 3
The detection of PCR product
Can come whether to exist in the working sample streptococcus aureus, escherichia coli, salmonella, shigella and Pseudomonas aeruginosa by the PCR product that produces in about 126-539 base pair molecular weight ranges.Appearance explanation streptococcus aureus, escherichia coli, salmonella, shigella and Pseudomonas aeruginosa from the PCR product of specific sample detect positive.Following table 6 is depicted as the PCR detection limit of Fel Ursi powder, FUFANG DANSHEN PIAN and three kinds of medicines of Radix Isatidis granules.
PCR detection limit in three kinds of different medicines of table 6
Sample bacterium number/gram medicine PCR result
Streptococcus aureus ATCC25923 culture 1.5 ± 0.7+
Streptococcus aureus CMCC26001 culture 1.4 ± 0.5+
Fel Ursi powder 2.1 ± 1.0+
FUFANG DANSHEN PIAN 1.4 ± 0.7+
Radix Isatidis granules 2.2 ± 1.1+
Pseudomonas aeruginosa ATCC27853 culture 1.3 ± 1.0+
Pseudomonas aeruginosa CMCC10121 culture 1.4 ± 0.8+
Fel Ursi powder 1.9 ± 1.3+
FUFANG DANSHEN PIAN 2.0 ± 1.1+
Radix Isatidis granules 1.8 ± 0.8+
Salmonella typhimurtum CMCC47729 culture 1.7 ± 0.8+
Salmonella enteritidis CMCC50041 culture 1.9 ± 1.0+
Fel Ursi powder 2.7 ± 1.2+
FUFANG DANSHEN PIAN 2.1 ± 1.4+
Radix Isatidis granules 1.6 ± 1.1+
Escherichia coli CMCC44101 culture 1.9 ± 0.7+
Escherichia coli CMCC44123 culture 1.6 ± 0.8+
Fel Ursi powder 1.9 ± 1.2+
FUFANG DANSHEN PIAN 2.3 ± 1.1+
Radix Isatidis granules 2.1 ± 1.2+
Shigella flexneri CMCC51061 culture 2.0 ± 1.1+
Shigella boydii CMCC51149 culture 1.4 ± 0.8+
Will Hayes shigella CMCC51054 culture 2.1 ± 0.9+
Fel Ursi powder 2.0 ± 1.0+
FUFANG DANSHEN PIAN 2.2 ± 0.8+
Radix Isatidis granules 1.8 ± 1.1+
Embodiment 4:
PPDC test kit detecting operation program
Reagent and equipment in the test kit that is not included in the experiment to be adopted: BE damping fluid, TRIS, the PCR test tube that does not conform to Rnase and Dnase, laser laser confocal microscope etc.PPDC test kit detecting operation program is as follows:
1. getting checking matter 1mg or 1ml adds 10ml and increases bacterial context soup and increased bacterium through 6 hours.
2. the centrifuging and taking throw out is got in the serial dNTP/PCR primer of an amount of adding pipe, carries out pcr amplification.
3. the dna sequence dna sex change after the amplification is hybridized with the single-stranded dna probe in the corresponding site of DNA chip in the PPDC test kit.
4. the fluorescent signal in each site in the laser confocal microscope detection arrays is determined the result.
Described although the present invention is directed to specific embodiments, a lot of other forms of the present invention for those skilled in the art and improvement are conspicuous.Additional claim and the present invention should be interpreted as covering all above-mentioned tangible other form and improvement that are included in the purport scope of the present invention usually.
Claims (14)
1, a kind of method that is used for systematically detecting the medicine main pathogenic microbes, this method comprises:
A) use the primer that is selected from main pathogenic microbes from the bacterium total cell dna of medicine to be measured, to go out the part of described main pathogenic microbes DNA by pcr amplification;
B) existence of detection amplified production.
2, the method for claim 1, wherein said main pathogenic microbes are streptococcus aureus, escherichia coli, salmonella, shigella, Pseudomonas aeruginosa.
3, method as claimed in claim 2, wherein streptococcus aureus, escherichia coli, salmonella, shigella, Pseudomonas aeruginosa are aerophil.
4, method as claimed in claim 3, the primer of the wherein said streptococcus aureus DNA that is used to increase
(A) and primer (B) sequence be SEQ ID NO.1 and SEQ ID NO.2; Primer (C) and primer (D) sequence of salmonella DNA of being used to increase is SEQ ID NO.3 and SEQ ID NO.4; Primer (E), primer (F), primer (G) and primer (H) sequence of shigella DNA of being used to increase is SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8; Primer (I) and primer (J) sequence of colon bacillus DNA of being used to increase is SEQ ID NO.9 and SEQ ID NO.10; The primer sequence of Pseudomonas aeruginosa DNA of being used to increase is SEQ ID NO.11 (K).
5, method as claimed in claim 3 is wherein also used the primer of differentiating viable bacteria and dead bacterium.
6, method as claimed in claim 5 differentiates that wherein the sequence of the primer of viable bacteria and dead bacterium is SEQ IDNO.12 and SEQ ID NO.13.
7, as the described method of one of claim 1-7, wherein said amplified reaction can produce the polynucleotide of length in 126-539 Nucleotide scope.
8, as the described method of one of claim 1-6, wherein the detection of amplified production compares by agarose gel electrophoresis and with the DNA standard molecular weight and finishes.
9, as the described method of one of claim 1-6, wherein the detection of amplified production is to hybridize by the dna fragmentation of amplification and the specific probe of DNA chip on the DNA chip, detects with laser confocal microscope then that the hybridization signal intensity of each probe molecule carries out.
10, method according to claim 9, thing to be checked are carried out mark with the Cy5 fluorescein when pcr amplification.
11, method according to claim 9 is characterized in that described specific probe is respectively streptococcus aureus Sau-1 specific probe: CATGTATCAGCAATAAAC (SEB gene); Streptococcus aureus Sau-2 specific probe: ATTAAGGACAGTAAGTTA (SEB gene); Salmonella SAl-1 specific probe: CTCCGCTCATGTATCGA (araC gene); Salmonella SAl-2 specific probe: TCTCATCACATCACTAA (araC gene); Shigella Shi-1 specific probe: CAACAATTCTTCCCTG (invE gene); Shigella Shi-2 specific probe: AAATTTGCCCCC (invE gene); Shigella Shi-3 specific probe: CCTAAGCATATTTCTGC (ipaH gene); Shigella Shi-4 specific probe: GCCAAAGCTGCCTGCA (ipaH gene); Escherichia coli Eco-1 specific probe: TTCTCACAGATAACTGTG (uidA gene); Escherichia coli Eco-2 specific probe: ATGCGATCTATATCACGC (uidA gene); Pseudomonas aeruginosa Pae-1 specific probe: TCTCTTCCGGCAGGCCGAT (rpmH gene); Viable bacteria detects: CATCACTTGATAGTTTAAAG; Clostridium tetani TTC-1 specific probe: CAATAATTAGCTCTAT (Tetanus toxin C gene); Clostridium tetani TTC-2 specific probe: CTTTTAGGGATTTATC (Tetanus toxin C gene).
12, the DNA chip that is used for the described detection method of claim 9, its probe array design is as follows: (5mm * 5mm) is with each site series arrangement streptococcus aureus Sau-1, Sau-2 specific probe to divide two row to make up 14 regional sites in a microscope slide surface; Salmonella SAl-1, SAl-2 specific probe; Shigella Shi-1, Shi-2, Shi-3, Shi-4 specific probe; Escherichia coli Eco-1, Eco-1; Pseudomonas aeruginosa Pae-1 and clostridium tetani TTC-1, TTC-2 specific probe, the point sample area of each probe is about 1.5mm * 1.5mm.
13, according to the DNA chip of claim 12, its synthetic in advance good specificity single-stranded dna probe is to be fixed on the site, described specific region by the contact of micro-sampling pin device direct physical.
14, a kind of PPDC test kit that can be used for the described detection method of claim 9, its composition comprises:
5 of chips
10 of hybridization cover glasses
DNTP/PCR primer series is mixed each 10ul
Close liquid (primer A, B, C,
D、E、F、G、H、I、J、
K、M、N、O)
2x hybridization buffer 500ul
The primer that is used for the pcr amplification of medicine main pathogenic microbes DNA is comprising primer sequence SEQ ID NO.1 and the SEQ ID NO.2 of the streptococcus aureus DNA that is used to increase; Primer sequence SEQ ID NO.3 and the SEQ ID NO.4 of salmonella DNA are used to increase; Primer sequence SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 and the SEQ ID NO.8 of shigella DNA are used to increase; Primer sequence SEQ ID NO.9 and the SEQ ID NO.10 of colon bacillus DNA are used to increase; The primer sequence SEQ ID NO.11 of Pseudomonas aeruginosa DNA is used to increase.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB031376444A CN1296488C (en) | 2003-06-19 | 2003-06-19 | Detection of main pathogenic microorganism in medicine |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB031376444A CN1296488C (en) | 2003-06-19 | 2003-06-19 | Detection of main pathogenic microorganism in medicine |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1514022A true CN1514022A (en) | 2004-07-21 |
| CN1296488C CN1296488C (en) | 2007-01-24 |
Family
ID=34240110
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB031376444A Expired - Lifetime CN1296488C (en) | 2003-06-19 | 2003-06-19 | Detection of main pathogenic microorganism in medicine |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1296488C (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101403001B (en) * | 2008-09-26 | 2011-04-27 | 广州华峰生物科技有限公司 | Rapid diagnosis reagent kit and detection method for pseudomonas aeruginosa gene |
| CN101429539B (en) * | 2007-11-09 | 2011-06-15 | 中山大学达安基因股份有限公司 | Reagent kit for real time fluorescence quantitative PCR detection of bacillus pyocyaneus |
| CN101012478B (en) * | 2003-04-02 | 2011-10-12 | 佳能株式会社 | Infectious pathogen detection probe and probe set, carrier, and genetic detecting method |
| CN106834413A (en) * | 2017-01-20 | 2017-06-13 | 商丘医学高等专科学校 | A kind of medicine Micro biological Tests method |
| CN107190046A (en) * | 2017-05-24 | 2017-09-22 | 中国检验检疫科学研究院 | EHEC proficiency testing sample and preparation method thereof in medicine |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1161060A (en) * | 1994-09-12 | 1997-10-01 | M·G·伯杰龙 | Specific and universal probes and amplification primers to rapidly detect and identify common bacterial pathogens and antibiotic resistance genes from clinical specimens for routine diagnosis Lab. |
| US5994066A (en) * | 1995-09-11 | 1999-11-30 | Infectio Diagnostic, Inc. | Species-specific and universal DNA probes and amplification primers to rapidly detect and identify common bacterial pathogens and associated antibiotic resistance genes from clinical specimens for routine diagnosis in microbiology laboratories |
| CN1232528C (en) * | 2001-11-16 | 2005-12-21 | 晶碁生化科技股份有限公司 | Nucleic acid sequence, method and kit for diagnosis of meningitis pathoogenic bacteria |
-
2003
- 2003-06-19 CN CNB031376444A patent/CN1296488C/en not_active Expired - Lifetime
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101012478B (en) * | 2003-04-02 | 2011-10-12 | 佳能株式会社 | Infectious pathogen detection probe and probe set, carrier, and genetic detecting method |
| CN101429539B (en) * | 2007-11-09 | 2011-06-15 | 中山大学达安基因股份有限公司 | Reagent kit for real time fluorescence quantitative PCR detection of bacillus pyocyaneus |
| CN101403001B (en) * | 2008-09-26 | 2011-04-27 | 广州华峰生物科技有限公司 | Rapid diagnosis reagent kit and detection method for pseudomonas aeruginosa gene |
| CN106834413A (en) * | 2017-01-20 | 2017-06-13 | 商丘医学高等专科学校 | A kind of medicine Micro biological Tests method |
| CN107190046A (en) * | 2017-05-24 | 2017-09-22 | 中国检验检疫科学研究院 | EHEC proficiency testing sample and preparation method thereof in medicine |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1296488C (en) | 2007-01-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1711357A (en) | One step real-time RT PCR kits for the universal detection of organisms in industrial products | |
| CN1451050A (en) | Method for controlling the microbiological guality of an aqueous medium and kit therefor | |
| CN1896284A (en) | Method for identifying allelic gene type | |
| CN1059562A (en) | Reduce the method for carryover contamination in the amplification procedure | |
| CN1850981A (en) | Method for amplifying target nucleic acid sequence by nickase, and kit for amplifying target nucleic acid sequence and its use | |
| CN1863927A (en) | Nucleic acid detection assay | |
| CN1687459A (en) | Authenticating gram positive bacteria species and method for testing drug resistant gene and dedicating kit | |
| CN1415020A (en) | Method of detecting variation and/or polymorphism | |
| CN1491285A (en) | Method of detecting pathogenic microorganism | |
| CN1993482A (en) | Instrument for detecting bacterium, method of detecting bacterium and kit for detecting bacterium | |
| CN1071955A (en) | Mycobacterium primers and probe | |
| CN1840693A (en) | Method for detecting drug resistant gene of gramnegative bacterium and its special chip and kit | |
| CN1876843A (en) | Method of detecting variation or polymorphism | |
| CN1798851A (en) | Detection of herpes simplex virus types 1 and 2 by nucleic acid amplification | |
| CN1304599C (en) | Medicine and bacterium resistant detection chip, method for preparation and application thereof | |
| CN1717495A (en) | Method for universal detection of micro-organisms and reaction medium therefor | |
| CN1661113A (en) | A set of oligonucleotide probe for detecting intestinal hemorrhage type colibacillus and vibrio cholerae | |
| CN101045944A (en) | Gene chip for detecting six kinds of diarrhea pathogens and its prepn process and kit | |
| CN101054603A (en) | Method for quick determination of cytokeratin 19 (CK19) and primers and probes therefore | |
| CN1745177A (en) | Method for the detection of pathogenic gram positive bacteria selected from the genera staphylococcus, enterococcus and streptococcus | |
| CN1514022A (en) | Detection of main pathogenic microorganism in medicine | |
| CN1786197A (en) | Method of detecting bioterror related pathogen bacteria and its special DNA chip | |
| CN1712543A (en) | Quantitative detection of Leber's genetic optic nerve disease | |
| CN1537954A (en) | Expressing genetic analysis method and probe reagent box for expressing genetic analysng | |
| CN1852992A (en) | Primer for detecting alicyclobacillus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CX01 | Expiry of patent term | ||
| CX01 | Expiry of patent term |
Granted publication date: 20070124 |