CN1786197A - Method of detecting bioterror related pathogen bacteria and its special DNA chip - Google Patents

Abstract

The invention discloses a detecting biological terror correlative pathogenic bacteria method and its special DNA chip. The method steps are using table one primer to do PCR amplification for waited sample DNA; hybridizing the gained amplification product with DNA chip; detecting hybrid signal; if the hybrid signal is positive, the sample contains biological terror correlative pathogenic bacteria. The DNA chip includes at least one probe from sequence one to sixteen. It has good application prospect in fighting biological terror field and clinic microorganism detection.

Description

The method of the terrified related diseases indigenous bacteria of a kind of detection of biological and DNA chip dedicated

Technical field

The present invention relates to the method for the terrified related diseases indigenous bacteria of a kind of detection of biological and DNA chip dedicated.

Background technology

After U.S.'s experience " anthrax mail " attack, anti-bio-terrorism has become important component part in the worldwide campaign against terrorism.One of prerequisite that the reply bio-terrorism threatens will be carried out accurate detection for the relevant cause of disease of bio-terrorism exactly.

At present, utilize biochip technology to realize that it is the key areas of domestic and international microbiologist's research that the general detection of bacterium is identified always.At present, the most frequently used strategy of the general detection chip of bacterium is to utilize 16S rRNA gene or 23SrRNA gene conservative in the bacterium, designing general amplimer and the special oligonucleotide probe of each bacterium is fixed on the chip, with the universal primer sample to be detected row labels of going forward side by side that increases, with chip hybridization, judge according to hybridization signal.But for various reasons, some designed oligonucleotide probe specificitys are unsatisfactory, and more serious cross reaction phenomenon is arranged, and detection specificity is not strong.

Summary of the invention

The purpose of this invention is to provide the method for the terrified related diseases indigenous bacteria of a kind of detection of biological and DNA chip dedicated.

The DNA chip of the terrified related diseases indigenous bacteria of detection of biological provided by the present invention comprises following 1) to 16) at least a probe:

1) SEQ ID № in the sequence table: 1 dna sequence dna or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 1 dna sequence dna hybridization that limits;

2) SEQ ID № in the sequence table: 2 dna sequence dna or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 2 dna sequence dnas hybridization that limit;

3) SEQ ID № in the sequence table: 3 dna sequence dna or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 3 dna sequence dnas hybridization that limit;

4) SEQ ID № in the sequence table: 4 dna sequence dna or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 4 dna sequence dnas hybridization that limit;

5) SEQ ID № in the sequence table: 5 dna sequence dna or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 5 dna sequence dnas hybridization that limit;

6) SEQ ID № in the sequence table: 6 dna sequence dna or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 6 dna sequence dnas hybridization that limit;

7) SEQ ID № in the sequence table: 7 dna sequence dna or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 7 dna sequence dnas hybridization that limit;

8) SEQ ID № in the sequence table: 8 dna sequence dna or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 8 dna sequence dnas hybridization that limit;

9) SEQ ID № in the sequence table: 9 dna sequence dna or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 9 dna sequence dnas hybridization that limit;

10) SEQ ID № in the sequence table: 10 dna sequence dna or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 10 dna sequence dnas hybridization that limit;

11) SEQ ID № in the sequence table: 11 dna sequence dna or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 11 dna sequence dnas hybridization that limit;

12) SEQ ID № in the sequence table: 12 dna sequence dna or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 12 dna sequence dnas hybridization that limit;

13) SEQ ID № in the sequence table: 13 dna sequence dna or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 13 dna sequence dnas hybridization that limit;

14) in the sequence table dna sequence dna of SEQ ID NQ:14 or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 14 dna sequence dnas hybridization that limit;

15) SEQ ID № in the sequence table: 15 dna sequence dna or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 15 dna sequence dnas hybridization that limit;

16) SEQ ID № in the sequence table: 16 dna sequence dna or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 16 dna sequence dnas hybridization that limit.

The rigorous condition of above-mentioned height can be in 2 * hybridization solution (10 * SSC, 0.04%SDS, 200 μ g/ μ l salmon sperm dnas, 10% T 500), 65 ℃ of hybridization down, washes chip afterwards.

SEQ ID № in the sequence table: 1 is made up of 334 deoxynucleotides, is Bacillus anthracis lethal gene gene (Balf), can be used for detecting Bacillus anthracis; SEQ ID № in the sequence table: 2 are made up of 249 deoxynucleotides, are bacillus anthracis protective antigen gene (Bapa), can be used for detecting Bacillus anthracis; SEQ ID № in the sequence table: 3 are made up of 268 deoxynucleotides, are pseudoglanders bulkholderia cepasea fur genes (Bpfur), can be used for detection type glanders bulkholderia cepasea; SEQ ID № in the sequence table: 4 are made up of 319 deoxynucleotides, are pseudoglanders bulkholderia cepasea membrane protein genes (Bpsl), can be used for detection type glanders bulkholderia cepasea; SEQ ID № in the sequence table: 5 are made up of 416 deoxynucleotides, are brucella 31kd protein genes (Bra31kd), can be used for detecting brucella; SEQ ID № in the sequence table: 6 are made up of 413 deoxynucleotides, are brucella outer membrane protein gene omp2 (Bromp), can be used for detecting brucella; SEQ ID № in the sequence table: 7 are made up of 421 deoxynucleotides, are Coxiella burnetii 27kd antigen genes (Coxb27kd), can be used for detecting Coxiella burnetii; SEQ ID № in the sequence table: 8 are made up of 296 deoxynucleotides, are Coxiella burnetii 34kd antigen genes (Coxb34kd), can be used for detecting Coxiella burnetii; SEQ ID № in the sequence table: 9 are made up of 457 deoxynucleotides, are native Lafranchise Salmonella fop genes (Ftfop), can be used for detecting native Lafranchise Salmonella; SEQ ID № in the sequence table: 10 are made up of 330 deoxynucleotides, are native Lafranchise Salmonella 23kD antigen genes (Ft23kd), can be used for detecting native Lafranchise Salmonella; SEQ ID № in the sequence table: 11 are made up of 474 deoxynucleotides, are Rickettsia prowazeki rpa genes (Rickpor), can be used for detecting Rickettsia prowazeki; SEQ ID № in the sequence table: 12 are made up of 214 deoxynucleotides, are Rickettsia prowazeki glta genes (Rpglta), can be used for detecting Rickettsia prowazeki; SEQ ID № in the sequence table: 13 are made up of 371 deoxynucleotides, are rickettsia rickettsii 190KD antigen genes (Rricl90kd), can be used for detecting rickettsia rickettsii; SEQ ID № in the sequence table: 14 are made up of 385 deoxynucleotides, are rickettsia rickettsii outer membrane protein gene (Rricompb), can be used for detecting rickettsia rickettsii; SEQ ID № in the sequence table: 15 are made up of 235 deoxynucleotides, are Yersinia pestis kantigen genes (Ypcalf), can be used for detecting Yersinia pestis; SEQ ID № in the sequence table: 16 are made up of 317 deoxynucleotides, are Yersinia pestis pla genes (Yppla), can be used for detecting Yersinia pestis.

In order to improve the accuracy of detection, described DNA chip comprises at least one pair of probe in following 8 pairs of probes: above-mentioned 1) and 2), 3) and 4), 5) and 6), 7) and 8), 9) and 10), 11) and 12), 13) and 14), 15) and 16).

Described bioterror related pathogen bacteria comprises at least a in following eight kinds of bacteriums: Bacillus anthracis (Bacillusanthracis), pseudoglanders bulkholderia cepasea (Burkholderia pseudomalleii), brucella (Brucella), Coxiella burnetii (Coxiella burnetii), soil Lafranchise Salmonella (Francisellatularensis), Rickettsia prowazeki (Rickettsia prowazekii), rickettsia rickettsii (Rickettsiarickettsii) and Yersinia pestis (Yersinia pestis).

Described DNA chip is preferably and comprises SEQ ID № in the sequence table: 1 to 16 dna sequence dna or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of 1 to the 16 dna sequence dna hybridization that limits.

The method of the terrified related diseases indigenous bacteria of detection of biological provided by the invention, be to be template with the DNA of testing sample respectively, with following 1) to 8) 8 pairs of primers to or by a primer of selecting from every pair of right primer centering of described 8 pairs of primers to 8 primers forming to carrying out pcr amplification, the DNA chip of the amplified production that obtains and the terrified related diseases indigenous bacteria of above-mentioned any one detection of biological is hybridized, if hybridization signal is positive, then testing sample for or contain the bioterror related pathogen bacteria of hybridization signal male probe correspondence;

Described 8 pairs of primers are to as follows:

1) primer of being made up of Balf-1 and Balf-B primer right and that be made up of Bapa-1 and Bapa-A is right; 2) primer of being made up of Bpfur-2 and Bpfur-A primer right and that be made up of Bpsl1705-F and Bpsl1705-R is right; 3) primer of being made up of Bra31kd-3 and Bra31kd-C primer right and that be made up of Bromp2b-4 and Bromp2b-D is right; 4) primer of being made up of Coxb27kd-5 and Coxb27kd-C primer right and that be made up of Coxb34kd-3 and Coxb34kd-D is right; 5) primer of being made up of Ftfop-1 and Ftfop-D primer right and that be made up of Ft23kd-3 and Ft23kd-B is right; 6) primer of being made up of Rickpor-Rpa-3 and Rickpor-Rpa-C primer right and that be made up of Rpglta-1 and Rpglta-A is right; 7) primer of being made up of Rric190kd-1 and Rric190kd-A primer right and that be made up of Rricompb-3 and Rricompb-C is right; 8) primer of being made up of Ypcalf-2 and Ypcalf-B primer right and that be made up of Yppla-2 and Yppla-C is right.

The right sequence of above-mentioned 8 pairs of primers is as shown in table 1.

In the aforesaid method, preferably use described 1) to 8) 8 pairs of primers to carrying out pcr amplification.

Described bioterror related pathogen bacteria comprises Bacillus anthracis, pseudoglanders bulkholderia cepasea, brucella, Coxiella burnetii, native Lafranchise Salmonella, Rickettsia prowazeki, rickettsia rickettsii and Yersinia pestis.

In order to improve detection efficiency, described PCR is preferably multiplex PCR.

The present invention selects specific gene design primer to carry out regular-PCR or multiplex PCR amplification and mark, utilizes one PCR product as probe, is prepared as the DNA chip, carries out the chip detection analysis again.The present invention adopts the general detection technique of specific gene multiplex PCR in conjunction with the DNA chip, can overcome the non-specific amplification phenomenon of the appearance that traditional multiplex PCR gel electrophoresis detection method can't distinguish; And under the situation that expanding fragment length is more or less the same in the multiplex PCR system, can not distinguish by traditional detected through gel electrophoresis, and method of the present invention can be differentiated very effectively and comes.The present invention has not only improved the sensitivity, specificity, stability and the circulation ratio that detect, and realizes the testing goal of " one-to-many ", and promptly once experiment can detect a plurality of target bacteria in the sample, satisfies the needs of anti-bio-terrorism.

The present invention selects 16 specific gene fragments (two fragments of every kind of target bacteria) of 8 kinds of bioterror related pathogen bacterias, carries out regular-PCR or multiplex PCR, finishes amplification and fluorescent mark, thereby carries out the analysis of DNA chip hybridization, provides detected result.The present invention has higher sensitivity and specificity in testing process, the non-specific result that both can avoid multiplex PCR in the past may occur in detecting can avoid the cross reaction that often occurs based in the gene chip detecting technique of conservative gene again.The present invention has realized once detecting 8 kinds of bioterror related pathogen bacterias (Bacillus anthracis, Yersinia pestis, brucella, native Lafranchise Salmonella, pseudoglanders bulkholderia cepasea, Rickettsia prowazeki, rickettsia rickettsii and Bai Shi cock steadite) simultaneously in the experiment; And each target bacteria selects two genes to detect, and avoided because the omission that reasons such as transgenation cause has also improved the accuracy that detects.The minimum target bacteria bacterium liquid sample that can detect 11-14CFU/ml of the present invention, the minimum target bacteria DNA that can detect 6-10ng/ μ l is than sensitive 10 times of traditional PCR-electrophoresis method.The present invention can effectively detect the target bacteria in blood and the zoogenetic infection tissue; The present invention can stablize and realize the general detection of various bacteria specifically, even and sample exist excessive irrelevant bacterium to disturb, still can provide correct result.The present invention in anti-bio-terrorism field and the Clinical microorganism context of detection have a good application prospect.

Description of drawings

Fig. 1 is a chip basic fundamental schema

Fig. 2 arranges synoptic diagram for the chip point sample

Fig. 3 is agarose gel electrophoresis figure as a result

Fig. 4 is Yersinia pestis specificity test-results figure

Fig. 5 is a Yersinia pestis EV76 bacterial strain 10 ^-8Extent of dilution bacterium liquid chip hybridization result

Fig. 6 is a Yersinia pestis EV76 bacterial strain 10 ^-7Extent of dilution bacterium liquid preparation simulation blood specimen chip hybridization result

Fig. 7 is a Yersinia pestis EV76 strain chromosome DNA serial dilution degree detected result

Fig. 8 is Yersinia pestis EV76 strain infection BALB/C mice each tissue detection result after 48 hours

Fig. 9 is a Bacillus anthracis specificity test-results

Figure 10 is a Bacillus anthracis A16R bacterial strain 10 ^-8Extent of dilution bacterium liquid chip hybridization result

Figure 11 is a Bacillus anthracis 10 ^-7Extent of dilution bacterium liquid preparation simulation blood specimen chip hybridization result

Figure 12 is a brucella specificity test-results

Figure 13 is 6pg/ μ l brucella chromosomal DNA chip hybridization result

Figure 14 is native Lafranchise Salmonella specificity test-results

Figure 15 is a pseudoglanders bulkholderia cepasea specificity test-results

Figure 16 is a Rickettsia prowazeki specificity test-results

Figure 17 is a rickettsia rickettsii specificity test-results

Figure 18 is a Bai Shi cock steadite specificity test-results

The experimental result that Figure 19 detects simultaneously for the plurality of target bacterium

Figure 20 is assorted bacterium interference experiment detected result

Figure 21 is biased sample Blind Test result

Embodiment

One, specific gene multiplex PCR of the present invention is in conjunction with the principle of DNA chip detection technology

1, DNA chip detection know-why: DNA microarray chip is meant simultaneously a large amount of probe molecules to be solidified in an orderly manner in upholder and is fixed on solid support (slide) surface, form intensive two-dimentional molecular arrangement, then with the molecular hybridization that hits of the biological sample to be measured of mark, by making nucleic acid molecular hybridization paired specificity by specific instrument such as laser confocal scanning or electric charge coupling photography camera (CCD) to intensity of hybridization signal carry out fast, walk abreast, check and analysis efficiently (Fig. 1).

2, multiplex PCR principle: general PCR only uses a pair of primer, by the archaeal dna polymerase amplification template, copies a large amount of purpose fragments, and it is mainly used in single segmental detection, and PCR is the microorganism detection method of using always.Multiplex PCR (multiplex PCR) claims multi-primers PCR or composite PCR again, is to add primer more than two pairs in same PCR reaction system, can amplify the PCR reaction of a plurality of nucleic acid fragments simultaneously.Generally speaking, every pair of primer amplification fragment length difference in the multiplex PCR system by agarose gel electrophoresis, is distinguished the amplified fragments of different sizes, detects when can realize a plurality of target gene.Design is during multiple PCR primer, should guarantee the specificity that increases, guarantees that again the difference in size between the different amplified fragments can be distinguished by agarose gel electrophoresis.But in real work, when especially designing the multiple PCR primer of a plurality of target genes of amplification (more than five), this target is difficult to be realized.Because multiplex PCR just carries out result's judgement by the size of amplified fragments, can't distinguish simultaneously for the false positive amplification that may occur.

3, the specific gene multiplex PCR is in conjunction with the principle of DNA chip detection technology: the method for the existing DNA of utilization chip technology bacterial detection generally all is based on 16S rRNA or 23S rRNA, the design oligonucleotides probe, utilize universal primer amplification label target sequence, realize detecting by rigorous hybridization.Because the rRNA gene order of bacterium is very conservative, often the probe of different bacterium only differs a Nucleotide, may produce cross reaction in crossover process, causes the difficulty of interpretation as a result.

The present invention gets up the multiplex PCR amplification with the DNA chips incorporate, if contain the nucleic acid of one or more target bacteria in the testing sample, multi-PRC reaction will increase and mark on special fragment, after hybridizing with the DNA chip, detect fluorescent signal by bio-chip test device, the bonding probes spot sample mode promptly can be judged the nucleic acid that whether contains target bacteria in the testing sample.

In the present invention, the specific gene fragment product that uses target bacteria is as probe, and the preparation chip can be avoided the cross reaction that may occur in the rRNA chip like this, has improved the accuracy that detects; Each target bacteria selects two specific fragments to be used for detecting simultaneously, still can provide the result under the situation of term single gene sudden change, omission can not occur.In addition, traditional multiplex PCR only by amplified production size judged result, occurs false positive results sometimes, and uses DNA chip hybridization judged result, and this method that detects based on sequence information has improved result's reliability greatly.

4, the chip point sample is arranged: in the present invention, use 8 kinds of target bacteria of 16 probe in detecting altogether; 32 inferior matrixes of point (4 * 8 arrange) on every sheet base, every inferior matrix is represented a kind of probe (see figure 2) by the design of 4 * 4 dot matrix; Every slide capacity is 4 * a 4 * 32=512 point like this, and each probe points repeats 32 times, can avoid because the false negative result that situations such as hybridization solution skewness cause.

Two, the method for the terrified related diseases indigenous bacteria of detection of biological of the present invention and DNA chip dedicated characteristic test thereof

1, specificity experiment: this experiment mainly is to select and the close edge of purpose bacterium or irrelevant some bacterial strains of bacterial strain, carry out the amplification while fluorescent mark of multiplex PCR, the hybridization of carrying out chip detects, observe and whether can detect positive signal specifically, and investigate it and in testing process, whether can avoid some irrelevant interference, investigate the specificity of this technology.

2, sensitivity evaluation: sensitivity evaluation of the present invention is in main definite different samples, with the minimum recall rate of the multi-form target bacteria template that exists.

(1) evaluation of karyomit(e) detection sensitivity: the chromosomal DNA that extracts target bacteria, after measuring concentration, it is carried out 10 times of serial dilutions, each extent of dilution is got certain amount as template, after carrying out the amplification of fluorescent mark multiplex PCR, with chip hybridization, investigate the sensitivity of the pure chromosome specimen of this technology for detection.

(2) evaluation of bacterium bacterium liquid detection sensitivity: the training objective bacterium, culture is carried out 10 times of serial dilutions, utilize dull and stereotyped streak method that each extent of dilution is carried out enumeration; Get each extent of dilution bacterium liquid simultaneously, extract dna profiling, carry out the amplification of fluorescent mark multiplex PCR after, with chip hybridization, estimate the sensitivity of present technique bacterial detection bacterium liquid.

(3) sensitivity of simulation blood specimen detects: the training objective bacterium, culture is carried out 10 times of serial dilutions, and then each extent of dilution bacterium liquid is got in certain amount adding animal or human's the blood, form the simulation blood specimen of series concentration.Extract dna profiling, carry out the amplification of fluorescent mark multiplex PCR after, with chip hybridization, estimate the sensitivity that present technique detects blood preparation.

3, the detection of zoogenetic infection sample: with a kind of target bacteria infection animal, take out organ such as liver, spleen, lung after the dissection respectively and with its grinding, extract organize total DNA after, carry out the amplification of fluorescent mark multiplex PCR after, with chip hybridization, estimate the ability that present technique detects the zoogenetic infection sample.

4, detect multiple target bacteria the time: artificial preparation contains the sample of multiple target bacteria DNA, carry out the amplification of fluorescent mark multiplex PCR after, with chip hybridization.Investigate the effect that present technique detects multiple target bacteria simultaneously, and based on the feasibility of the DNA chip detecting method of multiplex PCR.

5, the detection of assorted bacterium interference experiment: select arbitrarily a kind ofly to carry out mixing of different ratios with the incoherent bacterial strain of target bacteria with the purpose bacterium, the extraction dna profiling.Investigation is under the disturbance state of excessive irrelevant bacterium, and present technique detects the ability of target bacteria.

6, the Blind Test of sample: get the chromosomal DNA of several objects bacterium, carry out random groups and merge numbering, this operation is finished by a people; Carry out the multiplex PCR amplification label by another people then, chip hybridization provides detected result, contrasts with the original combined situation then, investigates present technique and carries out the accuracy that various product detect.

Unless other explanation is arranged, and traditional molecular biology, the cytobiology in this area used in enforcement of the present invention, and clone technology.

Embodiment 1, contain the preparation of the DNA chip of the probe of sequence 1 to 16 in the ordered list and the detection of eight kinds of bioterror related pathogen bacterias

1, contains the preparation of the DNA chip of the probe of sequence 1 to 16 in the ordered list

Bacterial isolates: eight kinds of bioterror related pathogen bacterias: Bacillus anthracis (Bacillus anthracis), Yersinia pestis (Yersinia pestis), brucella (Brucella), soil Lafranchise Salmonella (Francisellatularensis), pseudoglanders bulkholderia cepasea (Burkholderia pseudomalleii), Rickettsia prowazeki (Rickettsia prowazekii), rickettsia rickettsii (Rickettsia rickettsii) and Bai Shi cock steadite (Coxiella burnetii); And artificial tuberculosis yersinia genus (Yersinia pseudotubercolusis), subtilis (Bacillus subtilis), streptococcus aureus (Staphylococcus aureus), diphtheria corynebacterium (Corynebacterium diphtheriae), Salmonella typhi (Salmonella typhi), all available from pathogenic micro-organism Biosafety National Key Laboratory.The bacterium template DNA extract according to NaI cracking-glass powder absorption method carry out (Yang Ruifu, Guo Zhaobiao, Zhang Minli, etc.The research of diagnostic nucleic acid technical specificationsization [J]. biotechnology communication, 1999,8 (2): 81-88).

At above eight kinds of bioterror related pathogen bacterias, every kind of bacterium selects two specific genes as target gene, and the design primer sees table 1 for details.All primers are given birth to the biological company limited of worker by Shanghai and are synthesized.

Table 18 kinds of bioterror related pathogen bacteria specific probes primer and sequence thereof

The upstream primer title

Primer sequence (5 '--3 ')

The downstream primer title

Primer sequence (5 '--3 ')

Target gene (abbreviation)

Amplification length

Balf-1	AGGAACATCCCACAGACT	Balf-B	TCATCTTTCTTTGGCTCA	Bacillus anthracis lethal gene gene (Balf)	334bp
						Bapa-1	CAAGTGCTGGACCTACGG	Bapa-A	TTGCCTCTGGTGATACATTC	Bacillus anthracis protective antigen gene (Bapa)	249bp
Bpfur-2	ACGGCGTAATGCTCTGCG	Bpfur-A	GGTCGGATTGGTCATGGCTAG	Pseudoglanders bulkholderia cepasea fur gene (Bpfur)	268bp
						Bpsl1705-F	CATATTGATCGGGAGCCTTG	Bpsl1705-R	GGTGCCACTGTAACTGATAG	Pseudoglanders bulkholderia cepasea membrane protein gene (Bpsl)	319bp
Bra31kd-3	ACGCCTATTTCTTTGTGGG	Bra31kd-C	CCGATCATTGAGGGATTATTT	Brucella 31kd protein gene (Bra31kd)	416bp
						Bromp2b-4	TCGGGCGTAGATGGTAAA	Bromp2b-D	AACTGGTCGGTGATGTTGA	Brucella outer membrane protein gene omp2 (Bromp)	413bp
Coxb27kd-5	CAGTGGCAGGCAATCCTC	Coxb27kd-C	AACGCTTTATTACCAATGACG A	Coxiella burnetii 27kd antigen gene (Coxb27kd)	421bp
						Coxb34kd-3	ACGGAAGTTATGTTGCGAATG	Coxb34kd-D	AGGCGTTGTTGTTGCTGAA	Coxiella burnetii 34kd antigen gene (Coxb34kd)	296bp
Ftfop-1	AATTTCATTGCTCCTTTTG	Ftfop-D	TGTTAGTACCCGCTCTGC	Soil Lafranchise Salmonella fop gene (Ftfop)	457bp
						Ft23kd-3	GAAAGCTGATTCGGCTAC	Ft23kd-B	CCATCTTTTGAAACACCC	Soil Lafranchise Salmonella 23 kD antigen genes (Ft23kd)	330bp
Rickpor-Rpa-3	AGGTGGCAATGATGAGCG	Rickpor-Rpa-C	AGCCCGACTAATGCGTGT	Rickettsia prowazeki rpa gene (Rickpor)	474bp
						Rpglta-1	GCTAATGAAGCAGTGATA	Rpglta-A	ACAGCGGATTATTGTCTA	Rickettsia prowazeki glta gene (Rpglta)	214bp
Rric190kd-1	AAGGAGCGGGAGATTGTA	Rric190kd-A	TTGGATTTCGCCGATTTT	Rickettsia rickettsii 190KD antigen gene (Rric190kd)	371bp
						Rricompb-3	TGGTGCCGTGACTGATAC	Rricompb-C	GCCAATACCTGTGCCTAA	Rickettsia rickettsii outer membrane protein gene (Rricompb)	385bp
Ypcalf-2	CCCCAATGTCAAACGGCTCT	Ypcalf-B	GGATGACGGCATTCCTGCTC	Yersinia pestis kantigen gene (Ypcalf)	235bp
						Yppla-2	TCCATACTCATTTCTGACCCT G	Yppla-C	TTACCCGCACTCCTTTCG	Yersinia pestis pla gene (Yppla)	317bp

The preparation of probe: according to the primer of table 1, DNA with eight kinds of bacteriums of above-mentioned preparation is a template respectively, carry out pcr amplification reaction, 16 specific gene fragments of eight kinds of bioterror related pathogen bacterias of amplification, reaction system: in 30 μ l amplification systems, (the upstream and downstream primer concentration is 10 μ mol/L to 10 * PCR Master Mix, the concentration of dATP, dTTP, dGTP and dCTP is for being 0.8mmol/L, 100mmol/L Tris-HCl, and pH 8.3,50mmol/L KCl, 20mmol/L MgCl ₂, 0.1%BSA) 3 μ l, Taq archaeal dna polymerase (Promega company) 1.5U/ μ l, bacterium template DNA solution 5 μ l (10ng/ μ l), the sterilization deionized water is supplied reaction system; Adopt PE2400 DNA thermal cycler (PE).Response procedures is as follows: 94 ℃ of pre-sex change 3min of elder generation; 94 ℃ of sex change 50s again, 58 ℃ of annealing 50s, 72 ℃ are extended 50s, carry out 35 circulations; The last 5min that extends eventually; Reaction utilizes phenol chloroform extraction method purified pcr product after finishing, and carries out quantitatively with NanoDrop ND-1000 ultraviolet spectrophotometer.

The preparation of chip and processing: behind 99 ℃ of thermally denature 10min of the PCR product of purifying, the DMSO with 50% (dimethyl alum) is dissolved into the concentration of 2.0 μ g/ μ l, is transferred to 384 orifice plates; The point sample slide is CSS-1000 aldehyde radical slide (a U.S. CE L company).The slide for the treatment of point sample is placed on the Flexys biochip point sample instrument (Genomic Solutions Inc.), the point sample program is set, 32 inferior matrixes of point (4 * 8 arrange) on every sheet base, every inferior matrix is by 4 * 4 dot matrix design (see figure 2), every slide capacity is 4 * a 4 * 32=512 point like this, and each point repeats 32 times.1～No. 16 probe is followed successively by among Fig. 2: 1:Bpfur; 2:Bpsl; 3:Rric190kd; 4:Rricompb; 5:Bapa; 6:Balf; 7:Ft23kd; 8:Ftfop; 9:Coxb27kd; 10:Coxb34kd; 11:Yppla; 12:Ypcalf; 13:Bra31kd; 14:Bromp; 15:Rpglta; 16:Rickpor.Above probe title is corresponding to table 1, promptly No. 1, No. 2 probe in detecting pseudoglanders bulkholderia cepasea, No. 3, No. 4 probe in detecting rickettsia rickettsiis, No. 5, No. 6 probe in detecting Bacillus anthraciss, No. 7, No. 8 probe in detecting soil Lafranchise Salmonellas, No. 9, No. 10 detection Bai Shi cock steadites, No. 11, No. 12 detection Yersinia pestis, detect brucella No. 13, No. 14, No. 15, No. 16 detection Rickettsia prowazekis.The chip that the some system finishes is placed 24h at least in room temperature before use.Crosslinked under 60Milli Joule with the crosslinked instrument of UV (Heofer).The sealing treatment of chip surface free aldehyde: chip is dipped in confining liquid (1.5g NaBH ₄Fully be dissolved among 1 * PBS of 450ml, add the dehydrated alcohol of 133ml, mixing) middle 10min, slowly shake chip and make its adequate closure.Sodium laurylsulfonate SDS (available from Sigma) rinsing chip 2min with 0.1% washs 2min in the water, 95% washing with alcohol 2min promptly can be used for hybridization after drying.

2, utilize eight kinds of bioterror related pathogen bacterias of chip detection of step 1 preparation

(1) foundation of chip target sequence multiplex PCR system

With 16 pairs of combination of primers in the table 1 is three combinations, DNA of bacteria with correspondence is that template composition hybrid template carries out pcr amplification reaction, be every group and detect six fragments (seeing Table 2), thereby utilize these 3 PCR reactions promptly to detect 16 specific gene fragments of all eight kinds of bio-terrorism agent.In addition, in each combination, respectively the DNA of bacteria template in the combination is carried out the pcr amplification of single template.In 30 μ l amplification systems, (the upstream and downstream primer concentration is 10 μ mol/L to 10 * PCR Master Mix, and the concentration of dATP, dTTP, dGTP and dCTP is for being 0.8mmol/L, 100mmol/L Tris-HCl, pH 8.3,50mmol/L KCl, 20mmol/L MgCl ₂, 0.1%BSA) 3 μ l, Taq archaeal dna polymerase (Promega company) 1.5U/ μ l, bacterium template DNA solution 5 μ l (10ng/ μ l), the sterilization deionized water is supplied reaction system; Adopt PE2400DNA thermal cycler (PE).Response procedures is as follows: 94 ℃ of pre-sex change 3min of elder generation; 94 ℃ of sex change 50s again, 58 ℃ of annealing 50s, 72 ℃ are extended 50s, carry out 35 circulations; The last 5min that extends eventually; Utilize agarose gel electrophoresis to observe, examine it to be used for the feasibility of multiplex PCR combination.The result as shown in Figure 3, when electrophoresis result showed the single template of three combination amplifications, amplified band was limpid in sight, shows that these three combinations all can be used for multiplex PCR and detect.But in Fig. 3, when increasing the hybrid template of brucella and native Lafranchise Salmonella with " first group ", because Bromp (413bp) is more approaching with the size of two gene fragments of Ftfop (457bp) (table 1), can only observe a clear bright band in electrophoresis result, show, be difficult to accurately distinguish the close gene of clip size by common electrophoretic detection.A among Fig. 3: first group of multiplex PCR amplification; (stripe size is swimming lane Marker in the swimming lane: 100bp, 200bp, 300bp, 400bp, 500bp, 600bp), swimming lane 1 is the plate amplified production of the mixing mould of brucella and native Lafranchise Salmonella, and swimming lane 2 is the amplified production of the hybrid template of native Lafranchise Salmonella, Bacillus anthracis, Bai Shi cock steadite and rickettsia rickettsii; Swimming lane 3 is the amplified production of the hybrid template of brucella, Yersinia pestis, native Lafranchise Salmonella, Bacillus anthracis and rickettsia rickettsii; Swimming lane 4-9 is respectively the amplified production of the single template of brucella, Yersinia pestis, native Lafranchise Salmonella, Bacillus anthracis, Bai Shi cock steadite and rickettsia rickettsii.B: second group of multiplex PCR amplification; Swimming lane Marker is the same; Swimming lane 1 is the amplified production of the hybrid template of Yersinia pestis and pseudoglanders bulkholderia cepasea; Swimming lane 2 is the amplified production of the hybrid template of native Lafranchise Salmonella, Bai Shi cock steadite, pseudoglanders bulkholderia cepasea and Rickettsia prowazeki; Swimming lane 3 is the amplified production of the hybrid template of brucella, Yersinia pestis, native Lafranchise Salmonella, Bai Shi cock steadite and Rickettsia prowazeki; Swimming lane 4-9 is respectively the amplified production of the single template of brucella, Yersinia pestis, native Lafranchise Salmonella, Bai Shi cock steadite, pseudoglanders bulkholderia cepasea and Rickettsia prowazeki.C: the 3rd group of multiplex PCR amplification; Swimming lane Marker is the same; Swimming lane 1 is the amplified production of the hybrid template of Bacillus anthracis and rickettsia rickettsii; Swimming lane 2 is the amplified production of the hybrid template of rickettsia rickettsii, Rickettsia prowazeki, pseudoglanders bulkholderia cepasea and Yersinia pestis; Swimming lane 3 is the amplified production of the hybrid template of brucella, Bacillus anthracis, rickettsia rickettsii, Rickettsia prowazeki, pseudoglanders bulkholderia cepasea and Yersinia pestis; Swimming lane 4-9 is respectively the single template amplification product of brucella, Bacillus anthracis, rickettsia rickettsii, Rickettsia prowazeki, pseudoglanders bulkholderia cepasea and Yersinia pestis.

Combination of primers in the multi-PRC reaction system of three combinations of table 2

Group number	Primer is to title
							First group	Bromp2b-4 and Bromp2b-D	Yppla-2 and Yppla-C	Ftfop-1 and Ftfop-D	Bapa-1 and Bapa-A	Coxb34kd-3 and Coxb34kd-D	Rricompb-3 and Rricompb-C
Second group	Ypcalf-2 and Ypcalf-B	Bra31kd-3 and Bra31kd-C	Ft23kd-3 and Ft23kd-B	Coxb27kd-5 and Coxb27kd-C	Rpglta-1 and Rpglta-A	Bpfur-2 and Bpfur-A
							The 3rd group	Bra31kd-3 and Bra31kd-C	Balf-1 and Balf-B	Rric190kd-1 and Rric190kd-A	Rickpor-Rpa-3 and Rickpor-Rpa-C	Bpsl1705-F and Bpsl1705-R	Yppla-2 and Yppla-C

(2) chip detection of sequence to be checked:, all use three groups of multiplex PCR systems (seeing Table 2) to increase for DNA (eight kinds of DNA of bacteria of the said extracted) template of bacterial strain to be checked.Every group of multiplex PCR system is, in 30 μ l amplification systems, (six pairs of upstream and downstream primer concentrations are respectively 10 μ mol/L to 10 * PCR Master Mix, dATP, dTTP, dGTP concentration are 0.8mmol/L, the concentration of dCTP is 0.6mmol/L, and Cy5-dCTP concentration is 0.2mmol/L, 100mmol/L Tris-HCl, 50mmol/L KCl, 20mmol/L MgCl ₂, 0.1%BSA, pH 8.3) 3 μ l, Taq archaeal dna polymerase (Promega company) 1.5U/ μ l, template DNA solution 5 μ l to be checked (all being 10ng/ μ l), the sterilization deionized water is supplied reaction system; Adopt PE2400DNA thermal cycler (PE).Setting program is as follows: 94 ℃ of pre-sex change 3min of elder generation; 94 ℃ of sex change 50s then, 58 ℃ of annealing 50s, 72 ℃ are extended 50s, carry out 35 circulations; The last 5min that extends eventually.After amplified reaction finishes three groups of amplified productions are mixed, utilize Amicon Microcon-PCR purification kit (available from Millipore company) to carry out purifying, final elution volume is 30 μ l, gets 99 ℃ of sex change 10min of 15 μ l purified products, ice bath quenching 2min; With 15 μ l2 * hybridization solutions (10 * SSC, 0.04%SDS, 200 μ g/ μ l salmon sperm dnas, 10% T 500) mixing, be positioned in the hybridizing box of built-in chip again, place 65 ℃ of hybridization of hybrid heater 45min.Chip after the hybridization use successively washing lotion A (20 * SSC, 10%SDS), washing lotion B (20 * SSC), respectively wash 3min, 3min, 1min among the washing lotion C (95% ethanol).The chip that washing is finished places in GenePix Pro 4.1 scanners (Axon Instruments), and scan channel and sweep time are set, and carries out result's scanning.When the fluorescence reading of signaling point is higher than background reading 8000 when above, can see clear, bright hybridization point among the result, as the standard of judging negative and positive signal, the fluorescence reading value is high more with this, and then the brightness of hybridization is big more, and expression signal is strong more.

Embodiment 2, utilize the experimental verification of chip that embodiment prepares to eight kinds of bioterror related pathogen bacterias

One, the detection of Yersinia pestis (Yersinia pestis)

1, specificity experiment

Yersinia pestis to extract respectively, artificial tuberculosis yersinia genus, diphtheria corynebacterium, the DNA of streptococcus aureus or Salmonella typhi is as template, utilize primer in the table 2 of (1) of embodiment 1 step 2 to combination, method according to (2) of embodiment 1 step 2, each bacterium carries out three groups of multiplex PCRs respectively separately, three groups of amplified productions with each bacterium after amplified reaction finishes mix respectively separately, according to the method for (2) of embodiment 1 step 2 respectively with embodiment 1 in the DNA chip hybridization of preparation, the result as shown in Figure 4, the template that shows Yersinia pestis can produce positive signal at correct probe location (expecting that two probes have hybridization signal), and artificial tuberculosis yersinia genus, diphtheria corynebacterium, the template of streptococcus aureus and Salmonella typhi does not all have the specific hybridization signal and produces, and the DNA chip of visible embodiment 1 preparation detects for Yersinia pestis has good specificity.

2, bacterium bacterium liquid detection sensitivity experiment

With LB inclined-plane switching Yersinia pestis (EV76) (available from pathogenic micro-organism Biosafety National Key Laboratory), cultivate 48h for 26 ℃, the suspension thalline, (the original bacteria liquid dilution is 10 for 10 times to prepare 10 times of serial dilutions ^-1Extent of dilution, diluting 100 times is 10 ^-2Extent of dilution, the rest may be inferred ... dilution 10 ⁹Doubly be 10 ^-9Extent of dilution) until 10 ^-9Extent of dilution.Utilize dull and stereotyped streak method that bacterium is carried out enumeration.Get each extent of dilution bacterium liquid 1ml, collect thalline, extract DNA.Respectively with the DNA of each dilution bacterium liquid as template, utilize primer in the table 2 of (1) of embodiment 1 step 2 to combination, method according to (2) of embodiment 1 step 2, each dilution bacterium liquid carries out three groups of multiplex PCRs respectively separately, three groups of amplified productions with each dilution bacterium liquid after amplified reaction finishes mix respectively separately, according to the method for (2) of embodiment 1 step 2 respectively with embodiment 1 in the DNA chip hybridization of preparation, investigate bacterium serial dilution bacterium liquid hybridization sensitivity.The result shows that the DNA chip can detect 10 ^-8Dilution bacterium liquid (Fig. 5), through plate count, the original concentration that calculates Yersinia pestis bacterium liquid is 1.1 * 10 ⁹CFU/ml, therefore for Yersinia pestis, detection sensitivity is 1.1 * 10 ⁹CFU/ml * 10 ^-8(extent of dilution)=11 CFU/ml.

3, simulation blood specimen sensitivity experiment

With LB inclined-plane switching Yersinia pestis (EV76), cultivate 48h for 26 ℃, the suspension thalline, (the original bacteria liquid dilution is 10 for 10 times to prepare 10 times of serial dilutions ^-1Extent of dilution, diluting 100 times is 10 ^-2Extent of dilution, the rest may be inferred ... dilution 10 ⁹Doubly be 10 ^-9Extent of dilution) until 10 ^-9Extent of dilution.Utilize dull and stereotyped streak method to carry out enumeration.Get each extent of dilution simultaneously, respectively get 20 μ l in each extent of dilution and add 180 μ l rabbit blood, be prepared into series concentration (1-10 ^-9Extent of dilution) simulation blood specimen.Get the simulation blood specimen of each extent of dilution bacterium liquid preparation respectively, extract the test kit operation instructions according to the QIAamp whole blood DNA and extract DNA, respectively with the DNA of the simulation blood specimen of each extent of dilution bacterium liquid preparation as template, utilize primer in the table 2 of (1) of embodiment 1 step 2 to combination, method according to (2) of embodiment 1 step 2, the simulation blood specimen of each extent of dilution bacterium liquid preparation carries out three groups of multiplex PCRs respectively separately, after amplified reaction finishes, three groups of amplified productions of the simulation blood specimen of each extent of dilution bacterium liquid preparation are mixed respectively separately, according to the method for (2) of embodiment 1 step 2 respectively with embodiment 1 in the DNA chip hybridization of preparation, the result shows that the DNA chip can detect 10 ^-7The simulation blood specimen (Fig. 6) of dilution bacterium liquid preparation, through plate count, the original concentration that calculates Yersinia pestis bacterium liquid is 1.1 * 10 ⁹CFU/ml.Therefore for Yersinia pestis, simulation blood specimen detection sensitivity is 1.1 * 10 ⁹CFU/ml * 10 ^-7(extent of dilution)=110CFU/ml.

4, karyomit(e) dilution sensitivity experiment

With LB inclined-plane switching Yersinia pestis (EV76), cultivated 48 hours for 26 ℃, collect thalline, extract chromosomal DNA with the extractive method of phenol chloroform, after ultraviolet spectrophotometer carries out nucleic acid quantification, be the solution of 100ng/ μ l, 10ng/ μ l, 1ng/ μ l, 100pg/ μ l, 10pg/ μ l and 1pg/ μ l with its doubling dilution; Getting each dilution DNA subsequently is template, utilize primer in the table 2 of (1) of embodiment 1 step 2 to combination, method according to (2) of embodiment 1 step 2, each dilution DNA carries out three groups of multiplex PCRs respectively separately, three groups of amplified productions with each dilution DNA after amplified reaction finishes mix respectively separately, according to the method for (2) of embodiment 1 step 2 respectively with embodiment 1 in the DNA chip hybridization of preparation, the result shows that present technique can detect 10pg/ μ l Yersinia pestis (EV76) chromosomal DNA; And, in the agarose gel electrophoresis, when 100pg/ μ l, can observe positive signal at the pcr amplification of routine, 10pg/ μ l extent of dilution has not observed band (Fig. 7).As seen the DNA chip of embodiment 1 preparation is than the highly sensitive order of magnitude of conventional PCR detected through gel electrophoresis.Among Fig. 7, A is DNA chip detection 10pg/ μ l chromosomal DNA result, and B is PCR-detected through gel electrophoresis result.

5, the detection of zoogenetic infection sample

With Yersinia pestis EV76 strain infection BALB/C small white mouse, infect dissection in 48 hours, take out liver, spleen, lung organ and with its grinding, after extracting test kit (QIAGEN) and extract tissue DNA respectively with whole blood DNA, utilize primer in the table 2 of (1) of embodiment 1 step 2 to combination, method according to (2) of embodiment 1 step 2, the DNA of each tissue carries out three groups of multiplex PCRs respectively separately, three groups of amplified productions with the DNA of each tissue after amplified reaction finishes mix respectively separately, according to the method for (2) of embodiment 1 step 2 respectively with embodiment 1 in the DNA chip hybridization of preparation, the result shows the specific hybridization signal that all can detect Yersinia pestis in three kinds of infected tissues as shown in Figure 8.

Two, the detection of Bacillus anthracis (Bacillus anthracis)

1, specificity experiment

Bacillus anthracis to extract respectively, subtilis, diphtheria corynebacterium, the DNA of streptococcus aureus and Salmonella typhi is as template, utilize primer in the table 2 of (1) of embodiment 1 step 2 to combination, method according to (2) of embodiment 1 step 2, each bacterium carries out three groups of multiplex PCRs respectively separately, three groups of amplified productions with each bacterium after amplified reaction finishes mix respectively separately, according to the method for (2) of embodiment 1 step 2 respectively with embodiment 1 in the DNA chip hybridization of preparation, scanning result such as Fig. 9, the template that shows Bacillus anthracis can produce positive signal at correct probe location, and subtilis, diphtheria corynebacterium, the equal no signal of the template of streptococcus aureus and Salmonella typhi produces, and the DNA chip of visible embodiment 1 preparation detects for Bacillus anthracis has good specificity.

2, bacterium bacterium liquid detection sensitivity experiment

With LB inclined-plane switching Bacillus anthracis, cultivate 24h for 37 ℃, the suspension thalline prepares 10 times of serial dilutions until 10 ^-9(the original bacteria liquid dilution is 10 for 10 times to extent of dilution ^-1Extent of dilution, diluting 100 times is 10 ^-2Extent of dilution, the rest may be inferred ... dilution 10 ⁹Doubly be 10 ^-9Extent of dilution).Utilize dull and stereotyped streak method that bacterium is carried out enumeration.Get each extent of dilution bacterium liquid 1ml, collect thalline, extract DNA.Respectively with the DNA of each dilution bacterium liquid as template, utilize primer in the table 2 of (1) of embodiment 1 step 2 to combination, method according to (2) of embodiment 1 step 2, each dilution bacterium liquid carries out three groups of multiplex PCRs respectively separately, three groups of amplified productions with each dilution bacterium liquid after amplified reaction finishes mix respectively separately, according to the method for (2) of embodiment 1 step 2 respectively with embodiment 1 in the DNA chip hybridization of preparation, investigate bacterium serial dilution bacterium liquid hybridization sensitivity.The result shows that the DNA chip of embodiment 1 preparation can detect 10 as shown in figure 10 ^-8Dilution bacterium liquid.Through plate count, the original concentration that calculates Bacillus anthracis bacterium liquid is 1.4 * 10 ⁹CFU/ml.Therefore for Bacillus anthracis, detection sensitivity is 1.4 * 10 ⁹CFU/ml * 10 ^-8=14CFU/ml.

3, simulation blood specimen detection sensitivity experiment

With LB inclined-plane switching Bacillus anthracis A16R, cultivate 24h for 37 ℃, the PBS solution suspension thalline with 0.01M prepares 10 times of serial dilutions until 10 ^-9(the original bacteria liquid dilution is 10 for 10 times to extent of dilution ^-1Extent of dilution, diluting 100 times is 10 ^-2Extent of dilution, the rest may be inferred ... dilution 10 ⁹Doubly be 10 ^-9Extent of dilution).Utilize dull and stereotyped streak method to carry out enumeration; Get each extent of dilution simultaneously, respectively get 20 μ l in each extent of dilution and add 180 μ l rabbit blood and be prepared into series concentration (1-10 ^-9Extent of dilution) simulation blood specimen.Get the simulation blood specimen of each extent of dilution bacterium liquid preparation respectively, extract the test kit operation instructions according to the QIAamp whole blood DNA and extract DNA, respectively with the DNA of the simulation blood specimen of each extent of dilution bacterium liquid preparation as template, utilize primer in the table 2 of (1) of embodiment 1 step 2 to combination, method according to (2) of embodiment 1 step 2, the simulation blood specimen of each extent of dilution bacterium liquid preparation carries out three groups of multiplex PCRs respectively separately, after amplified reaction finishes, three groups of amplified productions of the simulation blood specimen of each extent of dilution bacterium liquid preparation are mixed respectively separately, according to the method for (2) of embodiment 1 step 2 respectively with embodiment 1 in the DNA chip hybridization of preparation, the result shows that the DNA chip of embodiment 1 preparation can detect 10 as shown in figure 11 ^-7The simulation blood specimen of dilution bacterium liquid preparation.Through plate count, the original concentration that calculates Bacillus anthracis bacterium liquid is 1.4 * 10 ⁹CFU/ml.Therefore for Bacillus anthracis, simulation blood specimen detection sensitivity is 1.4 * 10 ⁹CFU/ml * 10 ^-7=140 CFU/ml.

Three, the detection of brucella (Brucella)

1, specificity experiment

Respectively with brucella, diphtheria corynebacterium, the DNA of streptococcus aureus and Salmonella typhi is as template, utilize primer in the table 2 of (1) of embodiment 1 step 2 to combination, method according to (2) of embodiment 1 step 2, each bacterium carries out three groups of multiplex PCRs respectively separately, three groups of amplified productions with each bacterium after amplified reaction finishes mix respectively separately, according to the method for (2) of embodiment 1 step 2 respectively with embodiment 1 in the DNA chip hybridization of preparation, scanning result as shown in figure 12, show that brucellar template can produce positive signal at correct probe location, and diphtheria corynebacterium, the template of streptococcus aureus and Salmonella typhi does not all have specific signals and produces, and the DNA chip of visible embodiment 1 preparation detects for brucella has good specificity.

2, karyomit(e) dilution sensitivity experiment

With the brucella chromosomal DNA, doubling dilution becomes 100ng/ μ l, 10ng/ μ l, 1ng/ μ l, 0.1ng/ μ l, 0.01ng/ μ l, and at 1pg/ μ l～10pg/ μ l the gradient of going forward one by one of 1ng/ μ l is set; Getting each dilution DNA subsequently is template, utilize primer in the table 2 of (1) of embodiment 1 step 2 to combination, method according to (2) of embodiment 1 step 2, each dilution DNA carries out three groups of multiplex PCRs respectively separately, three groups of amplified productions with each dilution DNA after amplified reaction finishes mix respectively separately, according to the method for (2) of embodiment 1 step 2 respectively with embodiment 1 in the DNA chip hybridization of preparation, the result shows that method of the present invention can detect 6pg/ μ l brucella chromosomal DNA as shown in figure 13; And, in the agarose gel electrophoresis, when 100pg/ μ l, can observe positive signal at the pcr amplification of routine, 10pg/ μ l extent of dilution has not observed band.

Four, the detection of native Lafranchise Salmonella (Francisella tularensis)

Respectively with native Lafranchise Salmonella, diphtheria corynebacterium, the DNA of streptococcus aureus and Salmonella typhi is as template, utilize primer in the table 2 of (1) of embodiment 1 step 2 to combination, method according to (2) of embodiment 1 step 2, each bacterium carries out three groups of multiplex PCRs respectively separately, three groups of amplified productions with each bacterium after amplified reaction finishes mix respectively separately, according to the method for (2) of embodiment 1 step 2 respectively with embodiment 1 in the DNA chip hybridization of preparation, scanning result as shown in figure 14, the template that shows native Lafranchise Salmonella can produce positive signal at correct probe location, and diphtheria corynebacterium, the equal no signal of the template of streptococcus aureus and Salmonella typhi produces, and the DNA chip of visible embodiment 1 preparation detects for native Lafranchise Salmonella has good specificity.

Five, the detection of pseudoglanders bulkholderia cepasea (Burkholderia pseudomalleii)

Respectively with the pseudoglanders bulkholderia cepasea, diphtheria corynebacterium, the DNA of streptococcus aureus and Salmonella typhi is as template, utilize primer in the table 2 of (1) of embodiment 1 step 2 to combination, method according to (2) of embodiment 1 step 2, each bacterium carries out three groups of multiplex PCRs respectively separately, three groups of amplified productions with each bacterium after amplified reaction finishes mix respectively separately, according to the method for (2) of embodiment 1 step 2 respectively with embodiment 1 in the DNA chip hybridization of preparation, scanning result as shown in figure 15, the template that shows the pseudoglanders bulkholderia cepasea can produce positive signal at correct probe location, and diphtheria corynebacterium, the equal no signal of the template of streptococcus aureus and Salmonella typhi produces, and the DNA chip of visible embodiment 1 preparation detects for the pseudoglanders bulkholderia cepasea has good specificity.

Six, the detection of Rickettsia prowazeki (Rickettsia prowazekii)

Respectively with Rickettsia prowazeki, diphtheria corynebacterium, the DNA of streptococcus aureus and Salmonella typhi is as template, utilize primer in the table 2 of (1) of embodiment 1 step 2 to combination, method according to (2) of embodiment 1 step 2, each bacterium carries out three groups of multiplex PCRs respectively separately, three groups of amplified productions with each bacterium after amplified reaction finishes mix respectively separately, according to the method for (2) of embodiment 1 step 2 respectively with embodiment 1 in the DNA chip hybridization of preparation, scanning result as shown in figure 16, the template that shows Rickettsia prowazeki can produce positive signal at correct probe location, and diphtheria corynebacterium, the equal no signal of the template of streptococcus aureus and Salmonella typhi produces, and the DNA chip of visible embodiment 1 preparation detects for Rickettsia prowazeki has good specificity.

Seven, the detection of rickettsia rickettsii (Rickettsia rickettsii)

Respectively with rickettsia rickettsii, diphtheria corynebacterium, the DNA of streptococcus aureus and Salmonella typhi is as template, utilize primer in the table 2 of (1) of embodiment 1 step 2 to combination, method according to (2) of embodiment 1 step 2, each bacterium carries out three groups of multiplex PCRs respectively separately, three groups of amplified productions with each bacterium after amplified reaction finishes mix respectively separately, according to the method for (2) of embodiment 1 step 2 respectively with embodiment 1 in the DNA chip hybridization of preparation, scanning result as shown in figure 17, the template that shows rickettsia rickettsii can produce positive signal at correct probe location, and diphtheria corynebacterium, the equal no signal of the template of streptococcus aureus and Salmonella typhi produces, and the DNA chip of visible embodiment 1 preparation detects for rickettsia rickettsii has good specificity.

Eight, the detection of Bai Shi cock steadite (Coxiella burnetii)

Respectively with Bai Shi cock steadite, diphtheria corynebacterium, the DNA of streptococcus aureus and Salmonella typhi is as template, utilize primer in the table 2 of (1) of embodiment 1 step 2 to combination, method according to (2) of embodiment 1 step 2, each bacterium carries out three groups of multiplex PCRs respectively separately, three groups of amplified productions with each bacterium after amplified reaction finishes mix respectively separately, according to the method for (2) of embodiment 1 step 2 respectively with embodiment 1 in the DNA chip hybridization of preparation, scanning result as shown in figure 18, the template that shows Bai Shi cock steadite can produce positive signal at correct probe location, and diphtheria corynebacterium, the equal no signal of the template of streptococcus aureus and Salmonella typhi produces, and the DNA chip of visible embodiment 1 preparation has good specificity for Bai Shi Kao Kesishi health check-up measuring tool.

Nine, eight kinds of bioterror related pathogen bacteria while test experience

Respectively with 2,3,4,5,6, the DNA mixture of 8 target bacteria is as the template of amplification, utilize primer in the table 2 of (1) of embodiment 1 step 2 to combination, method according to (2) of embodiment 1 step 2, every kind of hybrid template carries out three groups of multiplex PCRs respectively separately, three groups of amplified productions with every kind of hybrid template after amplified reaction finishes mix respectively separately, according to the method for (2) of embodiment 1 step 2 respectively with embodiment 1 in the DNA chip hybridization of preparation, results of hybridization as shown in figure 19, show that each results of hybridization all has many group probes positive signal to occur, and signal mode and target bacteria fit like a glove, illustrate that method of the present invention can detect multiple bioterror related pathogen bacteria fully simultaneously, show that also the DNA chip detecting method based on multiplex PCR is feasible simultaneously.Wherein, among Figure 19, mouse+cloth represents that with Yersinia pestis and brucellar DNA be template, carries out the detected result of three groups of multiplex PCRs, chip hybridization; Class+uncle's expression is a template with the DNA of pseudoglanders bulkholderia cepasea and Bai Shi cock steadite, carries out the detected result of three groups of multiplex PCRs, chip hybridization; Mouse+cloth+charcoal represents that the DNA with Yersinia pestis, brucella and Bacillus anthracis is a template, carries out the detected result of three groups of multiplex PCRs, chip hybridization; Upright+soil+general expression is a template with the DNA of rickettsia rickettsii, native Lafranchise Salmonella and Rickettsia prowazeki, carries out the detected result of three groups of multiplex PCRs, chip hybridization; Class+charcoal+primary+cloth represents that with pseudoglanders bulkholderia cepasea, Bacillus anthracis, Bai Shi cock steadite and brucellar DNA be template, carries out the detected result of three groups of multiplex PCRs, chip hybridization; Upright+soil+mouse+general expression is a template with the DNA of rickettsia rickettsii, native Lafranchise Salmonella, Yersinia pestis and Rickettsia prowazeki, carries out the detected result of three groups of multiplex PCRs, chip hybridization; General+soil+cloth+charcoal+uncle's expression is a template with the DNA of Rickettsia prowazeki, native Lafranchise Salmonella, brucella, Bacillus anthracis and Bai Shi cock steadite, carries out the detected result of three groups of multiplex PCRs, chip hybridization; Upright+mouse+soil+cloth+class is represented that the DNA with rickettsia rickettsii, Yersinia pestis, native Lafranchise Salmonella, brucella and pseudoglanders bulkholderia cepasea is a template, is carried out the detected result of three groups of multiplex PCRs, chip hybridization; Class+mouse+primary+cloth+upright+soil expression is a template with the DNA of pseudoglanders bulkholderia cepasea, Yersinia pestis, Bai Shi cock steadite, brucella, rickettsia rickettsii and native Lafranchise Salmonella, carries out the detected result of three groups of multiplex PCRs, chip hybridization; Class+charcoal+primary+cloth+upright+soil+mouse+general expression is a template with the DNA of pseudoglanders Bai Kehuoerdeshi mattress, Bacillus anthracis, Bai Shi cock steadite, brucella, rickettsia rickettsii, native Lafranchise Salmonella, Yersinia pestis and Rickettsia prowazeki, carries out the detected result of three groups of multiplex PCRs, chip hybridization.

Ten, assorted bacterium interference experiment

With Yersinia pestis (EV76) and intestinal bacteria with 1: 100, with 1: 10000 cell number ratio mix at 1: 1000, DNA with the mixed bacteria liquid of each blending ratio of extracting is a template, utilize primer in the table 2 of (1) of embodiment 1 step 2 to combination, method according to (2) of embodiment 1 step 2, each mixed bacteria liquid carries out three groups of multiplex PCRs respectively separately, three groups of amplified productions with each mixed bacteria liquid after amplified reaction finishes mix respectively separately, according to the method for (2) of embodiment 1 step 2 respectively with embodiment 1 in the DNA chip hybridization of preparation, the result as shown in figure 20, even show that under the interference of 10000 times of irrelevant bacteriums (intestinal bacteria), method of the present invention still can realize the accurate detection to target bacteria (Yersinia pestis).Ratio is that Yersinia pestis and colibacillary bacterium are counted ratio among Figure 20.

11, biased sample Blind Test experiment

Select the template DNA of several objects bacterium, carry out combination number at random with water, specimen preparation is finished common preparation 6 duplicate samples (table 3) by a people.Utilize primer in the table 2 of (1) of embodiment 1 step 2 to combination by another people then, method according to (2) of embodiment 1 step 2, each sample carries out three groups of multiplex PCRs respectively separately, three groups of amplified productions with each sample after amplified reaction finishes mix respectively separately, according to the method for (2) of embodiment 1 step 2 respectively with embodiment 1 in each DNA chip hybridization of system, carry out the sample Blind Test, provide detected result according to the chip hybridization collection of illustrative plates, the nucleic acid that contains which kind of target bacteria in the judgement sample, check with primary sample composition information subsequently, investigate the ability that present technique detects unknown sample (may contain the plurality of target bacterium).

Biased sample hybridization collection of illustrative plates as shown in figure 21, biased sample array mode and as shown in table 3 by hybridization detection back sentence read result, show the detection all OK, illustrate that method of the present invention can be used for detecting unknown sample fully and whether contain above 8 kinds of bioterror related pathogen bacterias.Mouse represents that the DNA with Yersinia pestis is a template among Figure 21, carries out the detected result of three groups of multiplex PCRs, chip hybridization; Water meter shows the detected result of carrying out three groups of multiplex PCRs, chip hybridization with water replacement dna profiling; Class+primary+mouse+cloth represents that with pseudoglanders bulkholderia cepasea, Bai Shi cock steadite, Yersinia pestis and brucellar DNA be template, carries out the detected result of three groups of multiplex PCRs, chip hybridization; Class+soil+mouse+uncle's expression is a template with the DNA of pseudoglanders bulkholderia cepasea, native Lafranchise Salmonella, Yersinia pestis and Bai Shi cock steadite, carries out the detected result of three groups of multiplex PCRs, chip hybridization; Primary+mouse is represented the dna profiling with Bai Shi cock steadite and Yersinia pestis, carries out the detected result of three groups of multiplex PCRs, chip hybridization; Cloth+found the dna profiling of expression brucella and rickettsia rickettsii carries out the detected result of three groups of multiplex PCRs, chip hybridization.

Table 3. Blind Test sample combination mode and hybridization sentence read result

Sample number into spectrum	The sample practical combinations	The sample results of hybridization
			1	Yersinia pestis	Yersinia pestis
2	Water	Negative
			3	Pseudoglanders bulkholderia cepasea+Bai Shi cock steadite+Yersinia pestis+brucella	Pseudoglanders bulkholderia cepasea+Bai Shi cock steadite+Yersinia pestis+brucella
4	Pseudoglanders bulkholderia cepasea+native Lafranchise Salmonella+Yersinia pestis+Bai Shi cock steadite	Pseudoglanders bulkholderia cepasea+native Lafranchise Salmonella+Yersinia pestis+Bai Shi cock steadite
			5	Bai Shi cock steadite+Yersinia pestis	Bai Shi cock steadite+Yersinia pestis
6	Brucella+rickettsia rickettsii	Brucella+rickettsia rickettsii

Sequence table

<160>16

<210>1

<211>334

<212>DNA

＜213〉Bacillus anthracis (Bacillus anthracis)

<400>1

aggaacatcc cacagacttt tctgtagaat tcttggaaca aaatagcaat gaggtacaag 60

aagtatttgc gaaagctttt gcatattata tcgagccaca gcatcgtgat gttttacagc 120

tttatgcacc ggaagctttt aattacatgg ataaatttaa cgaacaagaa ataaatctat 180

ccttggaaga acttaaagat caacggatgc tgtcaagata tgaaaaatgg gaaaagataa 240

aacagcacta tcaacactgg agcgattctt tatctgaaga aggaagagga cttttaaaaa 300

agctgcagat tcctattgag ccaaagaaag atga 334

<210>2

<211>249

<212>DNA

＜213〉Bacillus anthracis (Bacillus anthracis)

<400>2

caagtgctgg acctacggtt ccagaccgtg acaatgatgg aatccctgat tcattagagg 60

tagaaggata tacggttgat gtcaaaaata aaagaacttt tctttcacca tggatttcta 120

atattcatga aaagaaagga ttaaccaaat ataaatcatc tcctgaaaaa tggagcacgg 180

cttctgatcc gtacagtgat ttcgaaaagg ttacaggacg gattgataag aatgtatcac 240

cagaggcaa 249

<210>3

<211>268

<212>DNA

＜213〉pseudoglanders bulkholderia cepasea (Burkholderia pseudomalleii)

<400>3

acggcgtaat gctctgcgcg atccgctggg tcacgctgtc gtacgacgaa caggcggcca 60

gtccgaccac ggcgacagct gcgatgacgg tgctccgcac gcggctcctc tgaagttgca 120

aaagcgatct tggaatcatg tccctcaccg tgctggccct tgtccaaggc cgcgcgagaa 180

tgtcacagat gactgaaaag gcgaaaagcc ggtactattg aagccctgca ttgtactcta 240

gggacgccta gccatgacca atccgacc 268

<210>4

<211>319

<212>DNA

＜213〉pseudoglanders bulkholderia cepasea (Burkholderia pseudomalleii)

<400>4

catattgatc gggagccttg ggtccacgct gccggctgtg gctggtacgg taataggcgg 60

cggggctcaa taccccaatt cggtaggcgg aacgagttct acgaccggcg atttgggcaa 120

cagctatatt ggtgcgagcg gtatgggtac cgccattact ggggataatg attgcctgag 180

cttgacttcg acccgcaacg tgctaaacag tgcgaatgtc ggctggcttt tgggaacgac 240

ttcacagacc accgatcctg gtccgttgta ccccggcccc ggcgcggaaa acaaccagac 300

tatcagttac agtggcacc 319

<210>5

<211>416

<212>DNA

＜213〉brucella (Brucella)

<400>5

acgcctattt ctttgtgggc ggctatccga cgggcgcaat ctcggaactg gccatctcga 60

acggtatttc gctcgttccg atctccgggc cggaagcgga caagattctg gagaaatatt 120

ccttcttctc gaaggatgtg gttcctgccg gagcctataa ggacgtggcg gaaacaccga 180

cccttgccgt tgccgcacag tgggtgacga gcgccaagca gccggacgac ctcatctata 240

acatcaccaa ggttctctgg aacgaggata cacgcaaggc actcgatgcg ggccatgcga 300

agggcaagct catcaagctc gatagtgcga cgagcagcct cggtattccg ctgcatcccg 360

gcgcagaacg cttttacaag gaagcgggcg tgctgaaata atccctcaat gatcgg 416

<210>6

<211>413

<212>DNA

＜213〉brucella (Brucella)

<400>6

tcgggcgtag atggtaaata tggtaatgaa accagcagcg gcaccgtcat ggagttcgcg 60

tatatccagc tcggtggtct gcgcgttggt atcgatgaat cggaattcca taccttcacc 120

ggttacctcg gcgatgtcat caacgatgac gtgatctcgg ctggctccta ccgcaccggc 180

aagatctcgt acaccttcac tggcggaaac ggcttctcgg ctgtgatcgc tctcgaacag 240

ggtggcgaag acgttgacaa cgattacacg atcgacggtt acatgccgca cgttgttggc 300

ggcctgaaat atgctggcgg ctggggttcg atcgctggtg ttgttgccta tgactcggtc 360

atagaagaat gggctgccaa ggttcgtggc gacgtcaaca tcaccgacca gtt 413

<210>7

<211>421

<212>DNA

＜213〉Bai Shi cock steadite (Coxiella burnetii)

<400>7

cagtggcagg caatcctcat ggcaatgtta cattggttga atttttcgat tatcaatgtg 60

gccattgcaa agccatgaat tctgttattc aagctatcgt gaaacaaaat aaaaacctcc 120

gcgttgtctt caaagaactg cccatttttg gcggccaatc gcaatacgct gccaaagtat 180

cattagcagc cgctaaacaa ggaaaatatt atgctttcca cgacgcgctg ctcagtgtcg 240

acggccaatt atcagaacaa atcacccttc aaaccgcaga aaaagtagga ttaaatgttg 300

ctcagctcaa aaaagacatg gataatcctg ctatccaaaa acaactgcgt gataacttcc 360

aattagctca atcgttacag ctagcaggca ccccgacgtt cgtcattggt aataaagcgt 420

t 421

<210>8

<211>296

<212>DNA

＜213〉Bai Shi cock steadite (Coxiella burnetii)

<400>8

acggaagtta tgttgcgaat gcgcattatt ggctcggtga aatttatctt caacagaaag 60

atcggaaaaa tgccgcccac gaatttcaaa ccgtaaggga taaatttccc aaatcggaaa 120

aggtacttga tgcgaaatta aaattagcca tcattgatgc ggaagacggg aaaattaaac 180

aggctaagga agaattaacc gaaattaaaa aacaacaccc tgaatctacg gcagcacaac 240

tcgccaatat ccgactccaa caattggagg aagtcgattc agcaacaaca acgcct 296

<210>9

<211>457

<212>DNA

＜213〉native Lafranchise Salmonella (Francisella tularensis)

<400>9

aatttcattg ctccttttgc aaatacttat agcgctttga ctaacaagga caatacttgg 60

ggtcctcaag atagaactgg ccagtggtac ttaggtgtag atgctaacgg tctagctaga 120

actcctaact ctccatcagg tgctggtgct aacttcacaa tcggttataa catcaataaa 180

tacttcgctg tacagtacaa ccaattagtt ggtagagtat ttgctggttt aggtgaaggt 240

gttgtaaact ttagtaataa tactatgttt actccatatg ctgcaggtgg tgctggttgg 300

gcaaatctag caggtcaagc aacaggtgct tgggatgtgg gtggtggtct taagtttgaa 360

ctatctagaa atgttcaagc aagtgttgac tacagatata tccaaacaat ggcacctagt 420

aatatttctg gtgctaatgg cagagcgggt actaaca 457

<210>10

<211>330

<212>DNA

＜213〉native Lafranchise Salmonella (Francisella tularensis)

<400>10

gaaagctgat tcggctacag ctgctgctag tgtaatacgt ttatctataa cgccaggctc 60

tataaatcca acaataagta ttactcttgg tgttctaatt aaatcaaatg ttagaactaa 120

aattgaagag aaagtttcga gtatattaca agcaagtgct acagatatga aaattaagtt 180

aggtaattct aataaaaaac aagagtataa aactgatgaa gcatggggta ttatgataga 240

tctatctaat ttagagttat atccaataag tgctaaggct tttagtatta gtatagagcc 300

aacagaactt atgggtgttt caaaagatgg 330

<210>11

<211>474

<212>DNA

＜213〉Rickettsia prowazeki (Rickettsia prowazekii)

<400>11

aggtggcaat gatgagcgtg agcaaacctt aaaccaaatg ttagtcgaaa tggatgggtt 60

tgaggcaaac gagggtgtgg taattattgc agctacaaac cgtccagacg ttcttgatcg 120

tgcattactg cgtcctggta gatttgatcg tcaaattgct gttgcaaacc ctgatataaa 180

tggtcgtgag caaattctaa aagtacattt aaaaaaaatt aaatataata gtacggtact 240

agcacgaatt attgctcgtg gaactcctgg tttctccggt gctgaacttg ctaatttagt 300

taatgaagct gcgcttattg ctgcgaggct tggtaaaaaa gaagtagata tgcacgatat 360

ggaagaagca aaagataagg ttttgatggg tgttgtgcgt cgctctattg caatgtcaga 420

gaaggagaaa agattaactg cgtatcatga aggaggacac gcattagtcg ggct 474

<210>12

<211>214

<212>DNA

＜213〉Rickettsia prowazeki (Rickettsia prowazekii)

<400>12

gctaatgaag cagtgataaa tatgcttaaa gaaattggca gttctgagaa tattcctaaa 60

tatgtagcta aagctaaaga taagaatgat ccatttaggt taatgggttt tggtcatcga 120

gtatataaaa gctatgaccc gcgtgccgca gtacttaaag aaacttgtaa agaagtatta 180

aatgaattag gtcagttaga caataatccg ctgt 214

<210>13

<211>371

<212>DNA

＜213〉rickettsia rickettsii (Rickettsia rickettsii)

<400>13

aaggagcggg agattgtagc acggcaggta ccacttttaa tacaacaaat atagtacttg 60

atattacagg tcaattagaa cttggagcta ctacggcaaa tgtagtttta tttaatgatg 120

ctgttcaatt aactcaaacc ggtaatattg gcggtttctt agattttaat gcaaaaaacg 180

gtatggtaac attaaataac aatgtaaatg ttgcgggagc agtccaaaat accggcggta 240

ctaataacgg tacgttaata gttttaggtg caagtaatct taatagagta aacgggattg 300

ctatgttaaa agtaggtgca ggaaatgtaa ctattgccaa aggcggtaaa gttaaaatcg 360

gcgaaatcca a 371

<210>14

<211>385

<212>DNA

＜213〉rickettsia rickettsii (Rickettsia rickettsii)

<400>14

tggtgccgtg actgatacga ttgcttttga aaattcaagt ttaggtgcag ttgtattctt 60

acctagaggc attccattca atgatgcagg caacacaatg cctttaacaa ttaaaagtac 120

cgtaggtaat aaaacagcta aaggttttga tgttcctagc gtggttgttt taggtgttga 180

tagtgtcatc gctgacggtc aagtaatcgg tgatcaaaat aatatcgtag gtctaggtct 240

tggaagcgat aacggcataa tcgttaatgc tactacatta tatgcaggta tcagtactct 300

aaacaataat caaggtactg tcacacttag cggtggtgtt cctaataccc ctggtacagt 360

ttatggctta ggcacaggta ttggc 385

<210>15

<211>235

<212>DNA

＜213〉Yersinia pestis (Yersinia pestis)

<400>15

ccccaatgtc aaacggctct taattgtatt caatcctcgc tcggcataaa tatacgaacg 60

ctgccatcct tgttgtttcc accatgaggt tgaactacga aagcgccaag cccctatgtt 120

taatcccggt tgcaactgag cataataaga gtccagagac ttgcctcctt ctctgaattt 180

tcttgtctgc atgttcgtat tataattcat gaacagagca ggaatgccgt catcc 235

<210>16

<211>317

<212>DNA

＜213〉Yersinia pestis (Yersinia pestis)

<400>16

tccatactca tttctgaccc tgaatgccag ggggtggacg tctctggctt ccgggtcagg 60

taatatggat gactacgact ggatgaatga aaatcaatct gagtggacag atcactcatc 120

tcatcctgct acaaatgtta atcatgccaa tgaatatgac ctcaatgtga aaggctggtt 180

actccaggat gagaattata aagcaggtat aacagcagga tatcaggaaa cacgtttcag 240

ttggacagct acaggtggtt catatagtta taataatgga gcttataccg gaaacttccc 300

gaaaggagtg cgggtaa 317

Claims (9)

1, the DNA chip of the terrified related diseases indigenous bacteria of a kind of detection of biological comprises following 1) to 16) at least a probe:

1) SEQ ID № in the sequence table: 1 dna sequence dna or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 1 dna sequence dna hybridization that limits;

2) SEQ ID № in the sequence table: 2 dna sequence dna or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 2 dna sequence dnas hybridization that limit;

3) SEQ ID № in the sequence table: 3 dna sequence dna or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 3 dna sequence dnas hybridization that limit;

4) SEQ ID № in the sequence table: 4 dna sequence dna or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 4 dna sequence dnas hybridization that limit;

5) SEQ ID № in the sequence table: 5 dna sequence dna or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 5 dna sequence dnas hybridization that limit;

6) SEQ ID № in the sequence table: 6 dna sequence dna or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 6 dna sequence dnas hybridization that limit;

7) SEQ ID № in the sequence table: 7 dna sequence dna or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 7 dna sequence dnas hybridization that limit;

8) SEQ ID № in the sequence table: 8 dna sequence dna or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 8 dna sequence dnas hybridization that limit;

9) SEQ ID № in the sequence table: 9 dna sequence dna or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 9 dna sequence dnas hybridization that limit;

10) SEQ ID № in the sequence table: 10 dna sequence dna or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 10 dna sequence dnas hybridization that limit;

11) SEQ ID № in the sequence table: 11 dna sequence dna or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 11 dna sequence dnas hybridization that limit;

12) SEQ ID № in the sequence table: 12 dna sequence dna or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 12 dna sequence dnas hybridization that limit;

13) SEQ ID № in the sequence table: 13 dna sequence dna or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 13 dna sequence dnas hybridization that limit;

14) SEQ ID № in the sequence table: 14 dna sequence dna or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 14 dna sequence dnas hybridization that limit;

15) SEQ ID № in the sequence table: 15 dna sequence dna or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 15 dna sequence dnas hybridization that limit;

16) SEQ ID № in the sequence table: 16 dna sequence dna or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 16 dna sequence dnas hybridization that limit.

2, DNA chip according to claim 1 is characterized in that: described DNA chip comprises at least one pair of probe in following 8 pairs of probes: described 1) and 2), 3) and 4), 5) and 6), 7) and 8), 9) and 10), 11) and 12), 13) and 14), 15) and 16).

3, DNA chip according to claim 1 and 2 is characterized in that: described bioterror related pathogen bacteria comprises at least a in following eight kinds of bacteriums: Bacillus anthracis (Bacillus anthracis), pseudoglanders bulkholderia cepasea (Burkholderia pseudomalleii), brucella (Brucella), Coxiella burnetii (Coxiella burnetii), soil Lafranchise Salmonella (Francisella tularensis), Rickettsia prowazeki (Rickettsia prowazekii), rickettsia rickettsii (Rickettsia rickettsii) and Yersinia pestis (Yersinia pestis).

4, DNA chip according to claim 1 and 2 is characterized in that: described DNA chip comprises SEQ ID № in the sequence table: 1 to 16 dna sequence dna and/or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of 1 to the 16 dna sequence dna hybridization that limits.

5, DNA chip according to claim 4 is characterized in that: described bioterror related pathogen bacteria comprises Bacillus anthracis (Bacillus anthracis), pseudoglanders bulkholderia cepasea (Burkholderiapseudomalleii), brucella (Brucella), Coxiella burnetii (Coxiella burnetii), soil Lafranchise Salmonella (Francisella tularensis), Rickettsia prowazeki (Rickettsia prowazekii), rickettsia rickettsii (Rickettsia rickettsii) and Yersinia pestis (Yersinia pestis).

6, the method for the terrified related diseases indigenous bacteria of a kind of detection of biological, be to be template with the DNA of testing sample respectively, with following 1) to 8) 8 pairs of primers to or by a primer of selecting from every pair of right primer centering of described 8 pairs of primers to 8 primers forming to carrying out pcr amplification, the DNA chip of the terrified related diseases indigenous bacteria of arbitrary described detection of biological in the amplified production that obtains and the claim 1 to 4 is hybridized, if hybridization signal is positive, then testing sample for or contain the bioterror related pathogen bacteria of hybridization signal male probe correspondence;

Described 8 pairs of primers are to as follows:

1) primer of being made up of Balf-1 and Balf-B primer right and that be made up of Bapa-1 and Bapa-A is right; 2) primer of being made up of Bpfur-2 and Bpfur-A primer right and that be made up of Bpsl1705-F and Bpsl1705-R is right; 3) primer of being made up of Bra31kd-3 and Bra31kd-C primer right and that be made up of Bromp2b-4 and Bromp2b-D is right; 4) primer of being made up of Coxb27kd-5 and Coxb27kd-C primer right and that be made up of Coxb34kd-3 and Coxb34kd-D is right; 5) primer of being made up of Ftfop-1 and Ftfop-D primer right and that be made up of Ft23kd-3 and Ft23kd-B is right; 6) primer of being made up of Rickpor-Rpa-3 and Rickpor-Rpa-C primer right and that be made up of Rpglta-1 and Rpglta-A is right; 7) primer of being made up of Rric190kd-1 and Rric190kd-A primer right and that be made up of Rricompb-3 and Rricompb-C is right; 8) primer of being made up of Ypcalf-2 and Ypcalf-B primer right and that be made up of Yppla-2 and Yppla-C is right.

7, method according to claim 6 is characterized in that: in the described method, with described 1) to 8) 8 pairs of primers to carrying out pcr amplification.

8, according to claim 6 or 7 described methods, it is characterized in that: described bioterror related pathogen bacteria comprises Bacillus anthracis, pseudoglanders bulkholderia cepasea, brucella, Coxiella burnetii, native Lafranchise Salmonella, Rickettsia prowazeki, rickettsia rickettsii and Yersinia pestis.

9, according to claim 6 or 7 described methods, it is characterized in that: described PCR is a multiplex PCR.

Images